Multiple sequence alignment - TraesCS5B01G562100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G562100 chr5B 100.000 6195 0 0 839 7033 708217942 708224136 0.000000e+00 11441
1 TraesCS5B01G562100 chr5B 100.000 567 0 0 1 567 708217104 708217670 0.000000e+00 1048
2 TraesCS5B01G562100 chr5B 91.436 362 21 1 1064 1415 365470078 365469717 8.200000e-134 488
3 TraesCS5B01G562100 chr5B 100.000 64 0 0 880 943 708217942 708218005 1.240000e-22 119
4 TraesCS5B01G562100 chr5B 100.000 64 0 0 839 902 708217983 708218046 1.240000e-22 119
5 TraesCS5B01G562100 chr5D 89.220 2245 127 45 898 3069 565141926 565139724 0.000000e+00 2699
6 TraesCS5B01G562100 chr5D 94.416 788 39 4 3896 4680 565139204 565138419 0.000000e+00 1206
7 TraesCS5B01G562100 chr5D 90.840 655 37 9 4720 5362 565138420 565137777 0.000000e+00 856
8 TraesCS5B01G562100 chr5D 91.317 357 23 6 3186 3536 565139725 565139371 1.370000e-131 481
9 TraesCS5B01G562100 chr5D 85.501 469 28 17 5362 5820 565137748 565137310 2.990000e-123 453
10 TraesCS5B01G562100 chr5D 79.769 346 26 27 6415 6719 565062114 565061772 1.990000e-50 211
11 TraesCS5B01G562100 chr5D 88.667 150 9 4 6792 6937 565061634 565061489 7.250000e-40 176
12 TraesCS5B01G562100 chr5D 87.500 136 12 3 3765 3895 565139367 565139232 1.220000e-32 152
13 TraesCS5B01G562100 chr5D 91.743 109 4 2 5833 5940 565137259 565137155 5.680000e-31 147
14 TraesCS5B01G562100 chr5D 94.318 88 5 0 6946 7033 565061422 565061335 1.230000e-27 135
15 TraesCS5B01G562100 chr5D 92.308 78 3 3 6719 6793 565061738 565061661 2.680000e-19 108
16 TraesCS5B01G562100 chr4A 87.882 1997 119 46 899 2838 606541341 606539411 0.000000e+00 2233
17 TraesCS5B01G562100 chr4A 94.543 788 38 4 3896 4680 606538395 606537610 0.000000e+00 1212
18 TraesCS5B01G562100 chr4A 92.748 717 45 3 2822 3536 606539270 606538559 0.000000e+00 1029
19 TraesCS5B01G562100 chr4A 90.061 654 35 13 4720 5362 606537611 606536977 0.000000e+00 821
20 TraesCS5B01G562100 chr4A 82.645 484 29 16 5363 5820 606536948 606536494 1.850000e-100 377
21 TraesCS5B01G562100 chr4A 78.492 358 39 16 1 348 606586509 606586180 4.300000e-47 200
22 TraesCS5B01G562100 chr4A 82.468 154 11 8 5827 5973 606536449 606536305 3.450000e-23 121
23 TraesCS5B01G562100 chr3B 90.187 428 22 6 1064 1472 580025926 580026352 2.230000e-149 540
24 TraesCS5B01G562100 chr1B 89.953 428 23 6 1064 1472 535811978 535812404 1.040000e-147 534
25 TraesCS5B01G562100 chr1B 89.097 321 23 3 1064 1373 25837271 25837590 8.550000e-104 388
26 TraesCS5B01G562100 chr6B 91.160 362 22 1 1064 1415 341955214 341955575 3.810000e-132 483
27 TraesCS5B01G562100 chr6B 90.055 362 26 4 1064 1415 341547271 341547632 1.790000e-125 460
28 TraesCS5B01G562100 chr1A 90.625 320 20 1 1064 1373 19976858 19977177 3.920000e-112 416
29 TraesCS5B01G562100 chr2D 85.352 355 40 8 2580 2931 80792981 80792636 2.410000e-94 357


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G562100 chr5B 708217104 708224136 7032 False 6244.500000 11441 100.000000 1 7033 2 chr5B.!!$F1 7032
1 TraesCS5B01G562100 chr5D 565137155 565141926 4771 True 856.285714 2699 90.076714 898 5940 7 chr5D.!!$R2 5042
2 TraesCS5B01G562100 chr4A 606536305 606541341 5036 True 965.500000 2233 88.391167 899 5973 6 chr4A.!!$R2 5074


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
468 469 0.025256 GTCGACGACAGAGTAGAGCG 59.975 60.0 22.66 0.0 32.09 5.03 F
517 518 0.035820 TGAACCCGCATGTAGAACCC 60.036 55.0 0.00 0.0 0.00 4.11 F
1813 1870 0.039165 ATCTATCATGCTTCGCGCGA 60.039 50.0 31.40 31.4 43.27 5.87 F
3576 3834 0.104144 TCTCCCTTGTTTCCTCCCCA 60.104 55.0 0.00 0.0 0.00 4.96 F
3629 3887 0.036388 CGCTGGTTTGGCTCTTCCTA 60.036 55.0 0.00 0.0 35.26 2.94 F
3735 3993 0.252103 AAGGAAGGACGCTACCTCCA 60.252 55.0 12.80 0.0 39.62 3.86 F
5494 5839 0.611200 TGGCGCACCACAATACTAGT 59.389 50.0 10.83 0.0 42.67 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1868 1926 0.100503 ACAAATAAATGAGGCGCGCC 59.899 50.000 42.34 42.34 0.00 6.53 R
2485 2586 0.770499 TTGGAGGAGCACCAACATCA 59.230 50.000 2.07 0.00 41.64 3.07 R
3610 3868 0.036388 TAGGAAGAGCCAAACCAGCG 60.036 55.000 0.00 0.00 40.02 5.18 R
5136 5452 0.179121 ATTGCAACGTCGATCCGCTA 60.179 50.000 0.00 0.00 0.00 4.26 R
5628 5982 0.250901 GCACCACCACCTGAGACAAT 60.251 55.000 0.00 0.00 0.00 2.71 R
5631 5985 1.004440 GAGCACCACCACCTGAGAC 60.004 63.158 0.00 0.00 0.00 3.36 R
6894 7309 0.028902 GCAAACGGTTGTCACCTCAC 59.971 55.000 15.84 0.00 41.64 3.51 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
17 18 4.275781 AGGGTGTGTTTGCTTGGG 57.724 55.556 0.00 0.00 0.00 4.12
18 19 2.133641 AGGGTGTGTTTGCTTGGGC 61.134 57.895 0.00 0.00 39.26 5.36
19 20 2.133641 GGGTGTGTTTGCTTGGGCT 61.134 57.895 0.00 0.00 39.59 5.19
20 21 1.067916 GGTGTGTTTGCTTGGGCTG 59.932 57.895 0.00 0.00 39.59 4.85
21 22 1.592400 GTGTGTTTGCTTGGGCTGC 60.592 57.895 0.00 0.00 39.59 5.25
22 23 2.056815 TGTGTTTGCTTGGGCTGCA 61.057 52.632 0.50 0.00 39.59 4.41
23 24 1.300388 GTGTTTGCTTGGGCTGCAG 60.300 57.895 10.11 10.11 41.71 4.41
24 25 2.356673 GTTTGCTTGGGCTGCAGC 60.357 61.111 30.88 30.88 41.71 5.25
25 26 2.522436 TTTGCTTGGGCTGCAGCT 60.522 55.556 35.82 0.00 41.71 4.24
26 27 2.863346 TTTGCTTGGGCTGCAGCTG 61.863 57.895 35.82 23.43 41.71 4.24
51 52 4.479993 CCCGGCTGGAAGGAGCTG 62.480 72.222 15.09 0.00 43.90 4.24
53 54 3.393970 CGGCTGGAAGGAGCTGGA 61.394 66.667 0.00 0.00 41.06 3.86
54 55 2.959484 CGGCTGGAAGGAGCTGGAA 61.959 63.158 0.00 0.00 41.06 3.53
55 56 1.380302 GGCTGGAAGGAGCTGGAAA 59.620 57.895 0.00 0.00 39.11 3.13
56 57 0.962855 GGCTGGAAGGAGCTGGAAAC 60.963 60.000 0.00 0.00 39.11 2.78
57 58 0.037447 GCTGGAAGGAGCTGGAAACT 59.963 55.000 0.00 0.00 35.95 2.66
58 59 1.818642 CTGGAAGGAGCTGGAAACTG 58.181 55.000 0.00 0.00 0.00 3.16
74 75 8.437360 CTGGAAACTGCACATCTATATAAACA 57.563 34.615 0.00 0.00 0.00 2.83
75 76 8.437360 TGGAAACTGCACATCTATATAAACAG 57.563 34.615 0.00 0.00 0.00 3.16
76 77 8.264347 TGGAAACTGCACATCTATATAAACAGA 58.736 33.333 0.00 0.00 0.00 3.41
77 78 9.277783 GGAAACTGCACATCTATATAAACAGAT 57.722 33.333 0.00 0.00 31.58 2.90
79 80 9.836864 AAACTGCACATCTATATAAACAGATCA 57.163 29.630 0.00 0.00 28.88 2.92
80 81 8.824159 ACTGCACATCTATATAAACAGATCAC 57.176 34.615 0.00 0.00 28.88 3.06
81 82 8.646004 ACTGCACATCTATATAAACAGATCACT 58.354 33.333 0.00 0.00 28.88 3.41
83 84 8.641541 TGCACATCTATATAAACAGATCACTGA 58.358 33.333 0.00 0.00 46.03 3.41
84 85 9.138062 GCACATCTATATAAACAGATCACTGAG 57.862 37.037 0.00 0.00 46.03 3.35
89 90 9.513906 TCTATATAAACAGATCACTGAGAGGAG 57.486 37.037 0.00 0.00 46.03 3.69
90 91 9.295825 CTATATAAACAGATCACTGAGAGGAGT 57.704 37.037 0.00 0.00 46.03 3.85
91 92 4.533919 AAACAGATCACTGAGAGGAGTG 57.466 45.455 0.00 0.00 46.03 3.51
92 93 3.168035 ACAGATCACTGAGAGGAGTGT 57.832 47.619 0.00 0.00 46.03 3.55
93 94 3.088532 ACAGATCACTGAGAGGAGTGTC 58.911 50.000 0.00 0.00 46.03 3.67
94 95 3.087781 CAGATCACTGAGAGGAGTGTCA 58.912 50.000 0.00 0.00 46.03 3.58
95 96 3.088532 AGATCACTGAGAGGAGTGTCAC 58.911 50.000 0.00 0.00 43.38 3.67
96 97 2.666272 TCACTGAGAGGAGTGTCACT 57.334 50.000 4.81 4.81 43.38 3.41
97 98 3.790089 TCACTGAGAGGAGTGTCACTA 57.210 47.619 5.21 0.00 43.38 2.74
98 99 3.413327 TCACTGAGAGGAGTGTCACTAC 58.587 50.000 7.16 7.16 43.38 2.73
99 100 3.073209 TCACTGAGAGGAGTGTCACTACT 59.927 47.826 18.12 18.12 43.53 2.57
100 101 4.286291 TCACTGAGAGGAGTGTCACTACTA 59.714 45.833 18.10 1.79 40.14 1.82
101 102 4.634004 CACTGAGAGGAGTGTCACTACTAG 59.366 50.000 18.10 13.90 40.14 2.57
102 103 4.287585 ACTGAGAGGAGTGTCACTACTAGT 59.712 45.833 18.10 14.54 40.14 2.57
103 104 5.484644 ACTGAGAGGAGTGTCACTACTAGTA 59.515 44.000 18.10 6.20 40.14 1.82
104 105 5.979993 TGAGAGGAGTGTCACTACTAGTAG 58.020 45.833 25.30 25.30 40.14 2.57
105 106 5.484644 TGAGAGGAGTGTCACTACTAGTAGT 59.515 44.000 26.61 26.61 40.14 2.73
106 107 6.666980 TGAGAGGAGTGTCACTACTAGTAGTA 59.333 42.308 30.34 16.00 40.14 1.82
124 125 9.834628 CTAGTAGTAGATGAAAGTAGCATTAGC 57.165 37.037 0.00 0.00 42.56 3.09
125 126 8.239038 AGTAGTAGATGAAAGTAGCATTAGCA 57.761 34.615 0.00 0.00 45.49 3.49
126 127 8.356657 AGTAGTAGATGAAAGTAGCATTAGCAG 58.643 37.037 0.00 0.00 45.49 4.24
127 128 7.118496 AGTAGATGAAAGTAGCATTAGCAGT 57.882 36.000 0.00 0.00 45.49 4.40
128 129 7.560368 AGTAGATGAAAGTAGCATTAGCAGTT 58.440 34.615 0.00 0.00 45.49 3.16
129 130 6.917217 AGATGAAAGTAGCATTAGCAGTTC 57.083 37.500 0.00 0.00 45.49 3.01
130 131 6.409704 AGATGAAAGTAGCATTAGCAGTTCA 58.590 36.000 0.00 0.00 45.49 3.18
131 132 7.052873 AGATGAAAGTAGCATTAGCAGTTCAT 58.947 34.615 0.00 0.00 45.49 2.57
132 133 6.426980 TGAAAGTAGCATTAGCAGTTCATG 57.573 37.500 0.00 0.00 45.49 3.07
133 134 5.939883 TGAAAGTAGCATTAGCAGTTCATGT 59.060 36.000 0.00 0.00 45.49 3.21
134 135 5.808042 AAGTAGCATTAGCAGTTCATGTG 57.192 39.130 0.00 0.00 45.49 3.21
135 136 4.836825 AGTAGCATTAGCAGTTCATGTGT 58.163 39.130 0.00 0.00 45.49 3.72
136 137 5.248640 AGTAGCATTAGCAGTTCATGTGTT 58.751 37.500 0.00 0.00 45.49 3.32
137 138 5.707298 AGTAGCATTAGCAGTTCATGTGTTT 59.293 36.000 0.00 0.00 45.49 2.83
138 139 6.878923 AGTAGCATTAGCAGTTCATGTGTTTA 59.121 34.615 0.00 0.00 45.49 2.01
139 140 5.942872 AGCATTAGCAGTTCATGTGTTTAC 58.057 37.500 0.00 0.00 45.49 2.01
140 141 5.095490 GCATTAGCAGTTCATGTGTTTACC 58.905 41.667 0.00 0.00 41.58 2.85
141 142 5.640732 CATTAGCAGTTCATGTGTTTACCC 58.359 41.667 0.00 0.00 0.00 3.69
142 143 3.222173 AGCAGTTCATGTGTTTACCCA 57.778 42.857 0.00 0.00 0.00 4.51
143 144 3.561143 AGCAGTTCATGTGTTTACCCAA 58.439 40.909 0.00 0.00 0.00 4.12
144 145 4.151883 AGCAGTTCATGTGTTTACCCAAT 58.848 39.130 0.00 0.00 0.00 3.16
145 146 4.218417 AGCAGTTCATGTGTTTACCCAATC 59.782 41.667 0.00 0.00 0.00 2.67
146 147 4.722194 CAGTTCATGTGTTTACCCAATCG 58.278 43.478 0.00 0.00 0.00 3.34
147 148 4.454161 CAGTTCATGTGTTTACCCAATCGA 59.546 41.667 0.00 0.00 0.00 3.59
148 149 4.695455 AGTTCATGTGTTTACCCAATCGAG 59.305 41.667 0.00 0.00 0.00 4.04
149 150 3.006940 TCATGTGTTTACCCAATCGAGC 58.993 45.455 0.00 0.00 0.00 5.03
150 151 2.851263 TGTGTTTACCCAATCGAGCT 57.149 45.000 0.00 0.00 0.00 4.09
151 152 3.965379 TGTGTTTACCCAATCGAGCTA 57.035 42.857 0.00 0.00 0.00 3.32
152 153 3.857052 TGTGTTTACCCAATCGAGCTAG 58.143 45.455 0.00 0.00 0.00 3.42
153 154 2.608090 GTGTTTACCCAATCGAGCTAGC 59.392 50.000 6.62 6.62 0.00 3.42
154 155 2.235155 TGTTTACCCAATCGAGCTAGCA 59.765 45.455 18.83 0.00 0.00 3.49
155 156 2.866762 GTTTACCCAATCGAGCTAGCAG 59.133 50.000 18.83 10.74 0.00 4.24
156 157 1.776662 TACCCAATCGAGCTAGCAGT 58.223 50.000 18.83 0.00 0.00 4.40
157 158 0.461961 ACCCAATCGAGCTAGCAGTC 59.538 55.000 18.83 5.64 0.00 3.51
158 159 0.461548 CCCAATCGAGCTAGCAGTCA 59.538 55.000 18.83 0.00 0.00 3.41
159 160 1.134699 CCCAATCGAGCTAGCAGTCAA 60.135 52.381 18.83 0.00 0.00 3.18
160 161 2.621338 CCAATCGAGCTAGCAGTCAAA 58.379 47.619 18.83 0.00 0.00 2.69
161 162 3.002791 CCAATCGAGCTAGCAGTCAAAA 58.997 45.455 18.83 0.00 0.00 2.44
162 163 3.436704 CCAATCGAGCTAGCAGTCAAAAA 59.563 43.478 18.83 0.00 0.00 1.94
185 186 9.709495 AAAAATTGCACTTTTATATGAGCAGAA 57.291 25.926 14.32 0.00 32.11 3.02
186 187 9.880157 AAAATTGCACTTTTATATGAGCAGAAT 57.120 25.926 12.58 0.00 32.11 2.40
188 189 9.956720 AATTGCACTTTTATATGAGCAGAATAC 57.043 29.630 0.00 0.00 32.11 1.89
189 190 8.737168 TTGCACTTTTATATGAGCAGAATACT 57.263 30.769 0.00 0.00 32.11 2.12
190 191 9.830975 TTGCACTTTTATATGAGCAGAATACTA 57.169 29.630 0.00 0.00 32.11 1.82
191 192 9.261180 TGCACTTTTATATGAGCAGAATACTAC 57.739 33.333 0.00 0.00 0.00 2.73
192 193 9.261180 GCACTTTTATATGAGCAGAATACTACA 57.739 33.333 0.00 0.00 0.00 2.74
196 197 9.764363 TTTTATATGAGCAGAATACTACACAGG 57.236 33.333 0.00 0.00 0.00 4.00
197 198 8.706322 TTATATGAGCAGAATACTACACAGGA 57.294 34.615 0.00 0.00 0.00 3.86
198 199 4.991153 TGAGCAGAATACTACACAGGAG 57.009 45.455 0.00 0.00 0.00 3.69
199 200 3.131223 TGAGCAGAATACTACACAGGAGC 59.869 47.826 0.00 0.00 0.00 4.70
200 201 3.099905 AGCAGAATACTACACAGGAGCA 58.900 45.455 0.00 0.00 0.00 4.26
201 202 3.131933 AGCAGAATACTACACAGGAGCAG 59.868 47.826 0.00 0.00 0.00 4.24
202 203 3.118956 GCAGAATACTACACAGGAGCAGT 60.119 47.826 0.00 0.00 0.00 4.40
203 204 4.428209 CAGAATACTACACAGGAGCAGTG 58.572 47.826 0.00 0.00 42.56 3.66
205 206 4.158764 AGAATACTACACAGGAGCAGTGTC 59.841 45.833 1.84 0.00 46.57 3.67
206 207 1.704641 ACTACACAGGAGCAGTGTCA 58.295 50.000 1.84 0.00 46.57 3.58
207 208 1.341531 ACTACACAGGAGCAGTGTCAC 59.658 52.381 1.84 0.00 46.57 3.67
208 209 1.615883 CTACACAGGAGCAGTGTCACT 59.384 52.381 0.00 0.00 46.57 3.41
209 210 1.704641 ACACAGGAGCAGTGTCACTA 58.295 50.000 4.85 0.00 46.57 2.74
210 211 1.615883 ACACAGGAGCAGTGTCACTAG 59.384 52.381 4.85 1.79 46.57 2.57
211 212 1.615883 CACAGGAGCAGTGTCACTAGT 59.384 52.381 4.85 0.00 32.44 2.57
212 213 1.615883 ACAGGAGCAGTGTCACTAGTG 59.384 52.381 17.17 17.17 0.00 2.74
213 214 1.067283 CAGGAGCAGTGTCACTAGTGG 60.067 57.143 22.48 7.34 0.00 4.00
214 215 0.969894 GGAGCAGTGTCACTAGTGGT 59.030 55.000 22.48 1.36 34.64 4.16
215 216 2.168496 GGAGCAGTGTCACTAGTGGTA 58.832 52.381 22.48 9.26 32.29 3.25
216 217 2.164624 GGAGCAGTGTCACTAGTGGTAG 59.835 54.545 22.48 9.62 32.29 3.18
217 218 1.546476 AGCAGTGTCACTAGTGGTAGC 59.454 52.381 22.48 17.72 30.49 3.58
218 219 1.546476 GCAGTGTCACTAGTGGTAGCT 59.454 52.381 22.48 12.46 0.00 3.32
219 220 2.672478 GCAGTGTCACTAGTGGTAGCTG 60.672 54.545 22.48 22.04 0.00 4.24
220 221 2.820197 CAGTGTCACTAGTGGTAGCTGA 59.180 50.000 22.48 0.00 0.00 4.26
221 222 3.255888 CAGTGTCACTAGTGGTAGCTGAA 59.744 47.826 22.48 0.00 0.00 3.02
222 223 3.895656 AGTGTCACTAGTGGTAGCTGAAA 59.104 43.478 22.48 0.00 0.00 2.69
223 224 4.344102 AGTGTCACTAGTGGTAGCTGAAAA 59.656 41.667 22.48 0.00 0.00 2.29
224 225 5.012148 AGTGTCACTAGTGGTAGCTGAAAAT 59.988 40.000 22.48 0.00 0.00 1.82
225 226 6.210784 AGTGTCACTAGTGGTAGCTGAAAATA 59.789 38.462 22.48 0.00 0.00 1.40
226 227 6.531948 GTGTCACTAGTGGTAGCTGAAAATAG 59.468 42.308 22.48 0.00 0.00 1.73
227 228 5.520649 GTCACTAGTGGTAGCTGAAAATAGC 59.479 44.000 22.48 0.00 44.01 2.97
228 229 5.186992 TCACTAGTGGTAGCTGAAAATAGCA 59.813 40.000 22.48 0.00 46.07 3.49
229 230 6.051717 CACTAGTGGTAGCTGAAAATAGCAT 58.948 40.000 15.49 0.00 46.07 3.79
230 231 6.540189 CACTAGTGGTAGCTGAAAATAGCATT 59.460 38.462 15.49 0.00 46.07 3.56
231 232 7.710907 CACTAGTGGTAGCTGAAAATAGCATTA 59.289 37.037 15.49 0.00 46.07 1.90
232 233 7.928706 ACTAGTGGTAGCTGAAAATAGCATTAG 59.071 37.037 10.39 10.39 46.07 1.73
233 234 5.529060 AGTGGTAGCTGAAAATAGCATTAGC 59.471 40.000 0.00 0.00 46.07 3.09
250 251 6.903419 GCATTAGCTATTCATGTCTTTACCC 58.097 40.000 0.00 0.00 37.91 3.69
251 252 6.486657 GCATTAGCTATTCATGTCTTTACCCA 59.513 38.462 0.00 0.00 37.91 4.51
252 253 7.013274 GCATTAGCTATTCATGTCTTTACCCAA 59.987 37.037 0.00 0.00 37.91 4.12
253 254 9.071276 CATTAGCTATTCATGTCTTTACCCAAT 57.929 33.333 0.00 0.00 0.00 3.16
254 255 8.677148 TTAGCTATTCATGTCTTTACCCAATC 57.323 34.615 0.00 0.00 0.00 2.67
255 256 5.760253 AGCTATTCATGTCTTTACCCAATCG 59.240 40.000 0.00 0.00 0.00 3.34
256 257 5.758296 GCTATTCATGTCTTTACCCAATCGA 59.242 40.000 0.00 0.00 0.00 3.59
257 258 6.073548 GCTATTCATGTCTTTACCCAATCGAG 60.074 42.308 0.00 0.00 0.00 4.04
258 259 3.531538 TCATGTCTTTACCCAATCGAGC 58.468 45.455 0.00 0.00 0.00 5.03
259 260 3.055458 TCATGTCTTTACCCAATCGAGCA 60.055 43.478 0.00 0.00 0.00 4.26
260 261 2.972625 TGTCTTTACCCAATCGAGCAG 58.027 47.619 0.00 0.00 0.00 4.24
261 262 2.301870 TGTCTTTACCCAATCGAGCAGT 59.698 45.455 0.00 0.00 0.00 4.40
262 263 2.930682 GTCTTTACCCAATCGAGCAGTC 59.069 50.000 0.00 0.00 0.00 3.51
263 264 2.565391 TCTTTACCCAATCGAGCAGTCA 59.435 45.455 0.00 0.00 0.00 3.41
264 265 3.007506 TCTTTACCCAATCGAGCAGTCAA 59.992 43.478 0.00 0.00 0.00 3.18
265 266 3.410631 TTACCCAATCGAGCAGTCAAA 57.589 42.857 0.00 0.00 0.00 2.69
266 267 2.496899 ACCCAATCGAGCAGTCAAAT 57.503 45.000 0.00 0.00 0.00 2.32
267 268 2.795329 ACCCAATCGAGCAGTCAAATT 58.205 42.857 0.00 0.00 0.00 1.82
268 269 3.950397 ACCCAATCGAGCAGTCAAATTA 58.050 40.909 0.00 0.00 0.00 1.40
269 270 3.941483 ACCCAATCGAGCAGTCAAATTAG 59.059 43.478 0.00 0.00 0.00 1.73
270 271 3.242870 CCCAATCGAGCAGTCAAATTAGC 60.243 47.826 0.00 0.00 0.00 3.09
271 272 3.374988 CCAATCGAGCAGTCAAATTAGCA 59.625 43.478 0.00 0.00 0.00 3.49
272 273 4.337763 CAATCGAGCAGTCAAATTAGCAC 58.662 43.478 0.00 0.00 0.00 4.40
273 274 3.319137 TCGAGCAGTCAAATTAGCACT 57.681 42.857 0.00 0.00 0.00 4.40
274 275 3.254060 TCGAGCAGTCAAATTAGCACTC 58.746 45.455 0.00 0.00 0.00 3.51
275 276 3.056536 TCGAGCAGTCAAATTAGCACTCT 60.057 43.478 0.00 0.00 0.00 3.24
276 277 3.681897 CGAGCAGTCAAATTAGCACTCTT 59.318 43.478 0.00 0.00 0.00 2.85
277 278 4.153117 CGAGCAGTCAAATTAGCACTCTTT 59.847 41.667 0.00 0.00 0.00 2.52
278 279 5.334414 CGAGCAGTCAAATTAGCACTCTTTT 60.334 40.000 0.00 0.00 0.00 2.27
279 280 6.128553 CGAGCAGTCAAATTAGCACTCTTTTA 60.129 38.462 0.00 0.00 0.00 1.52
280 281 7.413438 CGAGCAGTCAAATTAGCACTCTTTTAT 60.413 37.037 0.00 0.00 0.00 1.40
281 282 8.792830 AGCAGTCAAATTAGCACTCTTTTATA 57.207 30.769 0.00 0.00 0.00 0.98
282 283 8.887717 AGCAGTCAAATTAGCACTCTTTTATAG 58.112 33.333 0.00 0.00 0.00 1.31
283 284 8.669243 GCAGTCAAATTAGCACTCTTTTATAGT 58.331 33.333 0.00 0.00 0.00 2.12
311 312 9.130312 GTATAAGCAGAATACATACACACTAGC 57.870 37.037 0.00 0.00 31.43 3.42
312 313 5.598416 AGCAGAATACATACACACTAGCA 57.402 39.130 0.00 0.00 0.00 3.49
313 314 5.595885 AGCAGAATACATACACACTAGCAG 58.404 41.667 0.00 0.00 0.00 4.24
314 315 5.127845 AGCAGAATACATACACACTAGCAGT 59.872 40.000 0.00 0.00 0.00 4.40
315 316 5.812642 GCAGAATACATACACACTAGCAGTT 59.187 40.000 0.00 0.00 0.00 3.16
316 317 6.237942 GCAGAATACATACACACTAGCAGTTG 60.238 42.308 0.00 0.00 0.00 3.16
317 318 6.256539 CAGAATACATACACACTAGCAGTTGG 59.743 42.308 0.00 0.00 0.00 3.77
318 319 2.699954 ACATACACACTAGCAGTTGGC 58.300 47.619 0.00 0.00 45.30 4.52
336 337 5.957842 TTGGCTAGTACCAAATCAAACAG 57.042 39.130 0.00 0.00 46.65 3.16
337 338 4.980573 TGGCTAGTACCAAATCAAACAGT 58.019 39.130 0.00 0.00 36.55 3.55
338 339 5.001232 TGGCTAGTACCAAATCAAACAGTC 58.999 41.667 0.00 0.00 36.55 3.51
339 340 5.001232 GGCTAGTACCAAATCAAACAGTCA 58.999 41.667 0.00 0.00 0.00 3.41
340 341 5.472137 GGCTAGTACCAAATCAAACAGTCAA 59.528 40.000 0.00 0.00 0.00 3.18
341 342 6.016610 GGCTAGTACCAAATCAAACAGTCAAA 60.017 38.462 0.00 0.00 0.00 2.69
342 343 7.309194 GGCTAGTACCAAATCAAACAGTCAAAT 60.309 37.037 0.00 0.00 0.00 2.32
343 344 8.082242 GCTAGTACCAAATCAAACAGTCAAATT 58.918 33.333 0.00 0.00 0.00 1.82
344 345 9.965824 CTAGTACCAAATCAAACAGTCAAATTT 57.034 29.630 0.00 0.00 0.00 1.82
346 347 9.313118 AGTACCAAATCAAACAGTCAAATTTTC 57.687 29.630 0.00 0.00 0.00 2.29
347 348 9.092876 GTACCAAATCAAACAGTCAAATTTTCA 57.907 29.630 0.00 0.00 0.00 2.69
348 349 8.735692 ACCAAATCAAACAGTCAAATTTTCAT 57.264 26.923 0.00 0.00 0.00 2.57
349 350 8.829612 ACCAAATCAAACAGTCAAATTTTCATC 58.170 29.630 0.00 0.00 0.00 2.92
350 351 8.005466 CCAAATCAAACAGTCAAATTTTCATCG 58.995 33.333 0.00 0.00 0.00 3.84
351 352 6.695292 ATCAAACAGTCAAATTTTCATCGC 57.305 33.333 0.00 0.00 0.00 4.58
352 353 4.981674 TCAAACAGTCAAATTTTCATCGCC 59.018 37.500 0.00 0.00 0.00 5.54
353 354 4.582701 AACAGTCAAATTTTCATCGCCA 57.417 36.364 0.00 0.00 0.00 5.69
354 355 3.900941 ACAGTCAAATTTTCATCGCCAC 58.099 40.909 0.00 0.00 0.00 5.01
355 356 3.317711 ACAGTCAAATTTTCATCGCCACA 59.682 39.130 0.00 0.00 0.00 4.17
356 357 3.670055 CAGTCAAATTTTCATCGCCACAC 59.330 43.478 0.00 0.00 0.00 3.82
357 358 3.317711 AGTCAAATTTTCATCGCCACACA 59.682 39.130 0.00 0.00 0.00 3.72
358 359 3.425193 GTCAAATTTTCATCGCCACACAC 59.575 43.478 0.00 0.00 0.00 3.82
359 360 3.317711 TCAAATTTTCATCGCCACACACT 59.682 39.130 0.00 0.00 0.00 3.55
360 361 3.559238 AATTTTCATCGCCACACACTC 57.441 42.857 0.00 0.00 0.00 3.51
361 362 2.254546 TTTTCATCGCCACACACTCT 57.745 45.000 0.00 0.00 0.00 3.24
362 363 2.254546 TTTCATCGCCACACACTCTT 57.745 45.000 0.00 0.00 0.00 2.85
363 364 1.795768 TTCATCGCCACACACTCTTC 58.204 50.000 0.00 0.00 0.00 2.87
364 365 0.037326 TCATCGCCACACACTCTTCC 60.037 55.000 0.00 0.00 0.00 3.46
365 366 0.036952 CATCGCCACACACTCTTCCT 60.037 55.000 0.00 0.00 0.00 3.36
366 367 0.687354 ATCGCCACACACTCTTCCTT 59.313 50.000 0.00 0.00 0.00 3.36
367 368 0.249868 TCGCCACACACTCTTCCTTG 60.250 55.000 0.00 0.00 0.00 3.61
368 369 0.532862 CGCCACACACTCTTCCTTGT 60.533 55.000 0.00 0.00 0.00 3.16
369 370 1.230324 GCCACACACTCTTCCTTGTC 58.770 55.000 0.00 0.00 0.00 3.18
370 371 1.884235 CCACACACTCTTCCTTGTCC 58.116 55.000 0.00 0.00 0.00 4.02
371 372 1.417890 CCACACACTCTTCCTTGTCCT 59.582 52.381 0.00 0.00 0.00 3.85
372 373 2.158755 CCACACACTCTTCCTTGTCCTT 60.159 50.000 0.00 0.00 0.00 3.36
373 374 3.545703 CACACACTCTTCCTTGTCCTTT 58.454 45.455 0.00 0.00 0.00 3.11
374 375 3.947834 CACACACTCTTCCTTGTCCTTTT 59.052 43.478 0.00 0.00 0.00 2.27
375 376 4.399303 CACACACTCTTCCTTGTCCTTTTT 59.601 41.667 0.00 0.00 0.00 1.94
376 377 4.640647 ACACACTCTTCCTTGTCCTTTTTC 59.359 41.667 0.00 0.00 0.00 2.29
377 378 4.884164 CACACTCTTCCTTGTCCTTTTTCT 59.116 41.667 0.00 0.00 0.00 2.52
378 379 4.884164 ACACTCTTCCTTGTCCTTTTTCTG 59.116 41.667 0.00 0.00 0.00 3.02
379 380 4.884164 CACTCTTCCTTGTCCTTTTTCTGT 59.116 41.667 0.00 0.00 0.00 3.41
380 381 5.358160 CACTCTTCCTTGTCCTTTTTCTGTT 59.642 40.000 0.00 0.00 0.00 3.16
381 382 5.358160 ACTCTTCCTTGTCCTTTTTCTGTTG 59.642 40.000 0.00 0.00 0.00 3.33
382 383 4.644685 TCTTCCTTGTCCTTTTTCTGTTGG 59.355 41.667 0.00 0.00 0.00 3.77
383 384 3.295973 TCCTTGTCCTTTTTCTGTTGGG 58.704 45.455 0.00 0.00 0.00 4.12
384 385 2.224042 CCTTGTCCTTTTTCTGTTGGGC 60.224 50.000 0.00 0.00 0.00 5.36
385 386 1.028905 TGTCCTTTTTCTGTTGGGCG 58.971 50.000 0.00 0.00 0.00 6.13
386 387 1.029681 GTCCTTTTTCTGTTGGGCGT 58.970 50.000 0.00 0.00 0.00 5.68
387 388 1.028905 TCCTTTTTCTGTTGGGCGTG 58.971 50.000 0.00 0.00 0.00 5.34
388 389 0.597377 CCTTTTTCTGTTGGGCGTGC 60.597 55.000 0.00 0.00 0.00 5.34
389 390 0.597377 CTTTTTCTGTTGGGCGTGCC 60.597 55.000 1.16 1.16 0.00 5.01
390 391 1.323271 TTTTTCTGTTGGGCGTGCCA 61.323 50.000 13.76 0.00 37.98 4.92
391 392 1.733402 TTTTCTGTTGGGCGTGCCAG 61.733 55.000 13.76 1.22 37.98 4.85
392 393 4.641645 TCTGTTGGGCGTGCCAGG 62.642 66.667 13.76 0.00 37.98 4.45
402 403 4.120331 GTGCCAGGCCATTGCGTC 62.120 66.667 9.64 0.00 38.85 5.19
405 406 3.499737 CCAGGCCATTGCGTCGTC 61.500 66.667 5.01 0.00 38.85 4.20
406 407 3.499737 CAGGCCATTGCGTCGTCC 61.500 66.667 5.01 0.00 38.85 4.79
407 408 4.778143 AGGCCATTGCGTCGTCCC 62.778 66.667 5.01 0.00 38.85 4.46
408 409 4.778143 GGCCATTGCGTCGTCCCT 62.778 66.667 0.00 0.00 38.85 4.20
409 410 3.499737 GCCATTGCGTCGTCCCTG 61.500 66.667 0.00 0.00 0.00 4.45
410 411 2.264480 CCATTGCGTCGTCCCTGA 59.736 61.111 0.00 0.00 0.00 3.86
411 412 1.375396 CCATTGCGTCGTCCCTGAA 60.375 57.895 0.00 0.00 0.00 3.02
412 413 1.635663 CCATTGCGTCGTCCCTGAAC 61.636 60.000 0.00 0.00 0.00 3.18
413 414 0.670546 CATTGCGTCGTCCCTGAACT 60.671 55.000 0.00 0.00 0.00 3.01
414 415 0.389948 ATTGCGTCGTCCCTGAACTC 60.390 55.000 0.00 0.00 0.00 3.01
415 416 1.740332 TTGCGTCGTCCCTGAACTCA 61.740 55.000 0.00 0.00 0.00 3.41
416 417 1.215647 GCGTCGTCCCTGAACTCAT 59.784 57.895 0.00 0.00 0.00 2.90
417 418 0.802607 GCGTCGTCCCTGAACTCATC 60.803 60.000 0.00 0.00 0.00 2.92
418 419 0.526211 CGTCGTCCCTGAACTCATCA 59.474 55.000 0.00 0.00 36.38 3.07
419 420 1.067846 CGTCGTCCCTGAACTCATCAA 60.068 52.381 0.00 0.00 37.67 2.57
420 421 2.609491 CGTCGTCCCTGAACTCATCAAA 60.609 50.000 0.00 0.00 37.67 2.69
421 422 3.399330 GTCGTCCCTGAACTCATCAAAA 58.601 45.455 0.00 0.00 37.67 2.44
422 423 4.003648 GTCGTCCCTGAACTCATCAAAAT 58.996 43.478 0.00 0.00 37.67 1.82
423 424 4.455877 GTCGTCCCTGAACTCATCAAAATT 59.544 41.667 0.00 0.00 37.67 1.82
424 425 4.695455 TCGTCCCTGAACTCATCAAAATTC 59.305 41.667 0.00 0.00 37.67 2.17
425 426 4.142600 CGTCCCTGAACTCATCAAAATTCC 60.143 45.833 0.00 0.00 37.67 3.01
426 427 4.009675 TCCCTGAACTCATCAAAATTCCG 58.990 43.478 0.00 0.00 37.67 4.30
427 428 3.758554 CCCTGAACTCATCAAAATTCCGT 59.241 43.478 0.00 0.00 37.67 4.69
428 429 4.218417 CCCTGAACTCATCAAAATTCCGTT 59.782 41.667 0.00 0.00 37.67 4.44
429 430 5.278957 CCCTGAACTCATCAAAATTCCGTTT 60.279 40.000 0.00 0.00 37.67 3.60
430 431 5.858581 CCTGAACTCATCAAAATTCCGTTTC 59.141 40.000 0.00 0.00 37.67 2.78
431 432 5.768317 TGAACTCATCAAAATTCCGTTTCC 58.232 37.500 0.00 0.00 34.30 3.13
432 433 4.783764 ACTCATCAAAATTCCGTTTCCC 57.216 40.909 0.00 0.00 0.00 3.97
433 434 3.509967 ACTCATCAAAATTCCGTTTCCCC 59.490 43.478 0.00 0.00 0.00 4.81
434 435 2.490115 TCATCAAAATTCCGTTTCCCCG 59.510 45.455 0.00 0.00 0.00 5.73
461 462 3.386379 GAGGTTGTCGACGACAGAG 57.614 57.895 31.70 0.00 43.69 3.35
462 463 0.592148 GAGGTTGTCGACGACAGAGT 59.408 55.000 31.70 17.15 43.69 3.24
463 464 1.802960 GAGGTTGTCGACGACAGAGTA 59.197 52.381 31.70 12.93 43.69 2.59
464 465 1.805345 AGGTTGTCGACGACAGAGTAG 59.195 52.381 31.70 0.00 43.69 2.57
465 466 1.802960 GGTTGTCGACGACAGAGTAGA 59.197 52.381 31.70 11.84 43.69 2.59
466 467 2.159680 GGTTGTCGACGACAGAGTAGAG 60.160 54.545 31.70 0.00 43.69 2.43
467 468 1.077123 TGTCGACGACAGAGTAGAGC 58.923 55.000 26.04 0.00 37.67 4.09
468 469 0.025256 GTCGACGACAGAGTAGAGCG 59.975 60.000 22.66 0.00 32.09 5.03
469 470 0.389556 TCGACGACAGAGTAGAGCGT 60.390 55.000 0.00 0.00 37.97 5.07
470 471 0.247340 CGACGACAGAGTAGAGCGTG 60.247 60.000 0.00 0.00 35.09 5.34
471 472 1.077123 GACGACAGAGTAGAGCGTGA 58.923 55.000 0.00 0.00 35.09 4.35
472 473 1.463831 GACGACAGAGTAGAGCGTGAA 59.536 52.381 0.00 0.00 35.09 3.18
473 474 1.465387 ACGACAGAGTAGAGCGTGAAG 59.535 52.381 0.00 0.00 33.52 3.02
474 475 1.732809 CGACAGAGTAGAGCGTGAAGA 59.267 52.381 0.00 0.00 0.00 2.87
475 476 2.159824 CGACAGAGTAGAGCGTGAAGAA 59.840 50.000 0.00 0.00 0.00 2.52
476 477 3.494232 GACAGAGTAGAGCGTGAAGAAC 58.506 50.000 0.00 0.00 0.00 3.01
477 478 2.229302 ACAGAGTAGAGCGTGAAGAACC 59.771 50.000 0.00 0.00 0.00 3.62
478 479 1.819903 AGAGTAGAGCGTGAAGAACCC 59.180 52.381 0.00 0.00 0.00 4.11
479 480 0.526662 AGTAGAGCGTGAAGAACCCG 59.473 55.000 0.00 0.00 0.00 5.28
480 481 0.524862 GTAGAGCGTGAAGAACCCGA 59.475 55.000 0.00 0.00 0.00 5.14
481 482 1.134560 GTAGAGCGTGAAGAACCCGAT 59.865 52.381 0.00 0.00 0.00 4.18
482 483 0.108615 AGAGCGTGAAGAACCCGATG 60.109 55.000 0.00 0.00 0.00 3.84
483 484 0.108804 GAGCGTGAAGAACCCGATGA 60.109 55.000 0.00 0.00 0.00 2.92
484 485 0.537188 AGCGTGAAGAACCCGATGAT 59.463 50.000 0.00 0.00 0.00 2.45
485 486 0.931005 GCGTGAAGAACCCGATGATC 59.069 55.000 0.00 0.00 0.00 2.92
486 487 1.471676 GCGTGAAGAACCCGATGATCT 60.472 52.381 0.00 0.00 0.00 2.75
487 488 2.464865 CGTGAAGAACCCGATGATCTC 58.535 52.381 0.00 0.00 0.00 2.75
505 506 3.391355 GGCGACGTTATGAACCCG 58.609 61.111 0.00 0.00 0.00 5.28
506 507 2.699212 GCGACGTTATGAACCCGC 59.301 61.111 0.00 0.00 40.71 6.13
507 508 2.095847 GCGACGTTATGAACCCGCA 61.096 57.895 8.83 0.00 44.18 5.69
508 509 1.426041 GCGACGTTATGAACCCGCAT 61.426 55.000 8.83 0.00 44.18 4.73
509 510 0.300491 CGACGTTATGAACCCGCATG 59.700 55.000 0.00 0.00 0.00 4.06
510 511 1.365699 GACGTTATGAACCCGCATGT 58.634 50.000 0.00 0.00 0.00 3.21
511 512 2.542597 GACGTTATGAACCCGCATGTA 58.457 47.619 0.00 0.00 0.00 2.29
512 513 2.538449 GACGTTATGAACCCGCATGTAG 59.462 50.000 0.00 0.00 0.00 2.74
513 514 2.166870 ACGTTATGAACCCGCATGTAGA 59.833 45.455 0.00 0.00 0.00 2.59
514 515 3.191669 CGTTATGAACCCGCATGTAGAA 58.808 45.455 0.00 0.00 0.00 2.10
515 516 3.000925 CGTTATGAACCCGCATGTAGAAC 59.999 47.826 0.00 0.00 0.00 3.01
516 517 2.038387 ATGAACCCGCATGTAGAACC 57.962 50.000 0.00 0.00 0.00 3.62
517 518 0.035820 TGAACCCGCATGTAGAACCC 60.036 55.000 0.00 0.00 0.00 4.11
518 519 1.078708 AACCCGCATGTAGAACCCG 60.079 57.895 0.00 0.00 0.00 5.28
519 520 1.546589 AACCCGCATGTAGAACCCGA 61.547 55.000 0.00 0.00 0.00 5.14
520 521 1.335132 ACCCGCATGTAGAACCCGAT 61.335 55.000 0.00 0.00 0.00 4.18
521 522 0.880278 CCCGCATGTAGAACCCGATG 60.880 60.000 0.00 0.00 0.00 3.84
522 523 0.104120 CCGCATGTAGAACCCGATGA 59.896 55.000 0.00 0.00 0.00 2.92
523 524 1.270305 CCGCATGTAGAACCCGATGAT 60.270 52.381 0.00 0.00 0.00 2.45
524 525 2.061773 CGCATGTAGAACCCGATGATC 58.938 52.381 0.00 0.00 0.00 2.92
525 526 2.288457 CGCATGTAGAACCCGATGATCT 60.288 50.000 0.00 0.00 0.00 2.75
526 527 3.321497 GCATGTAGAACCCGATGATCTC 58.679 50.000 0.00 0.00 0.00 2.75
527 528 3.862642 GCATGTAGAACCCGATGATCTCC 60.863 52.174 0.00 0.00 0.00 3.71
528 529 3.026707 TGTAGAACCCGATGATCTCCA 57.973 47.619 0.00 0.00 0.00 3.86
529 530 2.693591 TGTAGAACCCGATGATCTCCAC 59.306 50.000 0.00 0.00 0.00 4.02
530 531 2.166907 AGAACCCGATGATCTCCACT 57.833 50.000 0.00 0.00 0.00 4.00
531 532 2.035632 AGAACCCGATGATCTCCACTC 58.964 52.381 0.00 0.00 0.00 3.51
532 533 1.069358 GAACCCGATGATCTCCACTCC 59.931 57.143 0.00 0.00 0.00 3.85
533 534 0.760945 ACCCGATGATCTCCACTCCC 60.761 60.000 0.00 0.00 0.00 4.30
534 535 1.662608 CCGATGATCTCCACTCCCG 59.337 63.158 0.00 0.00 0.00 5.14
535 536 1.662608 CGATGATCTCCACTCCCGG 59.337 63.158 0.00 0.00 0.00 5.73
536 537 1.810606 CGATGATCTCCACTCCCGGG 61.811 65.000 16.85 16.85 0.00 5.73
537 538 2.105806 GATGATCTCCACTCCCGGGC 62.106 65.000 18.49 0.00 0.00 6.13
538 539 2.444895 GATCTCCACTCCCGGGCT 60.445 66.667 18.49 0.00 0.00 5.19
539 540 2.041265 ATCTCCACTCCCGGGCTT 59.959 61.111 18.49 0.42 0.00 4.35
540 541 1.616628 ATCTCCACTCCCGGGCTTT 60.617 57.895 18.49 0.00 0.00 3.51
541 542 1.208165 ATCTCCACTCCCGGGCTTTT 61.208 55.000 18.49 0.00 0.00 2.27
542 543 1.074951 CTCCACTCCCGGGCTTTTT 59.925 57.895 18.49 0.00 0.00 1.94
564 565 2.561478 TTTTTGAGGAAGACTCCCGG 57.439 50.000 0.00 0.00 46.01 5.73
565 566 0.690762 TTTTGAGGAAGACTCCCGGG 59.309 55.000 16.85 16.85 46.01 5.73
566 567 1.838073 TTTGAGGAAGACTCCCGGGC 61.838 60.000 18.49 0.83 46.01 6.13
855 856 4.760047 CAGACCAGAACGGCCCGG 62.760 72.222 8.57 0.00 39.03 5.73
882 883 4.240103 CGATGCGGCCCATCCAGA 62.240 66.667 21.54 0.00 46.17 3.86
883 884 2.592861 GATGCGGCCCATCCAGAC 60.593 66.667 18.50 0.21 43.72 3.51
884 885 4.195334 ATGCGGCCCATCCAGACC 62.195 66.667 0.00 0.00 34.01 3.85
886 887 4.864334 GCGGCCCATCCAGACCAG 62.864 72.222 0.00 0.00 34.01 4.00
887 888 3.083349 CGGCCCATCCAGACCAGA 61.083 66.667 0.00 0.00 34.01 3.86
888 889 2.669133 CGGCCCATCCAGACCAGAA 61.669 63.158 0.00 0.00 34.01 3.02
889 890 1.077429 GGCCCATCCAGACCAGAAC 60.077 63.158 0.00 0.00 34.01 3.01
890 891 1.450312 GCCCATCCAGACCAGAACG 60.450 63.158 0.00 0.00 0.00 3.95
891 892 1.221840 CCCATCCAGACCAGAACGG 59.778 63.158 0.00 0.00 42.50 4.44
892 893 1.450312 CCATCCAGACCAGAACGGC 60.450 63.158 0.00 0.00 39.03 5.68
893 894 1.450312 CATCCAGACCAGAACGGCC 60.450 63.158 0.00 0.00 39.03 6.13
894 895 2.670148 ATCCAGACCAGAACGGCCC 61.670 63.158 0.00 0.00 39.03 5.80
895 896 4.760047 CCAGACCAGAACGGCCCG 62.760 72.222 0.00 0.00 39.03 6.13
896 897 4.760047 CAGACCAGAACGGCCCGG 62.760 72.222 8.57 0.00 39.03 5.73
923 924 4.240103 CGATGCGGCCCATCCAGA 62.240 66.667 21.54 0.00 46.17 3.86
1011 1012 0.744771 GCCGATCCAGTTCCAGTTCC 60.745 60.000 0.00 0.00 0.00 3.62
1012 1013 0.613260 CCGATCCAGTTCCAGTTCCA 59.387 55.000 0.00 0.00 0.00 3.53
1014 1015 1.001974 CGATCCAGTTCCAGTTCCACA 59.998 52.381 0.00 0.00 0.00 4.17
1029 1038 1.847968 CACACACCCCTCTCCCCTT 60.848 63.158 0.00 0.00 0.00 3.95
1242 1251 2.335712 CCAGAACAAGAAGGGCGGC 61.336 63.158 0.00 0.00 0.00 6.53
1307 1330 2.181865 AGGTCCTCCATCTCATCTCCAT 59.818 50.000 0.00 0.00 35.89 3.41
1321 1344 1.825281 CTCCATCCCCATCTCGCTCC 61.825 65.000 0.00 0.00 0.00 4.70
1331 1354 1.391933 ATCTCGCTCCCACGCATACA 61.392 55.000 0.00 0.00 0.00 2.29
1332 1355 1.153647 CTCGCTCCCACGCATACAA 60.154 57.895 0.00 0.00 0.00 2.41
1338 1361 0.604243 TCCCACGCATACAACACACC 60.604 55.000 0.00 0.00 0.00 4.16
1365 1397 2.689983 GGGATCCATGATTCAACACACC 59.310 50.000 15.23 0.00 0.00 4.16
1378 1410 6.506500 TTCAACACACCTAGTACTAGCTAC 57.493 41.667 22.39 0.00 31.95 3.58
1438 1490 5.444663 TCGATTCGATTCTGATCAGACAT 57.555 39.130 25.07 19.52 37.14 3.06
1446 1498 0.463204 CTGATCAGACATCGCCCACT 59.537 55.000 18.34 0.00 0.00 4.00
1452 1504 1.448540 GACATCGCCCACTGACAGG 60.449 63.158 7.51 0.00 0.00 4.00
1453 1505 2.821366 CATCGCCCACTGACAGGC 60.821 66.667 7.51 0.35 46.17 4.85
1467 1519 3.511610 AGGCCCCCAAGCAACAGT 61.512 61.111 0.00 0.00 0.00 3.55
1468 1520 2.524148 GGCCCCCAAGCAACAGTT 60.524 61.111 0.00 0.00 0.00 3.16
1469 1521 2.140138 GGCCCCCAAGCAACAGTTT 61.140 57.895 0.00 0.00 0.00 2.66
1470 1522 1.695114 GGCCCCCAAGCAACAGTTTT 61.695 55.000 0.00 0.00 0.00 2.43
1471 1523 0.180171 GCCCCCAAGCAACAGTTTTT 59.820 50.000 0.00 0.00 0.00 1.94
1516 1568 2.685100 GATTCGATTCGGGGTGTATCC 58.315 52.381 6.18 0.00 0.00 2.59
1518 1570 2.662535 TCGATTCGGGGTGTATCCTA 57.337 50.000 6.18 0.00 36.25 2.94
1519 1571 2.511659 TCGATTCGGGGTGTATCCTAG 58.488 52.381 6.18 0.00 36.25 3.02
1520 1572 2.158564 TCGATTCGGGGTGTATCCTAGT 60.159 50.000 6.18 0.00 36.25 2.57
1521 1573 3.072915 TCGATTCGGGGTGTATCCTAGTA 59.927 47.826 6.18 0.00 36.25 1.82
1522 1574 3.439476 CGATTCGGGGTGTATCCTAGTAG 59.561 52.174 0.00 0.00 36.25 2.57
1554 1606 8.725212 GCATAATCTTGCTAGTTCATTCATTC 57.275 34.615 0.00 0.00 39.57 2.67
1555 1607 8.347771 GCATAATCTTGCTAGTTCATTCATTCA 58.652 33.333 0.00 0.00 39.57 2.57
1559 1611 9.798994 AATCTTGCTAGTTCATTCATTCATTTC 57.201 29.630 0.00 0.00 0.00 2.17
1591 1643 8.782339 TGTGATGAAATGTATAGATGCATAGG 57.218 34.615 0.00 0.00 32.69 2.57
1593 1645 8.877779 GTGATGAAATGTATAGATGCATAGGTC 58.122 37.037 0.00 0.00 32.69 3.85
1639 1691 4.030216 TGGATGTGGTCTCAGCTGTATTA 58.970 43.478 14.67 0.00 0.00 0.98
1685 1742 2.377628 GAAGCACCACCACCTCGACA 62.378 60.000 0.00 0.00 0.00 4.35
1696 1753 0.608640 ACCTCGACATCAACACCCTC 59.391 55.000 0.00 0.00 0.00 4.30
1773 1830 2.683933 CACCGGTGAGCCTACCCT 60.684 66.667 31.31 0.00 37.44 4.34
1786 1843 0.761802 CTACCCTCAGCCTCCCATTC 59.238 60.000 0.00 0.00 0.00 2.67
1813 1870 0.039165 ATCTATCATGCTTCGCGCGA 60.039 50.000 31.40 31.40 43.27 5.87
1817 1874 0.378257 ATCATGCTTCGCGCGAAAAT 59.622 45.000 40.22 32.50 43.27 1.82
1856 1914 2.937469 TGCGCCATTTATTTGTCTGG 57.063 45.000 4.18 0.00 0.00 3.86
1863 1921 4.556699 GCCATTTATTTGTCTGGCCGATAC 60.557 45.833 0.00 0.00 46.76 2.24
1914 1972 2.948840 ATACGGCGCGCCTTAGTGAC 62.949 60.000 43.60 18.63 0.00 3.67
1920 1978 1.395608 GCGCGCCTTAGTGACAAATTA 59.604 47.619 23.24 0.00 0.00 1.40
1923 1981 4.088648 CGCGCCTTAGTGACAAATTAAAG 58.911 43.478 0.00 0.00 0.00 1.85
1926 1984 4.457949 CGCCTTAGTGACAAATTAAAGGGT 59.542 41.667 0.00 0.00 35.17 4.34
1927 1985 5.391629 CGCCTTAGTGACAAATTAAAGGGTC 60.392 44.000 0.00 0.00 35.17 4.46
1949 2007 1.570857 CCACCTTGGCACCCCTCATA 61.571 60.000 0.00 0.00 0.00 2.15
1951 2009 0.844661 ACCTTGGCACCCCTCATACA 60.845 55.000 0.00 0.00 0.00 2.29
2123 2201 5.513094 GGCTCATATGGGTTGCTTAGTGATA 60.513 44.000 4.11 0.00 0.00 2.15
2126 2205 7.824289 GCTCATATGGGTTGCTTAGTGATAATA 59.176 37.037 4.11 0.00 0.00 0.98
2326 2427 5.392767 TCATTCTATGCGAGTTATCCCTC 57.607 43.478 0.00 0.00 0.00 4.30
2327 2428 4.832823 TCATTCTATGCGAGTTATCCCTCA 59.167 41.667 0.00 0.00 0.00 3.86
2329 2430 5.808366 TTCTATGCGAGTTATCCCTCATT 57.192 39.130 0.00 0.00 0.00 2.57
2330 2431 6.911250 TTCTATGCGAGTTATCCCTCATTA 57.089 37.500 0.00 0.00 0.00 1.90
2485 2586 1.947456 TCGTCGCTCTACATGTATGCT 59.053 47.619 21.02 0.00 0.00 3.79
2650 2751 3.270027 TGGGAGCACAATAGTGATTTCG 58.730 45.455 0.00 0.00 45.89 3.46
2696 2797 9.162764 GCTGTATACTTTCTTAGGATTGTTTCA 57.837 33.333 4.17 0.00 0.00 2.69
2970 3223 3.941483 AGCTTTAATGAGTAACGCTGCAT 59.059 39.130 2.84 0.00 43.59 3.96
2983 3236 2.247637 CGCTGCATCATGTTTCACTTG 58.752 47.619 0.00 0.00 0.00 3.16
3066 3320 3.975479 TGGGAGGAGGGTAAACAAAAA 57.025 42.857 0.00 0.00 0.00 1.94
3067 3321 4.479156 TGGGAGGAGGGTAAACAAAAAT 57.521 40.909 0.00 0.00 0.00 1.82
3068 3322 4.412843 TGGGAGGAGGGTAAACAAAAATC 58.587 43.478 0.00 0.00 0.00 2.17
3081 3335 3.903467 ACAAAAATCCATAGGCCTCCTC 58.097 45.455 9.68 0.00 34.61 3.71
3104 3358 3.521560 CGTAAGTCTGCCATTGCTCTTA 58.478 45.455 0.00 0.00 38.71 2.10
3163 3417 1.675641 GGTGCATGGTGACCTGACC 60.676 63.158 2.11 0.00 36.43 4.02
3164 3418 1.675641 GTGCATGGTGACCTGACCC 60.676 63.158 2.11 0.00 34.79 4.46
3168 3422 1.229209 ATGGTGACCTGACCCGTCT 60.229 57.895 2.11 0.00 34.79 4.18
3173 3427 1.891150 GTGACCTGACCCGTCTCTAAA 59.109 52.381 0.00 0.00 0.00 1.85
3198 3452 0.179702 TGGATCTCTCAGGTGCATGC 59.820 55.000 11.82 11.82 0.00 4.06
3220 3475 4.164988 GCATATATGGGATTGAGGGTAGCT 59.835 45.833 14.51 0.00 0.00 3.32
3233 3488 1.490910 GGGTAGCTAGGTTGCAAGGAT 59.509 52.381 0.00 0.00 34.99 3.24
3279 3537 7.802738 TGATGTTTTGAGTGGTAGAATAAACG 58.197 34.615 0.00 0.00 0.00 3.60
3355 3613 1.001974 CAGTTGTCCGGATCAACCTGA 59.998 52.381 29.91 8.16 44.02 3.86
3361 3619 0.676782 CCGGATCAACCTGACCAACC 60.677 60.000 0.00 0.00 36.31 3.77
3370 3628 0.320374 CCTGACCAACCGCTCTACAA 59.680 55.000 0.00 0.00 0.00 2.41
3384 3642 5.036737 CGCTCTACAAAATTAATTGGGCAG 58.963 41.667 0.39 0.00 34.56 4.85
3483 3741 4.009675 TGAATTGATAGTCCAACTGGTGC 58.990 43.478 0.00 0.00 36.34 5.01
3485 3743 5.045942 TGAATTGATAGTCCAACTGGTGCTA 60.046 40.000 0.00 1.18 36.34 3.49
3502 3760 0.247419 CTATGCTTTCTGCGTGCACG 60.247 55.000 34.01 34.01 46.63 5.34
3505 3763 2.881266 GCTTTCTGCGTGCACGTGA 61.881 57.895 36.80 30.28 42.22 4.35
3536 3794 1.211703 TGAGGTTCTCTGTTTGGCACA 59.788 47.619 0.00 0.00 0.00 4.57
3542 3800 2.050714 CTGTTTGGCACAGCGCTG 60.051 61.111 34.89 34.89 46.70 5.18
3543 3801 2.515757 TGTTTGGCACAGCGCTGA 60.516 55.556 42.03 18.83 42.39 4.26
3544 3802 2.062361 CTGTTTGGCACAGCGCTGAA 62.062 55.000 42.03 23.71 46.70 3.02
3545 3803 1.286880 GTTTGGCACAGCGCTGAAT 59.713 52.632 42.03 20.06 42.39 2.57
3546 3804 0.521291 GTTTGGCACAGCGCTGAATA 59.479 50.000 42.03 21.93 42.39 1.75
3547 3805 1.133025 GTTTGGCACAGCGCTGAATAT 59.867 47.619 42.03 18.83 42.39 1.28
3548 3806 1.462616 TTGGCACAGCGCTGAATATT 58.537 45.000 42.03 18.41 42.39 1.28
3549 3807 1.462616 TGGCACAGCGCTGAATATTT 58.537 45.000 42.03 17.59 41.91 1.40
3550 3808 1.401552 TGGCACAGCGCTGAATATTTC 59.598 47.619 42.03 22.12 41.91 2.17
3551 3809 1.672881 GGCACAGCGCTGAATATTTCT 59.327 47.619 42.03 15.97 41.91 2.52
3552 3810 2.872245 GGCACAGCGCTGAATATTTCTA 59.128 45.455 42.03 0.00 41.91 2.10
3553 3811 3.059325 GGCACAGCGCTGAATATTTCTAG 60.059 47.826 42.03 13.00 41.91 2.43
3554 3812 3.059325 GCACAGCGCTGAATATTTCTAGG 60.059 47.826 42.03 12.78 37.77 3.02
3555 3813 4.371786 CACAGCGCTGAATATTTCTAGGA 58.628 43.478 42.03 0.00 0.00 2.94
3556 3814 4.993584 CACAGCGCTGAATATTTCTAGGAT 59.006 41.667 42.03 13.08 0.00 3.24
3557 3815 5.468072 CACAGCGCTGAATATTTCTAGGATT 59.532 40.000 42.03 12.37 0.00 3.01
3558 3816 5.698545 ACAGCGCTGAATATTTCTAGGATTC 59.301 40.000 42.03 0.00 0.00 2.52
3559 3817 5.931146 CAGCGCTGAATATTTCTAGGATTCT 59.069 40.000 33.66 0.00 32.01 2.40
3560 3818 6.090628 CAGCGCTGAATATTTCTAGGATTCTC 59.909 42.308 33.66 0.00 32.01 2.87
3561 3819 5.350091 GCGCTGAATATTTCTAGGATTCTCC 59.650 44.000 0.00 0.00 36.58 3.71
3562 3820 5.872070 CGCTGAATATTTCTAGGATTCTCCC 59.128 44.000 0.00 0.00 37.19 4.30
3563 3821 6.295575 CGCTGAATATTTCTAGGATTCTCCCT 60.296 42.308 0.00 0.00 37.19 4.20
3564 3822 7.457561 GCTGAATATTTCTAGGATTCTCCCTT 58.542 38.462 0.00 0.00 37.19 3.95
3565 3823 7.390162 GCTGAATATTTCTAGGATTCTCCCTTG 59.610 40.741 0.00 0.00 37.19 3.61
3566 3824 8.337118 TGAATATTTCTAGGATTCTCCCTTGT 57.663 34.615 0.00 0.00 37.19 3.16
3567 3825 8.781951 TGAATATTTCTAGGATTCTCCCTTGTT 58.218 33.333 0.00 0.00 37.19 2.83
3568 3826 9.634021 GAATATTTCTAGGATTCTCCCTTGTTT 57.366 33.333 0.00 0.00 37.19 2.83
3569 3827 9.634021 AATATTTCTAGGATTCTCCCTTGTTTC 57.366 33.333 0.00 0.00 37.19 2.78
3570 3828 5.437191 TTCTAGGATTCTCCCTTGTTTCC 57.563 43.478 0.00 0.00 37.19 3.13
3571 3829 4.699994 TCTAGGATTCTCCCTTGTTTCCT 58.300 43.478 0.00 0.00 37.19 3.36
3572 3830 4.717280 TCTAGGATTCTCCCTTGTTTCCTC 59.283 45.833 0.00 0.00 37.19 3.71
3573 3831 2.578480 AGGATTCTCCCTTGTTTCCTCC 59.422 50.000 0.00 0.00 37.19 4.30
3574 3832 2.357257 GGATTCTCCCTTGTTTCCTCCC 60.357 54.545 0.00 0.00 0.00 4.30
3575 3833 1.073098 TTCTCCCTTGTTTCCTCCCC 58.927 55.000 0.00 0.00 0.00 4.81
3576 3834 0.104144 TCTCCCTTGTTTCCTCCCCA 60.104 55.000 0.00 0.00 0.00 4.96
3577 3835 0.777446 CTCCCTTGTTTCCTCCCCAA 59.223 55.000 0.00 0.00 0.00 4.12
3578 3836 1.146982 CTCCCTTGTTTCCTCCCCAAA 59.853 52.381 0.00 0.00 0.00 3.28
3579 3837 1.133294 TCCCTTGTTTCCTCCCCAAAC 60.133 52.381 0.00 0.00 34.79 2.93
3580 3838 1.133167 CCCTTGTTTCCTCCCCAAACT 60.133 52.381 0.00 0.00 35.19 2.66
3581 3839 1.963515 CCTTGTTTCCTCCCCAAACTG 59.036 52.381 0.00 0.00 35.19 3.16
3582 3840 2.666317 CTTGTTTCCTCCCCAAACTGT 58.334 47.619 0.00 0.00 35.19 3.55
3583 3841 2.838637 TGTTTCCTCCCCAAACTGTT 57.161 45.000 0.00 0.00 35.19 3.16
3584 3842 2.661718 TGTTTCCTCCCCAAACTGTTC 58.338 47.619 0.00 0.00 35.19 3.18
3585 3843 2.024846 TGTTTCCTCCCCAAACTGTTCA 60.025 45.455 0.00 0.00 35.19 3.18
3586 3844 3.230976 GTTTCCTCCCCAAACTGTTCAT 58.769 45.455 0.00 0.00 32.01 2.57
3587 3845 3.611025 TTCCTCCCCAAACTGTTCATT 57.389 42.857 0.00 0.00 0.00 2.57
3588 3846 4.733077 TTCCTCCCCAAACTGTTCATTA 57.267 40.909 0.00 0.00 0.00 1.90
3589 3847 4.946160 TCCTCCCCAAACTGTTCATTAT 57.054 40.909 0.00 0.00 0.00 1.28
3590 3848 6.395780 TTCCTCCCCAAACTGTTCATTATA 57.604 37.500 0.00 0.00 0.00 0.98
3591 3849 5.751586 TCCTCCCCAAACTGTTCATTATAC 58.248 41.667 0.00 0.00 0.00 1.47
3592 3850 5.251932 TCCTCCCCAAACTGTTCATTATACA 59.748 40.000 0.00 0.00 0.00 2.29
3593 3851 5.949354 CCTCCCCAAACTGTTCATTATACAA 59.051 40.000 0.00 0.00 0.00 2.41
3594 3852 6.435904 CCTCCCCAAACTGTTCATTATACAAA 59.564 38.462 0.00 0.00 0.00 2.83
3595 3853 7.222000 TCCCCAAACTGTTCATTATACAAAC 57.778 36.000 0.00 0.00 0.00 2.93
3596 3854 6.209788 TCCCCAAACTGTTCATTATACAAACC 59.790 38.462 0.00 0.00 0.00 3.27
3597 3855 6.090129 CCCAAACTGTTCATTATACAAACCG 58.910 40.000 0.00 0.00 0.00 4.44
3598 3856 6.090129 CCAAACTGTTCATTATACAAACCGG 58.910 40.000 0.00 0.00 0.00 5.28
3599 3857 6.072397 CCAAACTGTTCATTATACAAACCGGA 60.072 38.462 9.46 0.00 0.00 5.14
3600 3858 6.737254 AACTGTTCATTATACAAACCGGAG 57.263 37.500 9.46 0.00 0.00 4.63
3601 3859 4.634443 ACTGTTCATTATACAAACCGGAGC 59.366 41.667 9.46 0.00 0.00 4.70
3602 3860 4.580868 TGTTCATTATACAAACCGGAGCA 58.419 39.130 9.46 0.00 0.00 4.26
3603 3861 4.634004 TGTTCATTATACAAACCGGAGCAG 59.366 41.667 9.46 0.00 0.00 4.24
3604 3862 4.746535 TCATTATACAAACCGGAGCAGA 57.253 40.909 9.46 0.00 0.00 4.26
3605 3863 4.439057 TCATTATACAAACCGGAGCAGAC 58.561 43.478 9.46 0.00 0.00 3.51
3606 3864 2.973694 TATACAAACCGGAGCAGACC 57.026 50.000 9.46 0.00 0.00 3.85
3607 3865 0.981183 ATACAAACCGGAGCAGACCA 59.019 50.000 9.46 0.00 0.00 4.02
3608 3866 0.320374 TACAAACCGGAGCAGACCAG 59.680 55.000 9.46 0.00 0.00 4.00
3609 3867 1.672356 CAAACCGGAGCAGACCAGG 60.672 63.158 9.46 0.00 0.00 4.45
3610 3868 3.553095 AAACCGGAGCAGACCAGGC 62.553 63.158 9.46 0.00 0.00 4.85
3623 3881 3.741476 CAGGCGCTGGTTTGGCTC 61.741 66.667 7.64 0.00 39.20 4.70
3624 3882 3.958860 AGGCGCTGGTTTGGCTCT 61.959 61.111 7.64 0.00 35.99 4.09
3625 3883 2.985847 GGCGCTGGTTTGGCTCTT 60.986 61.111 7.64 0.00 0.00 2.85
3626 3884 2.563427 GCGCTGGTTTGGCTCTTC 59.437 61.111 0.00 0.00 0.00 2.87
3627 3885 2.982744 GCGCTGGTTTGGCTCTTCC 61.983 63.158 0.00 0.00 0.00 3.46
3628 3886 1.302832 CGCTGGTTTGGCTCTTCCT 60.303 57.895 0.00 0.00 35.26 3.36
3629 3887 0.036388 CGCTGGTTTGGCTCTTCCTA 60.036 55.000 0.00 0.00 35.26 2.94
3630 3888 1.407437 CGCTGGTTTGGCTCTTCCTAT 60.407 52.381 0.00 0.00 35.26 2.57
3631 3889 2.728007 GCTGGTTTGGCTCTTCCTATT 58.272 47.619 0.00 0.00 35.26 1.73
3632 3890 3.092301 GCTGGTTTGGCTCTTCCTATTT 58.908 45.455 0.00 0.00 35.26 1.40
3633 3891 3.511540 GCTGGTTTGGCTCTTCCTATTTT 59.488 43.478 0.00 0.00 35.26 1.82
3634 3892 4.705023 GCTGGTTTGGCTCTTCCTATTTTA 59.295 41.667 0.00 0.00 35.26 1.52
3635 3893 5.163612 GCTGGTTTGGCTCTTCCTATTTTAG 60.164 44.000 0.00 0.00 35.26 1.85
3636 3894 5.887754 TGGTTTGGCTCTTCCTATTTTAGT 58.112 37.500 0.00 0.00 35.26 2.24
3637 3895 6.311735 TGGTTTGGCTCTTCCTATTTTAGTT 58.688 36.000 0.00 0.00 35.26 2.24
3638 3896 6.208599 TGGTTTGGCTCTTCCTATTTTAGTTG 59.791 38.462 0.00 0.00 35.26 3.16
3639 3897 6.208797 GGTTTGGCTCTTCCTATTTTAGTTGT 59.791 38.462 0.00 0.00 35.26 3.32
3640 3898 7.306213 GTTTGGCTCTTCCTATTTTAGTTGTC 58.694 38.462 0.00 0.00 35.26 3.18
3641 3899 5.175859 TGGCTCTTCCTATTTTAGTTGTCG 58.824 41.667 0.00 0.00 35.26 4.35
3642 3900 4.571176 GGCTCTTCCTATTTTAGTTGTCGG 59.429 45.833 0.00 0.00 0.00 4.79
3643 3901 5.176592 GCTCTTCCTATTTTAGTTGTCGGT 58.823 41.667 0.00 0.00 0.00 4.69
3644 3902 6.335777 GCTCTTCCTATTTTAGTTGTCGGTA 58.664 40.000 0.00 0.00 0.00 4.02
3645 3903 6.255237 GCTCTTCCTATTTTAGTTGTCGGTAC 59.745 42.308 0.00 0.00 0.00 3.34
3661 3919 3.665745 GGTACGGTCTGGTCTTAACAA 57.334 47.619 0.00 0.00 0.00 2.83
3662 3920 3.320626 GGTACGGTCTGGTCTTAACAAC 58.679 50.000 0.00 0.00 0.00 3.32
3663 3921 3.006217 GGTACGGTCTGGTCTTAACAACT 59.994 47.826 0.00 0.00 0.00 3.16
3664 3922 4.218417 GGTACGGTCTGGTCTTAACAACTA 59.782 45.833 0.00 0.00 0.00 2.24
3665 3923 4.248691 ACGGTCTGGTCTTAACAACTAC 57.751 45.455 0.00 0.00 0.00 2.73
3666 3924 3.893813 ACGGTCTGGTCTTAACAACTACT 59.106 43.478 0.00 0.00 0.00 2.57
3667 3925 5.072741 ACGGTCTGGTCTTAACAACTACTA 58.927 41.667 0.00 0.00 0.00 1.82
3668 3926 5.048434 ACGGTCTGGTCTTAACAACTACTAC 60.048 44.000 0.00 0.00 0.00 2.73
3669 3927 5.182760 CGGTCTGGTCTTAACAACTACTACT 59.817 44.000 0.00 0.00 0.00 2.57
3670 3928 6.294397 CGGTCTGGTCTTAACAACTACTACTT 60.294 42.308 0.00 0.00 0.00 2.24
3671 3929 7.440198 GGTCTGGTCTTAACAACTACTACTTT 58.560 38.462 0.00 0.00 0.00 2.66
3672 3930 7.598118 GGTCTGGTCTTAACAACTACTACTTTC 59.402 40.741 0.00 0.00 0.00 2.62
3673 3931 7.325579 GTCTGGTCTTAACAACTACTACTTTCG 59.674 40.741 0.00 0.00 0.00 3.46
3674 3932 7.229306 TCTGGTCTTAACAACTACTACTTTCGA 59.771 37.037 0.00 0.00 0.00 3.71
3675 3933 7.141363 TGGTCTTAACAACTACTACTTTCGAC 58.859 38.462 0.00 0.00 0.00 4.20
3676 3934 7.013655 TGGTCTTAACAACTACTACTTTCGACT 59.986 37.037 0.00 0.00 0.00 4.18
3677 3935 7.536964 GGTCTTAACAACTACTACTTTCGACTC 59.463 40.741 0.00 0.00 0.00 3.36
3678 3936 8.072567 GTCTTAACAACTACTACTTTCGACTCA 58.927 37.037 0.00 0.00 0.00 3.41
3679 3937 8.623903 TCTTAACAACTACTACTTTCGACTCAA 58.376 33.333 0.00 0.00 0.00 3.02
3680 3938 9.241317 CTTAACAACTACTACTTTCGACTCAAA 57.759 33.333 0.00 0.00 0.00 2.69
3681 3939 9.585099 TTAACAACTACTACTTTCGACTCAAAA 57.415 29.630 0.00 0.00 0.00 2.44
3682 3940 8.658499 AACAACTACTACTTTCGACTCAAAAT 57.342 30.769 0.00 0.00 0.00 1.82
3683 3941 9.754382 AACAACTACTACTTTCGACTCAAAATA 57.246 29.630 0.00 0.00 0.00 1.40
3684 3942 9.754382 ACAACTACTACTTTCGACTCAAAATAA 57.246 29.630 0.00 0.00 0.00 1.40
3687 3945 9.367444 ACTACTACTTTCGACTCAAAATAATGG 57.633 33.333 0.00 0.00 0.00 3.16
3688 3946 7.611213 ACTACTTTCGACTCAAAATAATGGG 57.389 36.000 0.00 0.00 0.00 4.00
3689 3947 7.166167 ACTACTTTCGACTCAAAATAATGGGT 58.834 34.615 0.00 0.00 36.50 4.51
3690 3948 6.254281 ACTTTCGACTCAAAATAATGGGTG 57.746 37.500 0.00 0.00 33.07 4.61
3691 3949 5.768164 ACTTTCGACTCAAAATAATGGGTGT 59.232 36.000 0.00 0.00 33.07 4.16
3692 3950 5.873179 TTCGACTCAAAATAATGGGTGTC 57.127 39.130 0.00 0.00 33.07 3.67
3693 3951 4.900684 TCGACTCAAAATAATGGGTGTCA 58.099 39.130 0.00 0.00 33.07 3.58
3694 3952 4.693566 TCGACTCAAAATAATGGGTGTCAC 59.306 41.667 0.00 0.00 33.07 3.67
3695 3953 4.142687 CGACTCAAAATAATGGGTGTCACC 60.143 45.833 14.13 14.13 33.07 4.02
3696 3954 4.735369 ACTCAAAATAATGGGTGTCACCA 58.265 39.130 23.48 10.15 46.24 4.17
3707 3965 5.365021 TGGGTGTCACCATTTTTCATTTT 57.635 34.783 23.48 0.00 41.02 1.82
3708 3966 5.749462 TGGGTGTCACCATTTTTCATTTTT 58.251 33.333 23.48 0.00 41.02 1.94
3728 3986 2.683916 TCCATGAAGGAAGGACGCT 58.316 52.632 0.00 0.00 45.65 5.07
3729 3987 1.860641 TCCATGAAGGAAGGACGCTA 58.139 50.000 0.00 0.00 45.65 4.26
3730 3988 1.480954 TCCATGAAGGAAGGACGCTAC 59.519 52.381 0.00 0.00 45.65 3.58
3731 3989 1.473434 CCATGAAGGAAGGACGCTACC 60.473 57.143 0.00 0.00 41.22 3.18
3732 3990 1.482593 CATGAAGGAAGGACGCTACCT 59.517 52.381 0.00 0.00 42.69 3.08
3733 3991 1.183549 TGAAGGAAGGACGCTACCTC 58.816 55.000 0.00 0.00 39.62 3.85
3734 3992 0.460722 GAAGGAAGGACGCTACCTCC 59.539 60.000 0.00 3.63 39.62 4.30
3735 3993 0.252103 AAGGAAGGACGCTACCTCCA 60.252 55.000 12.80 0.00 39.62 3.86
3736 3994 0.252103 AGGAAGGACGCTACCTCCAA 60.252 55.000 12.80 0.00 39.62 3.53
3737 3995 0.611714 GGAAGGACGCTACCTCCAAA 59.388 55.000 0.00 0.00 39.62 3.28
3738 3996 1.209747 GGAAGGACGCTACCTCCAAAT 59.790 52.381 0.00 0.00 39.62 2.32
3739 3997 2.355818 GGAAGGACGCTACCTCCAAATT 60.356 50.000 0.00 0.00 39.62 1.82
3740 3998 3.344515 GAAGGACGCTACCTCCAAATTT 58.655 45.455 0.00 0.00 39.62 1.82
3741 3999 2.987232 AGGACGCTACCTCCAAATTTC 58.013 47.619 0.00 0.00 34.98 2.17
3742 4000 2.304761 AGGACGCTACCTCCAAATTTCA 59.695 45.455 0.00 0.00 34.98 2.69
3743 4001 2.418976 GGACGCTACCTCCAAATTTCAC 59.581 50.000 0.00 0.00 0.00 3.18
3744 4002 2.073816 ACGCTACCTCCAAATTTCACG 58.926 47.619 0.00 0.00 0.00 4.35
3745 4003 1.396996 CGCTACCTCCAAATTTCACGG 59.603 52.381 0.00 0.00 0.00 4.94
3746 4004 2.433436 GCTACCTCCAAATTTCACGGT 58.567 47.619 6.92 6.92 0.00 4.83
3747 4005 3.602483 GCTACCTCCAAATTTCACGGTA 58.398 45.455 8.11 8.11 0.00 4.02
3748 4006 4.004982 GCTACCTCCAAATTTCACGGTAA 58.995 43.478 9.19 0.00 0.00 2.85
3749 4007 4.142752 GCTACCTCCAAATTTCACGGTAAC 60.143 45.833 9.19 3.62 0.00 2.50
3750 4008 4.094830 ACCTCCAAATTTCACGGTAACT 57.905 40.909 0.00 0.00 0.00 2.24
3751 4009 3.818773 ACCTCCAAATTTCACGGTAACTG 59.181 43.478 0.00 0.00 0.00 3.16
3752 4010 3.365969 CCTCCAAATTTCACGGTAACTGC 60.366 47.826 0.00 0.00 0.00 4.40
3753 4011 2.554893 TCCAAATTTCACGGTAACTGCC 59.445 45.455 0.00 0.00 0.00 4.85
3754 4012 2.556622 CCAAATTTCACGGTAACTGCCT 59.443 45.455 0.00 0.00 0.00 4.75
3755 4013 3.754323 CCAAATTTCACGGTAACTGCCTA 59.246 43.478 0.00 0.00 0.00 3.93
3756 4014 4.216687 CCAAATTTCACGGTAACTGCCTAA 59.783 41.667 0.00 0.00 0.00 2.69
3757 4015 5.278561 CCAAATTTCACGGTAACTGCCTAAA 60.279 40.000 0.00 0.00 0.00 1.85
3758 4016 6.386654 CAAATTTCACGGTAACTGCCTAAAT 58.613 36.000 0.00 0.00 0.00 1.40
3759 4017 6.584185 AATTTCACGGTAACTGCCTAAATT 57.416 33.333 0.00 0.00 0.00 1.82
3760 4018 7.690952 AATTTCACGGTAACTGCCTAAATTA 57.309 32.000 0.00 0.00 29.50 1.40
3761 4019 7.875327 ATTTCACGGTAACTGCCTAAATTAT 57.125 32.000 0.00 0.00 0.00 1.28
3762 4020 6.913873 TTCACGGTAACTGCCTAAATTATC 57.086 37.500 0.00 0.00 0.00 1.75
3763 4021 5.362263 TCACGGTAACTGCCTAAATTATCC 58.638 41.667 0.00 0.00 0.00 2.59
3773 4031 3.560068 GCCTAAATTATCCACGGTGTCTG 59.440 47.826 7.45 0.00 0.00 3.51
3778 4036 5.670792 AATTATCCACGGTGTCTGTCTTA 57.329 39.130 7.45 0.00 0.00 2.10
3792 4050 6.929606 GTGTCTGTCTTACCAATCTGTTAGTT 59.070 38.462 0.00 0.00 0.00 2.24
3794 4052 5.932303 TCTGTCTTACCAATCTGTTAGTTGC 59.068 40.000 0.00 0.00 0.00 4.17
3805 4063 8.087750 CCAATCTGTTAGTTGCCAAATTAAAGA 58.912 33.333 0.00 0.00 0.00 2.52
3807 4065 7.575414 TCTGTTAGTTGCCAAATTAAAGACA 57.425 32.000 0.00 0.00 0.00 3.41
3811 4069 5.590530 AGTTGCCAAATTAAAGACACACA 57.409 34.783 0.00 0.00 0.00 3.72
3869 4132 2.096496 CACCATGCTTCGATTGAGGAAC 59.904 50.000 0.00 0.00 0.00 3.62
3872 4135 2.839486 TGCTTCGATTGAGGAACTGT 57.161 45.000 0.00 0.00 41.55 3.55
3931 4221 2.995283 TGATCCATGAGCCTGAAGTTG 58.005 47.619 0.00 0.00 0.00 3.16
3947 4237 6.128282 CCTGAAGTTGTGCGTCTATTATTTGT 60.128 38.462 0.00 0.00 0.00 2.83
3958 4248 6.195244 GCGTCTATTATTTGTGAAGCAACATG 59.805 38.462 0.00 0.00 36.72 3.21
3984 4275 3.957591 TTTTATGCCACACATGTGCAT 57.042 38.095 25.68 23.27 44.34 3.96
3986 4277 5.397142 TTTTATGCCACACATGTGCATTA 57.603 34.783 25.68 14.04 44.34 1.90
4020 4311 9.229784 GCAGACATATCACAAATTTACAAGATG 57.770 33.333 0.00 0.00 0.00 2.90
4039 4330 4.897224 GATGTAATCGTGTGACATTGTGG 58.103 43.478 0.00 0.00 33.99 4.17
4045 4336 4.265904 TCGTGTGACATTGTGGACTTAT 57.734 40.909 0.00 0.00 0.00 1.73
4064 4355 7.201530 GGACTTATTTCCATGTTACGAGTTCTG 60.202 40.741 0.00 0.00 35.49 3.02
4071 4362 5.587043 TCCATGTTACGAGTTCTGTTTTGTT 59.413 36.000 0.00 0.00 0.00 2.83
4124 4415 6.639686 CAGCAACTGATATCAAAATATGGCAC 59.360 38.462 6.90 0.00 32.44 5.01
4169 4460 6.183361 TGGGAACAGTTGACACTAATCAGTTA 60.183 38.462 0.00 0.00 35.01 2.24
4306 4599 6.795144 TTAACCGTCTCCCAGTTATGATAA 57.205 37.500 0.00 0.00 0.00 1.75
4316 4609 9.948964 TCTCCCAGTTATGATAATATTCACATG 57.051 33.333 13.86 0.00 0.00 3.21
4345 4638 5.255397 AGGTGTGGGAGATTGTTTATTCA 57.745 39.130 0.00 0.00 0.00 2.57
4429 4722 6.773976 TTCCTCCCTGCTTACATTTTATTG 57.226 37.500 0.00 0.00 0.00 1.90
4430 4723 5.826643 TCCTCCCTGCTTACATTTTATTGT 58.173 37.500 0.00 0.00 0.00 2.71
4514 4807 2.285977 AGTTTGTGTTTCACTCCGGAC 58.714 47.619 0.00 0.00 35.11 4.79
4645 4938 0.879090 CTGTTTACCGGAAGTTGCCC 59.121 55.000 9.46 0.00 0.00 5.36
4671 4964 5.931441 AGTCATGTCAGCTTCTTTTGTAC 57.069 39.130 0.00 0.00 0.00 2.90
4672 4965 5.615289 AGTCATGTCAGCTTCTTTTGTACT 58.385 37.500 0.00 0.00 0.00 2.73
4676 4969 9.151471 GTCATGTCAGCTTCTTTTGTACTTATA 57.849 33.333 0.00 0.00 0.00 0.98
4677 4970 9.890629 TCATGTCAGCTTCTTTTGTACTTATAT 57.109 29.630 0.00 0.00 0.00 0.86
4737 5030 4.419282 TCTCATCCTTTTTGGGATTGCTT 58.581 39.130 0.00 0.00 42.89 3.91
4739 5032 4.158786 TCATCCTTTTTGGGATTGCTTGA 58.841 39.130 0.00 0.00 42.89 3.02
4765 5058 4.760204 TGCATCAAGAGGATAATGCATGAG 59.240 41.667 0.00 0.00 46.91 2.90
4777 5070 8.636213 AGGATAATGCATGAGAACCTTTTTATG 58.364 33.333 0.00 0.00 0.00 1.90
4872 5183 0.811281 GTAGTGGACATGGCCAAAGC 59.189 55.000 25.60 10.75 40.20 3.51
4925 5237 1.601903 GACGTCATGGCACTTGTCAAA 59.398 47.619 11.55 0.00 31.21 2.69
4926 5238 2.020720 ACGTCATGGCACTTGTCAAAA 58.979 42.857 0.00 0.00 31.21 2.44
4928 5240 2.397549 GTCATGGCACTTGTCAAAAGC 58.602 47.619 0.00 1.29 31.21 3.51
4969 5281 8.453320 TCAGATATTGCAATGTACAAGTCTTTG 58.547 33.333 22.27 0.17 40.24 2.77
4971 5283 8.454106 AGATATTGCAATGTACAAGTCTTTGTC 58.546 33.333 22.27 0.00 44.00 3.18
4974 5286 5.820131 TGCAATGTACAAGTCTTTGTCAAG 58.180 37.500 0.00 0.00 44.00 3.02
4975 5287 5.215160 GCAATGTACAAGTCTTTGTCAAGG 58.785 41.667 0.00 0.00 44.00 3.61
4976 5288 5.762045 CAATGTACAAGTCTTTGTCAAGGG 58.238 41.667 0.00 0.00 44.00 3.95
5000 5316 5.184479 GGGGTTAATGGTTTCTGTTACTTCC 59.816 44.000 0.00 0.00 0.00 3.46
5136 5452 6.431234 CAGATGGTAAAGTTCTGGCTTTAACT 59.569 38.462 12.79 0.00 44.58 2.24
5219 5535 5.189736 AGAAGGCTCATGAAGGTGTGTAATA 59.810 40.000 0.00 0.00 0.00 0.98
5220 5536 5.435686 AGGCTCATGAAGGTGTGTAATAA 57.564 39.130 0.00 0.00 0.00 1.40
5244 5560 8.581253 AATATTCCTAGTTTCCAGGTTGAAAG 57.419 34.615 0.00 0.00 35.04 2.62
5245 5561 5.382664 TTCCTAGTTTCCAGGTTGAAAGT 57.617 39.130 0.00 0.00 40.21 2.66
5262 5578 6.749036 TGAAAGTCTCTTTAGGTTCTCCTT 57.251 37.500 0.00 0.00 42.12 3.36
5263 5579 6.525629 TGAAAGTCTCTTTAGGTTCTCCTTG 58.474 40.000 0.00 0.00 42.12 3.61
5277 5593 8.226819 AGGTTCTCCTTGTCTAAAAGAAAAAG 57.773 34.615 0.00 0.00 42.12 2.27
5278 5594 7.834681 AGGTTCTCCTTGTCTAAAAGAAAAAGT 59.165 33.333 0.00 0.00 42.12 2.66
5279 5595 7.915923 GGTTCTCCTTGTCTAAAAGAAAAAGTG 59.084 37.037 0.00 0.00 0.00 3.16
5280 5596 7.027778 TCTCCTTGTCTAAAAGAAAAAGTGC 57.972 36.000 0.00 0.00 0.00 4.40
5301 5617 0.878416 TGGGCTGACGTGTTTTATGC 59.122 50.000 0.00 0.00 0.00 3.14
5303 5619 1.401018 GGGCTGACGTGTTTTATGCAC 60.401 52.381 0.00 0.00 0.00 4.57
5352 5668 1.749258 GGCTCCACGGACAATTCCC 60.749 63.158 0.00 0.00 38.99 3.97
5382 5727 6.492007 AACATCTCTGTTGTTTGCTAGATG 57.508 37.500 0.00 0.00 43.92 2.90
5383 5728 4.940046 ACATCTCTGTTGTTTGCTAGATGG 59.060 41.667 13.07 0.00 42.86 3.51
5396 5741 2.545532 GCTAGATGGTGCACTAGAGCTG 60.546 54.545 17.98 2.94 38.53 4.24
5427 5772 4.631813 CCTGCTTAGGTTAGTAGTGCAAAG 59.368 45.833 0.00 0.00 0.00 2.77
5428 5773 5.223449 TGCTTAGGTTAGTAGTGCAAAGT 57.777 39.130 0.00 0.00 0.00 2.66
5464 5809 5.661056 TTGTGGACTGGATCTACTTAGTG 57.339 43.478 0.00 0.00 39.50 2.74
5493 5838 3.451793 TGGCGCACCACAATACTAG 57.548 52.632 10.83 0.00 42.67 2.57
5494 5839 0.611200 TGGCGCACCACAATACTAGT 59.389 50.000 10.83 0.00 42.67 2.57
5517 5862 8.530804 AGTGATATATGATAGCTGATGCACTA 57.469 34.615 0.00 0.00 42.74 2.74
5519 5864 8.412456 GTGATATATGATAGCTGATGCACTAGT 58.588 37.037 0.00 0.00 42.74 2.57
5522 5867 5.541953 ATGATAGCTGATGCACTAGTTGA 57.458 39.130 0.00 0.00 42.74 3.18
5523 5868 5.541953 TGATAGCTGATGCACTAGTTGAT 57.458 39.130 0.00 0.00 42.74 2.57
5524 5869 5.295152 TGATAGCTGATGCACTAGTTGATG 58.705 41.667 0.00 0.00 42.74 3.07
5525 5870 3.623906 AGCTGATGCACTAGTTGATGT 57.376 42.857 0.00 0.00 42.74 3.06
5526 5871 3.268330 AGCTGATGCACTAGTTGATGTG 58.732 45.455 0.00 0.00 42.74 3.21
5527 5872 3.005554 GCTGATGCACTAGTTGATGTGT 58.994 45.455 0.00 0.00 39.41 3.72
5528 5873 3.438087 GCTGATGCACTAGTTGATGTGTT 59.562 43.478 0.00 0.00 39.41 3.32
5586 5940 8.985315 TGATCTAGTTTGATGCTGGAAATATT 57.015 30.769 0.00 0.00 0.00 1.28
5590 5944 9.851686 TCTAGTTTGATGCTGGAAATATTATGT 57.148 29.630 0.00 0.00 0.00 2.29
5591 5945 9.888878 CTAGTTTGATGCTGGAAATATTATGTG 57.111 33.333 0.00 0.00 0.00 3.21
5592 5946 8.297470 AGTTTGATGCTGGAAATATTATGTGT 57.703 30.769 0.00 0.00 0.00 3.72
5593 5947 8.752187 AGTTTGATGCTGGAAATATTATGTGTT 58.248 29.630 0.00 0.00 0.00 3.32
5594 5948 9.369904 GTTTGATGCTGGAAATATTATGTGTTT 57.630 29.630 0.00 0.00 0.00 2.83
5631 5985 8.693504 GTGTAGATCACATTGTTTGTTTGATTG 58.306 33.333 0.00 0.00 45.51 2.67
5632 5986 8.412456 TGTAGATCACATTGTTTGTTTGATTGT 58.588 29.630 0.00 0.00 36.00 2.71
5633 5987 7.935338 AGATCACATTGTTTGTTTGATTGTC 57.065 32.000 0.00 0.00 36.00 3.18
5634 5988 7.719483 AGATCACATTGTTTGTTTGATTGTCT 58.281 30.769 0.00 0.00 36.00 3.41
5635 5989 7.864379 AGATCACATTGTTTGTTTGATTGTCTC 59.136 33.333 0.00 0.00 36.00 3.36
5636 5990 6.861144 TCACATTGTTTGTTTGATTGTCTCA 58.139 32.000 0.00 0.00 36.00 3.27
5637 5991 6.974048 TCACATTGTTTGTTTGATTGTCTCAG 59.026 34.615 0.00 0.00 36.00 3.35
5638 5992 6.199531 CACATTGTTTGTTTGATTGTCTCAGG 59.800 38.462 0.00 0.00 36.00 3.86
5639 5993 5.913137 TTGTTTGTTTGATTGTCTCAGGT 57.087 34.783 0.00 0.00 34.68 4.00
5656 6010 2.920384 TGGTGGTGCTCCTGCGTA 60.920 61.111 6.34 0.00 43.34 4.42
5736 6107 2.544480 CTCGACATGAGCGTCTTGTA 57.456 50.000 0.00 0.00 38.03 2.41
5811 6182 1.435515 GCGTTTGCAGTTGGGTTCA 59.564 52.632 0.00 0.00 42.15 3.18
5820 6191 2.352127 GCAGTTGGGTTCATTTGAGCTC 60.352 50.000 6.82 6.82 0.00 4.09
5847 6256 1.649171 GAGTCGATAGCGTGTTGTGTG 59.351 52.381 0.00 0.00 38.98 3.82
5853 6262 2.488639 TAGCGTGTTGTGTGAACGTA 57.511 45.000 0.00 0.00 39.45 3.57
5863 6272 6.198778 GTGTTGTGTGAACGTACATTGTACTA 59.801 38.462 21.35 5.89 32.43 1.82
5923 6338 0.804156 AAGTGTTTTTGCGGCGGTTG 60.804 50.000 9.78 0.00 0.00 3.77
5924 6339 2.105128 TGTTTTTGCGGCGGTTGG 59.895 55.556 9.78 0.00 0.00 3.77
5925 6340 2.105328 GTTTTTGCGGCGGTTGGT 59.895 55.556 9.78 0.00 0.00 3.67
5926 6341 1.519676 GTTTTTGCGGCGGTTGGTT 60.520 52.632 9.78 0.00 0.00 3.67
5931 6346 2.065906 TTGCGGCGGTTGGTTCTTTC 62.066 55.000 9.78 0.00 0.00 2.62
5940 6355 5.388111 GCGGTTGGTTCTTTCAACTATAAC 58.612 41.667 6.86 0.00 42.76 1.89
5941 6356 5.180680 GCGGTTGGTTCTTTCAACTATAACT 59.819 40.000 6.86 0.00 42.76 2.24
5942 6357 6.369615 GCGGTTGGTTCTTTCAACTATAACTA 59.630 38.462 6.86 0.00 42.76 2.24
5943 6358 7.065443 GCGGTTGGTTCTTTCAACTATAACTAT 59.935 37.037 6.86 0.00 42.76 2.12
5944 6359 8.388103 CGGTTGGTTCTTTCAACTATAACTATG 58.612 37.037 6.86 0.00 42.76 2.23
5945 6360 8.674607 GGTTGGTTCTTTCAACTATAACTATGG 58.325 37.037 6.86 0.00 42.76 2.74
5946 6361 9.444600 GTTGGTTCTTTCAACTATAACTATGGA 57.555 33.333 0.00 0.00 40.73 3.41
5947 6362 9.444600 TTGGTTCTTTCAACTATAACTATGGAC 57.555 33.333 0.00 0.00 0.00 4.02
5948 6363 8.598916 TGGTTCTTTCAACTATAACTATGGACA 58.401 33.333 0.00 0.00 0.00 4.02
5949 6364 9.614792 GGTTCTTTCAACTATAACTATGGACAT 57.385 33.333 0.00 0.00 0.00 3.06
5963 6378 4.785511 ATGGACATACATAGTAGTCGGC 57.214 45.455 0.00 0.00 31.93 5.54
5976 6391 4.935630 TCGGCGCGACTATATGTG 57.064 55.556 12.10 0.00 0.00 3.21
5977 6392 1.371267 TCGGCGCGACTATATGTGC 60.371 57.895 12.10 0.00 40.76 4.57
5978 6393 1.371758 CGGCGCGACTATATGTGCT 60.372 57.895 12.10 0.00 41.23 4.40
5979 6394 0.109919 CGGCGCGACTATATGTGCTA 60.110 55.000 12.10 0.00 41.23 3.49
5980 6395 1.467543 CGGCGCGACTATATGTGCTAT 60.468 52.381 12.10 0.00 41.23 2.97
5981 6396 2.223180 CGGCGCGACTATATGTGCTATA 60.223 50.000 12.10 0.00 41.23 1.31
5982 6397 3.548214 CGGCGCGACTATATGTGCTATAT 60.548 47.826 12.10 0.00 41.23 0.86
5983 6398 4.319261 CGGCGCGACTATATGTGCTATATA 60.319 45.833 12.10 0.00 41.23 0.86
5984 6399 4.910456 GGCGCGACTATATGTGCTATATAC 59.090 45.833 12.10 0.00 41.23 1.47
5985 6400 5.505159 GGCGCGACTATATGTGCTATATACA 60.505 44.000 12.10 0.00 41.23 2.29
5986 6401 6.143496 GCGCGACTATATGTGCTATATACAT 58.857 40.000 12.10 7.62 41.36 2.29
5987 6402 6.637254 GCGCGACTATATGTGCTATATACATT 59.363 38.462 12.10 1.58 39.36 2.71
5988 6403 7.357613 GCGCGACTATATGTGCTATATACATTG 60.358 40.741 12.10 3.62 39.36 2.82
5989 6404 7.855904 CGCGACTATATGTGCTATATACATTGA 59.144 37.037 0.00 0.00 39.36 2.57
5990 6405 9.516314 GCGACTATATGTGCTATATACATTGAA 57.484 33.333 7.75 0.00 39.36 2.69
6029 6444 7.251704 ACTATGAAATTATCGTCTGCTTTGG 57.748 36.000 0.00 0.00 0.00 3.28
6030 6445 4.963276 TGAAATTATCGTCTGCTTTGGG 57.037 40.909 0.00 0.00 0.00 4.12
6031 6446 3.128589 TGAAATTATCGTCTGCTTTGGGC 59.871 43.478 0.00 0.00 42.22 5.36
6032 6447 1.680338 ATTATCGTCTGCTTTGGGCC 58.320 50.000 0.00 0.00 40.92 5.80
6033 6448 0.618458 TTATCGTCTGCTTTGGGCCT 59.382 50.000 4.53 0.00 40.92 5.19
6034 6449 0.107703 TATCGTCTGCTTTGGGCCTG 60.108 55.000 4.53 0.00 40.92 4.85
6035 6450 2.129555 ATCGTCTGCTTTGGGCCTGT 62.130 55.000 4.53 0.00 40.92 4.00
6036 6451 1.003839 CGTCTGCTTTGGGCCTGTA 60.004 57.895 4.53 0.00 40.92 2.74
6037 6452 1.298859 CGTCTGCTTTGGGCCTGTAC 61.299 60.000 4.53 0.00 40.92 2.90
6038 6453 0.960861 GTCTGCTTTGGGCCTGTACC 60.961 60.000 4.53 0.00 40.92 3.34
6039 6454 1.133809 TCTGCTTTGGGCCTGTACCT 61.134 55.000 4.53 0.00 40.92 3.08
6040 6455 0.251341 CTGCTTTGGGCCTGTACCTT 60.251 55.000 4.53 0.00 40.92 3.50
6041 6456 0.187361 TGCTTTGGGCCTGTACCTTT 59.813 50.000 4.53 0.00 40.92 3.11
6042 6457 0.603065 GCTTTGGGCCTGTACCTTTG 59.397 55.000 4.53 0.00 34.27 2.77
6043 6458 1.821666 GCTTTGGGCCTGTACCTTTGA 60.822 52.381 4.53 0.00 34.27 2.69
6044 6459 2.807676 CTTTGGGCCTGTACCTTTGAT 58.192 47.619 4.53 0.00 0.00 2.57
6045 6460 2.214376 TTGGGCCTGTACCTTTGATG 57.786 50.000 4.53 0.00 0.00 3.07
6046 6461 1.367346 TGGGCCTGTACCTTTGATGA 58.633 50.000 4.53 0.00 0.00 2.92
6047 6462 1.707989 TGGGCCTGTACCTTTGATGAA 59.292 47.619 4.53 0.00 0.00 2.57
6048 6463 2.092323 GGGCCTGTACCTTTGATGAAC 58.908 52.381 0.84 0.00 0.00 3.18
6049 6464 2.092323 GGCCTGTACCTTTGATGAACC 58.908 52.381 0.00 0.00 0.00 3.62
6050 6465 2.092323 GCCTGTACCTTTGATGAACCC 58.908 52.381 0.00 0.00 0.00 4.11
6051 6466 2.290960 GCCTGTACCTTTGATGAACCCT 60.291 50.000 0.00 0.00 0.00 4.34
6052 6467 3.054655 GCCTGTACCTTTGATGAACCCTA 60.055 47.826 0.00 0.00 0.00 3.53
6053 6468 4.514401 CCTGTACCTTTGATGAACCCTAC 58.486 47.826 0.00 0.00 0.00 3.18
6054 6469 4.019681 CCTGTACCTTTGATGAACCCTACA 60.020 45.833 0.00 0.00 0.00 2.74
6055 6470 5.339200 CCTGTACCTTTGATGAACCCTACAT 60.339 44.000 0.00 0.00 0.00 2.29
6056 6471 6.126883 CCTGTACCTTTGATGAACCCTACATA 60.127 42.308 0.00 0.00 0.00 2.29
6057 6472 6.646267 TGTACCTTTGATGAACCCTACATAC 58.354 40.000 0.00 0.00 0.00 2.39
6058 6473 5.772393 ACCTTTGATGAACCCTACATACA 57.228 39.130 0.00 0.00 0.00 2.29
6059 6474 6.327386 ACCTTTGATGAACCCTACATACAT 57.673 37.500 0.00 0.00 0.00 2.29
6060 6475 6.731467 ACCTTTGATGAACCCTACATACATT 58.269 36.000 0.00 0.00 0.00 2.71
6061 6476 6.603201 ACCTTTGATGAACCCTACATACATTG 59.397 38.462 0.00 0.00 0.00 2.82
6062 6477 6.603201 CCTTTGATGAACCCTACATACATTGT 59.397 38.462 0.00 0.00 42.62 2.71
6063 6478 7.773224 CCTTTGATGAACCCTACATACATTGTA 59.227 37.037 0.00 0.00 39.87 2.41
6064 6479 9.342308 CTTTGATGAACCCTACATACATTGTAT 57.658 33.333 3.40 3.40 40.02 2.29
6065 6480 8.902540 TTGATGAACCCTACATACATTGTATC 57.097 34.615 6.34 0.00 40.02 2.24
6066 6481 8.028652 TGATGAACCCTACATACATTGTATCA 57.971 34.615 6.34 1.25 40.02 2.15
6067 6482 8.490311 TGATGAACCCTACATACATTGTATCAA 58.510 33.333 6.34 0.00 40.02 2.57
6068 6483 9.337396 GATGAACCCTACATACATTGTATCAAA 57.663 33.333 6.34 0.00 40.02 2.69
6069 6484 9.866655 ATGAACCCTACATACATTGTATCAAAT 57.133 29.630 6.34 0.00 40.02 2.32
6070 6485 9.337396 TGAACCCTACATACATTGTATCAAATC 57.663 33.333 6.34 1.40 40.02 2.17
6071 6486 9.561069 GAACCCTACATACATTGTATCAAATCT 57.439 33.333 6.34 0.00 40.02 2.40
6072 6487 9.920946 AACCCTACATACATTGTATCAAATCTT 57.079 29.630 6.34 0.00 40.02 2.40
6073 6488 9.561069 ACCCTACATACATTGTATCAAATCTTC 57.439 33.333 6.34 0.00 40.02 2.87
6074 6489 9.784531 CCCTACATACATTGTATCAAATCTTCT 57.215 33.333 6.34 0.00 40.02 2.85
6081 6496 8.553459 ACATTGTATCAAATCTTCTTCTTCGT 57.447 30.769 0.00 0.00 0.00 3.85
6082 6497 8.446273 ACATTGTATCAAATCTTCTTCTTCGTG 58.554 33.333 0.00 0.00 0.00 4.35
6083 6498 7.962964 TTGTATCAAATCTTCTTCTTCGTGT 57.037 32.000 0.00 0.00 0.00 4.49
6084 6499 7.962964 TGTATCAAATCTTCTTCTTCGTGTT 57.037 32.000 0.00 0.00 0.00 3.32
6085 6500 8.378172 TGTATCAAATCTTCTTCTTCGTGTTT 57.622 30.769 0.00 0.00 0.00 2.83
6086 6501 8.282592 TGTATCAAATCTTCTTCTTCGTGTTTG 58.717 33.333 0.00 0.00 0.00 2.93
6087 6502 6.677781 TCAAATCTTCTTCTTCGTGTTTGT 57.322 33.333 0.00 0.00 0.00 2.83
6088 6503 6.715464 TCAAATCTTCTTCTTCGTGTTTGTC 58.285 36.000 0.00 0.00 0.00 3.18
6089 6504 4.974103 ATCTTCTTCTTCGTGTTTGTCG 57.026 40.909 0.00 0.00 0.00 4.35
6090 6505 2.538449 TCTTCTTCTTCGTGTTTGTCGC 59.462 45.455 0.00 0.00 0.00 5.19
6096 6511 3.758777 CGTGTTTGTCGCGCGCTA 61.759 61.111 30.48 17.01 42.93 4.26
6097 6512 2.202008 GTGTTTGTCGCGCGCTAC 60.202 61.111 30.48 28.55 0.00 3.58
6098 6513 2.355363 TGTTTGTCGCGCGCTACT 60.355 55.556 31.71 0.00 0.00 2.57
6099 6514 2.093983 GTTTGTCGCGCGCTACTG 59.906 61.111 31.71 16.64 0.00 2.74
6100 6515 2.355363 TTTGTCGCGCGCTACTGT 60.355 55.556 31.71 0.00 0.00 3.55
6101 6516 1.952133 TTTGTCGCGCGCTACTGTT 60.952 52.632 31.71 0.00 0.00 3.16
6102 6517 2.153219 TTTGTCGCGCGCTACTGTTG 62.153 55.000 31.71 14.80 0.00 3.33
6103 6518 2.803670 GTCGCGCGCTACTGTTGA 60.804 61.111 30.48 14.26 0.00 3.18
6104 6519 2.049894 TCGCGCGCTACTGTTGAA 60.050 55.556 30.48 0.00 0.00 2.69
6105 6520 1.662133 TCGCGCGCTACTGTTGAAA 60.662 52.632 30.48 0.00 0.00 2.69
6106 6521 1.203065 CGCGCGCTACTGTTGAAAA 59.797 52.632 30.48 0.00 0.00 2.29
6107 6522 0.179225 CGCGCGCTACTGTTGAAAAT 60.179 50.000 30.48 0.00 0.00 1.82
6108 6523 1.524548 GCGCGCTACTGTTGAAAATC 58.475 50.000 26.67 0.00 0.00 2.17
6109 6524 1.136085 GCGCGCTACTGTTGAAAATCA 60.136 47.619 26.67 0.00 0.00 2.57
6110 6525 2.495939 CGCGCTACTGTTGAAAATCAC 58.504 47.619 5.56 0.00 0.00 3.06
6111 6526 2.495939 GCGCTACTGTTGAAAATCACG 58.504 47.619 0.00 0.00 0.00 4.35
6112 6527 2.156891 GCGCTACTGTTGAAAATCACGA 59.843 45.455 0.00 0.00 0.00 4.35
6113 6528 3.363575 GCGCTACTGTTGAAAATCACGAA 60.364 43.478 0.00 0.00 0.00 3.85
6114 6529 4.768145 CGCTACTGTTGAAAATCACGAAA 58.232 39.130 0.00 0.00 0.00 3.46
6115 6530 5.201910 CGCTACTGTTGAAAATCACGAAAA 58.798 37.500 0.00 0.00 0.00 2.29
6116 6531 5.851177 CGCTACTGTTGAAAATCACGAAAAT 59.149 36.000 0.00 0.00 0.00 1.82
6117 6532 6.359617 CGCTACTGTTGAAAATCACGAAAATT 59.640 34.615 0.00 0.00 0.00 1.82
6118 6533 7.493313 GCTACTGTTGAAAATCACGAAAATTG 58.507 34.615 0.00 0.00 0.00 2.32
6119 6534 6.272698 ACTGTTGAAAATCACGAAAATTGC 57.727 33.333 0.00 0.00 0.00 3.56
6120 6535 6.042143 ACTGTTGAAAATCACGAAAATTGCT 58.958 32.000 0.00 0.00 0.00 3.91
6121 6536 6.534793 ACTGTTGAAAATCACGAAAATTGCTT 59.465 30.769 0.00 0.00 0.00 3.91
6122 6537 7.064490 ACTGTTGAAAATCACGAAAATTGCTTT 59.936 29.630 0.00 0.00 0.00 3.51
6123 6538 8.412608 TGTTGAAAATCACGAAAATTGCTTTA 57.587 26.923 0.00 0.00 0.00 1.85
6124 6539 9.039870 TGTTGAAAATCACGAAAATTGCTTTAT 57.960 25.926 0.00 0.00 0.00 1.40
6125 6540 9.862585 GTTGAAAATCACGAAAATTGCTTTATT 57.137 25.926 0.00 0.00 0.00 1.40
6154 6569 3.423996 TTTTTGACGGGCAAACAGTAC 57.576 42.857 8.88 0.00 45.64 2.73
6155 6570 1.310904 TTTGACGGGCAAACAGTACC 58.689 50.000 4.55 0.00 41.37 3.34
6156 6571 0.470766 TTGACGGGCAAACAGTACCT 59.529 50.000 0.00 0.00 32.46 3.08
6157 6572 1.340088 TGACGGGCAAACAGTACCTA 58.660 50.000 0.00 0.00 0.00 3.08
6158 6573 1.001181 TGACGGGCAAACAGTACCTAC 59.999 52.381 0.00 0.00 0.00 3.18
6159 6574 0.037975 ACGGGCAAACAGTACCTACG 60.038 55.000 0.00 0.00 0.00 3.51
6160 6575 0.244450 CGGGCAAACAGTACCTACGA 59.756 55.000 0.00 0.00 0.00 3.43
6161 6576 1.337074 CGGGCAAACAGTACCTACGAA 60.337 52.381 0.00 0.00 0.00 3.85
6162 6577 2.071540 GGGCAAACAGTACCTACGAAC 58.928 52.381 0.00 0.00 0.00 3.95
6163 6578 2.071540 GGCAAACAGTACCTACGAACC 58.928 52.381 0.00 0.00 0.00 3.62
6164 6579 2.071540 GCAAACAGTACCTACGAACCC 58.928 52.381 0.00 0.00 0.00 4.11
6165 6580 2.548493 GCAAACAGTACCTACGAACCCA 60.548 50.000 0.00 0.00 0.00 4.51
6166 6581 3.062042 CAAACAGTACCTACGAACCCAC 58.938 50.000 0.00 0.00 0.00 4.61
6167 6582 1.260544 ACAGTACCTACGAACCCACC 58.739 55.000 0.00 0.00 0.00 4.61
6168 6583 0.533951 CAGTACCTACGAACCCACCC 59.466 60.000 0.00 0.00 0.00 4.61
6169 6584 0.114954 AGTACCTACGAACCCACCCA 59.885 55.000 0.00 0.00 0.00 4.51
6170 6585 0.975887 GTACCTACGAACCCACCCAA 59.024 55.000 0.00 0.00 0.00 4.12
6171 6586 1.347378 GTACCTACGAACCCACCCAAA 59.653 52.381 0.00 0.00 0.00 3.28
6172 6587 0.109153 ACCTACGAACCCACCCAAAC 59.891 55.000 0.00 0.00 0.00 2.93
6173 6588 0.607217 CCTACGAACCCACCCAAACC 60.607 60.000 0.00 0.00 0.00 3.27
6174 6589 0.108963 CTACGAACCCACCCAAACCA 59.891 55.000 0.00 0.00 0.00 3.67
6175 6590 0.179023 TACGAACCCACCCAAACCAC 60.179 55.000 0.00 0.00 0.00 4.16
6176 6591 1.152839 CGAACCCACCCAAACCACT 60.153 57.895 0.00 0.00 0.00 4.00
6177 6592 1.452145 CGAACCCACCCAAACCACTG 61.452 60.000 0.00 0.00 0.00 3.66
6178 6593 0.396556 GAACCCACCCAAACCACTGT 60.397 55.000 0.00 0.00 0.00 3.55
6179 6594 0.686112 AACCCACCCAAACCACTGTG 60.686 55.000 0.00 0.00 0.00 3.66
6180 6595 2.498056 CCCACCCAAACCACTGTGC 61.498 63.158 1.29 0.00 0.00 4.57
6181 6596 1.455587 CCACCCAAACCACTGTGCT 60.456 57.895 1.29 0.00 0.00 4.40
6182 6597 1.455383 CCACCCAAACCACTGTGCTC 61.455 60.000 1.29 0.00 0.00 4.26
6183 6598 0.466189 CACCCAAACCACTGTGCTCT 60.466 55.000 1.29 0.00 0.00 4.09
6184 6599 0.258774 ACCCAAACCACTGTGCTCTT 59.741 50.000 1.29 0.00 0.00 2.85
6185 6600 0.954452 CCCAAACCACTGTGCTCTTC 59.046 55.000 1.29 0.00 0.00 2.87
6186 6601 0.954452 CCAAACCACTGTGCTCTTCC 59.046 55.000 1.29 0.00 0.00 3.46
6187 6602 1.679139 CAAACCACTGTGCTCTTCCA 58.321 50.000 1.29 0.00 0.00 3.53
6188 6603 2.023673 CAAACCACTGTGCTCTTCCAA 58.976 47.619 1.29 0.00 0.00 3.53
6189 6604 1.972872 AACCACTGTGCTCTTCCAAG 58.027 50.000 1.29 0.00 0.00 3.61
6190 6605 0.839946 ACCACTGTGCTCTTCCAAGT 59.160 50.000 1.29 0.00 0.00 3.16
6191 6606 1.212935 ACCACTGTGCTCTTCCAAGTT 59.787 47.619 1.29 0.00 0.00 2.66
6192 6607 1.605710 CCACTGTGCTCTTCCAAGTTG 59.394 52.381 1.29 0.00 0.00 3.16
6193 6608 2.564771 CACTGTGCTCTTCCAAGTTGA 58.435 47.619 3.87 0.00 0.00 3.18
6194 6609 2.547211 CACTGTGCTCTTCCAAGTTGAG 59.453 50.000 3.87 0.00 0.00 3.02
6195 6610 2.171448 ACTGTGCTCTTCCAAGTTGAGT 59.829 45.455 3.87 0.00 0.00 3.41
6196 6611 2.805099 CTGTGCTCTTCCAAGTTGAGTC 59.195 50.000 3.87 0.00 0.00 3.36
6197 6612 2.170397 TGTGCTCTTCCAAGTTGAGTCA 59.830 45.455 3.87 0.00 0.00 3.41
6198 6613 2.545946 GTGCTCTTCCAAGTTGAGTCAC 59.454 50.000 3.87 4.64 32.51 3.67
6199 6614 2.435805 TGCTCTTCCAAGTTGAGTCACT 59.564 45.455 3.87 0.00 0.00 3.41
6200 6615 3.063485 GCTCTTCCAAGTTGAGTCACTC 58.937 50.000 3.87 0.00 0.00 3.51
6201 6616 3.493350 GCTCTTCCAAGTTGAGTCACTCA 60.493 47.826 2.36 2.36 38.87 3.41
6202 6617 4.054671 CTCTTCCAAGTTGAGTCACTCAC 58.945 47.826 7.12 3.09 40.46 3.51
6203 6618 2.910688 TCCAAGTTGAGTCACTCACC 57.089 50.000 7.12 0.00 40.46 4.02
6204 6619 2.398588 TCCAAGTTGAGTCACTCACCT 58.601 47.619 7.12 2.11 40.46 4.00
6205 6620 2.365617 TCCAAGTTGAGTCACTCACCTC 59.634 50.000 7.12 1.31 40.46 3.85
6206 6621 2.548920 CCAAGTTGAGTCACTCACCTCC 60.549 54.545 7.12 0.00 40.46 4.30
6207 6622 0.962489 AGTTGAGTCACTCACCTCCG 59.038 55.000 7.12 0.00 40.46 4.63
6208 6623 0.674534 GTTGAGTCACTCACCTCCGT 59.325 55.000 7.12 0.00 40.46 4.69
6209 6624 0.959553 TTGAGTCACTCACCTCCGTC 59.040 55.000 7.12 0.00 40.46 4.79
6210 6625 0.894184 TGAGTCACTCACCTCCGTCC 60.894 60.000 2.36 0.00 35.39 4.79
6211 6626 0.609681 GAGTCACTCACCTCCGTCCT 60.610 60.000 0.00 0.00 0.00 3.85
6212 6627 0.609681 AGTCACTCACCTCCGTCCTC 60.610 60.000 0.00 0.00 0.00 3.71
6213 6628 0.609681 GTCACTCACCTCCGTCCTCT 60.610 60.000 0.00 0.00 0.00 3.69
6214 6629 0.322636 TCACTCACCTCCGTCCTCTC 60.323 60.000 0.00 0.00 0.00 3.20
6215 6630 0.322997 CACTCACCTCCGTCCTCTCT 60.323 60.000 0.00 0.00 0.00 3.10
6216 6631 0.406361 ACTCACCTCCGTCCTCTCTT 59.594 55.000 0.00 0.00 0.00 2.85
6217 6632 1.099689 CTCACCTCCGTCCTCTCTTC 58.900 60.000 0.00 0.00 0.00 2.87
6218 6633 0.323542 TCACCTCCGTCCTCTCTTCC 60.324 60.000 0.00 0.00 0.00 3.46
6219 6634 1.000612 ACCTCCGTCCTCTCTTCCC 59.999 63.158 0.00 0.00 0.00 3.97
6220 6635 1.758906 CCTCCGTCCTCTCTTCCCC 60.759 68.421 0.00 0.00 0.00 4.81
6221 6636 1.000486 CTCCGTCCTCTCTTCCCCA 60.000 63.158 0.00 0.00 0.00 4.96
6222 6637 0.614979 CTCCGTCCTCTCTTCCCCAA 60.615 60.000 0.00 0.00 0.00 4.12
6223 6638 0.903454 TCCGTCCTCTCTTCCCCAAC 60.903 60.000 0.00 0.00 0.00 3.77
6224 6639 1.597461 CGTCCTCTCTTCCCCAACC 59.403 63.158 0.00 0.00 0.00 3.77
6225 6640 1.900545 CGTCCTCTCTTCCCCAACCC 61.901 65.000 0.00 0.00 0.00 4.11
6226 6641 1.229853 TCCTCTCTTCCCCAACCCC 60.230 63.158 0.00 0.00 0.00 4.95
6227 6642 2.670148 CCTCTCTTCCCCAACCCCG 61.670 68.421 0.00 0.00 0.00 5.73
6228 6643 2.609610 TCTCTTCCCCAACCCCGG 60.610 66.667 0.00 0.00 0.00 5.73
6229 6644 4.426313 CTCTTCCCCAACCCCGGC 62.426 72.222 0.00 0.00 0.00 6.13
6230 6645 4.995058 TCTTCCCCAACCCCGGCT 62.995 66.667 0.00 0.00 0.00 5.52
6231 6646 3.979497 CTTCCCCAACCCCGGCTT 61.979 66.667 0.00 0.00 0.00 4.35
6232 6647 3.938637 CTTCCCCAACCCCGGCTTC 62.939 68.421 0.00 0.00 0.00 3.86
6271 6686 4.222847 GGATCCACCCGAGCGGTC 62.223 72.222 6.95 4.06 43.58 4.79
6272 6687 3.458163 GATCCACCCGAGCGGTCA 61.458 66.667 15.89 0.00 43.58 4.02
6273 6688 3.432051 GATCCACCCGAGCGGTCAG 62.432 68.421 15.89 7.76 43.58 3.51
6274 6689 3.957435 ATCCACCCGAGCGGTCAGA 62.957 63.158 15.89 3.28 43.58 3.27
6275 6690 3.461773 CCACCCGAGCGGTCAGAT 61.462 66.667 15.89 0.00 43.58 2.90
6276 6691 2.105128 CACCCGAGCGGTCAGATC 59.895 66.667 15.89 0.00 43.58 2.75
6277 6692 3.148279 ACCCGAGCGGTCAGATCC 61.148 66.667 15.89 0.00 43.58 3.36
6284 6699 3.147595 CGGTCAGATCCGCCCTCA 61.148 66.667 0.00 0.00 43.96 3.86
6285 6700 2.501610 GGTCAGATCCGCCCTCAC 59.498 66.667 0.00 0.00 0.00 3.51
6286 6701 2.060980 GGTCAGATCCGCCCTCACT 61.061 63.158 0.00 0.00 0.00 3.41
6287 6702 1.439644 GTCAGATCCGCCCTCACTC 59.560 63.158 0.00 0.00 0.00 3.51
6288 6703 1.758514 TCAGATCCGCCCTCACTCC 60.759 63.158 0.00 0.00 0.00 3.85
6289 6704 2.444895 AGATCCGCCCTCACTCCC 60.445 66.667 0.00 0.00 0.00 4.30
6290 6705 2.444895 GATCCGCCCTCACTCCCT 60.445 66.667 0.00 0.00 0.00 4.20
6291 6706 2.444895 ATCCGCCCTCACTCCCTC 60.445 66.667 0.00 0.00 0.00 4.30
6292 6707 4.779733 TCCGCCCTCACTCCCTCC 62.780 72.222 0.00 0.00 0.00 4.30
6294 6709 4.787280 CGCCCTCACTCCCTCCCT 62.787 72.222 0.00 0.00 0.00 4.20
6295 6710 2.766229 GCCCTCACTCCCTCCCTC 60.766 72.222 0.00 0.00 0.00 4.30
6296 6711 2.041405 CCCTCACTCCCTCCCTCC 60.041 72.222 0.00 0.00 0.00 4.30
6297 6712 2.041405 CCTCACTCCCTCCCTCCC 60.041 72.222 0.00 0.00 0.00 4.30
6298 6713 2.641746 CCTCACTCCCTCCCTCCCT 61.642 68.421 0.00 0.00 0.00 4.20
6299 6714 1.075600 CTCACTCCCTCCCTCCCTC 60.076 68.421 0.00 0.00 0.00 4.30
6300 6715 2.041405 CACTCCCTCCCTCCCTCC 60.041 72.222 0.00 0.00 0.00 4.30
6301 6716 3.369388 ACTCCCTCCCTCCCTCCC 61.369 72.222 0.00 0.00 0.00 4.30
6302 6717 3.039526 CTCCCTCCCTCCCTCCCT 61.040 72.222 0.00 0.00 0.00 4.20
6303 6718 3.036959 TCCCTCCCTCCCTCCCTC 61.037 72.222 0.00 0.00 0.00 4.30
6304 6719 4.179599 CCCTCCCTCCCTCCCTCC 62.180 77.778 0.00 0.00 0.00 4.30
6305 6720 4.179599 CCTCCCTCCCTCCCTCCC 62.180 77.778 0.00 0.00 0.00 4.30
6306 6721 3.039526 CTCCCTCCCTCCCTCCCT 61.040 72.222 0.00 0.00 0.00 4.20
6307 6722 3.036959 TCCCTCCCTCCCTCCCTC 61.037 72.222 0.00 0.00 0.00 4.30
6308 6723 4.179599 CCCTCCCTCCCTCCCTCC 62.180 77.778 0.00 0.00 0.00 4.30
6309 6724 4.179599 CCTCCCTCCCTCCCTCCC 62.180 77.778 0.00 0.00 0.00 4.30
6310 6725 3.039526 CTCCCTCCCTCCCTCCCT 61.040 72.222 0.00 0.00 0.00 4.20
6311 6726 3.036959 TCCCTCCCTCCCTCCCTC 61.037 72.222 0.00 0.00 0.00 4.30
6312 6727 4.179599 CCCTCCCTCCCTCCCTCC 62.180 77.778 0.00 0.00 0.00 4.30
6313 6728 3.039526 CCTCCCTCCCTCCCTCCT 61.040 72.222 0.00 0.00 0.00 3.69
6314 6729 2.612251 CTCCCTCCCTCCCTCCTC 59.388 72.222 0.00 0.00 0.00 3.71
6315 6730 3.430497 TCCCTCCCTCCCTCCTCG 61.430 72.222 0.00 0.00 0.00 4.63
6324 6739 4.082523 CCCTCCTCGCGCTGGAAA 62.083 66.667 18.48 1.73 32.61 3.13
6325 6740 2.815647 CCTCCTCGCGCTGGAAAC 60.816 66.667 18.48 0.00 32.61 2.78
6326 6741 2.815647 CTCCTCGCGCTGGAAACC 60.816 66.667 18.48 0.00 32.61 3.27
6327 6742 4.388499 TCCTCGCGCTGGAAACCC 62.388 66.667 16.30 0.00 0.00 4.11
6328 6743 4.394712 CCTCGCGCTGGAAACCCT 62.395 66.667 5.56 0.00 0.00 4.34
6329 6744 2.577059 CTCGCGCTGGAAACCCTA 59.423 61.111 5.56 0.00 0.00 3.53
6330 6745 1.519455 CTCGCGCTGGAAACCCTAG 60.519 63.158 5.56 0.00 0.00 3.02
6331 6746 1.945354 CTCGCGCTGGAAACCCTAGA 61.945 60.000 5.56 0.00 0.00 2.43
6332 6747 1.810030 CGCGCTGGAAACCCTAGAC 60.810 63.158 5.56 0.00 0.00 2.59
6333 6748 1.449778 GCGCTGGAAACCCTAGACC 60.450 63.158 0.00 0.00 0.00 3.85
6334 6749 1.153628 CGCTGGAAACCCTAGACCG 60.154 63.158 0.00 0.00 0.00 4.79
6335 6750 1.449778 GCTGGAAACCCTAGACCGC 60.450 63.158 0.00 0.00 0.00 5.68
6336 6751 1.221021 CTGGAAACCCTAGACCGCC 59.779 63.158 0.00 0.00 0.00 6.13
6337 6752 2.253403 CTGGAAACCCTAGACCGCCC 62.253 65.000 0.00 0.00 0.00 6.13
6338 6753 2.186125 GAAACCCTAGACCGCCCG 59.814 66.667 0.00 0.00 0.00 6.13
6339 6754 3.381333 GAAACCCTAGACCGCCCGG 62.381 68.421 4.96 4.96 42.03 5.73
6344 6759 4.609018 CTAGACCGCCCGGCCATG 62.609 72.222 2.24 0.00 39.32 3.66
6357 6772 4.431131 CCATGGCGACCCAGGCTT 62.431 66.667 0.00 0.00 46.24 4.35
6358 6773 2.825836 CATGGCGACCCAGGCTTC 60.826 66.667 0.00 0.00 46.24 3.86
6359 6774 3.329889 ATGGCGACCCAGGCTTCA 61.330 61.111 0.00 0.00 46.24 3.02
6360 6775 3.628646 ATGGCGACCCAGGCTTCAC 62.629 63.158 0.00 0.00 46.24 3.18
6361 6776 4.021925 GGCGACCCAGGCTTCACT 62.022 66.667 0.00 0.00 0.00 3.41
6362 6777 2.032681 GCGACCCAGGCTTCACTT 59.967 61.111 0.00 0.00 0.00 3.16
6363 6778 2.035442 GCGACCCAGGCTTCACTTC 61.035 63.158 0.00 0.00 0.00 3.01
6364 6779 1.376037 CGACCCAGGCTTCACTTCC 60.376 63.158 0.00 0.00 0.00 3.46
6365 6780 1.761174 GACCCAGGCTTCACTTCCA 59.239 57.895 0.00 0.00 0.00 3.53
6366 6781 0.606673 GACCCAGGCTTCACTTCCAC 60.607 60.000 0.00 0.00 0.00 4.02
6367 6782 1.672356 CCCAGGCTTCACTTCCACG 60.672 63.158 0.00 0.00 0.00 4.94
6368 6783 1.371183 CCAGGCTTCACTTCCACGA 59.629 57.895 0.00 0.00 0.00 4.35
6369 6784 0.671781 CCAGGCTTCACTTCCACGAG 60.672 60.000 0.00 0.00 0.00 4.18
6370 6785 0.318441 CAGGCTTCACTTCCACGAGA 59.682 55.000 0.00 0.00 0.00 4.04
6371 6786 0.605589 AGGCTTCACTTCCACGAGAG 59.394 55.000 0.00 0.00 0.00 3.20
6372 6787 0.603569 GGCTTCACTTCCACGAGAGA 59.396 55.000 0.00 0.00 0.00 3.10
6373 6788 1.205893 GGCTTCACTTCCACGAGAGAT 59.794 52.381 0.00 0.00 0.00 2.75
6374 6789 2.535331 GCTTCACTTCCACGAGAGATC 58.465 52.381 0.00 0.00 0.00 2.75
6375 6790 2.165437 GCTTCACTTCCACGAGAGATCT 59.835 50.000 0.00 0.00 0.00 2.75
6376 6791 3.768406 CTTCACTTCCACGAGAGATCTG 58.232 50.000 0.00 0.00 0.00 2.90
6377 6792 1.474478 TCACTTCCACGAGAGATCTGC 59.526 52.381 0.00 0.00 0.00 4.26
6378 6793 1.476085 CACTTCCACGAGAGATCTGCT 59.524 52.381 0.00 0.00 0.00 4.24
6379 6794 1.476085 ACTTCCACGAGAGATCTGCTG 59.524 52.381 0.00 0.00 0.00 4.41
6380 6795 0.174389 TTCCACGAGAGATCTGCTGC 59.826 55.000 0.00 0.00 0.00 5.25
6381 6796 0.682532 TCCACGAGAGATCTGCTGCT 60.683 55.000 0.00 0.00 0.00 4.24
6382 6797 0.248990 CCACGAGAGATCTGCTGCTC 60.249 60.000 0.00 0.00 0.00 4.26
6383 6798 0.248990 CACGAGAGATCTGCTGCTCC 60.249 60.000 0.00 0.00 0.00 4.70
6384 6799 1.363443 CGAGAGATCTGCTGCTCCC 59.637 63.158 0.00 0.00 0.00 4.30
6385 6800 1.108727 CGAGAGATCTGCTGCTCCCT 61.109 60.000 0.00 0.00 0.00 4.20
6386 6801 0.675633 GAGAGATCTGCTGCTCCCTC 59.324 60.000 0.00 0.00 0.00 4.30
6387 6802 0.760189 AGAGATCTGCTGCTCCCTCC 60.760 60.000 0.00 0.00 0.00 4.30
6388 6803 0.760189 GAGATCTGCTGCTCCCTCCT 60.760 60.000 0.00 0.00 0.00 3.69
6389 6804 0.760189 AGATCTGCTGCTCCCTCCTC 60.760 60.000 0.00 0.00 0.00 3.71
6390 6805 1.757423 GATCTGCTGCTCCCTCCTCC 61.757 65.000 0.00 0.00 0.00 4.30
6391 6806 2.254773 ATCTGCTGCTCCCTCCTCCT 62.255 60.000 0.00 0.00 0.00 3.69
6392 6807 2.364842 TGCTGCTCCCTCCTCCTC 60.365 66.667 0.00 0.00 0.00 3.71
6393 6808 3.160748 GCTGCTCCCTCCTCCTCC 61.161 72.222 0.00 0.00 0.00 4.30
6394 6809 2.695597 CTGCTCCCTCCTCCTCCT 59.304 66.667 0.00 0.00 0.00 3.69
6395 6810 1.457455 CTGCTCCCTCCTCCTCCTC 60.457 68.421 0.00 0.00 0.00 3.71
6396 6811 2.123033 GCTCCCTCCTCCTCCTCC 60.123 72.222 0.00 0.00 0.00 4.30
6397 6812 2.710826 GCTCCCTCCTCCTCCTCCT 61.711 68.421 0.00 0.00 0.00 3.69
6398 6813 1.541672 CTCCCTCCTCCTCCTCCTC 59.458 68.421 0.00 0.00 0.00 3.71
6399 6814 2.015726 TCCCTCCTCCTCCTCCTCC 61.016 68.421 0.00 0.00 0.00 4.30
6400 6815 2.018086 CCCTCCTCCTCCTCCTCCT 61.018 68.421 0.00 0.00 0.00 3.69
6401 6816 1.541672 CCTCCTCCTCCTCCTCCTC 59.458 68.421 0.00 0.00 0.00 3.71
6402 6817 1.541672 CTCCTCCTCCTCCTCCTCC 59.458 68.421 0.00 0.00 0.00 4.30
6403 6818 0.998945 CTCCTCCTCCTCCTCCTCCT 60.999 65.000 0.00 0.00 0.00 3.69
6404 6819 0.996762 TCCTCCTCCTCCTCCTCCTC 60.997 65.000 0.00 0.00 0.00 3.71
6405 6820 1.541672 CTCCTCCTCCTCCTCCTCC 59.458 68.421 0.00 0.00 0.00 4.30
6406 6821 1.230650 TCCTCCTCCTCCTCCTCCA 60.231 63.158 0.00 0.00 0.00 3.86
6407 6822 0.855855 TCCTCCTCCTCCTCCTCCAA 60.856 60.000 0.00 0.00 0.00 3.53
6408 6823 0.689412 CCTCCTCCTCCTCCTCCAAC 60.689 65.000 0.00 0.00 0.00 3.77
6409 6824 1.000486 TCCTCCTCCTCCTCCAACG 60.000 63.158 0.00 0.00 0.00 4.10
6410 6825 2.060980 CCTCCTCCTCCTCCAACGG 61.061 68.421 0.00 0.00 0.00 4.44
6411 6826 1.305381 CTCCTCCTCCTCCAACGGT 60.305 63.158 0.00 0.00 0.00 4.83
6412 6827 1.608717 CTCCTCCTCCTCCAACGGTG 61.609 65.000 0.00 0.00 0.00 4.94
6414 6829 1.913762 CTCCTCCTCCAACGGTGGT 60.914 63.158 21.31 0.00 46.11 4.16
6415 6830 1.889530 CTCCTCCTCCAACGGTGGTC 61.890 65.000 21.31 0.00 46.11 4.02
6416 6831 1.913762 CCTCCTCCAACGGTGGTCT 60.914 63.158 21.31 0.00 46.11 3.85
6417 6832 1.481056 CCTCCTCCAACGGTGGTCTT 61.481 60.000 21.31 0.00 46.11 3.01
6418 6833 0.037232 CTCCTCCAACGGTGGTCTTC 60.037 60.000 21.31 0.00 46.11 2.87
6419 6834 0.471211 TCCTCCAACGGTGGTCTTCT 60.471 55.000 21.31 0.00 46.11 2.85
6420 6835 0.396811 CCTCCAACGGTGGTCTTCTT 59.603 55.000 21.31 0.00 46.11 2.52
6421 6836 1.608283 CCTCCAACGGTGGTCTTCTTC 60.608 57.143 21.31 0.00 46.11 2.87
6422 6837 1.344763 CTCCAACGGTGGTCTTCTTCT 59.655 52.381 21.31 0.00 46.11 2.85
6423 6838 1.766496 TCCAACGGTGGTCTTCTTCTT 59.234 47.619 21.31 0.00 46.11 2.52
6424 6839 2.143925 CCAACGGTGGTCTTCTTCTTC 58.856 52.381 12.69 0.00 40.42 2.87
6425 6840 2.224305 CCAACGGTGGTCTTCTTCTTCT 60.224 50.000 12.69 0.00 40.42 2.85
6426 6841 3.467803 CAACGGTGGTCTTCTTCTTCTT 58.532 45.455 0.00 0.00 0.00 2.52
6427 6842 3.388345 ACGGTGGTCTTCTTCTTCTTC 57.612 47.619 0.00 0.00 0.00 2.87
6428 6843 2.966516 ACGGTGGTCTTCTTCTTCTTCT 59.033 45.455 0.00 0.00 0.00 2.85
6429 6844 3.388350 ACGGTGGTCTTCTTCTTCTTCTT 59.612 43.478 0.00 0.00 0.00 2.52
6430 6845 3.991121 CGGTGGTCTTCTTCTTCTTCTTC 59.009 47.826 0.00 0.00 0.00 2.87
6431 6846 4.320023 GGTGGTCTTCTTCTTCTTCTTCC 58.680 47.826 0.00 0.00 0.00 3.46
6432 6847 4.320023 GTGGTCTTCTTCTTCTTCTTCCC 58.680 47.826 0.00 0.00 0.00 3.97
6433 6848 4.041075 GTGGTCTTCTTCTTCTTCTTCCCT 59.959 45.833 0.00 0.00 0.00 4.20
6434 6849 4.284746 TGGTCTTCTTCTTCTTCTTCCCTC 59.715 45.833 0.00 0.00 0.00 4.30
6435 6850 4.530553 GGTCTTCTTCTTCTTCTTCCCTCT 59.469 45.833 0.00 0.00 0.00 3.69
6436 6851 5.337250 GGTCTTCTTCTTCTTCTTCCCTCTC 60.337 48.000 0.00 0.00 0.00 3.20
6437 6852 5.480422 GTCTTCTTCTTCTTCTTCCCTCTCT 59.520 44.000 0.00 0.00 0.00 3.10
6438 6853 5.714806 TCTTCTTCTTCTTCTTCCCTCTCTC 59.285 44.000 0.00 0.00 0.00 3.20
6439 6854 5.269554 TCTTCTTCTTCTTCCCTCTCTCT 57.730 43.478 0.00 0.00 0.00 3.10
6440 6855 5.016173 TCTTCTTCTTCTTCCCTCTCTCTG 58.984 45.833 0.00 0.00 0.00 3.35
6441 6856 4.666412 TCTTCTTCTTCCCTCTCTCTGA 57.334 45.455 0.00 0.00 0.00 3.27
6442 6857 4.340617 TCTTCTTCTTCCCTCTCTCTGAC 58.659 47.826 0.00 0.00 0.00 3.51
6443 6858 3.094484 TCTTCTTCCCTCTCTCTGACC 57.906 52.381 0.00 0.00 0.00 4.02
6444 6859 2.107366 CTTCTTCCCTCTCTCTGACCC 58.893 57.143 0.00 0.00 0.00 4.46
6445 6860 0.336737 TCTTCCCTCTCTCTGACCCC 59.663 60.000 0.00 0.00 0.00 4.95
6446 6861 0.338120 CTTCCCTCTCTCTGACCCCT 59.662 60.000 0.00 0.00 0.00 4.79
6447 6862 0.041833 TTCCCTCTCTCTGACCCCTG 59.958 60.000 0.00 0.00 0.00 4.45
6448 6863 1.149782 TCCCTCTCTCTGACCCCTGT 61.150 60.000 0.00 0.00 0.00 4.00
6449 6864 0.686112 CCCTCTCTCTGACCCCTGTC 60.686 65.000 0.00 0.00 42.12 3.51
6450 6865 1.034838 CCTCTCTCTGACCCCTGTCG 61.035 65.000 0.00 0.00 44.86 4.35
6451 6866 1.662438 CTCTCTCTGACCCCTGTCGC 61.662 65.000 0.00 0.00 44.86 5.19
6452 6867 3.057547 CTCTCTGACCCCTGTCGCG 62.058 68.421 0.00 0.00 44.86 5.87
6453 6868 3.374402 CTCTGACCCCTGTCGCGT 61.374 66.667 5.77 0.00 44.86 6.01
6454 6869 3.343788 CTCTGACCCCTGTCGCGTC 62.344 68.421 5.77 0.00 44.86 5.19
6455 6870 3.374402 CTGACCCCTGTCGCGTCT 61.374 66.667 5.77 0.00 44.86 4.18
6456 6871 3.633094 CTGACCCCTGTCGCGTCTG 62.633 68.421 5.77 4.37 44.86 3.51
6457 6872 3.681835 GACCCCTGTCGCGTCTGT 61.682 66.667 5.77 0.00 0.00 3.41
6458 6873 3.628280 GACCCCTGTCGCGTCTGTC 62.628 68.421 5.77 3.29 0.00 3.51
6459 6874 3.374402 CCCCTGTCGCGTCTGTCT 61.374 66.667 5.77 0.00 0.00 3.41
6460 6875 2.126307 CCCTGTCGCGTCTGTCTG 60.126 66.667 5.77 0.00 0.00 3.51
6461 6876 2.645567 CCTGTCGCGTCTGTCTGT 59.354 61.111 5.77 0.00 0.00 3.41
6462 6877 1.730902 CCTGTCGCGTCTGTCTGTG 60.731 63.158 5.77 0.00 0.00 3.66
6463 6878 1.008424 CTGTCGCGTCTGTCTGTGT 60.008 57.895 5.77 0.00 0.00 3.72
6464 6879 0.237498 CTGTCGCGTCTGTCTGTGTA 59.763 55.000 5.77 0.00 0.00 2.90
6465 6880 0.237498 TGTCGCGTCTGTCTGTGTAG 59.763 55.000 5.77 0.00 0.00 2.74
6466 6881 0.454620 GTCGCGTCTGTCTGTGTAGG 60.455 60.000 5.77 0.00 0.00 3.18
6467 6882 0.887836 TCGCGTCTGTCTGTGTAGGT 60.888 55.000 5.77 0.00 0.00 3.08
6468 6883 0.800631 CGCGTCTGTCTGTGTAGGTA 59.199 55.000 0.00 0.00 0.00 3.08
6469 6884 1.202043 CGCGTCTGTCTGTGTAGGTAG 60.202 57.143 0.00 0.00 0.00 3.18
6470 6885 1.467713 GCGTCTGTCTGTGTAGGTAGC 60.468 57.143 0.00 0.00 0.00 3.58
6471 6886 2.085320 CGTCTGTCTGTGTAGGTAGCT 58.915 52.381 0.00 0.00 0.00 3.32
6472 6887 2.488545 CGTCTGTCTGTGTAGGTAGCTT 59.511 50.000 0.00 0.00 0.00 3.74
6473 6888 3.670895 CGTCTGTCTGTGTAGGTAGCTTG 60.671 52.174 0.00 0.00 0.00 4.01
6474 6889 3.506455 GTCTGTCTGTGTAGGTAGCTTGA 59.494 47.826 0.00 0.00 0.00 3.02
6475 6890 3.759086 TCTGTCTGTGTAGGTAGCTTGAG 59.241 47.826 0.00 0.00 0.00 3.02
6476 6891 2.826128 TGTCTGTGTAGGTAGCTTGAGG 59.174 50.000 0.00 0.00 0.00 3.86
6477 6892 2.166664 GTCTGTGTAGGTAGCTTGAGGG 59.833 54.545 0.00 0.00 0.00 4.30
6478 6893 0.902531 TGTGTAGGTAGCTTGAGGGC 59.097 55.000 0.00 0.00 0.00 5.19
6479 6894 0.902531 GTGTAGGTAGCTTGAGGGCA 59.097 55.000 0.00 0.00 34.17 5.36
6480 6895 1.134670 GTGTAGGTAGCTTGAGGGCAG 60.135 57.143 0.00 0.00 34.17 4.85
6481 6896 0.179070 GTAGGTAGCTTGAGGGCAGC 60.179 60.000 0.00 0.00 34.17 5.25
6482 6897 1.676678 TAGGTAGCTTGAGGGCAGCG 61.677 60.000 0.00 0.00 34.17 5.18
6483 6898 2.512515 GTAGCTTGAGGGCAGCGG 60.513 66.667 0.00 0.00 34.17 5.52
6484 6899 4.473520 TAGCTTGAGGGCAGCGGC 62.474 66.667 0.00 0.00 40.13 6.53
6514 6929 2.526304 GGCACCCAAAGAAAGGAAAC 57.474 50.000 0.00 0.00 0.00 2.78
6515 6930 1.070134 GGCACCCAAAGAAAGGAAACC 59.930 52.381 0.00 0.00 0.00 3.27
6516 6931 2.039418 GCACCCAAAGAAAGGAAACCT 58.961 47.619 0.00 0.00 33.87 3.50
6518 6933 3.492656 GCACCCAAAGAAAGGAAACCTTC 60.493 47.826 3.45 0.00 43.92 3.46
6519 6934 3.960755 CACCCAAAGAAAGGAAACCTTCT 59.039 43.478 3.45 1.16 43.92 2.85
6520 6935 4.038042 CACCCAAAGAAAGGAAACCTTCTC 59.962 45.833 3.45 4.61 43.92 2.87
6521 6936 3.574396 CCCAAAGAAAGGAAACCTTCTCC 59.426 47.826 3.45 0.00 43.92 3.71
6522 6937 3.253432 CCAAAGAAAGGAAACCTTCTCCG 59.747 47.826 3.45 0.09 43.92 4.63
6523 6938 2.186532 AGAAAGGAAACCTTCTCCGC 57.813 50.000 3.45 0.00 43.92 5.54
6524 6939 1.166129 GAAAGGAAACCTTCTCCGCC 58.834 55.000 3.45 0.00 43.92 6.13
6525 6940 0.605589 AAAGGAAACCTTCTCCGCCG 60.606 55.000 3.45 0.00 43.92 6.46
6526 6941 3.125573 GGAAACCTTCTCCGCCGC 61.126 66.667 0.00 0.00 0.00 6.53
6527 6942 2.047179 GAAACCTTCTCCGCCGCT 60.047 61.111 0.00 0.00 0.00 5.52
6528 6943 1.217244 GAAACCTTCTCCGCCGCTA 59.783 57.895 0.00 0.00 0.00 4.26
6529 6944 1.079336 AAACCTTCTCCGCCGCTAC 60.079 57.895 0.00 0.00 0.00 3.58
6530 6945 1.823169 AAACCTTCTCCGCCGCTACA 61.823 55.000 0.00 0.00 0.00 2.74
6531 6946 2.105128 CCTTCTCCGCCGCTACAG 59.895 66.667 0.00 0.00 0.00 2.74
6532 6947 2.415608 CCTTCTCCGCCGCTACAGA 61.416 63.158 0.00 0.00 0.00 3.41
6533 6948 1.064946 CTTCTCCGCCGCTACAGAG 59.935 63.158 0.00 0.00 0.00 3.35
6534 6949 2.343163 CTTCTCCGCCGCTACAGAGG 62.343 65.000 0.00 0.00 38.10 3.69
6535 6950 2.829003 CTCCGCCGCTACAGAGGA 60.829 66.667 2.88 0.00 37.14 3.71
6536 6951 2.829003 TCCGCCGCTACAGAGGAG 60.829 66.667 2.88 0.00 37.14 3.69
6537 6952 3.905678 CCGCCGCTACAGAGGAGG 61.906 72.222 7.35 7.35 46.60 4.30
6538 6953 2.829003 CGCCGCTACAGAGGAGGA 60.829 66.667 2.88 0.00 37.14 3.71
6539 6954 2.840066 CGCCGCTACAGAGGAGGAG 61.840 68.421 2.88 0.00 37.14 3.69
6540 6955 1.454111 GCCGCTACAGAGGAGGAGA 60.454 63.158 2.88 0.00 37.14 3.71
6541 6956 1.452145 GCCGCTACAGAGGAGGAGAG 61.452 65.000 2.88 0.00 37.14 3.20
6542 6957 0.821711 CCGCTACAGAGGAGGAGAGG 60.822 65.000 0.00 0.00 37.14 3.69
6543 6958 1.452145 CGCTACAGAGGAGGAGAGGC 61.452 65.000 0.00 0.00 0.00 4.70
6544 6959 0.106217 GCTACAGAGGAGGAGAGGCT 60.106 60.000 0.00 0.00 0.00 4.58
6545 6960 1.981256 CTACAGAGGAGGAGAGGCTC 58.019 60.000 6.34 6.34 0.00 4.70
6546 6961 0.181587 TACAGAGGAGGAGAGGCTCG 59.818 60.000 9.22 0.00 0.00 5.03
6547 6962 1.225983 CAGAGGAGGAGAGGCTCGA 59.774 63.158 9.22 0.00 0.00 4.04
6548 6963 0.395036 CAGAGGAGGAGAGGCTCGAA 60.395 60.000 9.22 0.00 0.00 3.71
6549 6964 0.106719 AGAGGAGGAGAGGCTCGAAG 60.107 60.000 9.22 0.00 0.00 3.79
6550 6965 1.076339 AGGAGGAGAGGCTCGAAGG 60.076 63.158 9.22 0.00 0.00 3.46
6551 6966 1.380650 GGAGGAGAGGCTCGAAGGT 60.381 63.158 9.22 0.00 0.00 3.50
6552 6967 0.106619 GGAGGAGAGGCTCGAAGGTA 60.107 60.000 9.22 0.00 0.00 3.08
6553 6968 1.479757 GGAGGAGAGGCTCGAAGGTAT 60.480 57.143 9.22 0.00 0.00 2.73
6554 6969 1.883926 GAGGAGAGGCTCGAAGGTATC 59.116 57.143 9.22 0.00 0.00 2.24
6555 6970 0.963225 GGAGAGGCTCGAAGGTATCC 59.037 60.000 9.22 4.88 0.00 2.59
6556 6971 1.479757 GGAGAGGCTCGAAGGTATCCT 60.480 57.143 9.22 0.00 33.87 3.24
6565 6980 3.676953 AAGGTATCCTTCCCCTCCC 57.323 57.895 0.00 0.00 40.17 4.30
6566 6981 0.728843 AAGGTATCCTTCCCCTCCCA 59.271 55.000 0.00 0.00 40.17 4.37
6567 6982 0.029989 AGGTATCCTTCCCCTCCCAC 60.030 60.000 0.00 0.00 0.00 4.61
6568 6983 0.029989 GGTATCCTTCCCCTCCCACT 60.030 60.000 0.00 0.00 0.00 4.00
6569 6984 1.425694 GTATCCTTCCCCTCCCACTC 58.574 60.000 0.00 0.00 0.00 3.51
6570 6985 0.267960 TATCCTTCCCCTCCCACTCC 59.732 60.000 0.00 0.00 0.00 3.85
6571 6986 1.837533 ATCCTTCCCCTCCCACTCCA 61.838 60.000 0.00 0.00 0.00 3.86
6572 6987 1.308216 CCTTCCCCTCCCACTCCAT 60.308 63.158 0.00 0.00 0.00 3.41
6573 6988 1.348775 CCTTCCCCTCCCACTCCATC 61.349 65.000 0.00 0.00 0.00 3.51
6574 6989 0.327000 CTTCCCCTCCCACTCCATCT 60.327 60.000 0.00 0.00 0.00 2.90
6575 6990 0.326618 TTCCCCTCCCACTCCATCTC 60.327 60.000 0.00 0.00 0.00 2.75
6576 6991 1.231751 TCCCCTCCCACTCCATCTCT 61.232 60.000 0.00 0.00 0.00 3.10
6577 6992 0.762461 CCCCTCCCACTCCATCTCTC 60.762 65.000 0.00 0.00 0.00 3.20
6578 6993 0.762461 CCCTCCCACTCCATCTCTCC 60.762 65.000 0.00 0.00 0.00 3.71
6579 6994 1.112315 CCTCCCACTCCATCTCTCCG 61.112 65.000 0.00 0.00 0.00 4.63
6580 6995 0.106469 CTCCCACTCCATCTCTCCGA 60.106 60.000 0.00 0.00 0.00 4.55
6581 6996 0.558220 TCCCACTCCATCTCTCCGAT 59.442 55.000 0.00 0.00 0.00 4.18
6582 6997 1.062886 TCCCACTCCATCTCTCCGATT 60.063 52.381 0.00 0.00 0.00 3.34
6583 6998 1.765314 CCCACTCCATCTCTCCGATTT 59.235 52.381 0.00 0.00 0.00 2.17
6584 6999 2.484417 CCCACTCCATCTCTCCGATTTG 60.484 54.545 0.00 0.00 0.00 2.32
6585 7000 2.432146 CCACTCCATCTCTCCGATTTGA 59.568 50.000 0.00 0.00 0.00 2.69
6586 7001 3.118629 CCACTCCATCTCTCCGATTTGAA 60.119 47.826 0.00 0.00 0.00 2.69
6587 7002 3.868077 CACTCCATCTCTCCGATTTGAAC 59.132 47.826 0.00 0.00 0.00 3.18
6588 7003 3.515502 ACTCCATCTCTCCGATTTGAACA 59.484 43.478 0.00 0.00 0.00 3.18
6589 7004 4.163078 ACTCCATCTCTCCGATTTGAACAT 59.837 41.667 0.00 0.00 0.00 2.71
6590 7005 4.445453 TCCATCTCTCCGATTTGAACATG 58.555 43.478 0.00 0.00 0.00 3.21
6591 7006 4.162131 TCCATCTCTCCGATTTGAACATGA 59.838 41.667 0.00 0.00 0.00 3.07
6592 7007 4.510711 CCATCTCTCCGATTTGAACATGAG 59.489 45.833 0.00 0.00 0.00 2.90
6593 7008 3.525537 TCTCTCCGATTTGAACATGAGC 58.474 45.455 0.00 0.00 0.00 4.26
6594 7009 3.055891 TCTCTCCGATTTGAACATGAGCA 60.056 43.478 0.00 0.00 0.00 4.26
6595 7010 3.875727 CTCTCCGATTTGAACATGAGCAT 59.124 43.478 0.00 0.00 0.00 3.79
6596 7011 3.873361 TCTCCGATTTGAACATGAGCATC 59.127 43.478 0.00 0.00 0.00 3.91
6607 7022 3.179925 TGAGCATCATCAGCCAACC 57.820 52.632 0.00 0.00 42.56 3.77
6608 7023 0.328926 TGAGCATCATCAGCCAACCA 59.671 50.000 0.00 0.00 42.56 3.67
6609 7024 1.272037 TGAGCATCATCAGCCAACCAA 60.272 47.619 0.00 0.00 42.56 3.67
6610 7025 1.133790 GAGCATCATCAGCCAACCAAC 59.866 52.381 0.00 0.00 33.17 3.77
6611 7026 0.889994 GCATCATCAGCCAACCAACA 59.110 50.000 0.00 0.00 0.00 3.33
6612 7027 1.479323 GCATCATCAGCCAACCAACAT 59.521 47.619 0.00 0.00 0.00 2.71
6613 7028 2.093869 GCATCATCAGCCAACCAACATT 60.094 45.455 0.00 0.00 0.00 2.71
6614 7029 3.777478 CATCATCAGCCAACCAACATTC 58.223 45.455 0.00 0.00 0.00 2.67
6615 7030 3.159213 TCATCAGCCAACCAACATTCT 57.841 42.857 0.00 0.00 0.00 2.40
6616 7031 2.821378 TCATCAGCCAACCAACATTCTG 59.179 45.455 0.00 0.00 0.00 3.02
6617 7032 1.619654 TCAGCCAACCAACATTCTGG 58.380 50.000 0.00 0.00 42.68 3.86
6618 7033 4.994744 GCCAACCAACATTCTGGC 57.005 55.556 0.00 0.00 46.95 4.85
6620 7035 1.586028 CCAACCAACATTCTGGCCG 59.414 57.895 0.00 0.00 40.45 6.13
6621 7036 1.586028 CAACCAACATTCTGGCCGG 59.414 57.895 4.71 4.71 40.45 6.13
6622 7037 2.275380 AACCAACATTCTGGCCGGC 61.275 57.895 21.18 21.18 40.45 6.13
6623 7038 2.361610 CCAACATTCTGGCCGGCT 60.362 61.111 28.56 1.80 0.00 5.52
6624 7039 1.978617 CCAACATTCTGGCCGGCTT 60.979 57.895 28.56 7.85 0.00 4.35
6625 7040 1.535204 CCAACATTCTGGCCGGCTTT 61.535 55.000 28.56 3.70 0.00 3.51
6626 7041 0.318120 CAACATTCTGGCCGGCTTTT 59.682 50.000 28.56 1.69 0.00 2.27
6627 7042 0.603065 AACATTCTGGCCGGCTTTTC 59.397 50.000 28.56 10.32 0.00 2.29
6628 7043 0.251341 ACATTCTGGCCGGCTTTTCT 60.251 50.000 28.56 5.92 0.00 2.52
6629 7044 0.890683 CATTCTGGCCGGCTTTTCTT 59.109 50.000 28.56 4.32 0.00 2.52
6630 7045 1.135286 CATTCTGGCCGGCTTTTCTTC 60.135 52.381 28.56 8.18 0.00 2.87
6631 7046 0.110486 TTCTGGCCGGCTTTTCTTCT 59.890 50.000 28.56 0.00 0.00 2.85
6632 7047 0.321653 TCTGGCCGGCTTTTCTTCTC 60.322 55.000 28.56 6.48 0.00 2.87
6633 7048 1.303317 TGGCCGGCTTTTCTTCTCC 60.303 57.895 28.56 5.64 0.00 3.71
6634 7049 1.002011 GGCCGGCTTTTCTTCTCCT 60.002 57.895 28.56 0.00 0.00 3.69
6635 7050 1.308783 GGCCGGCTTTTCTTCTCCTG 61.309 60.000 28.56 0.00 0.00 3.86
6636 7051 1.308783 GCCGGCTTTTCTTCTCCTGG 61.309 60.000 22.15 0.00 0.00 4.45
6637 7052 0.324943 CCGGCTTTTCTTCTCCTGGA 59.675 55.000 0.00 0.00 0.00 3.86
6638 7053 1.065126 CCGGCTTTTCTTCTCCTGGAT 60.065 52.381 0.00 0.00 0.00 3.41
6639 7054 2.284190 CGGCTTTTCTTCTCCTGGATC 58.716 52.381 0.00 0.00 0.00 3.36
6640 7055 2.649190 GGCTTTTCTTCTCCTGGATCC 58.351 52.381 4.20 4.20 0.00 3.36
6641 7056 2.649190 GCTTTTCTTCTCCTGGATCCC 58.351 52.381 9.90 0.00 0.00 3.85
6642 7057 2.685224 GCTTTTCTTCTCCTGGATCCCC 60.685 54.545 9.90 0.00 0.00 4.81
6643 7058 2.359376 TTTCTTCTCCTGGATCCCCA 57.641 50.000 9.90 0.00 40.95 4.96
6644 7059 2.594536 TTCTTCTCCTGGATCCCCAT 57.405 50.000 9.90 0.00 42.59 4.00
6645 7060 2.109229 TCTTCTCCTGGATCCCCATC 57.891 55.000 9.90 0.00 42.59 3.51
6646 7061 1.582624 TCTTCTCCTGGATCCCCATCT 59.417 52.381 9.90 0.00 42.59 2.90
6647 7062 1.698532 CTTCTCCTGGATCCCCATCTG 59.301 57.143 9.90 0.00 42.59 2.90
6648 7063 0.944238 TCTCCTGGATCCCCATCTGA 59.056 55.000 9.90 0.00 42.59 3.27
6649 7064 1.511299 TCTCCTGGATCCCCATCTGAT 59.489 52.381 9.90 0.00 42.59 2.90
6650 7065 1.629353 CTCCTGGATCCCCATCTGATG 59.371 57.143 9.90 10.71 42.59 3.07
6651 7066 1.061111 TCCTGGATCCCCATCTGATGT 60.061 52.381 15.95 0.00 42.59 3.06
6652 7067 1.073444 CCTGGATCCCCATCTGATGTG 59.927 57.143 15.95 5.04 42.59 3.21
6653 7068 0.475475 TGGATCCCCATCTGATGTGC 59.525 55.000 15.95 4.04 37.58 4.57
6654 7069 0.604780 GGATCCCCATCTGATGTGCG 60.605 60.000 15.95 3.67 0.00 5.34
6655 7070 0.604780 GATCCCCATCTGATGTGCGG 60.605 60.000 15.95 11.84 0.00 5.69
6656 7071 1.348008 ATCCCCATCTGATGTGCGGT 61.348 55.000 15.95 0.00 0.00 5.68
6657 7072 1.077501 CCCCATCTGATGTGCGGTT 60.078 57.895 15.95 0.00 0.00 4.44
6658 7073 0.680921 CCCCATCTGATGTGCGGTTT 60.681 55.000 15.95 0.00 0.00 3.27
6659 7074 0.452987 CCCATCTGATGTGCGGTTTG 59.547 55.000 15.95 0.00 0.00 2.93
6660 7075 0.452987 CCATCTGATGTGCGGTTTGG 59.547 55.000 15.95 0.00 0.00 3.28
6661 7076 0.452987 CATCTGATGTGCGGTTTGGG 59.547 55.000 9.50 0.00 0.00 4.12
6662 7077 0.327924 ATCTGATGTGCGGTTTGGGA 59.672 50.000 0.00 0.00 0.00 4.37
6663 7078 0.327924 TCTGATGTGCGGTTTGGGAT 59.672 50.000 0.00 0.00 0.00 3.85
6664 7079 1.176527 CTGATGTGCGGTTTGGGATT 58.823 50.000 0.00 0.00 0.00 3.01
6665 7080 1.133025 CTGATGTGCGGTTTGGGATTC 59.867 52.381 0.00 0.00 0.00 2.52
6666 7081 1.271871 TGATGTGCGGTTTGGGATTCT 60.272 47.619 0.00 0.00 0.00 2.40
6667 7082 1.818674 GATGTGCGGTTTGGGATTCTT 59.181 47.619 0.00 0.00 0.00 2.52
6668 7083 1.243902 TGTGCGGTTTGGGATTCTTC 58.756 50.000 0.00 0.00 0.00 2.87
6669 7084 0.526211 GTGCGGTTTGGGATTCTTCC 59.474 55.000 0.00 0.00 41.77 3.46
6670 7085 0.404040 TGCGGTTTGGGATTCTTCCT 59.596 50.000 0.00 0.00 42.20 3.36
6671 7086 1.203001 TGCGGTTTGGGATTCTTCCTT 60.203 47.619 0.00 0.00 42.20 3.36
6672 7087 1.202348 GCGGTTTGGGATTCTTCCTTG 59.798 52.381 0.00 0.00 42.20 3.61
6673 7088 1.202348 CGGTTTGGGATTCTTCCTTGC 59.798 52.381 0.00 0.00 42.20 4.01
6674 7089 1.550524 GGTTTGGGATTCTTCCTTGCC 59.449 52.381 0.00 0.00 42.20 4.52
6675 7090 2.529632 GTTTGGGATTCTTCCTTGCCT 58.470 47.619 0.00 0.00 42.20 4.75
6676 7091 2.899900 GTTTGGGATTCTTCCTTGCCTT 59.100 45.455 0.00 0.00 42.20 4.35
6677 7092 2.514458 TGGGATTCTTCCTTGCCTTC 57.486 50.000 0.00 0.00 42.20 3.46
6678 7093 1.995542 TGGGATTCTTCCTTGCCTTCT 59.004 47.619 0.00 0.00 42.20 2.85
6679 7094 2.379907 TGGGATTCTTCCTTGCCTTCTT 59.620 45.455 0.00 0.00 42.20 2.52
6680 7095 3.020274 GGGATTCTTCCTTGCCTTCTTC 58.980 50.000 0.00 0.00 42.20 2.87
6681 7096 3.562176 GGGATTCTTCCTTGCCTTCTTCA 60.562 47.826 0.00 0.00 42.20 3.02
6682 7097 3.441922 GGATTCTTCCTTGCCTTCTTCAC 59.558 47.826 0.00 0.00 39.14 3.18
6683 7098 2.568623 TCTTCCTTGCCTTCTTCACC 57.431 50.000 0.00 0.00 0.00 4.02
6684 7099 1.774254 TCTTCCTTGCCTTCTTCACCA 59.226 47.619 0.00 0.00 0.00 4.17
6685 7100 1.882623 CTTCCTTGCCTTCTTCACCAC 59.117 52.381 0.00 0.00 0.00 4.16
6686 7101 0.110486 TCCTTGCCTTCTTCACCACC 59.890 55.000 0.00 0.00 0.00 4.61
6687 7102 0.178992 CCTTGCCTTCTTCACCACCA 60.179 55.000 0.00 0.00 0.00 4.17
6688 7103 1.548582 CCTTGCCTTCTTCACCACCAT 60.549 52.381 0.00 0.00 0.00 3.55
6689 7104 1.815003 CTTGCCTTCTTCACCACCATC 59.185 52.381 0.00 0.00 0.00 3.51
6690 7105 1.067295 TGCCTTCTTCACCACCATCT 58.933 50.000 0.00 0.00 0.00 2.90
6691 7106 1.003580 TGCCTTCTTCACCACCATCTC 59.996 52.381 0.00 0.00 0.00 2.75
6692 7107 1.680249 GCCTTCTTCACCACCATCTCC 60.680 57.143 0.00 0.00 0.00 3.71
6693 7108 1.912043 CCTTCTTCACCACCATCTCCT 59.088 52.381 0.00 0.00 0.00 3.69
6694 7109 2.093235 CCTTCTTCACCACCATCTCCTC 60.093 54.545 0.00 0.00 0.00 3.71
6695 7110 1.573108 TCTTCACCACCATCTCCTCC 58.427 55.000 0.00 0.00 0.00 4.30
6696 7111 1.079490 TCTTCACCACCATCTCCTCCT 59.921 52.381 0.00 0.00 0.00 3.69
6697 7112 1.484240 CTTCACCACCATCTCCTCCTC 59.516 57.143 0.00 0.00 0.00 3.71
6698 7113 0.325671 TCACCACCATCTCCTCCTCC 60.326 60.000 0.00 0.00 0.00 4.30
6699 7114 1.003573 ACCACCATCTCCTCCTCCC 59.996 63.158 0.00 0.00 0.00 4.30
6700 7115 1.768077 CCACCATCTCCTCCTCCCC 60.768 68.421 0.00 0.00 0.00 4.81
6701 7116 1.003442 CACCATCTCCTCCTCCCCA 59.997 63.158 0.00 0.00 0.00 4.96
6702 7117 0.621571 CACCATCTCCTCCTCCCCAA 60.622 60.000 0.00 0.00 0.00 4.12
6703 7118 0.327000 ACCATCTCCTCCTCCCCAAG 60.327 60.000 0.00 0.00 0.00 3.61
6704 7119 0.030705 CCATCTCCTCCTCCCCAAGA 60.031 60.000 0.00 0.00 0.00 3.02
6705 7120 1.626350 CCATCTCCTCCTCCCCAAGAA 60.626 57.143 0.00 0.00 0.00 2.52
6706 7121 1.488393 CATCTCCTCCTCCCCAAGAAC 59.512 57.143 0.00 0.00 0.00 3.01
6707 7122 0.491823 TCTCCTCCTCCCCAAGAACA 59.508 55.000 0.00 0.00 0.00 3.18
6708 7123 0.908198 CTCCTCCTCCCCAAGAACAG 59.092 60.000 0.00 0.00 0.00 3.16
6709 7124 0.547712 TCCTCCTCCCCAAGAACAGG 60.548 60.000 0.00 0.00 0.00 4.00
6710 7125 1.566298 CCTCCTCCCCAAGAACAGGG 61.566 65.000 0.00 0.00 46.36 4.45
6711 7126 2.203549 CTCCTCCCCAAGAACAGGGC 62.204 65.000 0.00 0.00 45.39 5.19
6712 7127 2.356667 CTCCCCAAGAACAGGGCC 59.643 66.667 0.00 0.00 45.39 5.80
6713 7128 2.121506 TCCCCAAGAACAGGGCCT 60.122 61.111 0.00 0.00 45.39 5.19
6714 7129 1.778383 TCCCCAAGAACAGGGCCTT 60.778 57.895 1.32 0.00 45.39 4.35
6715 7130 1.304464 CCCCAAGAACAGGGCCTTC 60.304 63.158 1.32 0.00 45.39 3.46
6716 7131 1.460255 CCCAAGAACAGGGCCTTCA 59.540 57.895 1.32 0.00 39.96 3.02
6717 7132 0.895559 CCCAAGAACAGGGCCTTCAC 60.896 60.000 1.32 0.00 39.96 3.18
6718 7133 0.895559 CCAAGAACAGGGCCTTCACC 60.896 60.000 1.32 0.00 0.00 4.02
6736 7151 3.426474 CCCCCTCCCTTCTTCTTCT 57.574 57.895 0.00 0.00 0.00 2.85
6737 7152 0.915364 CCCCCTCCCTTCTTCTTCTG 59.085 60.000 0.00 0.00 0.00 3.02
6738 7153 0.254462 CCCCTCCCTTCTTCTTCTGC 59.746 60.000 0.00 0.00 0.00 4.26
6739 7154 1.284313 CCCTCCCTTCTTCTTCTGCT 58.716 55.000 0.00 0.00 0.00 4.24
6740 7155 1.632920 CCCTCCCTTCTTCTTCTGCTT 59.367 52.381 0.00 0.00 0.00 3.91
6741 7156 2.040947 CCCTCCCTTCTTCTTCTGCTTT 59.959 50.000 0.00 0.00 0.00 3.51
6742 7157 3.499382 CCCTCCCTTCTTCTTCTGCTTTT 60.499 47.826 0.00 0.00 0.00 2.27
6743 7158 3.755905 CCTCCCTTCTTCTTCTGCTTTTC 59.244 47.826 0.00 0.00 0.00 2.29
6744 7159 4.506448 CCTCCCTTCTTCTTCTGCTTTTCT 60.506 45.833 0.00 0.00 0.00 2.52
6745 7160 5.053978 TCCCTTCTTCTTCTGCTTTTCTT 57.946 39.130 0.00 0.00 0.00 2.52
6746 7161 5.066593 TCCCTTCTTCTTCTGCTTTTCTTC 58.933 41.667 0.00 0.00 0.00 2.87
6747 7162 4.823989 CCCTTCTTCTTCTGCTTTTCTTCA 59.176 41.667 0.00 0.00 0.00 3.02
6748 7163 5.476254 CCCTTCTTCTTCTGCTTTTCTTCAT 59.524 40.000 0.00 0.00 0.00 2.57
6749 7164 6.349197 CCCTTCTTCTTCTGCTTTTCTTCATC 60.349 42.308 0.00 0.00 0.00 2.92
6750 7165 6.430616 CCTTCTTCTTCTGCTTTTCTTCATCT 59.569 38.462 0.00 0.00 0.00 2.90
6751 7166 7.605691 CCTTCTTCTTCTGCTTTTCTTCATCTA 59.394 37.037 0.00 0.00 0.00 1.98
6752 7167 9.165035 CTTCTTCTTCTGCTTTTCTTCATCTAT 57.835 33.333 0.00 0.00 0.00 1.98
6753 7168 8.489990 TCTTCTTCTGCTTTTCTTCATCTATG 57.510 34.615 0.00 0.00 0.00 2.23
6754 7169 6.674694 TCTTCTGCTTTTCTTCATCTATGC 57.325 37.500 0.00 0.00 0.00 3.14
6755 7170 6.175471 TCTTCTGCTTTTCTTCATCTATGCA 58.825 36.000 0.00 0.00 0.00 3.96
6756 7171 6.827251 TCTTCTGCTTTTCTTCATCTATGCAT 59.173 34.615 3.79 3.79 0.00 3.96
6757 7172 6.615264 TCTGCTTTTCTTCATCTATGCATC 57.385 37.500 0.19 0.00 0.00 3.91
6758 7173 6.354938 TCTGCTTTTCTTCATCTATGCATCT 58.645 36.000 0.19 0.00 0.00 2.90
6759 7174 6.260271 TCTGCTTTTCTTCATCTATGCATCTG 59.740 38.462 0.19 0.00 0.00 2.90
6760 7175 5.213675 GCTTTTCTTCATCTATGCATCTGC 58.786 41.667 0.19 0.00 42.50 4.26
6801 7216 7.447374 TTTTTCCTGGTTCAGTATGTATGTG 57.553 36.000 0.00 0.00 37.40 3.21
6802 7217 5.755409 TTCCTGGTTCAGTATGTATGTGT 57.245 39.130 0.00 0.00 37.40 3.72
6803 7218 5.084818 TCCTGGTTCAGTATGTATGTGTG 57.915 43.478 0.00 0.00 37.40 3.82
6804 7219 4.530553 TCCTGGTTCAGTATGTATGTGTGT 59.469 41.667 0.00 0.00 37.40 3.72
6805 7220 5.717654 TCCTGGTTCAGTATGTATGTGTGTA 59.282 40.000 0.00 0.00 37.40 2.90
6806 7221 6.382859 TCCTGGTTCAGTATGTATGTGTGTAT 59.617 38.462 0.00 0.00 37.40 2.29
6807 7222 6.479990 CCTGGTTCAGTATGTATGTGTGTATG 59.520 42.308 0.00 0.00 37.40 2.39
6808 7223 6.345298 TGGTTCAGTATGTATGTGTGTATGG 58.655 40.000 0.00 0.00 37.40 2.74
6809 7224 6.155393 TGGTTCAGTATGTATGTGTGTATGGA 59.845 38.462 0.00 0.00 37.40 3.41
6810 7225 7.147567 TGGTTCAGTATGTATGTGTGTATGGAT 60.148 37.037 0.00 0.00 37.40 3.41
6811 7226 7.171508 GGTTCAGTATGTATGTGTGTATGGATG 59.828 40.741 0.00 0.00 37.40 3.51
6812 7227 7.360113 TCAGTATGTATGTGTGTATGGATGT 57.640 36.000 0.00 0.00 37.40 3.06
6813 7228 7.209475 TCAGTATGTATGTGTGTATGGATGTG 58.791 38.462 0.00 0.00 37.40 3.21
6814 7229 5.991606 AGTATGTATGTGTGTATGGATGTGC 59.008 40.000 0.00 0.00 0.00 4.57
6815 7230 4.486125 TGTATGTGTGTATGGATGTGCT 57.514 40.909 0.00 0.00 0.00 4.40
6816 7231 5.606348 TGTATGTGTGTATGGATGTGCTA 57.394 39.130 0.00 0.00 0.00 3.49
6817 7232 5.356426 TGTATGTGTGTATGGATGTGCTAC 58.644 41.667 0.00 0.00 0.00 3.58
6818 7233 4.760530 ATGTGTGTATGGATGTGCTACT 57.239 40.909 0.00 0.00 0.00 2.57
6819 7234 4.551702 TGTGTGTATGGATGTGCTACTT 57.448 40.909 0.00 0.00 0.00 2.24
6820 7235 4.252878 TGTGTGTATGGATGTGCTACTTG 58.747 43.478 0.00 0.00 0.00 3.16
6821 7236 3.063997 GTGTGTATGGATGTGCTACTTGC 59.936 47.826 0.00 0.00 43.25 4.01
6822 7237 2.614057 GTGTATGGATGTGCTACTTGCC 59.386 50.000 0.00 0.00 42.00 4.52
6823 7238 2.238395 TGTATGGATGTGCTACTTGCCA 59.762 45.455 0.00 0.00 42.00 4.92
6824 7239 1.755179 ATGGATGTGCTACTTGCCAC 58.245 50.000 0.00 0.00 42.00 5.01
6825 7240 0.322456 TGGATGTGCTACTTGCCACC 60.322 55.000 0.00 0.00 42.00 4.61
6826 7241 1.369091 GGATGTGCTACTTGCCACCG 61.369 60.000 0.00 0.00 42.00 4.94
6827 7242 1.369091 GATGTGCTACTTGCCACCGG 61.369 60.000 0.00 0.00 42.00 5.28
6828 7243 1.836999 ATGTGCTACTTGCCACCGGA 61.837 55.000 9.46 0.00 42.00 5.14
6829 7244 1.302192 GTGCTACTTGCCACCGGAA 60.302 57.895 9.46 0.00 42.00 4.30
6830 7245 1.003839 TGCTACTTGCCACCGGAAG 60.004 57.895 9.46 3.21 42.00 3.46
6832 7247 2.180159 GCTACTTGCCACCGGAAGGA 62.180 60.000 19.58 3.75 45.84 3.36
6833 7248 3.655264 GCTACTTGCCACCGGAAGGAA 62.655 57.143 19.58 11.26 45.84 3.36
6834 7249 4.902241 GCTACTTGCCACCGGAAGGAAT 62.902 54.545 19.58 0.21 45.84 3.01
6835 7250 5.561065 GCTACTTGCCACCGGAAGGAATA 62.561 52.174 19.58 4.29 45.84 1.75
6836 7251 6.964088 GCTACTTGCCACCGGAAGGAATAA 62.964 50.000 19.58 10.59 45.84 1.40
6852 7267 9.852091 GGAAGGAATAAAATATCTGATGAATGC 57.148 33.333 0.00 0.00 0.00 3.56
6876 7291 4.818534 TTTTGCTGTGTCTGATCAACTC 57.181 40.909 0.00 0.61 0.00 3.01
6877 7292 3.758755 TTGCTGTGTCTGATCAACTCT 57.241 42.857 0.00 0.00 0.00 3.24
6878 7293 3.758755 TGCTGTGTCTGATCAACTCTT 57.241 42.857 0.00 0.00 0.00 2.85
6879 7294 3.396560 TGCTGTGTCTGATCAACTCTTG 58.603 45.455 0.00 0.03 0.00 3.02
6880 7295 3.181462 TGCTGTGTCTGATCAACTCTTGT 60.181 43.478 0.00 0.00 0.00 3.16
6881 7296 3.186001 GCTGTGTCTGATCAACTCTTGTG 59.814 47.826 0.00 0.00 0.00 3.33
6882 7297 4.375272 CTGTGTCTGATCAACTCTTGTGT 58.625 43.478 0.00 0.00 0.00 3.72
6883 7298 4.122046 TGTGTCTGATCAACTCTTGTGTG 58.878 43.478 0.00 0.00 0.00 3.82
6884 7299 4.122776 GTGTCTGATCAACTCTTGTGTGT 58.877 43.478 0.00 0.00 0.00 3.72
6885 7300 4.210120 GTGTCTGATCAACTCTTGTGTGTC 59.790 45.833 0.00 0.00 0.00 3.67
6886 7301 3.743396 GTCTGATCAACTCTTGTGTGTCC 59.257 47.826 0.00 0.00 0.00 4.02
6887 7302 3.387699 TCTGATCAACTCTTGTGTGTCCA 59.612 43.478 0.00 0.00 0.00 4.02
6888 7303 3.732212 TGATCAACTCTTGTGTGTCCAG 58.268 45.455 0.00 0.00 0.00 3.86
6889 7304 2.620251 TCAACTCTTGTGTGTCCAGG 57.380 50.000 0.00 0.00 0.00 4.45
6890 7305 2.115427 TCAACTCTTGTGTGTCCAGGA 58.885 47.619 0.00 0.00 0.00 3.86
6891 7306 2.705658 TCAACTCTTGTGTGTCCAGGAT 59.294 45.455 0.00 0.00 0.00 3.24
6892 7307 3.136443 TCAACTCTTGTGTGTCCAGGATT 59.864 43.478 0.00 0.00 0.00 3.01
6893 7308 3.409026 ACTCTTGTGTGTCCAGGATTC 57.591 47.619 0.00 0.00 0.00 2.52
6894 7309 2.289072 ACTCTTGTGTGTCCAGGATTCG 60.289 50.000 0.00 0.00 0.00 3.34
6895 7310 1.691976 TCTTGTGTGTCCAGGATTCGT 59.308 47.619 0.00 0.00 0.00 3.85
6896 7311 1.800586 CTTGTGTGTCCAGGATTCGTG 59.199 52.381 0.00 0.00 0.00 4.35
6897 7312 1.044611 TGTGTGTCCAGGATTCGTGA 58.955 50.000 7.91 0.00 0.00 4.35
6898 7313 1.000843 TGTGTGTCCAGGATTCGTGAG 59.999 52.381 7.91 0.00 0.00 3.51
6899 7314 0.608130 TGTGTCCAGGATTCGTGAGG 59.392 55.000 7.91 0.00 0.00 3.86
6900 7315 0.608640 GTGTCCAGGATTCGTGAGGT 59.391 55.000 7.91 0.00 0.00 3.85
6901 7316 0.608130 TGTCCAGGATTCGTGAGGTG 59.392 55.000 7.91 0.00 0.00 4.00
6902 7317 0.895530 GTCCAGGATTCGTGAGGTGA 59.104 55.000 7.91 0.00 0.00 4.02
6903 7318 0.895530 TCCAGGATTCGTGAGGTGAC 59.104 55.000 7.91 0.00 0.00 3.67
6904 7319 0.608130 CCAGGATTCGTGAGGTGACA 59.392 55.000 7.91 0.00 0.00 3.58
6905 7320 1.001974 CCAGGATTCGTGAGGTGACAA 59.998 52.381 7.91 0.00 0.00 3.18
6906 7321 2.069273 CAGGATTCGTGAGGTGACAAC 58.931 52.381 0.00 0.00 0.00 3.32
6915 7330 2.725641 GGTGACAACCGTTTGCCC 59.274 61.111 0.00 0.00 36.51 5.36
6916 7331 2.122167 GGTGACAACCGTTTGCCCA 61.122 57.895 0.00 0.00 36.51 5.36
6917 7332 1.358759 GTGACAACCGTTTGCCCAG 59.641 57.895 0.00 0.00 36.00 4.45
6918 7333 2.335011 GACAACCGTTTGCCCAGC 59.665 61.111 0.00 0.00 36.00 4.85
6919 7334 3.207547 GACAACCGTTTGCCCAGCC 62.208 63.158 0.00 0.00 36.00 4.85
6920 7335 3.989787 CAACCGTTTGCCCAGCCC 61.990 66.667 0.00 0.00 0.00 5.19
6921 7336 4.531426 AACCGTTTGCCCAGCCCA 62.531 61.111 0.00 0.00 0.00 5.36
6924 7339 3.222855 CGTTTGCCCAGCCCACAA 61.223 61.111 0.00 0.00 0.00 3.33
6925 7340 2.736531 GTTTGCCCAGCCCACAAG 59.263 61.111 0.00 0.00 0.00 3.16
6926 7341 2.133641 GTTTGCCCAGCCCACAAGT 61.134 57.895 0.00 0.00 0.00 3.16
6927 7342 1.382420 TTTGCCCAGCCCACAAGTT 60.382 52.632 0.00 0.00 0.00 2.66
6928 7343 1.684386 TTTGCCCAGCCCACAAGTTG 61.684 55.000 0.00 0.00 0.00 3.16
6929 7344 2.521708 GCCCAGCCCACAAGTTGT 60.522 61.111 1.64 1.64 0.00 3.32
6931 7346 2.730094 CCAGCCCACAAGTTGTGC 59.270 61.111 27.31 18.43 46.51 4.57
6932 7347 1.829533 CCAGCCCACAAGTTGTGCT 60.830 57.895 27.31 20.26 46.51 4.40
6933 7348 1.361271 CAGCCCACAAGTTGTGCTG 59.639 57.895 27.31 26.14 46.51 4.41
6934 7349 1.076777 AGCCCACAAGTTGTGCTGT 60.077 52.632 27.31 12.36 46.51 4.40
6935 7350 0.684153 AGCCCACAAGTTGTGCTGTT 60.684 50.000 27.31 16.42 46.51 3.16
6936 7351 0.175531 GCCCACAAGTTGTGCTGTTT 59.824 50.000 27.31 0.00 46.51 2.83
6937 7352 1.802508 GCCCACAAGTTGTGCTGTTTC 60.803 52.381 27.31 10.06 46.51 2.78
6938 7353 1.202405 CCCACAAGTTGTGCTGTTTCC 60.202 52.381 27.31 0.00 46.51 3.13
6939 7354 1.476085 CCACAAGTTGTGCTGTTTCCA 59.524 47.619 27.31 0.00 46.51 3.53
6940 7355 2.094286 CCACAAGTTGTGCTGTTTCCAA 60.094 45.455 27.31 0.00 46.51 3.53
6941 7356 3.583806 CACAAGTTGTGCTGTTTCCAAA 58.416 40.909 22.33 0.00 41.89 3.28
6942 7357 3.993081 CACAAGTTGTGCTGTTTCCAAAA 59.007 39.130 22.33 0.00 41.89 2.44
6943 7358 4.450419 CACAAGTTGTGCTGTTTCCAAAAA 59.550 37.500 22.33 0.00 41.89 1.94
6944 7359 5.122082 CACAAGTTGTGCTGTTTCCAAAAAT 59.878 36.000 22.33 0.00 41.89 1.82
6945 7360 5.351189 ACAAGTTGTGCTGTTTCCAAAAATC 59.649 36.000 7.96 0.00 0.00 2.17
6946 7361 4.441792 AGTTGTGCTGTTTCCAAAAATCC 58.558 39.130 0.00 0.00 0.00 3.01
6947 7362 3.467374 TGTGCTGTTTCCAAAAATCCC 57.533 42.857 0.00 0.00 0.00 3.85
6948 7363 2.103941 TGTGCTGTTTCCAAAAATCCCC 59.896 45.455 0.00 0.00 0.00 4.81
6949 7364 2.103941 GTGCTGTTTCCAAAAATCCCCA 59.896 45.455 0.00 0.00 0.00 4.96
6950 7365 2.103941 TGCTGTTTCCAAAAATCCCCAC 59.896 45.455 0.00 0.00 0.00 4.61
6951 7366 2.549992 GCTGTTTCCAAAAATCCCCACC 60.550 50.000 0.00 0.00 0.00 4.61
6952 7367 2.038426 CTGTTTCCAAAAATCCCCACCC 59.962 50.000 0.00 0.00 0.00 4.61
6953 7368 1.349688 GTTTCCAAAAATCCCCACCCC 59.650 52.381 0.00 0.00 0.00 4.95
6954 7369 0.568192 TTCCAAAAATCCCCACCCCA 59.432 50.000 0.00 0.00 0.00 4.96
6955 7370 0.178918 TCCAAAAATCCCCACCCCAC 60.179 55.000 0.00 0.00 0.00 4.61
6956 7371 1.198094 CCAAAAATCCCCACCCCACC 61.198 60.000 0.00 0.00 0.00 4.61
6957 7372 1.159905 AAAAATCCCCACCCCACCC 59.840 57.895 0.00 0.00 0.00 4.61
6958 7373 1.679969 AAAAATCCCCACCCCACCCA 61.680 55.000 0.00 0.00 0.00 4.51
6959 7374 1.679969 AAAATCCCCACCCCACCCAA 61.680 55.000 0.00 0.00 0.00 4.12
6960 7375 1.679969 AAATCCCCACCCCACCCAAA 61.680 55.000 0.00 0.00 0.00 3.28
6961 7376 1.679969 AATCCCCACCCCACCCAAAA 61.680 55.000 0.00 0.00 0.00 2.44
6962 7377 2.395180 ATCCCCACCCCACCCAAAAC 62.395 60.000 0.00 0.00 0.00 2.43
6963 7378 2.915137 CCCACCCCACCCAAAACG 60.915 66.667 0.00 0.00 0.00 3.60
6964 7379 2.915137 CCACCCCACCCAAAACGG 60.915 66.667 0.00 0.00 0.00 4.44
6965 7380 2.196229 CACCCCACCCAAAACGGA 59.804 61.111 0.00 0.00 36.56 4.69
6966 7381 1.455959 CACCCCACCCAAAACGGAA 60.456 57.895 0.00 0.00 36.56 4.30
6967 7382 1.152631 ACCCCACCCAAAACGGAAG 60.153 57.895 0.00 0.00 36.56 3.46
6968 7383 2.570284 CCCCACCCAAAACGGAAGC 61.570 63.158 0.00 0.00 36.56 3.86
6969 7384 1.830408 CCCACCCAAAACGGAAGCA 60.830 57.895 0.00 0.00 36.56 3.91
6970 7385 1.362355 CCACCCAAAACGGAAGCAC 59.638 57.895 0.00 0.00 36.56 4.40
6971 7386 1.008995 CACCCAAAACGGAAGCACG 60.009 57.895 0.00 0.00 36.56 5.34
6972 7387 1.153127 ACCCAAAACGGAAGCACGA 60.153 52.632 2.50 0.00 36.56 4.35
6973 7388 1.164041 ACCCAAAACGGAAGCACGAG 61.164 55.000 2.50 0.00 36.56 4.18
6974 7389 1.164041 CCCAAAACGGAAGCACGAGT 61.164 55.000 2.50 0.00 36.56 4.18
6975 7390 1.504359 CCAAAACGGAAGCACGAGTA 58.496 50.000 2.50 0.00 36.56 2.59
6976 7391 1.868498 CCAAAACGGAAGCACGAGTAA 59.132 47.619 2.50 0.00 36.56 2.24
6977 7392 2.288458 CCAAAACGGAAGCACGAGTAAA 59.712 45.455 2.50 0.00 36.56 2.01
6978 7393 3.285745 CAAAACGGAAGCACGAGTAAAC 58.714 45.455 2.50 0.00 37.61 2.01
6979 7394 2.228138 AACGGAAGCACGAGTAAACA 57.772 45.000 2.50 0.00 37.61 2.83
6980 7395 2.228138 ACGGAAGCACGAGTAAACAA 57.772 45.000 2.50 0.00 37.61 2.83
6981 7396 2.132762 ACGGAAGCACGAGTAAACAAG 58.867 47.619 2.50 0.00 37.61 3.16
6982 7397 1.459592 CGGAAGCACGAGTAAACAAGG 59.540 52.381 0.00 0.00 35.47 3.61
6983 7398 2.762745 GGAAGCACGAGTAAACAAGGA 58.237 47.619 0.00 0.00 0.00 3.36
6984 7399 2.737252 GGAAGCACGAGTAAACAAGGAG 59.263 50.000 0.00 0.00 0.00 3.69
6985 7400 2.457366 AGCACGAGTAAACAAGGAGG 57.543 50.000 0.00 0.00 0.00 4.30
6986 7401 0.796927 GCACGAGTAAACAAGGAGGC 59.203 55.000 0.00 0.00 0.00 4.70
6987 7402 1.608283 GCACGAGTAAACAAGGAGGCT 60.608 52.381 0.00 0.00 0.00 4.58
6988 7403 2.767505 CACGAGTAAACAAGGAGGCTT 58.232 47.619 0.00 0.00 0.00 4.35
6989 7404 2.480419 CACGAGTAAACAAGGAGGCTTG 59.520 50.000 0.00 0.00 39.98 4.01
6991 7406 2.480419 CGAGTAAACAAGGAGGCTTGTG 59.520 50.000 0.00 0.00 45.64 3.33
6992 7407 2.814336 GAGTAAACAAGGAGGCTTGTGG 59.186 50.000 0.00 0.00 45.64 4.17
6993 7408 1.269723 GTAAACAAGGAGGCTTGTGGC 59.730 52.381 0.00 0.00 45.64 5.01
7002 7417 2.521708 GCTTGTGGCCTTGTGGGT 60.522 61.111 3.32 0.00 37.43 4.51
7003 7418 2.564721 GCTTGTGGCCTTGTGGGTC 61.565 63.158 3.32 0.00 40.85 4.46
7004 7419 2.203280 TTGTGGCCTTGTGGGTCG 60.203 61.111 3.32 0.00 44.07 4.79
7009 7424 4.021925 GCCTTGTGGGTCGCCTCT 62.022 66.667 0.00 0.00 37.43 3.69
7010 7425 2.266055 CCTTGTGGGTCGCCTCTC 59.734 66.667 0.00 0.00 0.00 3.20
7011 7426 2.266055 CTTGTGGGTCGCCTCTCC 59.734 66.667 0.00 0.00 0.00 3.71
7012 7427 2.203788 TTGTGGGTCGCCTCTCCT 60.204 61.111 0.00 0.00 0.00 3.69
7013 7428 1.831652 CTTGTGGGTCGCCTCTCCTT 61.832 60.000 0.00 0.00 0.00 3.36
7014 7429 1.827399 TTGTGGGTCGCCTCTCCTTC 61.827 60.000 0.00 0.00 0.00 3.46
7015 7430 2.119611 TGGGTCGCCTCTCCTTCA 59.880 61.111 0.00 0.00 0.00 3.02
7016 7431 1.306141 TGGGTCGCCTCTCCTTCAT 60.306 57.895 0.00 0.00 0.00 2.57
7017 7432 1.330655 TGGGTCGCCTCTCCTTCATC 61.331 60.000 0.00 0.00 0.00 2.92
7018 7433 1.066587 GGTCGCCTCTCCTTCATCG 59.933 63.158 0.00 0.00 0.00 3.84
7019 7434 1.066587 GTCGCCTCTCCTTCATCGG 59.933 63.158 0.00 0.00 0.00 4.18
7020 7435 2.279784 CGCCTCTCCTTCATCGGC 60.280 66.667 0.00 0.00 37.40 5.54
7021 7436 2.279784 GCCTCTCCTTCATCGGCG 60.280 66.667 0.00 0.00 0.00 6.46
7022 7437 2.786495 GCCTCTCCTTCATCGGCGA 61.786 63.158 13.87 13.87 0.00 5.54
7023 7438 1.066587 CCTCTCCTTCATCGGCGAC 59.933 63.158 13.76 0.00 0.00 5.19
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 2.133641 GCCCAAGCAAACACACCCT 61.134 57.895 0.00 0.00 39.53 4.34
1 2 2.133641 AGCCCAAGCAAACACACCC 61.134 57.895 0.00 0.00 43.56 4.61
2 3 1.067916 CAGCCCAAGCAAACACACC 59.932 57.895 0.00 0.00 43.56 4.16
3 4 1.592400 GCAGCCCAAGCAAACACAC 60.592 57.895 0.00 0.00 43.56 3.82
4 5 2.018727 CTGCAGCCCAAGCAAACACA 62.019 55.000 0.00 0.00 42.17 3.72
5 6 1.300388 CTGCAGCCCAAGCAAACAC 60.300 57.895 0.00 0.00 42.17 3.32
6 7 3.131155 CTGCAGCCCAAGCAAACA 58.869 55.556 0.00 0.00 42.17 2.83
7 8 2.356673 GCTGCAGCCCAAGCAAAC 60.357 61.111 28.76 0.00 42.17 2.93
8 9 2.522436 AGCTGCAGCCCAAGCAAA 60.522 55.556 34.39 0.00 42.17 3.68
9 10 3.299977 CAGCTGCAGCCCAAGCAA 61.300 61.111 34.39 0.00 42.17 3.91
34 35 4.479993 CAGCTCCTTCCAGCCGGG 62.480 72.222 2.18 0.00 40.65 5.73
35 36 4.479993 CCAGCTCCTTCCAGCCGG 62.480 72.222 0.00 0.00 40.65 6.13
36 37 2.469465 TTTCCAGCTCCTTCCAGCCG 62.469 60.000 0.00 0.00 40.65 5.52
37 38 0.962855 GTTTCCAGCTCCTTCCAGCC 60.963 60.000 0.00 0.00 40.65 4.85
38 39 0.037447 AGTTTCCAGCTCCTTCCAGC 59.963 55.000 0.00 0.00 39.99 4.85
39 40 1.818642 CAGTTTCCAGCTCCTTCCAG 58.181 55.000 0.00 0.00 0.00 3.86
40 41 0.250901 GCAGTTTCCAGCTCCTTCCA 60.251 55.000 0.00 0.00 0.00 3.53
41 42 0.250901 TGCAGTTTCCAGCTCCTTCC 60.251 55.000 0.00 0.00 0.00 3.46
42 43 0.877743 GTGCAGTTTCCAGCTCCTTC 59.122 55.000 0.00 0.00 0.00 3.46
43 44 0.183492 TGTGCAGTTTCCAGCTCCTT 59.817 50.000 0.00 0.00 0.00 3.36
44 45 0.403271 ATGTGCAGTTTCCAGCTCCT 59.597 50.000 0.00 0.00 0.00 3.69
45 46 0.807496 GATGTGCAGTTTCCAGCTCC 59.193 55.000 0.00 0.00 0.00 4.70
46 47 1.818642 AGATGTGCAGTTTCCAGCTC 58.181 50.000 0.00 0.00 0.00 4.09
47 48 3.641434 ATAGATGTGCAGTTTCCAGCT 57.359 42.857 0.00 0.00 0.00 4.24
48 49 7.012327 TGTTTATATAGATGTGCAGTTTCCAGC 59.988 37.037 0.00 0.00 0.00 4.85
49 50 8.437360 TGTTTATATAGATGTGCAGTTTCCAG 57.563 34.615 0.00 0.00 0.00 3.86
50 51 8.264347 TCTGTTTATATAGATGTGCAGTTTCCA 58.736 33.333 0.00 0.00 0.00 3.53
51 52 8.662781 TCTGTTTATATAGATGTGCAGTTTCC 57.337 34.615 0.00 0.00 0.00 3.13
53 54 9.836864 TGATCTGTTTATATAGATGTGCAGTTT 57.163 29.630 0.00 0.00 32.96 2.66
54 55 9.265901 GTGATCTGTTTATATAGATGTGCAGTT 57.734 33.333 0.00 0.00 32.96 3.16
55 56 8.646004 AGTGATCTGTTTATATAGATGTGCAGT 58.354 33.333 0.00 0.00 32.96 4.40
56 57 8.923683 CAGTGATCTGTTTATATAGATGTGCAG 58.076 37.037 0.00 0.00 32.96 4.41
57 58 8.641541 TCAGTGATCTGTTTATATAGATGTGCA 58.358 33.333 0.00 0.00 41.91 4.57
58 59 9.138062 CTCAGTGATCTGTTTATATAGATGTGC 57.862 37.037 0.00 0.00 41.91 4.57
63 64 9.513906 CTCCTCTCAGTGATCTGTTTATATAGA 57.486 37.037 0.00 0.00 41.91 1.98
64 65 9.295825 ACTCCTCTCAGTGATCTGTTTATATAG 57.704 37.037 0.00 0.00 41.91 1.31
65 66 9.072375 CACTCCTCTCAGTGATCTGTTTATATA 57.928 37.037 0.00 0.00 45.92 0.86
66 67 7.563188 ACACTCCTCTCAGTGATCTGTTTATAT 59.437 37.037 7.59 0.00 45.92 0.86
67 68 6.892456 ACACTCCTCTCAGTGATCTGTTTATA 59.108 38.462 7.59 0.00 45.92 0.98
68 69 5.719085 ACACTCCTCTCAGTGATCTGTTTAT 59.281 40.000 7.59 0.00 45.92 1.40
69 70 5.080337 ACACTCCTCTCAGTGATCTGTTTA 58.920 41.667 7.59 0.00 45.92 2.01
70 71 3.900601 ACACTCCTCTCAGTGATCTGTTT 59.099 43.478 7.59 0.00 45.92 2.83
71 72 3.505386 ACACTCCTCTCAGTGATCTGTT 58.495 45.455 7.59 0.00 45.92 3.16
72 73 3.088532 GACACTCCTCTCAGTGATCTGT 58.911 50.000 7.59 0.00 45.92 3.41
73 74 3.087781 TGACACTCCTCTCAGTGATCTG 58.912 50.000 7.59 0.00 45.92 2.90
74 75 3.088532 GTGACACTCCTCTCAGTGATCT 58.911 50.000 7.59 0.00 45.92 2.75
75 76 3.088532 AGTGACACTCCTCTCAGTGATC 58.911 50.000 1.07 2.82 45.92 2.92
76 77 3.168035 AGTGACACTCCTCTCAGTGAT 57.832 47.619 1.07 0.00 45.92 3.06
77 78 2.666272 AGTGACACTCCTCTCAGTGA 57.334 50.000 1.07 0.00 45.92 3.41
79 80 3.799432 AGTAGTGACACTCCTCTCAGT 57.201 47.619 12.39 0.00 0.00 3.41
80 81 4.839121 ACTAGTAGTGACACTCCTCTCAG 58.161 47.826 12.39 3.20 0.00 3.35
81 82 4.912317 ACTAGTAGTGACACTCCTCTCA 57.088 45.455 12.39 0.00 0.00 3.27
82 83 5.981174 ACTACTAGTAGTGACACTCCTCTC 58.019 45.833 30.33 0.00 44.11 3.20
83 84 6.896860 TCTACTACTAGTAGTGACACTCCTCT 59.103 42.308 35.52 14.08 46.31 3.69
84 85 7.111247 TCTACTACTAGTAGTGACACTCCTC 57.889 44.000 35.52 4.42 46.31 3.71
85 86 7.345132 TCATCTACTACTAGTAGTGACACTCCT 59.655 40.741 35.52 16.88 46.31 3.69
86 87 7.499292 TCATCTACTACTAGTAGTGACACTCC 58.501 42.308 35.52 0.00 46.31 3.85
87 88 8.945481 TTCATCTACTACTAGTAGTGACACTC 57.055 38.462 35.52 4.22 46.31 3.51
88 89 9.386010 CTTTCATCTACTACTAGTAGTGACACT 57.614 37.037 35.52 17.00 46.31 3.55
89 90 9.165035 ACTTTCATCTACTACTAGTAGTGACAC 57.835 37.037 35.52 0.00 46.31 3.67
92 93 9.545105 GCTACTTTCATCTACTACTAGTAGTGA 57.455 37.037 35.52 29.43 46.31 3.41
93 94 9.327628 TGCTACTTTCATCTACTACTAGTAGTG 57.672 37.037 35.52 26.39 46.31 2.74
98 99 9.834628 GCTAATGCTACTTTCATCTACTACTAG 57.165 37.037 0.00 0.00 36.03 2.57
99 100 9.350951 TGCTAATGCTACTTTCATCTACTACTA 57.649 33.333 0.00 0.00 40.48 1.82
100 101 8.239038 TGCTAATGCTACTTTCATCTACTACT 57.761 34.615 0.00 0.00 40.48 2.57
101 102 8.138712 ACTGCTAATGCTACTTTCATCTACTAC 58.861 37.037 0.00 0.00 40.48 2.73
102 103 8.239038 ACTGCTAATGCTACTTTCATCTACTA 57.761 34.615 0.00 0.00 40.48 1.82
103 104 7.118496 ACTGCTAATGCTACTTTCATCTACT 57.882 36.000 0.00 0.00 40.48 2.57
104 105 7.492669 TGAACTGCTAATGCTACTTTCATCTAC 59.507 37.037 0.00 0.00 40.48 2.59
105 106 7.555965 TGAACTGCTAATGCTACTTTCATCTA 58.444 34.615 0.00 0.00 40.48 1.98
106 107 6.409704 TGAACTGCTAATGCTACTTTCATCT 58.590 36.000 0.00 0.00 40.48 2.90
107 108 6.668541 TGAACTGCTAATGCTACTTTCATC 57.331 37.500 0.00 0.00 40.48 2.92
108 109 6.600822 ACATGAACTGCTAATGCTACTTTCAT 59.399 34.615 0.00 0.00 40.48 2.57
109 110 5.939883 ACATGAACTGCTAATGCTACTTTCA 59.060 36.000 0.00 0.00 40.48 2.69
110 111 6.128172 ACACATGAACTGCTAATGCTACTTTC 60.128 38.462 0.00 0.00 40.48 2.62
111 112 5.707298 ACACATGAACTGCTAATGCTACTTT 59.293 36.000 0.00 0.00 40.48 2.66
112 113 5.248640 ACACATGAACTGCTAATGCTACTT 58.751 37.500 0.00 0.00 40.48 2.24
113 114 4.836825 ACACATGAACTGCTAATGCTACT 58.163 39.130 0.00 0.00 40.48 2.57
114 115 5.551760 AACACATGAACTGCTAATGCTAC 57.448 39.130 0.00 0.00 40.48 3.58
115 116 6.093495 GGTAAACACATGAACTGCTAATGCTA 59.907 38.462 0.00 0.00 40.48 3.49
116 117 5.106157 GGTAAACACATGAACTGCTAATGCT 60.106 40.000 0.00 0.00 40.48 3.79
117 118 5.095490 GGTAAACACATGAACTGCTAATGC 58.905 41.667 0.00 0.00 40.20 3.56
118 119 5.182950 TGGGTAAACACATGAACTGCTAATG 59.817 40.000 0.00 0.00 0.00 1.90
119 120 5.321102 TGGGTAAACACATGAACTGCTAAT 58.679 37.500 0.00 0.00 0.00 1.73
120 121 4.720046 TGGGTAAACACATGAACTGCTAA 58.280 39.130 0.00 0.00 0.00 3.09
121 122 4.359434 TGGGTAAACACATGAACTGCTA 57.641 40.909 0.00 0.00 0.00 3.49
122 123 3.222173 TGGGTAAACACATGAACTGCT 57.778 42.857 0.00 0.00 0.00 4.24
123 124 4.485163 GATTGGGTAAACACATGAACTGC 58.515 43.478 0.00 0.00 0.00 4.40
124 125 4.454161 TCGATTGGGTAAACACATGAACTG 59.546 41.667 0.00 0.00 0.00 3.16
125 126 4.647611 TCGATTGGGTAAACACATGAACT 58.352 39.130 0.00 0.00 0.00 3.01
126 127 4.671766 GCTCGATTGGGTAAACACATGAAC 60.672 45.833 0.00 0.00 0.00 3.18
127 128 3.438781 GCTCGATTGGGTAAACACATGAA 59.561 43.478 0.00 0.00 0.00 2.57
128 129 3.006940 GCTCGATTGGGTAAACACATGA 58.993 45.455 0.00 0.00 0.00 3.07
129 130 3.009723 AGCTCGATTGGGTAAACACATG 58.990 45.455 0.00 0.00 0.00 3.21
130 131 3.350219 AGCTCGATTGGGTAAACACAT 57.650 42.857 0.00 0.00 0.00 3.21
131 132 2.851263 AGCTCGATTGGGTAAACACA 57.149 45.000 0.00 0.00 0.00 3.72
132 133 2.608090 GCTAGCTCGATTGGGTAAACAC 59.392 50.000 7.70 0.00 0.00 3.32
133 134 2.235155 TGCTAGCTCGATTGGGTAAACA 59.765 45.455 17.23 0.00 0.00 2.83
134 135 2.866762 CTGCTAGCTCGATTGGGTAAAC 59.133 50.000 17.23 0.00 0.00 2.01
135 136 2.500098 ACTGCTAGCTCGATTGGGTAAA 59.500 45.455 17.23 0.00 0.00 2.01
136 137 2.100916 GACTGCTAGCTCGATTGGGTAA 59.899 50.000 17.23 0.00 0.00 2.85
137 138 1.681793 GACTGCTAGCTCGATTGGGTA 59.318 52.381 17.23 0.00 0.00 3.69
138 139 0.461961 GACTGCTAGCTCGATTGGGT 59.538 55.000 17.23 2.09 0.00 4.51
139 140 0.461548 TGACTGCTAGCTCGATTGGG 59.538 55.000 17.23 0.00 0.00 4.12
140 141 2.299993 TTGACTGCTAGCTCGATTGG 57.700 50.000 17.23 0.31 0.00 3.16
141 142 4.668576 TTTTTGACTGCTAGCTCGATTG 57.331 40.909 17.23 1.99 0.00 2.67
159 160 9.709495 TTCTGCTCATATAAAAGTGCAATTTTT 57.291 25.926 27.47 19.48 39.23 1.94
160 161 9.880157 ATTCTGCTCATATAAAAGTGCAATTTT 57.120 25.926 25.89 25.89 34.36 1.82
162 163 9.956720 GTATTCTGCTCATATAAAAGTGCAATT 57.043 29.630 0.00 0.00 34.36 2.32
163 164 9.347240 AGTATTCTGCTCATATAAAAGTGCAAT 57.653 29.630 0.00 0.00 34.36 3.56
164 165 8.737168 AGTATTCTGCTCATATAAAAGTGCAA 57.263 30.769 0.00 0.00 34.36 4.08
165 166 9.261180 GTAGTATTCTGCTCATATAAAAGTGCA 57.739 33.333 0.00 0.00 33.75 4.57
166 167 9.261180 TGTAGTATTCTGCTCATATAAAAGTGC 57.739 33.333 0.00 0.00 0.00 4.40
170 171 9.764363 CCTGTGTAGTATTCTGCTCATATAAAA 57.236 33.333 0.00 0.00 31.72 1.52
171 172 9.143155 TCCTGTGTAGTATTCTGCTCATATAAA 57.857 33.333 0.00 0.00 31.72 1.40
172 173 8.706322 TCCTGTGTAGTATTCTGCTCATATAA 57.294 34.615 0.00 0.00 31.72 0.98
173 174 7.094162 GCTCCTGTGTAGTATTCTGCTCATATA 60.094 40.741 0.00 0.00 31.72 0.86
174 175 6.295011 GCTCCTGTGTAGTATTCTGCTCATAT 60.295 42.308 0.00 0.00 31.72 1.78
175 176 5.010112 GCTCCTGTGTAGTATTCTGCTCATA 59.990 44.000 0.00 0.00 31.72 2.15
176 177 4.202202 GCTCCTGTGTAGTATTCTGCTCAT 60.202 45.833 0.00 0.00 31.72 2.90
177 178 3.131223 GCTCCTGTGTAGTATTCTGCTCA 59.869 47.826 0.00 0.00 0.00 4.26
178 179 3.131223 TGCTCCTGTGTAGTATTCTGCTC 59.869 47.826 0.00 0.00 0.00 4.26
179 180 3.099905 TGCTCCTGTGTAGTATTCTGCT 58.900 45.455 0.00 0.00 0.00 4.24
180 181 3.118956 ACTGCTCCTGTGTAGTATTCTGC 60.119 47.826 0.00 0.00 31.35 4.26
181 182 4.081972 ACACTGCTCCTGTGTAGTATTCTG 60.082 45.833 6.16 0.00 42.91 3.02
182 183 4.090090 ACACTGCTCCTGTGTAGTATTCT 58.910 43.478 6.16 0.00 42.91 2.40
183 184 4.082190 TGACACTGCTCCTGTGTAGTATTC 60.082 45.833 7.68 0.00 44.27 1.75
184 185 3.832490 TGACACTGCTCCTGTGTAGTATT 59.168 43.478 7.68 0.00 44.27 1.89
185 186 3.193691 GTGACACTGCTCCTGTGTAGTAT 59.806 47.826 7.68 0.00 44.27 2.12
186 187 2.557056 GTGACACTGCTCCTGTGTAGTA 59.443 50.000 7.68 0.00 44.27 1.82
187 188 1.341531 GTGACACTGCTCCTGTGTAGT 59.658 52.381 7.68 0.00 44.27 2.73
188 189 1.615883 AGTGACACTGCTCCTGTGTAG 59.384 52.381 7.47 0.00 44.27 2.74
189 190 1.704641 AGTGACACTGCTCCTGTGTA 58.295 50.000 7.47 0.00 44.27 2.90
190 191 1.615883 CTAGTGACACTGCTCCTGTGT 59.384 52.381 18.58 7.47 46.25 3.72
191 192 1.615883 ACTAGTGACACTGCTCCTGTG 59.384 52.381 18.58 0.00 38.85 3.66
192 193 1.615883 CACTAGTGACACTGCTCCTGT 59.384 52.381 18.45 4.71 0.00 4.00
193 194 1.067283 CCACTAGTGACACTGCTCCTG 60.067 57.143 24.68 5.75 0.00 3.86
194 195 1.261480 CCACTAGTGACACTGCTCCT 58.739 55.000 24.68 0.00 0.00 3.69
195 196 0.969894 ACCACTAGTGACACTGCTCC 59.030 55.000 24.68 0.00 0.00 4.70
196 197 2.416162 GCTACCACTAGTGACACTGCTC 60.416 54.545 24.68 1.45 0.00 4.26
197 198 1.546476 GCTACCACTAGTGACACTGCT 59.454 52.381 24.68 0.00 0.00 4.24
198 199 1.546476 AGCTACCACTAGTGACACTGC 59.454 52.381 24.68 18.17 0.00 4.40
199 200 2.820197 TCAGCTACCACTAGTGACACTG 59.180 50.000 24.68 21.86 0.00 3.66
200 201 3.156288 TCAGCTACCACTAGTGACACT 57.844 47.619 24.68 13.68 0.00 3.55
201 202 3.936372 TTCAGCTACCACTAGTGACAC 57.064 47.619 24.68 10.31 0.00 3.67
202 203 4.948341 TTTTCAGCTACCACTAGTGACA 57.052 40.909 24.68 10.05 0.00 3.58
203 204 5.520649 GCTATTTTCAGCTACCACTAGTGAC 59.479 44.000 24.68 10.31 38.57 3.67
204 205 5.186992 TGCTATTTTCAGCTACCACTAGTGA 59.813 40.000 24.68 4.16 42.30 3.41
205 206 5.419542 TGCTATTTTCAGCTACCACTAGTG 58.580 41.667 16.34 16.34 42.30 2.74
206 207 5.677319 TGCTATTTTCAGCTACCACTAGT 57.323 39.130 0.00 0.00 42.30 2.57
207 208 7.095439 GCTAATGCTATTTTCAGCTACCACTAG 60.095 40.741 0.00 0.00 42.30 2.57
208 209 6.706270 GCTAATGCTATTTTCAGCTACCACTA 59.294 38.462 0.00 0.00 42.30 2.74
209 210 5.529060 GCTAATGCTATTTTCAGCTACCACT 59.471 40.000 0.00 0.00 42.30 4.00
210 211 5.752712 GCTAATGCTATTTTCAGCTACCAC 58.247 41.667 0.00 0.00 42.30 4.16
226 227 6.486657 TGGGTAAAGACATGAATAGCTAATGC 59.513 38.462 0.00 0.00 40.05 3.56
227 228 8.450578 TTGGGTAAAGACATGAATAGCTAATG 57.549 34.615 0.00 0.00 0.00 1.90
228 229 9.289782 GATTGGGTAAAGACATGAATAGCTAAT 57.710 33.333 0.00 6.10 32.17 1.73
229 230 7.441157 CGATTGGGTAAAGACATGAATAGCTAA 59.559 37.037 0.00 1.50 0.00 3.09
230 231 6.929049 CGATTGGGTAAAGACATGAATAGCTA 59.071 38.462 0.00 0.00 0.00 3.32
231 232 5.760253 CGATTGGGTAAAGACATGAATAGCT 59.240 40.000 0.00 0.00 0.00 3.32
232 233 5.758296 TCGATTGGGTAAAGACATGAATAGC 59.242 40.000 0.00 0.00 0.00 2.97
233 234 6.073548 GCTCGATTGGGTAAAGACATGAATAG 60.074 42.308 0.00 0.00 0.00 1.73
234 235 5.758296 GCTCGATTGGGTAAAGACATGAATA 59.242 40.000 0.00 0.00 0.00 1.75
235 236 4.576463 GCTCGATTGGGTAAAGACATGAAT 59.424 41.667 0.00 0.00 0.00 2.57
236 237 3.938963 GCTCGATTGGGTAAAGACATGAA 59.061 43.478 0.00 0.00 0.00 2.57
237 238 3.055458 TGCTCGATTGGGTAAAGACATGA 60.055 43.478 0.00 0.00 0.00 3.07
238 239 3.270027 TGCTCGATTGGGTAAAGACATG 58.730 45.455 0.00 0.00 0.00 3.21
239 240 3.055094 ACTGCTCGATTGGGTAAAGACAT 60.055 43.478 0.00 0.00 0.00 3.06
240 241 2.301870 ACTGCTCGATTGGGTAAAGACA 59.698 45.455 0.00 0.00 0.00 3.41
241 242 2.930682 GACTGCTCGATTGGGTAAAGAC 59.069 50.000 0.00 0.00 0.00 3.01
242 243 2.565391 TGACTGCTCGATTGGGTAAAGA 59.435 45.455 0.00 0.00 0.00 2.52
243 244 2.972625 TGACTGCTCGATTGGGTAAAG 58.027 47.619 0.00 0.00 0.00 1.85
244 245 3.410631 TTGACTGCTCGATTGGGTAAA 57.589 42.857 0.00 0.00 0.00 2.01
245 246 3.410631 TTTGACTGCTCGATTGGGTAA 57.589 42.857 0.00 0.00 0.00 2.85
246 247 3.627395 ATTTGACTGCTCGATTGGGTA 57.373 42.857 0.00 0.00 0.00 3.69
247 248 2.496899 ATTTGACTGCTCGATTGGGT 57.503 45.000 0.00 0.00 0.00 4.51
248 249 3.242870 GCTAATTTGACTGCTCGATTGGG 60.243 47.826 0.00 0.00 0.00 4.12
249 250 3.374988 TGCTAATTTGACTGCTCGATTGG 59.625 43.478 0.00 0.00 0.00 3.16
250 251 4.093998 AGTGCTAATTTGACTGCTCGATTG 59.906 41.667 0.00 0.00 0.00 2.67
251 252 4.256920 AGTGCTAATTTGACTGCTCGATT 58.743 39.130 0.00 0.00 0.00 3.34
252 253 3.866651 AGTGCTAATTTGACTGCTCGAT 58.133 40.909 0.00 0.00 0.00 3.59
253 254 3.056536 AGAGTGCTAATTTGACTGCTCGA 60.057 43.478 0.00 0.00 0.00 4.04
254 255 3.257393 AGAGTGCTAATTTGACTGCTCG 58.743 45.455 0.00 0.00 0.00 5.03
255 256 5.619625 AAAGAGTGCTAATTTGACTGCTC 57.380 39.130 0.00 0.00 0.00 4.26
256 257 7.693969 ATAAAAGAGTGCTAATTTGACTGCT 57.306 32.000 0.00 0.00 0.00 4.24
257 258 8.669243 ACTATAAAAGAGTGCTAATTTGACTGC 58.331 33.333 0.00 0.00 0.00 4.40
285 286 9.130312 GCTAGTGTGTATGTATTCTGCTTATAC 57.870 37.037 0.00 0.00 0.00 1.47
286 287 8.856103 TGCTAGTGTGTATGTATTCTGCTTATA 58.144 33.333 0.00 0.00 0.00 0.98
287 288 7.726216 TGCTAGTGTGTATGTATTCTGCTTAT 58.274 34.615 0.00 0.00 0.00 1.73
288 289 7.107639 TGCTAGTGTGTATGTATTCTGCTTA 57.892 36.000 0.00 0.00 0.00 3.09
289 290 5.977635 TGCTAGTGTGTATGTATTCTGCTT 58.022 37.500 0.00 0.00 0.00 3.91
290 291 5.127845 ACTGCTAGTGTGTATGTATTCTGCT 59.872 40.000 0.00 0.00 0.00 4.24
291 292 5.352284 ACTGCTAGTGTGTATGTATTCTGC 58.648 41.667 0.00 0.00 0.00 4.26
292 293 6.256539 CCAACTGCTAGTGTGTATGTATTCTG 59.743 42.308 0.00 0.00 0.00 3.02
293 294 6.341316 CCAACTGCTAGTGTGTATGTATTCT 58.659 40.000 0.00 0.00 0.00 2.40
294 295 5.006746 GCCAACTGCTAGTGTGTATGTATTC 59.993 44.000 0.00 0.00 36.87 1.75
295 296 4.876107 GCCAACTGCTAGTGTGTATGTATT 59.124 41.667 0.00 0.00 36.87 1.89
296 297 4.442706 GCCAACTGCTAGTGTGTATGTAT 58.557 43.478 0.00 0.00 36.87 2.29
297 298 3.857052 GCCAACTGCTAGTGTGTATGTA 58.143 45.455 0.00 0.00 36.87 2.29
298 299 2.699954 GCCAACTGCTAGTGTGTATGT 58.300 47.619 0.00 0.00 36.87 2.29
310 311 3.343617 TGATTTGGTACTAGCCAACTGC 58.656 45.455 1.63 0.00 46.98 4.40
311 312 5.240623 TGTTTGATTTGGTACTAGCCAACTG 59.759 40.000 1.63 0.00 46.98 3.16
312 313 5.381757 TGTTTGATTTGGTACTAGCCAACT 58.618 37.500 1.63 0.00 46.98 3.16
313 314 5.240844 ACTGTTTGATTTGGTACTAGCCAAC 59.759 40.000 1.63 0.00 46.98 3.77
314 315 5.381757 ACTGTTTGATTTGGTACTAGCCAA 58.618 37.500 0.00 0.00 45.83 4.52
315 316 4.980573 ACTGTTTGATTTGGTACTAGCCA 58.019 39.130 0.00 0.00 36.62 4.75
316 317 5.001232 TGACTGTTTGATTTGGTACTAGCC 58.999 41.667 0.00 0.00 0.00 3.93
317 318 6.554334 TTGACTGTTTGATTTGGTACTAGC 57.446 37.500 0.00 0.00 0.00 3.42
318 319 9.965824 AAATTTGACTGTTTGATTTGGTACTAG 57.034 29.630 0.00 0.00 0.00 2.57
320 321 9.313118 GAAAATTTGACTGTTTGATTTGGTACT 57.687 29.630 0.00 0.00 0.00 2.73
321 322 9.092876 TGAAAATTTGACTGTTTGATTTGGTAC 57.907 29.630 0.00 0.00 0.00 3.34
322 323 9.829507 ATGAAAATTTGACTGTTTGATTTGGTA 57.170 25.926 0.00 0.00 0.00 3.25
323 324 8.735692 ATGAAAATTTGACTGTTTGATTTGGT 57.264 26.923 0.00 0.00 0.00 3.67
324 325 8.005466 CGATGAAAATTTGACTGTTTGATTTGG 58.995 33.333 0.00 0.00 0.00 3.28
325 326 7.528182 GCGATGAAAATTTGACTGTTTGATTTG 59.472 33.333 0.00 0.00 0.00 2.32
326 327 7.307337 GGCGATGAAAATTTGACTGTTTGATTT 60.307 33.333 0.00 0.00 0.00 2.17
327 328 6.146021 GGCGATGAAAATTTGACTGTTTGATT 59.854 34.615 0.00 0.00 0.00 2.57
328 329 5.634859 GGCGATGAAAATTTGACTGTTTGAT 59.365 36.000 0.00 0.00 0.00 2.57
329 330 4.981674 GGCGATGAAAATTTGACTGTTTGA 59.018 37.500 0.00 0.00 0.00 2.69
330 331 4.744137 TGGCGATGAAAATTTGACTGTTTG 59.256 37.500 0.00 0.00 0.00 2.93
331 332 4.744631 GTGGCGATGAAAATTTGACTGTTT 59.255 37.500 0.00 0.00 0.00 2.83
332 333 4.202101 TGTGGCGATGAAAATTTGACTGTT 60.202 37.500 0.00 0.00 0.00 3.16
333 334 3.317711 TGTGGCGATGAAAATTTGACTGT 59.682 39.130 0.00 0.00 0.00 3.55
334 335 3.670055 GTGTGGCGATGAAAATTTGACTG 59.330 43.478 0.00 0.00 0.00 3.51
335 336 3.317711 TGTGTGGCGATGAAAATTTGACT 59.682 39.130 0.00 0.00 0.00 3.41
336 337 3.425193 GTGTGTGGCGATGAAAATTTGAC 59.575 43.478 0.00 0.00 0.00 3.18
337 338 3.317711 AGTGTGTGGCGATGAAAATTTGA 59.682 39.130 0.00 0.00 0.00 2.69
338 339 3.641648 AGTGTGTGGCGATGAAAATTTG 58.358 40.909 0.00 0.00 0.00 2.32
339 340 3.569701 AGAGTGTGTGGCGATGAAAATTT 59.430 39.130 0.00 0.00 0.00 1.82
340 341 3.149196 AGAGTGTGTGGCGATGAAAATT 58.851 40.909 0.00 0.00 0.00 1.82
341 342 2.783135 AGAGTGTGTGGCGATGAAAAT 58.217 42.857 0.00 0.00 0.00 1.82
342 343 2.254546 AGAGTGTGTGGCGATGAAAA 57.745 45.000 0.00 0.00 0.00 2.29
343 344 2.143122 GAAGAGTGTGTGGCGATGAAA 58.857 47.619 0.00 0.00 0.00 2.69
344 345 1.608025 GGAAGAGTGTGTGGCGATGAA 60.608 52.381 0.00 0.00 0.00 2.57
345 346 0.037326 GGAAGAGTGTGTGGCGATGA 60.037 55.000 0.00 0.00 0.00 2.92
346 347 0.036952 AGGAAGAGTGTGTGGCGATG 60.037 55.000 0.00 0.00 0.00 3.84
347 348 0.687354 AAGGAAGAGTGTGTGGCGAT 59.313 50.000 0.00 0.00 0.00 4.58
348 349 0.249868 CAAGGAAGAGTGTGTGGCGA 60.250 55.000 0.00 0.00 0.00 5.54
349 350 0.532862 ACAAGGAAGAGTGTGTGGCG 60.533 55.000 0.00 0.00 0.00 5.69
350 351 1.230324 GACAAGGAAGAGTGTGTGGC 58.770 55.000 0.00 0.00 0.00 5.01
351 352 1.417890 AGGACAAGGAAGAGTGTGTGG 59.582 52.381 0.00 0.00 0.00 4.17
352 353 2.918712 AGGACAAGGAAGAGTGTGTG 57.081 50.000 0.00 0.00 0.00 3.82
353 354 3.933861 AAAGGACAAGGAAGAGTGTGT 57.066 42.857 0.00 0.00 0.00 3.72
354 355 4.884164 AGAAAAAGGACAAGGAAGAGTGTG 59.116 41.667 0.00 0.00 0.00 3.82
355 356 4.884164 CAGAAAAAGGACAAGGAAGAGTGT 59.116 41.667 0.00 0.00 0.00 3.55
356 357 4.884164 ACAGAAAAAGGACAAGGAAGAGTG 59.116 41.667 0.00 0.00 0.00 3.51
357 358 5.117406 ACAGAAAAAGGACAAGGAAGAGT 57.883 39.130 0.00 0.00 0.00 3.24
358 359 5.221126 CCAACAGAAAAAGGACAAGGAAGAG 60.221 44.000 0.00 0.00 0.00 2.85
359 360 4.644685 CCAACAGAAAAAGGACAAGGAAGA 59.355 41.667 0.00 0.00 0.00 2.87
360 361 4.202151 CCCAACAGAAAAAGGACAAGGAAG 60.202 45.833 0.00 0.00 0.00 3.46
361 362 3.704061 CCCAACAGAAAAAGGACAAGGAA 59.296 43.478 0.00 0.00 0.00 3.36
362 363 3.295973 CCCAACAGAAAAAGGACAAGGA 58.704 45.455 0.00 0.00 0.00 3.36
363 364 2.224042 GCCCAACAGAAAAAGGACAAGG 60.224 50.000 0.00 0.00 0.00 3.61
364 365 2.543653 CGCCCAACAGAAAAAGGACAAG 60.544 50.000 0.00 0.00 0.00 3.16
365 366 1.407258 CGCCCAACAGAAAAAGGACAA 59.593 47.619 0.00 0.00 0.00 3.18
366 367 1.028905 CGCCCAACAGAAAAAGGACA 58.971 50.000 0.00 0.00 0.00 4.02
367 368 1.029681 ACGCCCAACAGAAAAAGGAC 58.970 50.000 0.00 0.00 0.00 3.85
368 369 1.028905 CACGCCCAACAGAAAAAGGA 58.971 50.000 0.00 0.00 0.00 3.36
369 370 0.597377 GCACGCCCAACAGAAAAAGG 60.597 55.000 0.00 0.00 0.00 3.11
370 371 0.597377 GGCACGCCCAACAGAAAAAG 60.597 55.000 0.00 0.00 0.00 2.27
371 372 1.323271 TGGCACGCCCAACAGAAAAA 61.323 50.000 5.42 0.00 41.82 1.94
372 373 1.733402 CTGGCACGCCCAACAGAAAA 61.733 55.000 5.42 0.00 44.81 2.29
373 374 2.124109 TGGCACGCCCAACAGAAA 60.124 55.556 5.42 0.00 41.82 2.52
374 375 2.594303 CTGGCACGCCCAACAGAA 60.594 61.111 5.42 0.00 44.81 3.02
375 376 4.641645 CCTGGCACGCCCAACAGA 62.642 66.667 5.42 0.00 44.81 3.41
385 386 4.120331 GACGCAATGGCCTGGCAC 62.120 66.667 22.05 10.55 36.38 5.01
388 389 3.499737 GACGACGCAATGGCCTGG 61.500 66.667 3.32 0.00 36.38 4.45
389 390 3.499737 GGACGACGCAATGGCCTG 61.500 66.667 3.32 0.00 36.38 4.85
390 391 4.778143 GGGACGACGCAATGGCCT 62.778 66.667 3.32 0.00 36.38 5.19
391 392 4.778143 AGGGACGACGCAATGGCC 62.778 66.667 0.00 0.00 36.38 5.36
392 393 3.499737 CAGGGACGACGCAATGGC 61.500 66.667 4.64 0.00 0.00 4.40
393 394 1.375396 TTCAGGGACGACGCAATGG 60.375 57.895 4.64 0.00 0.00 3.16
394 395 0.670546 AGTTCAGGGACGACGCAATG 60.671 55.000 4.64 0.00 0.00 2.82
395 396 0.389948 GAGTTCAGGGACGACGCAAT 60.390 55.000 4.64 0.00 0.00 3.56
396 397 1.006571 GAGTTCAGGGACGACGCAA 60.007 57.895 4.64 0.00 0.00 4.85
397 398 1.532604 ATGAGTTCAGGGACGACGCA 61.533 55.000 4.64 0.00 0.00 5.24
398 399 0.802607 GATGAGTTCAGGGACGACGC 60.803 60.000 0.00 0.00 0.00 5.19
399 400 0.526211 TGATGAGTTCAGGGACGACG 59.474 55.000 0.00 0.00 0.00 5.12
400 401 2.743636 TTGATGAGTTCAGGGACGAC 57.256 50.000 0.00 0.00 35.27 4.34
401 402 3.762407 TTTTGATGAGTTCAGGGACGA 57.238 42.857 0.00 0.00 35.27 4.20
402 403 4.142600 GGAATTTTGATGAGTTCAGGGACG 60.143 45.833 0.00 0.00 35.27 4.79
403 404 4.142600 CGGAATTTTGATGAGTTCAGGGAC 60.143 45.833 0.00 0.00 35.27 4.46
404 405 4.009675 CGGAATTTTGATGAGTTCAGGGA 58.990 43.478 0.00 0.00 35.27 4.20
405 406 3.758554 ACGGAATTTTGATGAGTTCAGGG 59.241 43.478 0.00 0.00 35.27 4.45
406 407 5.376854 AACGGAATTTTGATGAGTTCAGG 57.623 39.130 0.00 0.00 35.27 3.86
407 408 5.858581 GGAAACGGAATTTTGATGAGTTCAG 59.141 40.000 0.00 0.00 35.27 3.02
408 409 5.278758 GGGAAACGGAATTTTGATGAGTTCA 60.279 40.000 0.00 0.00 0.00 3.18
409 410 5.161358 GGGAAACGGAATTTTGATGAGTTC 58.839 41.667 0.00 0.00 0.00 3.01
410 411 4.021456 GGGGAAACGGAATTTTGATGAGTT 60.021 41.667 0.00 0.00 0.00 3.01
411 412 3.509967 GGGGAAACGGAATTTTGATGAGT 59.490 43.478 0.00 0.00 0.00 3.41
412 413 3.427503 CGGGGAAACGGAATTTTGATGAG 60.428 47.826 0.00 0.00 0.00 2.90
413 414 2.490115 CGGGGAAACGGAATTTTGATGA 59.510 45.455 0.00 0.00 0.00 2.92
414 415 2.874849 CGGGGAAACGGAATTTTGATG 58.125 47.619 0.00 0.00 0.00 3.07
439 440 4.394078 TCGTCGACAACCTCGCCG 62.394 66.667 17.16 0.00 44.94 6.46
440 441 2.804090 GTCGTCGACAACCTCGCC 60.804 66.667 20.28 0.00 42.62 5.54
441 442 2.050714 TGTCGTCGACAACCTCGC 60.051 61.111 25.13 0.00 39.78 5.03
442 443 0.452950 CTCTGTCGTCGACAACCTCG 60.453 60.000 26.79 15.81 42.26 4.63
443 444 0.592148 ACTCTGTCGTCGACAACCTC 59.408 55.000 26.79 0.36 42.26 3.85
444 445 1.805345 CTACTCTGTCGTCGACAACCT 59.195 52.381 26.79 14.61 42.26 3.50
445 446 1.802960 TCTACTCTGTCGTCGACAACC 59.197 52.381 26.79 1.50 42.26 3.77
446 447 2.725452 GCTCTACTCTGTCGTCGACAAC 60.725 54.545 26.79 8.25 42.26 3.32
447 448 1.463831 GCTCTACTCTGTCGTCGACAA 59.536 52.381 26.79 16.90 42.26 3.18
448 449 1.077123 GCTCTACTCTGTCGTCGACA 58.923 55.000 25.51 25.51 40.50 4.35
449 450 0.025256 CGCTCTACTCTGTCGTCGAC 59.975 60.000 18.51 18.51 0.00 4.20
450 451 0.389556 ACGCTCTACTCTGTCGTCGA 60.390 55.000 0.00 0.00 0.00 4.20
451 452 0.247340 CACGCTCTACTCTGTCGTCG 60.247 60.000 0.00 0.00 0.00 5.12
452 453 1.077123 TCACGCTCTACTCTGTCGTC 58.923 55.000 0.00 0.00 0.00 4.20
453 454 1.465387 CTTCACGCTCTACTCTGTCGT 59.535 52.381 0.00 0.00 0.00 4.34
454 455 1.732809 TCTTCACGCTCTACTCTGTCG 59.267 52.381 0.00 0.00 0.00 4.35
455 456 3.494232 GTTCTTCACGCTCTACTCTGTC 58.506 50.000 0.00 0.00 0.00 3.51
456 457 2.229302 GGTTCTTCACGCTCTACTCTGT 59.771 50.000 0.00 0.00 0.00 3.41
457 458 2.416162 GGGTTCTTCACGCTCTACTCTG 60.416 54.545 0.00 0.00 35.40 3.35
458 459 1.819903 GGGTTCTTCACGCTCTACTCT 59.180 52.381 0.00 0.00 35.40 3.24
459 460 1.467713 CGGGTTCTTCACGCTCTACTC 60.468 57.143 0.00 0.00 35.72 2.59
460 461 0.526662 CGGGTTCTTCACGCTCTACT 59.473 55.000 0.00 0.00 35.72 2.57
461 462 0.524862 TCGGGTTCTTCACGCTCTAC 59.475 55.000 0.00 0.00 43.41 2.59
462 463 1.134367 CATCGGGTTCTTCACGCTCTA 59.866 52.381 0.00 0.00 43.41 2.43
463 464 0.108615 CATCGGGTTCTTCACGCTCT 60.109 55.000 0.00 0.00 43.41 4.09
464 465 0.108804 TCATCGGGTTCTTCACGCTC 60.109 55.000 0.00 0.00 43.41 5.03
465 466 0.537188 ATCATCGGGTTCTTCACGCT 59.463 50.000 0.00 0.00 43.41 5.07
466 467 0.931005 GATCATCGGGTTCTTCACGC 59.069 55.000 0.00 0.00 43.41 5.34
467 468 2.464865 GAGATCATCGGGTTCTTCACG 58.535 52.381 0.00 0.00 45.33 4.35
479 480 1.979469 CATAACGTCGCCGAGATCATC 59.021 52.381 0.00 0.00 37.88 2.92
480 481 1.607148 TCATAACGTCGCCGAGATCAT 59.393 47.619 0.00 0.00 37.88 2.45
481 482 1.018910 TCATAACGTCGCCGAGATCA 58.981 50.000 0.00 0.00 37.88 2.92
482 483 1.779724 GTTCATAACGTCGCCGAGATC 59.220 52.381 0.00 0.00 37.88 2.75
483 484 1.535437 GGTTCATAACGTCGCCGAGAT 60.535 52.381 0.00 0.00 37.88 2.75
484 485 0.179156 GGTTCATAACGTCGCCGAGA 60.179 55.000 0.00 0.00 37.88 4.04
485 486 1.143969 GGGTTCATAACGTCGCCGAG 61.144 60.000 0.00 0.00 37.88 4.63
486 487 1.153784 GGGTTCATAACGTCGCCGA 60.154 57.895 0.00 0.00 37.88 5.54
487 488 2.510594 CGGGTTCATAACGTCGCCG 61.511 63.158 0.00 0.00 40.83 6.46
488 489 2.805807 GCGGGTTCATAACGTCGCC 61.806 63.158 14.07 0.00 43.66 5.54
489 490 1.426041 ATGCGGGTTCATAACGTCGC 61.426 55.000 16.57 16.57 46.87 5.19
490 491 0.300491 CATGCGGGTTCATAACGTCG 59.700 55.000 0.00 0.00 33.81 5.12
491 492 1.365699 ACATGCGGGTTCATAACGTC 58.634 50.000 0.00 0.00 0.00 4.34
492 493 2.166870 TCTACATGCGGGTTCATAACGT 59.833 45.455 0.00 0.00 0.00 3.99
493 494 2.816689 TCTACATGCGGGTTCATAACG 58.183 47.619 0.00 0.00 0.00 3.18
494 495 3.311596 GGTTCTACATGCGGGTTCATAAC 59.688 47.826 0.00 0.00 0.00 1.89
495 496 3.537580 GGTTCTACATGCGGGTTCATAA 58.462 45.455 0.00 0.00 0.00 1.90
496 497 2.158871 GGGTTCTACATGCGGGTTCATA 60.159 50.000 0.00 0.00 0.00 2.15
497 498 1.408266 GGGTTCTACATGCGGGTTCAT 60.408 52.381 0.00 0.00 0.00 2.57
498 499 0.035820 GGGTTCTACATGCGGGTTCA 60.036 55.000 0.00 0.00 0.00 3.18
499 500 1.087771 CGGGTTCTACATGCGGGTTC 61.088 60.000 0.00 0.00 0.00 3.62
500 501 1.078708 CGGGTTCTACATGCGGGTT 60.079 57.895 0.00 0.00 0.00 4.11
501 502 1.335132 ATCGGGTTCTACATGCGGGT 61.335 55.000 0.00 0.00 0.00 5.28
502 503 0.880278 CATCGGGTTCTACATGCGGG 60.880 60.000 0.00 0.00 0.00 6.13
503 504 0.104120 TCATCGGGTTCTACATGCGG 59.896 55.000 0.00 0.00 0.00 5.69
504 505 2.061773 GATCATCGGGTTCTACATGCG 58.938 52.381 0.00 0.00 0.00 4.73
505 506 3.321497 GAGATCATCGGGTTCTACATGC 58.679 50.000 0.00 0.00 0.00 4.06
506 507 3.321968 TGGAGATCATCGGGTTCTACATG 59.678 47.826 0.00 0.00 32.36 3.21
507 508 3.322254 GTGGAGATCATCGGGTTCTACAT 59.678 47.826 0.00 0.00 38.22 2.29
508 509 2.693591 GTGGAGATCATCGGGTTCTACA 59.306 50.000 0.00 0.00 34.45 2.74
509 510 2.959707 AGTGGAGATCATCGGGTTCTAC 59.040 50.000 0.00 0.00 0.00 2.59
510 511 3.223435 GAGTGGAGATCATCGGGTTCTA 58.777 50.000 0.00 0.00 0.00 2.10
511 512 2.035632 GAGTGGAGATCATCGGGTTCT 58.964 52.381 0.00 0.00 0.00 3.01
512 513 1.069358 GGAGTGGAGATCATCGGGTTC 59.931 57.143 0.00 0.00 0.00 3.62
513 514 1.123928 GGAGTGGAGATCATCGGGTT 58.876 55.000 0.00 0.00 0.00 4.11
514 515 0.760945 GGGAGTGGAGATCATCGGGT 60.761 60.000 0.00 0.00 0.00 5.28
515 516 1.810606 CGGGAGTGGAGATCATCGGG 61.811 65.000 0.00 0.00 0.00 5.14
516 517 1.662608 CGGGAGTGGAGATCATCGG 59.337 63.158 0.00 0.00 0.00 4.18
517 518 1.662608 CCGGGAGTGGAGATCATCG 59.337 63.158 0.00 0.00 0.00 3.84
518 519 2.053618 CCCGGGAGTGGAGATCATC 58.946 63.158 18.48 0.00 0.00 2.92
519 520 2.143419 GCCCGGGAGTGGAGATCAT 61.143 63.158 29.31 0.00 0.00 2.45
520 521 2.764128 GCCCGGGAGTGGAGATCA 60.764 66.667 29.31 0.00 0.00 2.92
521 522 1.627297 AAAGCCCGGGAGTGGAGATC 61.627 60.000 29.31 1.92 0.00 2.75
522 523 1.208165 AAAAGCCCGGGAGTGGAGAT 61.208 55.000 29.31 0.00 0.00 2.75
523 524 1.423794 AAAAAGCCCGGGAGTGGAGA 61.424 55.000 29.31 0.00 0.00 3.71
524 525 1.074951 AAAAAGCCCGGGAGTGGAG 59.925 57.895 29.31 0.00 0.00 3.86
525 526 3.257133 AAAAAGCCCGGGAGTGGA 58.743 55.556 29.31 0.00 0.00 4.02
545 546 1.073284 CCCGGGAGTCTTCCTCAAAAA 59.927 52.381 18.48 0.00 43.49 1.94
546 547 0.690762 CCCGGGAGTCTTCCTCAAAA 59.309 55.000 18.48 0.00 43.49 2.44
547 548 1.838073 GCCCGGGAGTCTTCCTCAAA 61.838 60.000 29.31 0.00 43.49 2.69
548 549 2.291043 GCCCGGGAGTCTTCCTCAA 61.291 63.158 29.31 0.00 43.49 3.02
549 550 2.683933 GCCCGGGAGTCTTCCTCA 60.684 66.667 29.31 0.00 43.49 3.86
865 866 4.240103 TCTGGATGGGCCGCATCG 62.240 66.667 21.03 12.54 40.66 3.84
866 867 2.592861 GTCTGGATGGGCCGCATC 60.593 66.667 20.18 20.18 40.66 3.91
867 868 4.195334 GGTCTGGATGGGCCGCAT 62.195 66.667 6.43 6.43 40.66 4.73
869 870 4.864334 CTGGTCTGGATGGGCCGC 62.864 72.222 0.00 0.00 40.66 6.53
870 871 2.669133 TTCTGGTCTGGATGGGCCG 61.669 63.158 0.00 0.00 40.66 6.13
871 872 1.077429 GTTCTGGTCTGGATGGGCC 60.077 63.158 0.00 0.00 37.10 5.80
872 873 1.450312 CGTTCTGGTCTGGATGGGC 60.450 63.158 0.00 0.00 0.00 5.36
873 874 1.221840 CCGTTCTGGTCTGGATGGG 59.778 63.158 0.00 0.00 0.00 4.00
874 875 1.450312 GCCGTTCTGGTCTGGATGG 60.450 63.158 0.00 0.00 41.21 3.51
875 876 1.450312 GGCCGTTCTGGTCTGGATG 60.450 63.158 0.00 0.00 40.15 3.51
876 877 2.670148 GGGCCGTTCTGGTCTGGAT 61.670 63.158 0.00 0.00 44.07 3.41
877 878 3.319198 GGGCCGTTCTGGTCTGGA 61.319 66.667 0.00 0.00 44.07 3.86
878 879 4.760047 CGGGCCGTTCTGGTCTGG 62.760 72.222 19.97 0.00 45.67 3.86
908 909 4.195334 GGTCTGGATGGGCCGCAT 62.195 66.667 6.43 6.43 40.66 4.73
958 959 2.491693 CTCAGGAAGAAGAAGAGAGCGT 59.508 50.000 0.00 0.00 0.00 5.07
959 960 2.735126 GCTCAGGAAGAAGAAGAGAGCG 60.735 54.545 0.00 0.00 37.81 5.03
960 961 2.233431 TGCTCAGGAAGAAGAAGAGAGC 59.767 50.000 0.00 0.00 45.23 4.09
961 962 3.673052 CGTGCTCAGGAAGAAGAAGAGAG 60.673 52.174 0.00 0.00 0.00 3.20
1011 1012 1.427072 AAAGGGGAGAGGGGTGTGTG 61.427 60.000 0.00 0.00 0.00 3.82
1012 1013 1.072930 AAAGGGGAGAGGGGTGTGT 60.073 57.895 0.00 0.00 0.00 3.72
1014 1015 1.541620 GGAAAGGGGAGAGGGGTGT 60.542 63.158 0.00 0.00 0.00 4.16
1029 1038 2.186903 GCCATCTTCTCGCCGGAA 59.813 61.111 5.05 0.00 0.00 4.30
1292 1301 1.223858 TGGGGATGGAGATGAGATGGA 59.776 52.381 0.00 0.00 0.00 3.41
1307 1330 2.764128 GTGGGAGCGAGATGGGGA 60.764 66.667 0.00 0.00 0.00 4.81
1321 1344 1.495509 CGGTGTGTTGTATGCGTGG 59.504 57.895 0.00 0.00 0.00 4.94
1331 1354 1.607612 GATCCCATCCCGGTGTGTT 59.392 57.895 0.00 0.00 0.00 3.32
1332 1355 2.375345 GGATCCCATCCCGGTGTGT 61.375 63.158 0.00 0.00 43.88 3.72
1378 1410 6.128391 GCCTGTGAGAGTAAGATCGATACTAG 60.128 46.154 12.44 7.46 33.85 2.57
1384 1416 2.685388 CTGCCTGTGAGAGTAAGATCGA 59.315 50.000 0.00 0.00 0.00 3.59
1392 1424 0.252421 TGATCCCTGCCTGTGAGAGT 60.252 55.000 0.00 0.00 0.00 3.24
1446 1498 3.506743 TTGCTTGGGGGCCTGTCA 61.507 61.111 0.84 0.00 0.00 3.58
1452 1504 0.180171 AAAAACTGTTGCTTGGGGGC 59.820 50.000 0.00 0.00 0.00 5.80
1470 1522 5.915812 TCGAATCGAATCTGACACAAAAA 57.084 34.783 1.57 0.00 31.06 1.94
1471 1523 6.480524 AATCGAATCGAATCTGACACAAAA 57.519 33.333 10.12 0.00 39.99 2.44
1472 1524 5.220209 CGAATCGAATCGAATCTGACACAAA 60.220 40.000 17.84 0.00 45.48 2.83
1473 1525 4.265320 CGAATCGAATCGAATCTGACACAA 59.735 41.667 17.84 0.00 45.48 3.33
1474 1526 3.791353 CGAATCGAATCGAATCTGACACA 59.209 43.478 17.84 0.00 45.48 3.72
1475 1527 4.347566 CGAATCGAATCGAATCTGACAC 57.652 45.455 17.84 0.00 45.48 3.67
1491 1543 1.792949 CACCCCGAATCGAATCGAATC 59.207 52.381 23.84 10.29 45.48 2.52
1570 1622 7.921304 TGGACCTATGCATCTATACATTTCAT 58.079 34.615 0.19 0.00 0.00 2.57
1580 1632 8.699130 CAATATGTCTATGGACCTATGCATCTA 58.301 37.037 0.19 0.00 41.47 1.98
1582 1634 6.765036 CCAATATGTCTATGGACCTATGCATC 59.235 42.308 0.19 0.00 41.47 3.91
1584 1636 5.784906 TCCAATATGTCTATGGACCTATGCA 59.215 40.000 6.77 0.00 41.47 3.96
1591 1643 5.764686 TGCACATTCCAATATGTCTATGGAC 59.235 40.000 1.56 1.56 42.42 4.02
1593 1645 5.766670 ACTGCACATTCCAATATGTCTATGG 59.233 40.000 0.00 0.00 36.64 2.74
1639 1691 2.519013 GCCTCCTGGAAGAAAACACAT 58.481 47.619 0.00 0.00 34.07 3.21
1696 1753 2.505982 CAGTCGGTATGGCCCCTG 59.494 66.667 0.00 0.00 0.00 4.45
1773 1830 0.755079 CTGATCGAATGGGAGGCTGA 59.245 55.000 0.00 0.00 0.00 4.26
1786 1843 4.104066 CGAAGCATGATAGATCCTGATCG 58.896 47.826 0.00 4.69 42.48 3.69
1817 1874 6.584563 GGCGCATACAAGAGAAAATTAAAACA 59.415 34.615 10.83 0.00 0.00 2.83
1866 1924 2.058829 AAATAAATGAGGCGCGCCCG 62.059 55.000 44.47 0.00 39.21 6.13
1868 1926 0.100503 ACAAATAAATGAGGCGCGCC 59.899 50.000 42.34 42.34 0.00 6.53
1872 1930 2.223572 GGCCAGACAAATAAATGAGGCG 60.224 50.000 0.00 0.00 37.25 5.52
1926 1984 2.840753 GGGGTGCCAAGGTGGAAGA 61.841 63.158 0.00 0.00 40.96 2.87
1927 1985 2.283173 GGGGTGCCAAGGTGGAAG 60.283 66.667 0.00 0.00 40.96 3.46
1949 2007 1.202976 AGCTCTGATTGGGCAAACTGT 60.203 47.619 0.00 0.00 0.00 3.55
1951 2009 1.542492 CAGCTCTGATTGGGCAAACT 58.458 50.000 0.00 0.00 0.00 2.66
2123 2201 4.608170 TCCAAGGCAGGATCCTTTTATT 57.392 40.909 13.00 1.80 43.62 1.40
2126 2205 2.999185 TTCCAAGGCAGGATCCTTTT 57.001 45.000 13.00 4.23 43.62 2.27
2172 2251 4.875536 CGGACATGATTGGTTGATCAAGTA 59.124 41.667 8.80 0.00 37.89 2.24
2173 2252 3.691118 CGGACATGATTGGTTGATCAAGT 59.309 43.478 8.80 0.00 39.77 3.16
2329 2430 8.139350 CCTCGTGGTGTTAGAATATGTTGTATA 58.861 37.037 0.00 0.00 0.00 1.47
2330 2431 6.984474 CCTCGTGGTGTTAGAATATGTTGTAT 59.016 38.462 0.00 0.00 0.00 2.29
2485 2586 0.770499 TTGGAGGAGCACCAACATCA 59.230 50.000 2.07 0.00 41.64 3.07
2611 2712 1.134280 CCATCACCAGTCCCATGAGTC 60.134 57.143 0.00 0.00 0.00 3.36
2650 2751 3.129871 GCTCATCATACCTTCAGAGCAC 58.870 50.000 7.29 0.00 45.67 4.40
2696 2797 9.429359 CTGATTCATGAGTAACTACTTGAAACT 57.571 33.333 7.67 0.00 36.91 2.66
2827 3080 0.238289 CGGCATTACGATTCATGGCC 59.762 55.000 0.00 0.00 41.75 5.36
2970 3223 8.713971 ACTCCCATATATACAAGTGAAACATGA 58.286 33.333 0.00 0.00 37.85 3.07
3022 3276 7.173218 CCATAAGTCTAGCACTCTTGTTTTTCA 59.827 37.037 0.00 0.00 32.30 2.69
3032 3286 3.567397 TCCTCCCATAAGTCTAGCACTC 58.433 50.000 0.00 0.00 32.30 3.51
3034 3288 2.630580 CCTCCTCCCATAAGTCTAGCAC 59.369 54.545 0.00 0.00 0.00 4.40
3066 3320 1.229336 CGGGAGGAGGCCTATGGAT 60.229 63.158 4.42 0.00 31.76 3.41
3067 3321 1.365894 TACGGGAGGAGGCCTATGGA 61.366 60.000 4.42 0.00 31.76 3.41
3068 3322 0.471211 TTACGGGAGGAGGCCTATGG 60.471 60.000 4.42 0.00 31.76 2.74
3081 3335 0.392998 AGCAATGGCAGACTTACGGG 60.393 55.000 0.00 0.00 44.61 5.28
3135 3389 1.815613 CACCATGCACCCGTTAATCAA 59.184 47.619 0.00 0.00 0.00 2.57
3163 3417 3.829601 AGATCCAGGCTATTTAGAGACGG 59.170 47.826 0.00 0.00 0.00 4.79
3164 3418 4.764823 AGAGATCCAGGCTATTTAGAGACG 59.235 45.833 0.00 0.00 0.00 4.18
3168 3422 5.083122 CCTGAGAGATCCAGGCTATTTAGA 58.917 45.833 3.86 0.00 43.93 2.10
3198 3452 5.965033 AGCTACCCTCAATCCCATATATG 57.035 43.478 5.68 5.68 0.00 1.78
3355 3613 6.386654 CAATTAATTTTGTAGAGCGGTTGGT 58.613 36.000 0.00 0.00 0.00 3.67
3361 3619 4.992688 TGCCCAATTAATTTTGTAGAGCG 58.007 39.130 0.00 0.00 0.00 5.03
3483 3741 0.247419 CGTGCACGCAGAAAGCATAG 60.247 55.000 28.16 0.00 46.13 2.23
3485 3743 2.253758 ACGTGCACGCAGAAAGCAT 61.254 52.632 37.35 13.37 46.13 3.79
3502 3760 0.326264 ACCTCAACCCAGAGCATCAC 59.674 55.000 0.00 0.00 37.82 3.06
3505 3763 1.280421 GAGAACCTCAACCCAGAGCAT 59.720 52.381 0.00 0.00 34.26 3.79
3508 3766 1.974236 ACAGAGAACCTCAACCCAGAG 59.026 52.381 0.00 0.00 32.06 3.35
3510 3768 2.880890 CAAACAGAGAACCTCAACCCAG 59.119 50.000 0.00 0.00 32.06 4.45
3536 3794 6.107901 AGAATCCTAGAAATATTCAGCGCT 57.892 37.500 2.64 2.64 33.06 5.92
3537 3795 6.401955 GAGAATCCTAGAAATATTCAGCGC 57.598 41.667 0.00 0.00 33.06 5.92
3554 3812 2.357257 GGGGAGGAAACAAGGGAGAATC 60.357 54.545 0.00 0.00 0.00 2.52
3555 3813 1.641192 GGGGAGGAAACAAGGGAGAAT 59.359 52.381 0.00 0.00 0.00 2.40
3556 3814 1.073098 GGGGAGGAAACAAGGGAGAA 58.927 55.000 0.00 0.00 0.00 2.87
3557 3815 0.104144 TGGGGAGGAAACAAGGGAGA 60.104 55.000 0.00 0.00 0.00 3.71
3558 3816 0.777446 TTGGGGAGGAAACAAGGGAG 59.223 55.000 0.00 0.00 0.00 4.30
3559 3817 1.133294 GTTTGGGGAGGAAACAAGGGA 60.133 52.381 0.00 0.00 34.13 4.20
3560 3818 1.133167 AGTTTGGGGAGGAAACAAGGG 60.133 52.381 0.00 0.00 36.03 3.95
3561 3819 1.963515 CAGTTTGGGGAGGAAACAAGG 59.036 52.381 0.00 0.00 36.03 3.61
3562 3820 2.666317 ACAGTTTGGGGAGGAAACAAG 58.334 47.619 0.00 0.00 36.03 3.16
3563 3821 2.838637 ACAGTTTGGGGAGGAAACAA 57.161 45.000 0.00 0.00 36.03 2.83
3564 3822 2.024846 TGAACAGTTTGGGGAGGAAACA 60.025 45.455 0.00 0.00 36.03 2.83
3565 3823 2.661718 TGAACAGTTTGGGGAGGAAAC 58.338 47.619 0.00 0.00 34.15 2.78
3566 3824 3.611025 ATGAACAGTTTGGGGAGGAAA 57.389 42.857 0.00 0.00 0.00 3.13
3567 3825 3.611025 AATGAACAGTTTGGGGAGGAA 57.389 42.857 0.00 0.00 0.00 3.36
3568 3826 4.946160 ATAATGAACAGTTTGGGGAGGA 57.054 40.909 0.00 0.00 0.00 3.71
3569 3827 5.505780 TGTATAATGAACAGTTTGGGGAGG 58.494 41.667 0.00 0.00 0.00 4.30
3570 3828 7.312899 GTTTGTATAATGAACAGTTTGGGGAG 58.687 38.462 0.00 0.00 0.00 4.30
3571 3829 6.209788 GGTTTGTATAATGAACAGTTTGGGGA 59.790 38.462 0.00 0.00 0.00 4.81
3572 3830 6.394809 GGTTTGTATAATGAACAGTTTGGGG 58.605 40.000 0.00 0.00 0.00 4.96
3573 3831 6.090129 CGGTTTGTATAATGAACAGTTTGGG 58.910 40.000 0.00 0.00 0.00 4.12
3574 3832 6.072397 TCCGGTTTGTATAATGAACAGTTTGG 60.072 38.462 0.00 0.00 0.00 3.28
3575 3833 6.904498 TCCGGTTTGTATAATGAACAGTTTG 58.096 36.000 0.00 0.00 0.00 2.93
3576 3834 6.349033 GCTCCGGTTTGTATAATGAACAGTTT 60.349 38.462 0.00 0.00 0.00 2.66
3577 3835 5.123344 GCTCCGGTTTGTATAATGAACAGTT 59.877 40.000 0.00 0.00 0.00 3.16
3578 3836 4.634443 GCTCCGGTTTGTATAATGAACAGT 59.366 41.667 0.00 0.00 0.00 3.55
3579 3837 4.634004 TGCTCCGGTTTGTATAATGAACAG 59.366 41.667 0.00 0.00 0.00 3.16
3580 3838 4.580868 TGCTCCGGTTTGTATAATGAACA 58.419 39.130 0.00 0.00 0.00 3.18
3581 3839 4.873827 TCTGCTCCGGTTTGTATAATGAAC 59.126 41.667 0.00 0.00 0.00 3.18
3582 3840 4.873827 GTCTGCTCCGGTTTGTATAATGAA 59.126 41.667 0.00 0.00 0.00 2.57
3583 3841 4.439057 GTCTGCTCCGGTTTGTATAATGA 58.561 43.478 0.00 0.00 0.00 2.57
3584 3842 3.560068 GGTCTGCTCCGGTTTGTATAATG 59.440 47.826 0.00 0.00 0.00 1.90
3585 3843 3.199071 TGGTCTGCTCCGGTTTGTATAAT 59.801 43.478 0.00 0.00 0.00 1.28
3586 3844 2.568062 TGGTCTGCTCCGGTTTGTATAA 59.432 45.455 0.00 0.00 0.00 0.98
3587 3845 2.167693 CTGGTCTGCTCCGGTTTGTATA 59.832 50.000 0.00 0.00 0.00 1.47
3588 3846 0.981183 TGGTCTGCTCCGGTTTGTAT 59.019 50.000 0.00 0.00 0.00 2.29
3589 3847 0.320374 CTGGTCTGCTCCGGTTTGTA 59.680 55.000 0.00 0.00 0.00 2.41
3590 3848 1.071471 CTGGTCTGCTCCGGTTTGT 59.929 57.895 0.00 0.00 0.00 2.83
3591 3849 1.672356 CCTGGTCTGCTCCGGTTTG 60.672 63.158 0.00 0.00 32.33 2.93
3592 3850 2.750350 CCTGGTCTGCTCCGGTTT 59.250 61.111 0.00 0.00 32.33 3.27
3593 3851 4.021925 GCCTGGTCTGCTCCGGTT 62.022 66.667 0.00 0.00 32.33 4.44
3606 3864 3.741476 GAGCCAAACCAGCGCCTG 61.741 66.667 2.29 1.18 34.64 4.85
3607 3865 3.497884 AAGAGCCAAACCAGCGCCT 62.498 57.895 2.29 0.00 34.64 5.52
3608 3866 2.982744 GAAGAGCCAAACCAGCGCC 61.983 63.158 2.29 0.00 34.64 6.53
3609 3867 2.563427 GAAGAGCCAAACCAGCGC 59.437 61.111 0.00 0.00 34.64 5.92
3610 3868 0.036388 TAGGAAGAGCCAAACCAGCG 60.036 55.000 0.00 0.00 40.02 5.18
3611 3869 2.426842 ATAGGAAGAGCCAAACCAGC 57.573 50.000 0.00 0.00 40.02 4.85
3612 3870 5.946377 ACTAAAATAGGAAGAGCCAAACCAG 59.054 40.000 0.00 0.00 40.02 4.00
3613 3871 5.887754 ACTAAAATAGGAAGAGCCAAACCA 58.112 37.500 0.00 0.00 40.02 3.67
3614 3872 6.208797 ACAACTAAAATAGGAAGAGCCAAACC 59.791 38.462 0.00 0.00 40.02 3.27
3615 3873 7.215719 ACAACTAAAATAGGAAGAGCCAAAC 57.784 36.000 0.00 0.00 40.02 2.93
3616 3874 6.148811 CGACAACTAAAATAGGAAGAGCCAAA 59.851 38.462 0.00 0.00 40.02 3.28
3617 3875 5.642063 CGACAACTAAAATAGGAAGAGCCAA 59.358 40.000 0.00 0.00 40.02 4.52
3618 3876 5.175859 CGACAACTAAAATAGGAAGAGCCA 58.824 41.667 0.00 0.00 40.02 4.75
3619 3877 4.571176 CCGACAACTAAAATAGGAAGAGCC 59.429 45.833 0.00 0.00 0.00 4.70
3620 3878 5.176592 ACCGACAACTAAAATAGGAAGAGC 58.823 41.667 0.00 0.00 0.00 4.09
3621 3879 6.471519 CGTACCGACAACTAAAATAGGAAGAG 59.528 42.308 0.00 0.00 0.00 2.85
3622 3880 6.324819 CGTACCGACAACTAAAATAGGAAGA 58.675 40.000 0.00 0.00 0.00 2.87
3623 3881 5.517770 CCGTACCGACAACTAAAATAGGAAG 59.482 44.000 0.00 0.00 0.00 3.46
3624 3882 5.047377 ACCGTACCGACAACTAAAATAGGAA 60.047 40.000 0.00 0.00 0.00 3.36
3625 3883 4.462483 ACCGTACCGACAACTAAAATAGGA 59.538 41.667 0.00 0.00 0.00 2.94
3626 3884 4.747810 ACCGTACCGACAACTAAAATAGG 58.252 43.478 0.00 0.00 0.00 2.57
3627 3885 5.514204 CAGACCGTACCGACAACTAAAATAG 59.486 44.000 0.00 0.00 0.00 1.73
3628 3886 5.401550 CAGACCGTACCGACAACTAAAATA 58.598 41.667 0.00 0.00 0.00 1.40
3629 3887 4.240096 CAGACCGTACCGACAACTAAAAT 58.760 43.478 0.00 0.00 0.00 1.82
3630 3888 3.552684 CCAGACCGTACCGACAACTAAAA 60.553 47.826 0.00 0.00 0.00 1.52
3631 3889 2.030007 CCAGACCGTACCGACAACTAAA 60.030 50.000 0.00 0.00 0.00 1.85
3632 3890 1.541147 CCAGACCGTACCGACAACTAA 59.459 52.381 0.00 0.00 0.00 2.24
3633 3891 1.167851 CCAGACCGTACCGACAACTA 58.832 55.000 0.00 0.00 0.00 2.24
3634 3892 0.825010 ACCAGACCGTACCGACAACT 60.825 55.000 0.00 0.00 0.00 3.16
3635 3893 0.387750 GACCAGACCGTACCGACAAC 60.388 60.000 0.00 0.00 0.00 3.32
3636 3894 0.538057 AGACCAGACCGTACCGACAA 60.538 55.000 0.00 0.00 0.00 3.18
3637 3895 0.538057 AAGACCAGACCGTACCGACA 60.538 55.000 0.00 0.00 0.00 4.35
3638 3896 1.453155 TAAGACCAGACCGTACCGAC 58.547 55.000 0.00 0.00 0.00 4.79
3639 3897 1.812571 GTTAAGACCAGACCGTACCGA 59.187 52.381 0.00 0.00 0.00 4.69
3640 3898 1.541147 TGTTAAGACCAGACCGTACCG 59.459 52.381 0.00 0.00 0.00 4.02
3641 3899 3.006217 AGTTGTTAAGACCAGACCGTACC 59.994 47.826 0.00 0.00 0.00 3.34
3642 3900 4.248691 AGTTGTTAAGACCAGACCGTAC 57.751 45.455 0.00 0.00 0.00 3.67
3643 3901 5.072741 AGTAGTTGTTAAGACCAGACCGTA 58.927 41.667 0.00 0.00 0.00 4.02
3644 3902 3.893813 AGTAGTTGTTAAGACCAGACCGT 59.106 43.478 0.00 0.00 0.00 4.83
3645 3903 4.516365 AGTAGTTGTTAAGACCAGACCG 57.484 45.455 0.00 0.00 0.00 4.79
3646 3904 6.587206 AGTAGTAGTTGTTAAGACCAGACC 57.413 41.667 0.00 0.00 0.00 3.85
3647 3905 7.325579 CGAAAGTAGTAGTTGTTAAGACCAGAC 59.674 40.741 0.00 0.00 0.00 3.51
3648 3906 7.229306 TCGAAAGTAGTAGTTGTTAAGACCAGA 59.771 37.037 0.00 0.00 0.00 3.86
3649 3907 7.325579 GTCGAAAGTAGTAGTTGTTAAGACCAG 59.674 40.741 0.00 0.00 0.00 4.00
3650 3908 7.013655 AGTCGAAAGTAGTAGTTGTTAAGACCA 59.986 37.037 0.00 0.00 0.00 4.02
3651 3909 7.366513 AGTCGAAAGTAGTAGTTGTTAAGACC 58.633 38.462 0.00 0.00 0.00 3.85
3652 3910 8.072567 TGAGTCGAAAGTAGTAGTTGTTAAGAC 58.927 37.037 0.00 0.00 0.00 3.01
3653 3911 8.158169 TGAGTCGAAAGTAGTAGTTGTTAAGA 57.842 34.615 0.00 0.00 0.00 2.10
3654 3912 8.792831 TTGAGTCGAAAGTAGTAGTTGTTAAG 57.207 34.615 0.00 0.00 0.00 1.85
3655 3913 9.585099 TTTTGAGTCGAAAGTAGTAGTTGTTAA 57.415 29.630 1.08 0.00 0.00 2.01
3656 3914 9.754382 ATTTTGAGTCGAAAGTAGTAGTTGTTA 57.246 29.630 11.20 0.00 0.00 2.41
3657 3915 8.658499 ATTTTGAGTCGAAAGTAGTAGTTGTT 57.342 30.769 11.20 0.00 0.00 2.83
3658 3916 9.754382 TTATTTTGAGTCGAAAGTAGTAGTTGT 57.246 29.630 11.20 0.00 0.00 3.32
3661 3919 9.367444 CCATTATTTTGAGTCGAAAGTAGTAGT 57.633 33.333 11.20 0.00 0.00 2.73
3662 3920 8.818057 CCCATTATTTTGAGTCGAAAGTAGTAG 58.182 37.037 11.20 0.00 0.00 2.57
3663 3921 8.316214 ACCCATTATTTTGAGTCGAAAGTAGTA 58.684 33.333 11.20 0.00 0.00 1.82
3664 3922 7.119262 CACCCATTATTTTGAGTCGAAAGTAGT 59.881 37.037 11.20 0.00 0.00 2.73
3665 3923 7.119262 ACACCCATTATTTTGAGTCGAAAGTAG 59.881 37.037 11.20 2.13 0.00 2.57
3666 3924 6.938030 ACACCCATTATTTTGAGTCGAAAGTA 59.062 34.615 11.20 2.59 0.00 2.24
3667 3925 5.768164 ACACCCATTATTTTGAGTCGAAAGT 59.232 36.000 11.20 0.39 0.00 2.66
3668 3926 6.072728 TGACACCCATTATTTTGAGTCGAAAG 60.073 38.462 11.20 0.00 0.00 2.62
3669 3927 5.765677 TGACACCCATTATTTTGAGTCGAAA 59.234 36.000 8.01 8.01 0.00 3.46
3670 3928 5.180492 GTGACACCCATTATTTTGAGTCGAA 59.820 40.000 0.00 0.00 0.00 3.71
3671 3929 4.693566 GTGACACCCATTATTTTGAGTCGA 59.306 41.667 0.00 0.00 0.00 4.20
3672 3930 4.142687 GGTGACACCCATTATTTTGAGTCG 60.143 45.833 14.16 0.00 30.04 4.18
3673 3931 4.764823 TGGTGACACCCATTATTTTGAGTC 59.235 41.667 22.00 0.00 37.50 3.36
3674 3932 4.735369 TGGTGACACCCATTATTTTGAGT 58.265 39.130 22.00 0.00 37.50 3.41
3710 3968 1.480954 GTAGCGTCCTTCCTTCATGGA 59.519 52.381 0.00 0.00 44.51 3.41
3711 3969 1.473434 GGTAGCGTCCTTCCTTCATGG 60.473 57.143 0.00 0.00 37.10 3.66
3712 3970 1.482593 AGGTAGCGTCCTTCCTTCATG 59.517 52.381 0.00 0.00 35.54 3.07
3713 3971 1.757699 GAGGTAGCGTCCTTCCTTCAT 59.242 52.381 4.36 0.00 38.79 2.57
3714 3972 1.183549 GAGGTAGCGTCCTTCCTTCA 58.816 55.000 4.36 0.00 38.79 3.02
3715 3973 0.460722 GGAGGTAGCGTCCTTCCTTC 59.539 60.000 4.36 0.00 38.79 3.46
3716 3974 0.252103 TGGAGGTAGCGTCCTTCCTT 60.252 55.000 8.94 0.00 38.79 3.36
3717 3975 0.252103 TTGGAGGTAGCGTCCTTCCT 60.252 55.000 8.94 0.00 41.09 3.36
3718 3976 0.611714 TTTGGAGGTAGCGTCCTTCC 59.388 55.000 8.94 8.22 38.97 3.46
3719 3977 2.693267 ATTTGGAGGTAGCGTCCTTC 57.307 50.000 8.94 3.24 38.97 3.46
3720 3978 3.244770 TGAAATTTGGAGGTAGCGTCCTT 60.245 43.478 0.00 0.00 38.97 3.36
3721 3979 2.304761 TGAAATTTGGAGGTAGCGTCCT 59.695 45.455 0.00 2.48 38.97 3.85
3722 3980 2.418976 GTGAAATTTGGAGGTAGCGTCC 59.581 50.000 0.00 1.33 38.71 4.79
3723 3981 2.093783 CGTGAAATTTGGAGGTAGCGTC 59.906 50.000 0.00 0.00 0.00 5.19
3724 3982 2.073816 CGTGAAATTTGGAGGTAGCGT 58.926 47.619 0.00 0.00 0.00 5.07
3725 3983 1.396996 CCGTGAAATTTGGAGGTAGCG 59.603 52.381 0.00 0.00 0.00 4.26
3726 3984 2.433436 ACCGTGAAATTTGGAGGTAGC 58.567 47.619 0.00 0.00 0.00 3.58
3727 3985 5.121768 CAGTTACCGTGAAATTTGGAGGTAG 59.878 44.000 0.00 0.00 35.89 3.18
3728 3986 4.998672 CAGTTACCGTGAAATTTGGAGGTA 59.001 41.667 0.00 3.41 33.58 3.08
3729 3987 3.818773 CAGTTACCGTGAAATTTGGAGGT 59.181 43.478 0.00 4.41 35.91 3.85
3730 3988 3.365969 GCAGTTACCGTGAAATTTGGAGG 60.366 47.826 0.00 0.00 0.00 4.30
3731 3989 3.365969 GGCAGTTACCGTGAAATTTGGAG 60.366 47.826 0.00 0.00 0.00 3.86
3732 3990 2.554893 GGCAGTTACCGTGAAATTTGGA 59.445 45.455 0.00 0.00 0.00 3.53
3733 3991 2.556622 AGGCAGTTACCGTGAAATTTGG 59.443 45.455 0.00 0.00 33.69 3.28
3734 3992 3.915437 AGGCAGTTACCGTGAAATTTG 57.085 42.857 0.00 0.00 33.69 2.32
3735 3993 6.584185 ATTTAGGCAGTTACCGTGAAATTT 57.416 33.333 0.00 0.00 33.69 1.82
3736 3994 6.584185 AATTTAGGCAGTTACCGTGAAATT 57.416 33.333 0.00 0.00 31.84 1.82
3737 3995 7.012989 GGATAATTTAGGCAGTTACCGTGAAAT 59.987 37.037 0.00 0.00 33.69 2.17
3738 3996 6.316890 GGATAATTTAGGCAGTTACCGTGAAA 59.683 38.462 0.00 0.00 33.69 2.69
3739 3997 5.818857 GGATAATTTAGGCAGTTACCGTGAA 59.181 40.000 0.00 0.00 33.69 3.18
3740 3998 5.104859 TGGATAATTTAGGCAGTTACCGTGA 60.105 40.000 0.00 0.00 33.69 4.35
3741 3999 5.007332 GTGGATAATTTAGGCAGTTACCGTG 59.993 44.000 0.00 0.00 33.69 4.94
3742 4000 5.121105 GTGGATAATTTAGGCAGTTACCGT 58.879 41.667 0.00 0.00 33.69 4.83
3743 4001 4.210537 CGTGGATAATTTAGGCAGTTACCG 59.789 45.833 0.00 0.00 33.69 4.02
3744 4002 4.514066 CCGTGGATAATTTAGGCAGTTACC 59.486 45.833 0.00 0.00 0.00 2.85
3745 4003 5.007332 CACCGTGGATAATTTAGGCAGTTAC 59.993 44.000 0.00 0.00 0.00 2.50
3746 4004 5.120399 CACCGTGGATAATTTAGGCAGTTA 58.880 41.667 0.00 0.00 0.00 2.24
3747 4005 3.945285 CACCGTGGATAATTTAGGCAGTT 59.055 43.478 0.00 0.00 0.00 3.16
3748 4006 3.054655 ACACCGTGGATAATTTAGGCAGT 60.055 43.478 3.03 0.00 0.00 4.40
3749 4007 3.541632 ACACCGTGGATAATTTAGGCAG 58.458 45.455 3.03 0.00 0.00 4.85
3750 4008 3.199071 AGACACCGTGGATAATTTAGGCA 59.801 43.478 3.03 0.00 0.00 4.75
3751 4009 3.560068 CAGACACCGTGGATAATTTAGGC 59.440 47.826 3.03 0.00 0.00 3.93
3752 4010 4.766375 ACAGACACCGTGGATAATTTAGG 58.234 43.478 3.03 0.00 0.00 2.69
3753 4011 5.661458 AGACAGACACCGTGGATAATTTAG 58.339 41.667 3.03 0.00 0.00 1.85
3754 4012 5.670792 AGACAGACACCGTGGATAATTTA 57.329 39.130 3.03 0.00 0.00 1.40
3755 4013 4.553330 AGACAGACACCGTGGATAATTT 57.447 40.909 3.03 0.00 0.00 1.82
3756 4014 4.553330 AAGACAGACACCGTGGATAATT 57.447 40.909 3.03 0.00 0.00 1.40
3757 4015 4.142004 GGTAAGACAGACACCGTGGATAAT 60.142 45.833 3.03 0.00 0.00 1.28
3758 4016 3.194116 GGTAAGACAGACACCGTGGATAA 59.806 47.826 3.03 0.00 0.00 1.75
3759 4017 2.756760 GGTAAGACAGACACCGTGGATA 59.243 50.000 3.03 0.00 0.00 2.59
3760 4018 1.549170 GGTAAGACAGACACCGTGGAT 59.451 52.381 3.03 0.00 0.00 3.41
3761 4019 0.963962 GGTAAGACAGACACCGTGGA 59.036 55.000 3.03 0.00 0.00 4.02
3762 4020 0.677288 TGGTAAGACAGACACCGTGG 59.323 55.000 3.03 0.00 34.94 4.94
3763 4021 2.519377 TTGGTAAGACAGACACCGTG 57.481 50.000 0.00 0.00 34.94 4.94
3773 4031 5.001232 TGGCAACTAACAGATTGGTAAGAC 58.999 41.667 0.00 0.00 37.61 3.01
3778 4036 5.806654 AATTTGGCAACTAACAGATTGGT 57.193 34.783 0.00 0.00 33.08 3.67
3792 4050 7.678218 GCAAAAATGTGTGTCTTTAATTTGGCA 60.678 33.333 0.00 0.00 0.00 4.92
3794 4052 7.918643 AGCAAAAATGTGTGTCTTTAATTTGG 58.081 30.769 0.00 0.00 0.00 3.28
3805 4063 4.953940 ACCCAATAGCAAAAATGTGTGT 57.046 36.364 0.00 0.00 0.00 3.72
3839 4102 3.292481 AAGCATGGTGGGCCTCCTG 62.292 63.158 24.13 19.18 35.27 3.86
3840 4103 2.943265 AAGCATGGTGGGCCTCCT 60.943 61.111 24.13 8.29 35.27 3.69
3869 4132 0.248336 CGCATGCCATAACTGCACAG 60.248 55.000 13.15 0.00 42.38 3.66
3872 4135 0.392863 AGTCGCATGCCATAACTGCA 60.393 50.000 13.15 0.00 43.97 4.41
3931 4221 5.216566 TGCTTCACAAATAATAGACGCAC 57.783 39.130 0.00 0.00 31.54 5.34
3984 4275 9.797642 ATTTGTGATATGTCTGCATATTCCTAA 57.202 29.630 0.00 1.44 45.45 2.69
3986 4277 8.701908 AATTTGTGATATGTCTGCATATTCCT 57.298 30.769 0.00 0.00 45.45 3.36
4004 4295 8.839914 CACACGATTACATCTTGTAAATTTGTG 58.160 33.333 16.05 16.05 44.84 3.33
4014 4305 6.017325 CACAATGTCACACGATTACATCTTG 58.983 40.000 0.00 0.00 32.80 3.02
4015 4306 5.122239 CCACAATGTCACACGATTACATCTT 59.878 40.000 0.00 0.00 32.80 2.40
4020 4311 3.994392 AGTCCACAATGTCACACGATTAC 59.006 43.478 0.00 0.00 0.00 1.89
4026 4317 5.240623 TGGAAATAAGTCCACAATGTCACAC 59.759 40.000 0.00 0.00 42.97 3.82
4039 4330 7.331193 ACAGAACTCGTAACATGGAAATAAGTC 59.669 37.037 0.00 0.00 0.00 3.01
4045 4336 6.094325 ACAAAACAGAACTCGTAACATGGAAA 59.906 34.615 0.00 0.00 0.00 3.13
4051 4342 8.288208 TGTTAAAACAAAACAGAACTCGTAACA 58.712 29.630 0.00 0.00 35.67 2.41
4124 4415 1.884235 ACTCTTTGCCACTCTTTCCG 58.116 50.000 0.00 0.00 0.00 4.30
4178 4469 4.508943 CCATTTGGGGATATGTCAGCCATA 60.509 45.833 0.00 0.00 40.27 2.74
4288 4581 8.088365 TGTGAATATTATCATAACTGGGAGACG 58.912 37.037 0.00 0.00 0.00 4.18
4306 4599 6.603201 CCCACACCTAAAGAACATGTGAATAT 59.397 38.462 0.00 0.00 42.63 1.28
4316 4609 4.652822 ACAATCTCCCACACCTAAAGAAC 58.347 43.478 0.00 0.00 0.00 3.01
4345 4638 4.846940 ACCTCCTTCACTGAACTATCCTTT 59.153 41.667 0.00 0.00 0.00 3.11
4429 4722 5.687285 CACAGGAATAGTTTGAAACTTGCAC 59.313 40.000 16.49 5.31 42.81 4.57
4430 4723 5.592282 TCACAGGAATAGTTTGAAACTTGCA 59.408 36.000 16.49 0.00 42.81 4.08
4645 4938 6.963796 ACAAAAGAAGCTGACATGACTTTAG 58.036 36.000 0.00 0.00 0.00 1.85
4702 4995 8.624776 CAAAAAGGATGAGAAGGTATTGGATAC 58.375 37.037 0.00 0.00 35.00 2.24
4703 4996 7.779798 CCAAAAAGGATGAGAAGGTATTGGATA 59.220 37.037 0.00 0.00 41.22 2.59
4704 4997 6.608808 CCAAAAAGGATGAGAAGGTATTGGAT 59.391 38.462 0.00 0.00 41.22 3.41
4705 4998 5.951747 CCAAAAAGGATGAGAAGGTATTGGA 59.048 40.000 0.00 0.00 41.22 3.53
4706 4999 5.127682 CCCAAAAAGGATGAGAAGGTATTGG 59.872 44.000 0.00 0.00 41.22 3.16
4707 5000 5.951747 TCCCAAAAAGGATGAGAAGGTATTG 59.048 40.000 0.00 0.00 41.22 1.90
4708 5001 6.152638 TCCCAAAAAGGATGAGAAGGTATT 57.847 37.500 0.00 0.00 41.22 1.89
4709 5002 5.796502 TCCCAAAAAGGATGAGAAGGTAT 57.203 39.130 0.00 0.00 41.22 2.73
4710 5003 5.796502 ATCCCAAAAAGGATGAGAAGGTA 57.203 39.130 0.00 0.00 45.25 3.08
4711 5004 4.682021 ATCCCAAAAAGGATGAGAAGGT 57.318 40.909 0.00 0.00 45.25 3.50
4712 5005 4.382362 GCAATCCCAAAAAGGATGAGAAGG 60.382 45.833 0.00 0.00 46.31 3.46
4713 5006 4.465305 AGCAATCCCAAAAAGGATGAGAAG 59.535 41.667 0.00 0.00 46.31 2.85
4714 5007 4.419282 AGCAATCCCAAAAAGGATGAGAA 58.581 39.130 0.00 0.00 46.31 2.87
4715 5008 4.051661 AGCAATCCCAAAAAGGATGAGA 57.948 40.909 0.00 0.00 46.31 3.27
4716 5009 4.221262 TCAAGCAATCCCAAAAAGGATGAG 59.779 41.667 0.00 0.00 46.31 2.90
4717 5010 4.158786 TCAAGCAATCCCAAAAAGGATGA 58.841 39.130 0.00 0.00 46.31 2.92
4718 5011 4.540359 TCAAGCAATCCCAAAAAGGATG 57.460 40.909 0.00 0.00 46.31 3.51
4737 5030 5.001874 GCATTATCCTCTTGATGCAGATCA 58.998 41.667 0.00 0.00 43.23 2.92
4739 5032 4.981812 TGCATTATCCTCTTGATGCAGAT 58.018 39.130 5.82 0.00 46.94 2.90
4765 5058 7.494298 TGAAGAAAGGCAAACATAAAAAGGTTC 59.506 33.333 0.00 0.00 0.00 3.62
4777 5070 2.430694 ACCTTGGTGAAGAAAGGCAAAC 59.569 45.455 1.38 0.00 45.82 2.93
4907 5218 2.653890 CTTTTGACAAGTGCCATGACG 58.346 47.619 0.00 0.00 0.00 4.35
4925 5237 2.166254 CTGACAAACAACAGGGTTGCTT 59.834 45.455 8.89 0.75 0.00 3.91
4926 5238 1.750778 CTGACAAACAACAGGGTTGCT 59.249 47.619 8.89 0.00 0.00 3.91
4928 5240 5.964958 ATATCTGACAAACAACAGGGTTG 57.035 39.130 7.51 7.51 35.20 3.77
4975 5287 4.669700 AGTAACAGAAACCATTAACCCCC 58.330 43.478 0.00 0.00 0.00 5.40
4976 5288 5.184479 GGAAGTAACAGAAACCATTAACCCC 59.816 44.000 0.00 0.00 0.00 4.95
5131 5447 2.789208 CAACGTCGATCCGCTAGTTAA 58.211 47.619 0.00 0.00 0.00 2.01
5136 5452 0.179121 ATTGCAACGTCGATCCGCTA 60.179 50.000 0.00 0.00 0.00 4.26
5219 5535 8.170730 ACTTTCAACCTGGAAACTAGGAATATT 58.829 33.333 0.00 0.00 38.71 1.28
5220 5536 7.699878 ACTTTCAACCTGGAAACTAGGAATAT 58.300 34.615 0.00 0.00 38.71 1.28
5229 5545 5.836821 AAAGAGACTTTCAACCTGGAAAC 57.163 39.130 0.00 0.00 33.48 2.78
5238 5554 6.749036 AGGAGAACCTAAAGAGACTTTCAA 57.251 37.500 0.00 0.00 45.83 2.69
5262 5578 5.738783 GCCCATGCACTTTTTCTTTTAGACA 60.739 40.000 0.00 0.00 37.47 3.41
5263 5579 4.686091 GCCCATGCACTTTTTCTTTTAGAC 59.314 41.667 0.00 0.00 37.47 2.59
5277 5593 1.795170 AAACACGTCAGCCCATGCAC 61.795 55.000 0.00 0.00 41.13 4.57
5278 5594 1.106351 AAAACACGTCAGCCCATGCA 61.106 50.000 0.00 0.00 41.13 3.96
5279 5595 0.878416 TAAAACACGTCAGCCCATGC 59.122 50.000 0.00 0.00 37.95 4.06
5280 5596 2.731968 GCATAAAACACGTCAGCCCATG 60.732 50.000 0.00 0.00 0.00 3.66
5301 5617 4.813161 CCAGAAATAGCACCTGAGTATGTG 59.187 45.833 0.00 0.00 35.58 3.21
5303 5619 3.812053 GCCAGAAATAGCACCTGAGTATG 59.188 47.826 0.00 0.00 0.00 2.39
5352 5668 5.630680 GCAAACAACAGAGATGTTACCATTG 59.369 40.000 0.00 0.00 39.98 2.82
5382 5727 1.825474 TCCTAACAGCTCTAGTGCACC 59.175 52.381 14.63 0.00 34.99 5.01
5383 5728 3.254892 GTTCCTAACAGCTCTAGTGCAC 58.745 50.000 18.36 9.40 34.99 4.57
5492 5837 7.421087 AGTGCATCAGCTATCATATATCACT 57.579 36.000 0.00 0.00 42.74 3.41
5493 5838 8.412456 ACTAGTGCATCAGCTATCATATATCAC 58.588 37.037 0.00 0.00 42.74 3.06
5494 5839 8.530804 ACTAGTGCATCAGCTATCATATATCA 57.469 34.615 0.00 0.00 42.74 2.15
5505 5850 3.268330 CACATCAACTAGTGCATCAGCT 58.732 45.455 0.00 0.00 42.74 4.24
5513 5858 4.761745 CACGACAAACACATCAACTAGTG 58.238 43.478 0.00 0.00 41.40 2.74
5517 5862 2.287915 GAGCACGACAAACACATCAACT 59.712 45.455 0.00 0.00 0.00 3.16
5519 5864 2.031560 GTGAGCACGACAAACACATCAA 59.968 45.455 0.00 0.00 0.00 2.57
5522 5867 1.867233 GAGTGAGCACGACAAACACAT 59.133 47.619 0.00 0.00 36.20 3.21
5523 5868 1.286501 GAGTGAGCACGACAAACACA 58.713 50.000 0.00 0.00 36.20 3.72
5524 5869 1.286501 TGAGTGAGCACGACAAACAC 58.713 50.000 0.00 0.00 36.20 3.32
5525 5870 2.135139 GATGAGTGAGCACGACAAACA 58.865 47.619 0.00 0.00 36.20 2.83
5526 5871 1.461127 GGATGAGTGAGCACGACAAAC 59.539 52.381 0.00 5.74 36.20 2.93
5527 5872 1.344438 AGGATGAGTGAGCACGACAAA 59.656 47.619 0.00 0.00 36.20 2.83
5528 5873 0.969149 AGGATGAGTGAGCACGACAA 59.031 50.000 0.00 0.00 36.20 3.18
5587 5941 9.216117 GATCTACACACCTTTAACTAAACACAT 57.784 33.333 0.00 0.00 0.00 3.21
5588 5942 8.205512 TGATCTACACACCTTTAACTAAACACA 58.794 33.333 0.00 0.00 0.00 3.72
5589 5943 8.597662 TGATCTACACACCTTTAACTAAACAC 57.402 34.615 0.00 0.00 0.00 3.32
5607 5961 8.801715 ACAATCAAACAAACAATGTGATCTAC 57.198 30.769 0.00 0.00 42.99 2.59
5610 5964 7.648908 TGAGACAATCAAACAAACAATGTGATC 59.351 33.333 0.00 0.00 36.39 2.92
5620 5974 4.097741 CACCACCTGAGACAATCAAACAAA 59.902 41.667 0.00 0.00 37.52 2.83
5626 5980 1.072173 CACCACCACCTGAGACAATCA 59.928 52.381 0.00 0.00 36.21 2.57
5627 5981 1.813513 CACCACCACCTGAGACAATC 58.186 55.000 0.00 0.00 0.00 2.67
5628 5982 0.250901 GCACCACCACCTGAGACAAT 60.251 55.000 0.00 0.00 0.00 2.71
5631 5985 1.004440 GAGCACCACCACCTGAGAC 60.004 63.158 0.00 0.00 0.00 3.36
5632 5986 2.217038 GGAGCACCACCACCTGAGA 61.217 63.158 0.00 0.00 35.97 3.27
5633 5987 2.219875 AGGAGCACCACCACCTGAG 61.220 63.158 2.07 0.00 38.94 3.35
5634 5988 2.122413 AGGAGCACCACCACCTGA 60.122 61.111 2.07 0.00 38.94 3.86
5635 5989 2.033141 CAGGAGCACCACCACCTG 59.967 66.667 2.07 0.00 42.71 4.00
5636 5990 3.958860 GCAGGAGCACCACCACCT 61.959 66.667 2.07 0.00 41.58 4.00
5638 5992 3.234630 TACGCAGGAGCACCACCAC 62.235 63.158 2.07 0.00 42.27 4.16
5639 5993 2.920384 TACGCAGGAGCACCACCA 60.920 61.111 2.07 0.00 42.27 4.17
5656 6010 2.034879 CCGCAAGTCGCCAGAATGT 61.035 57.895 0.00 0.00 37.30 2.71
5734 6105 4.988029 TCCTCAGGGAAGCTATCTAGTAC 58.012 47.826 0.00 0.00 38.93 2.73
5736 6107 4.544564 TTCCTCAGGGAAGCTATCTAGT 57.455 45.455 0.00 0.00 45.72 2.57
5787 6158 1.355210 CAACTGCAAACGCCGAGTT 59.645 52.632 0.00 0.00 46.76 3.01
5788 6159 2.542907 CCAACTGCAAACGCCGAGT 61.543 57.895 0.00 0.00 0.00 4.18
5792 6163 1.299850 GAACCCAACTGCAAACGCC 60.300 57.895 0.00 0.00 0.00 5.68
5794 6165 2.507339 AATGAACCCAACTGCAAACG 57.493 45.000 0.00 0.00 0.00 3.60
5798 6169 1.340889 GCTCAAATGAACCCAACTGCA 59.659 47.619 0.00 0.00 0.00 4.41
5811 6182 0.990374 ACTCTGGGCTGAGCTCAAAT 59.010 50.000 18.85 0.00 39.14 2.32
5820 6191 1.007964 CGCTATCGACTCTGGGCTG 60.008 63.158 0.00 0.00 38.10 4.85
5863 6272 8.682936 AAACAACAGATTCACAGAGAAACTAT 57.317 30.769 0.00 0.00 37.26 2.12
5923 6338 9.614792 ATGTCCATAGTTATAGTTGAAAGAACC 57.385 33.333 0.00 0.00 0.00 3.62
5940 6355 5.447413 CGCCGACTACTATGTATGTCCATAG 60.447 48.000 6.64 6.64 46.37 2.23
5941 6356 4.393990 CGCCGACTACTATGTATGTCCATA 59.606 45.833 0.00 0.00 0.00 2.74
5942 6357 3.190744 CGCCGACTACTATGTATGTCCAT 59.809 47.826 0.00 0.00 0.00 3.41
5943 6358 2.551032 CGCCGACTACTATGTATGTCCA 59.449 50.000 0.00 0.00 0.00 4.02
5944 6359 2.667724 GCGCCGACTACTATGTATGTCC 60.668 54.545 0.00 0.00 0.00 4.02
5945 6360 2.582687 GCGCCGACTACTATGTATGTC 58.417 52.381 0.00 0.00 0.00 3.06
5946 6361 1.069432 CGCGCCGACTACTATGTATGT 60.069 52.381 0.00 0.00 0.00 2.29
5947 6362 1.196127 TCGCGCCGACTACTATGTATG 59.804 52.381 0.00 0.00 0.00 2.39
5948 6363 1.516161 TCGCGCCGACTACTATGTAT 58.484 50.000 0.00 0.00 0.00 2.29
5949 6364 2.990642 TCGCGCCGACTACTATGTA 58.009 52.632 0.00 0.00 0.00 2.29
5961 6376 2.279582 ATAGCACATATAGTCGCGCC 57.720 50.000 0.00 0.00 32.06 6.53
5963 6378 7.855904 TCAATGTATATAGCACATATAGTCGCG 59.144 37.037 0.00 0.00 35.58 5.87
6003 6418 8.826710 CCAAAGCAGACGATAATTTCATAGTTA 58.173 33.333 0.00