Multiple sequence alignment - TraesCS5B01G559500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G559500 chr5B 100.000 5308 0 0 1 5308 706354015 706348708 0.000000e+00 9803.0
1 TraesCS5B01G559500 chr5B 97.189 249 6 1 2400 2648 706351566 706351319 2.290000e-113 420.0
2 TraesCS5B01G559500 chr5B 97.189 249 6 1 2450 2697 706351616 706351368 2.290000e-113 420.0
3 TraesCS5B01G559500 chr5B 95.000 200 8 2 2400 2599 706351516 706351319 3.990000e-81 313.0
4 TraesCS5B01G559500 chr5B 95.000 200 8 2 2500 2697 706351616 706351417 3.990000e-81 313.0
5 TraesCS5B01G559500 chr5B 93.333 150 8 2 2400 2549 706351466 706351319 2.490000e-53 220.0
6 TraesCS5B01G559500 chr5B 90.909 66 4 2 5238 5302 68930242 68930178 2.630000e-13 87.9
7 TraesCS5B01G559500 chr5D 83.535 1239 130 45 2659 3848 563969531 563968318 0.000000e+00 1090.0
8 TraesCS5B01G559500 chr5D 98.974 195 2 0 5105 5299 563967401 563967207 3.040000e-92 350.0
9 TraesCS5B01G559500 chr5D 96.129 155 5 1 2507 2661 281948500 281948653 8.820000e-63 252.0
10 TraesCS5B01G559500 chr5D 82.828 297 31 15 1313 1602 563970258 563969975 1.140000e-61 248.0
11 TraesCS5B01G559500 chr5D 88.205 195 16 5 4037 4225 563968088 563967895 5.350000e-55 226.0
12 TraesCS5B01G559500 chr5D 91.781 146 12 0 3 148 563972628 563972483 2.510000e-48 204.0
13 TraesCS5B01G559500 chr5D 83.553 152 14 5 145 292 563972024 563971880 1.200000e-26 132.0
14 TraesCS5B01G559500 chr5D 86.290 124 9 6 1049 1164 563970467 563970344 1.550000e-25 128.0
15 TraesCS5B01G559500 chr5D 96.970 66 2 0 1092 1157 442364691 442364756 1.560000e-20 111.0
16 TraesCS5B01G559500 chr5D 92.063 63 3 2 5238 5299 61642937 61642998 2.630000e-13 87.9
17 TraesCS5B01G559500 chr4A 86.335 805 65 24 3063 3827 608559301 608560100 0.000000e+00 835.0
18 TraesCS5B01G559500 chr4A 83.977 518 55 7 3146 3636 406203328 406202812 6.220000e-129 472.0
19 TraesCS5B01G559500 chr4A 83.399 506 36 24 3901 4387 608560118 608560594 4.910000e-115 425.0
20 TraesCS5B01G559500 chr4A 89.320 309 15 16 5007 5302 608560745 608561048 6.490000e-99 372.0
21 TraesCS5B01G559500 chr4A 94.771 153 6 2 1317 1469 608558532 608558682 2.470000e-58 237.0
22 TraesCS5B01G559500 chr4A 90.541 148 11 1 1 148 608556465 608556609 5.420000e-45 193.0
23 TraesCS5B01G559500 chr4A 79.225 284 27 15 2820 3072 608558870 608559152 9.140000e-38 169.0
24 TraesCS5B01G559500 chr4A 88.148 135 11 5 1031 1161 608558287 608558420 7.120000e-34 156.0
25 TraesCS5B01G559500 chr2D 84.363 518 52 13 3146 3636 369044090 369044605 1.030000e-131 481.0
26 TraesCS5B01G559500 chr2D 96.774 155 4 1 2507 2661 638082543 638082390 1.900000e-64 257.0
27 TraesCS5B01G559500 chr2D 96.774 155 4 1 2507 2661 639843458 639843305 1.900000e-64 257.0
28 TraesCS5B01G559500 chr2D 94.231 156 7 2 2407 2562 638082543 638082390 2.470000e-58 237.0
29 TraesCS5B01G559500 chr2D 94.231 156 7 2 2407 2562 639843458 639843305 2.470000e-58 237.0
30 TraesCS5B01G559500 chr2D 94.068 118 7 0 4557 4674 418057634 418057517 4.220000e-41 180.0
31 TraesCS5B01G559500 chr2D 88.073 109 6 4 4032 4138 558944617 558944514 7.220000e-24 122.0
32 TraesCS5B01G559500 chr2D 82.270 141 18 5 5162 5297 357978398 357978536 1.210000e-21 115.0
33 TraesCS5B01G559500 chr7B 84.306 497 56 17 3357 3842 62920211 62919726 2.900000e-127 466.0
34 TraesCS5B01G559500 chr3B 83.123 397 45 14 3313 3690 820882722 820883115 5.090000e-90 342.0
35 TraesCS5B01G559500 chr3B 94.167 120 7 0 4557 4676 457968682 457968801 3.260000e-42 183.0
36 TraesCS5B01G559500 chr3B 91.200 125 11 0 4557 4681 805003450 805003326 2.540000e-38 171.0
37 TraesCS5B01G559500 chr7D 96.795 156 3 2 2507 2661 135720311 135720157 5.270000e-65 259.0
38 TraesCS5B01G559500 chr7D 94.268 157 6 3 2407 2562 135720311 135720157 2.470000e-58 237.0
39 TraesCS5B01G559500 chr7D 88.028 142 10 3 4032 4171 33799266 33799130 1.530000e-35 161.0
40 TraesCS5B01G559500 chr7D 96.552 58 2 0 1356 1413 292420354 292420411 4.380000e-16 97.1
41 TraesCS5B01G559500 chr3D 96.774 155 4 1 2507 2661 26599120 26598967 1.900000e-64 257.0
42 TraesCS5B01G559500 chr3D 94.231 156 7 2 2407 2562 26599120 26598967 2.470000e-58 237.0
43 TraesCS5B01G559500 chr3D 85.326 184 16 5 4032 4213 590337889 590337715 4.220000e-41 180.0
44 TraesCS5B01G559500 chr3D 92.562 121 8 1 4554 4673 439679608 439679488 7.070000e-39 172.0
45 TraesCS5B01G559500 chr3D 96.970 66 2 0 1092 1157 563213231 563213166 1.560000e-20 111.0
46 TraesCS5B01G559500 chr3D 97.436 39 0 1 574 612 40551834 40551797 1.230000e-06 65.8
47 TraesCS5B01G559500 chr6B 94.969 159 6 2 2507 2664 54550981 54550824 1.140000e-61 248.0
48 TraesCS5B01G559500 chr6B 92.500 160 9 3 2407 2565 54550981 54550824 5.350000e-55 226.0
49 TraesCS5B01G559500 chr6B 88.489 139 12 3 4538 4673 534978373 534978510 1.180000e-36 165.0
50 TraesCS5B01G559500 chr6B 100.000 58 0 0 1356 1413 575574270 575574213 2.020000e-19 108.0
51 TraesCS5B01G559500 chr6D 95.484 155 6 1 2507 2661 244145359 244145512 4.110000e-61 246.0
52 TraesCS5B01G559500 chr6D 87.234 141 13 4 4032 4171 367052297 367052433 7.120000e-34 156.0
53 TraesCS5B01G559500 chr6D 86.620 142 12 4 4032 4171 367089655 367089791 3.310000e-32 150.0
54 TraesCS5B01G559500 chr6D 96.970 66 2 0 1092 1157 54417838 54417773 1.560000e-20 111.0
55 TraesCS5B01G559500 chr6D 93.023 43 2 1 571 613 203747255 203747296 1.600000e-05 62.1
56 TraesCS5B01G559500 chr7A 84.553 246 33 2 3331 3576 162157309 162157069 6.870000e-59 239.0
57 TraesCS5B01G559500 chr7A 84.553 246 33 2 3331 3576 162327342 162327582 6.870000e-59 239.0
58 TraesCS5B01G559500 chr7A 84.553 246 33 2 3331 3576 668693659 668693899 6.870000e-59 239.0
59 TraesCS5B01G559500 chr1A 91.892 148 3 2 5164 5302 525014565 525014712 1.170000e-46 198.0
60 TraesCS5B01G559500 chr1A 91.216 148 4 2 5164 5302 523115867 523115720 5.420000e-45 193.0
61 TraesCS5B01G559500 chr2B 85.870 184 15 5 4032 4213 765979858 765980032 9.080000e-43 185.0
62 TraesCS5B01G559500 chr2B 93.277 119 8 0 4555 4673 629811210 629811328 5.460000e-40 176.0
63 TraesCS5B01G559500 chr2B 81.560 141 19 6 5162 5297 425439621 425439759 5.620000e-20 110.0
64 TraesCS5B01G559500 chr4B 94.167 120 7 0 4555 4674 618321936 618321817 3.260000e-42 183.0
65 TraesCS5B01G559500 chr1B 94.737 114 6 0 4560 4673 216499506 216499393 1.520000e-40 178.0
66 TraesCS5B01G559500 chr1B 90.551 127 12 0 4550 4676 156585605 156585479 9.140000e-38 169.0
67 TraesCS5B01G559500 chr1B 97.059 34 1 0 580 613 620494942 620494909 2.060000e-04 58.4
68 TraesCS5B01G559500 chr1D 88.028 142 10 4 4032 4171 427744347 427744211 1.530000e-35 161.0
69 TraesCS5B01G559500 chr1D 96.970 66 2 0 1092 1157 460356381 460356446 1.560000e-20 111.0
70 TraesCS5B01G559500 chr1D 96.970 66 2 0 1092 1157 489737326 489737261 1.560000e-20 111.0
71 TraesCS5B01G559500 chr1D 98.276 58 1 0 1356 1413 2853090 2853147 9.400000e-18 102.0
72 TraesCS5B01G559500 chr4D 94.737 76 1 1 1085 1157 3462628 3462703 1.210000e-21 115.0
73 TraesCS5B01G559500 chrUn 92.105 76 3 3 1085 1157 105261411 105261486 2.610000e-18 104.0
74 TraesCS5B01G559500 chr5A 92.063 63 3 2 5238 5299 51671674 51671735 2.630000e-13 87.9
75 TraesCS5B01G559500 chr5A 100.000 30 0 0 573 602 453001423 453001394 7.430000e-04 56.5
76 TraesCS5B01G559500 chr6A 93.023 43 2 1 571 613 289025649 289025690 1.600000e-05 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G559500 chr5B 706348708 706354015 5307 True 1914.833333 9803 96.285167 1 5308 6 chr5B.!!$R2 5307
1 TraesCS5B01G559500 chr5D 563967207 563972628 5421 True 339.714286 1090 87.880857 3 5299 7 chr5D.!!$R1 5296
2 TraesCS5B01G559500 chr4A 406202812 406203328 516 True 472.000000 472 83.977000 3146 3636 1 chr4A.!!$R1 490
3 TraesCS5B01G559500 chr4A 608556465 608561048 4583 False 341.000000 835 87.391286 1 5302 7 chr4A.!!$F1 5301
4 TraesCS5B01G559500 chr2D 369044090 369044605 515 False 481.000000 481 84.363000 3146 3636 1 chr2D.!!$F2 490


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
542 3011 0.032515 TAATGGGAGAGGAGCGGTGA 60.033 55.0 0.00 0.0 0.00 4.02 F
852 3321 0.033894 GCTTAAACCATCCCCGGGAA 60.034 55.0 26.32 0.0 34.34 3.97 F
1528 4086 0.046242 ACTGGGATGGGAGGAATCCA 59.954 55.0 0.61 0.0 44.71 3.41 F
1696 4291 0.036858 AAGCCTGCTTCTTCGTCTCC 60.037 55.0 0.00 0.0 0.00 3.71 F
2115 4713 0.037232 GGTCGACAGTTCCAAGGAGG 60.037 60.0 18.91 0.0 39.47 4.30 F
2117 4715 0.178944 TCGACAGTTCCAAGGAGGGA 60.179 55.0 0.00 0.0 38.24 4.20 F
3792 6627 0.034670 GGAGGATCTGCTTGTGCCTT 60.035 55.0 0.00 0.0 38.71 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1475 4033 0.036765 AGCGGCGATTGGTTACTGAA 60.037 50.0 12.98 0.00 0.00 3.02 R
1677 4252 0.036858 GGAGACGAAGAAGCAGGCTT 60.037 55.0 6.17 6.17 39.23 4.35 R
2921 5530 0.037734 ACCTTCCCGGTGGACAATTC 59.962 55.0 11.63 0.00 46.80 2.17 R
2956 5583 0.320946 CGCCGGGGAAAACTACTCAA 60.321 55.0 14.46 0.00 0.00 3.02 R
3396 6207 0.322816 CAACCATGGGACTGGAGGTG 60.323 60.0 18.09 0.00 39.73 4.00 R
3850 6685 0.453390 GGTAGACCAGTACCGGAACG 59.547 60.0 9.46 0.00 44.43 3.95 R
5061 8077 0.037734 TCTCTCGGCTCACACACCTA 59.962 55.0 0.00 0.00 0.00 3.08 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 1.216710 CTTCGTCAGCTCCAGGGAC 59.783 63.158 0.00 0.00 0.00 4.46
62 63 2.410466 CTCCAGGGACGAGCTAGTC 58.590 63.158 17.76 17.76 40.25 2.59
178 2611 1.288127 CTTGCCAACCTGCTTCAGC 59.712 57.895 0.00 0.00 42.50 4.26
222 2655 2.038952 TGCTTCAGTATCTGTTGGCACT 59.961 45.455 0.00 0.00 31.58 4.40
246 2679 1.799258 GCTGGTGTGTTGCCCTCTTG 61.799 60.000 0.00 0.00 0.00 3.02
249 2682 0.890996 GGTGTGTTGCCCTCTTGAGG 60.891 60.000 9.60 9.60 0.00 3.86
258 2691 2.503895 CCCTCTTGAGGCTTTGATGT 57.496 50.000 11.01 0.00 0.00 3.06
268 2737 0.961019 GCTTTGATGTTGGGAGCACA 59.039 50.000 0.00 0.00 33.68 4.57
278 2747 2.203070 GGAGCACAATCGCGGGAT 60.203 61.111 9.50 9.50 36.85 3.85
279 2748 2.537560 GGAGCACAATCGCGGGATG 61.538 63.158 16.45 12.17 36.85 3.51
288 2757 1.695114 ATCGCGGGATGATTGGTGGA 61.695 55.000 14.93 0.00 0.00 4.02
290 2759 1.224592 GCGGGATGATTGGTGGACT 59.775 57.895 0.00 0.00 0.00 3.85
291 2760 1.097547 GCGGGATGATTGGTGGACTG 61.098 60.000 0.00 0.00 0.00 3.51
292 2761 1.097547 CGGGATGATTGGTGGACTGC 61.098 60.000 0.00 0.00 0.00 4.40
293 2762 0.257039 GGGATGATTGGTGGACTGCT 59.743 55.000 0.00 0.00 0.00 4.24
294 2763 1.341383 GGGATGATTGGTGGACTGCTT 60.341 52.381 0.00 0.00 0.00 3.91
295 2764 1.747355 GGATGATTGGTGGACTGCTTG 59.253 52.381 0.00 0.00 0.00 4.01
297 2766 1.608055 TGATTGGTGGACTGCTTGTG 58.392 50.000 0.00 0.00 0.00 3.33
298 2767 1.133823 TGATTGGTGGACTGCTTGTGT 60.134 47.619 0.00 0.00 0.00 3.72
299 2768 1.956477 GATTGGTGGACTGCTTGTGTT 59.044 47.619 0.00 0.00 0.00 3.32
301 2770 0.254462 TGGTGGACTGCTTGTGTTGA 59.746 50.000 0.00 0.00 0.00 3.18
302 2771 1.133823 TGGTGGACTGCTTGTGTTGAT 60.134 47.619 0.00 0.00 0.00 2.57
303 2772 1.537202 GGTGGACTGCTTGTGTTGATC 59.463 52.381 0.00 0.00 0.00 2.92
304 2773 2.498167 GTGGACTGCTTGTGTTGATCT 58.502 47.619 0.00 0.00 0.00 2.75
307 2776 2.498167 GACTGCTTGTGTTGATCTGGT 58.502 47.619 0.00 0.00 0.00 4.00
308 2777 2.481952 GACTGCTTGTGTTGATCTGGTC 59.518 50.000 0.00 0.00 0.00 4.02
309 2778 2.158769 ACTGCTTGTGTTGATCTGGTCA 60.159 45.455 0.00 0.00 34.25 4.02
310 2779 2.221169 TGCTTGTGTTGATCTGGTCAC 58.779 47.619 0.00 0.00 36.32 3.67
311 2780 2.158769 TGCTTGTGTTGATCTGGTCACT 60.159 45.455 0.00 0.00 36.32 3.41
312 2781 2.225019 GCTTGTGTTGATCTGGTCACTG 59.775 50.000 0.00 0.00 36.32 3.66
313 2782 3.732212 CTTGTGTTGATCTGGTCACTGA 58.268 45.455 0.00 0.00 36.32 3.41
314 2783 4.321718 CTTGTGTTGATCTGGTCACTGAT 58.678 43.478 0.00 0.00 36.32 2.90
315 2784 5.482006 CTTGTGTTGATCTGGTCACTGATA 58.518 41.667 0.00 0.00 36.32 2.15
316 2785 5.682234 TGTGTTGATCTGGTCACTGATAT 57.318 39.130 0.00 0.00 36.32 1.63
317 2786 5.664457 TGTGTTGATCTGGTCACTGATATC 58.336 41.667 0.00 0.00 36.32 1.63
318 2787 5.423290 TGTGTTGATCTGGTCACTGATATCT 59.577 40.000 3.98 0.00 36.32 1.98
319 2788 5.752472 GTGTTGATCTGGTCACTGATATCTG 59.248 44.000 7.98 7.98 36.32 2.90
320 2789 5.423290 TGTTGATCTGGTCACTGATATCTGT 59.577 40.000 9.28 9.28 36.32 3.41
321 2790 5.781210 TGATCTGGTCACTGATATCTGTC 57.219 43.478 11.94 3.10 35.69 3.51
322 2791 5.203528 TGATCTGGTCACTGATATCTGTCA 58.796 41.667 11.94 7.22 35.69 3.58
332 2801 3.632189 TGATATCTGTCAGCGTTCATCG 58.368 45.455 3.98 0.00 43.12 3.84
342 2811 2.991728 CGTTCATCGCAAACAGCAG 58.008 52.632 0.00 0.00 46.13 4.24
343 2812 0.512518 CGTTCATCGCAAACAGCAGA 59.487 50.000 0.00 0.00 46.13 4.26
344 2813 1.129251 CGTTCATCGCAAACAGCAGAT 59.871 47.619 0.00 0.00 46.13 2.90
345 2814 2.413239 CGTTCATCGCAAACAGCAGATT 60.413 45.455 0.00 0.00 46.13 2.40
346 2815 2.905959 TCATCGCAAACAGCAGATTG 57.094 45.000 0.00 0.00 46.13 2.67
347 2816 2.153645 TCATCGCAAACAGCAGATTGT 58.846 42.857 1.27 0.00 46.13 2.71
348 2817 2.095617 TCATCGCAAACAGCAGATTGTG 60.096 45.455 6.36 6.36 46.13 3.33
349 2818 1.308047 TCGCAAACAGCAGATTGTGT 58.692 45.000 11.41 0.00 46.13 3.72
350 2819 1.675483 TCGCAAACAGCAGATTGTGTT 59.325 42.857 11.41 0.00 46.13 3.32
351 2820 2.098934 TCGCAAACAGCAGATTGTGTTT 59.901 40.909 11.41 3.55 45.59 2.83
357 2826 5.835113 AACAGCAGATTGTGTTTGTTAGT 57.165 34.783 4.74 0.00 35.57 2.24
358 2827 5.835113 ACAGCAGATTGTGTTTGTTAGTT 57.165 34.783 0.00 0.00 0.00 2.24
359 2828 6.935741 ACAGCAGATTGTGTTTGTTAGTTA 57.064 33.333 0.00 0.00 0.00 2.24
360 2829 7.510549 ACAGCAGATTGTGTTTGTTAGTTAT 57.489 32.000 0.00 0.00 0.00 1.89
361 2830 7.362662 ACAGCAGATTGTGTTTGTTAGTTATG 58.637 34.615 0.00 0.00 0.00 1.90
362 2831 6.803320 CAGCAGATTGTGTTTGTTAGTTATGG 59.197 38.462 0.00 0.00 0.00 2.74
363 2832 6.071952 AGCAGATTGTGTTTGTTAGTTATGGG 60.072 38.462 0.00 0.00 0.00 4.00
364 2833 6.620678 CAGATTGTGTTTGTTAGTTATGGGG 58.379 40.000 0.00 0.00 0.00 4.96
365 2834 6.432783 CAGATTGTGTTTGTTAGTTATGGGGA 59.567 38.462 0.00 0.00 0.00 4.81
366 2835 7.007723 AGATTGTGTTTGTTAGTTATGGGGAA 58.992 34.615 0.00 0.00 0.00 3.97
367 2836 7.507616 AGATTGTGTTTGTTAGTTATGGGGAAA 59.492 33.333 0.00 0.00 0.00 3.13
368 2837 7.604657 TTGTGTTTGTTAGTTATGGGGAAAT 57.395 32.000 0.00 0.00 0.00 2.17
369 2838 7.604657 TGTGTTTGTTAGTTATGGGGAAATT 57.395 32.000 0.00 0.00 0.00 1.82
370 2839 7.437748 TGTGTTTGTTAGTTATGGGGAAATTG 58.562 34.615 0.00 0.00 0.00 2.32
371 2840 7.070074 TGTGTTTGTTAGTTATGGGGAAATTGT 59.930 33.333 0.00 0.00 0.00 2.71
372 2841 7.383843 GTGTTTGTTAGTTATGGGGAAATTGTG 59.616 37.037 0.00 0.00 0.00 3.33
373 2842 6.597832 TTGTTAGTTATGGGGAAATTGTGG 57.402 37.500 0.00 0.00 0.00 4.17
374 2843 5.020132 TGTTAGTTATGGGGAAATTGTGGG 58.980 41.667 0.00 0.00 0.00 4.61
375 2844 3.845109 AGTTATGGGGAAATTGTGGGT 57.155 42.857 0.00 0.00 0.00 4.51
376 2845 4.140575 AGTTATGGGGAAATTGTGGGTT 57.859 40.909 0.00 0.00 0.00 4.11
377 2846 4.093743 AGTTATGGGGAAATTGTGGGTTC 58.906 43.478 0.00 0.00 0.00 3.62
378 2847 4.093743 GTTATGGGGAAATTGTGGGTTCT 58.906 43.478 0.00 0.00 0.00 3.01
379 2848 2.008242 TGGGGAAATTGTGGGTTCTG 57.992 50.000 0.00 0.00 0.00 3.02
380 2849 1.219213 TGGGGAAATTGTGGGTTCTGT 59.781 47.619 0.00 0.00 0.00 3.41
381 2850 2.447429 TGGGGAAATTGTGGGTTCTGTA 59.553 45.455 0.00 0.00 0.00 2.74
382 2851 3.117093 TGGGGAAATTGTGGGTTCTGTAA 60.117 43.478 0.00 0.00 0.00 2.41
383 2852 3.898741 GGGGAAATTGTGGGTTCTGTAAA 59.101 43.478 0.00 0.00 0.00 2.01
384 2853 4.345547 GGGGAAATTGTGGGTTCTGTAAAA 59.654 41.667 0.00 0.00 0.00 1.52
385 2854 5.294356 GGGAAATTGTGGGTTCTGTAAAAC 58.706 41.667 0.00 0.00 0.00 2.43
386 2855 5.069914 GGGAAATTGTGGGTTCTGTAAAACT 59.930 40.000 0.00 0.00 0.00 2.66
387 2856 6.265876 GGGAAATTGTGGGTTCTGTAAAACTA 59.734 38.462 0.00 0.00 0.00 2.24
388 2857 7.368059 GGAAATTGTGGGTTCTGTAAAACTAG 58.632 38.462 0.00 0.00 0.00 2.57
389 2858 6.894339 AATTGTGGGTTCTGTAAAACTAGG 57.106 37.500 0.00 0.00 0.00 3.02
390 2859 4.360951 TGTGGGTTCTGTAAAACTAGGG 57.639 45.455 0.00 0.00 0.00 3.53
391 2860 3.073356 TGTGGGTTCTGTAAAACTAGGGG 59.927 47.826 0.00 0.00 0.00 4.79
392 2861 3.073503 GTGGGTTCTGTAAAACTAGGGGT 59.926 47.826 0.00 0.00 0.00 4.95
393 2862 3.073356 TGGGTTCTGTAAAACTAGGGGTG 59.927 47.826 0.00 0.00 0.00 4.61
394 2863 3.328637 GGGTTCTGTAAAACTAGGGGTGA 59.671 47.826 0.00 0.00 0.00 4.02
395 2864 4.202493 GGGTTCTGTAAAACTAGGGGTGAA 60.202 45.833 0.00 0.00 0.00 3.18
396 2865 5.379187 GGTTCTGTAAAACTAGGGGTGAAA 58.621 41.667 0.00 0.00 0.00 2.69
397 2866 5.472478 GGTTCTGTAAAACTAGGGGTGAAAG 59.528 44.000 0.00 0.00 0.00 2.62
398 2867 4.648651 TCTGTAAAACTAGGGGTGAAAGC 58.351 43.478 0.00 0.00 0.00 3.51
399 2868 4.103469 TCTGTAAAACTAGGGGTGAAAGCA 59.897 41.667 0.00 0.00 34.77 3.91
400 2869 4.394729 TGTAAAACTAGGGGTGAAAGCAG 58.605 43.478 0.00 0.00 34.77 4.24
401 2870 3.876309 AAAACTAGGGGTGAAAGCAGA 57.124 42.857 0.00 0.00 34.77 4.26
402 2871 4.388577 AAAACTAGGGGTGAAAGCAGAT 57.611 40.909 0.00 0.00 34.77 2.90
403 2872 4.388577 AAACTAGGGGTGAAAGCAGATT 57.611 40.909 0.00 0.00 34.77 2.40
404 2873 3.356529 ACTAGGGGTGAAAGCAGATTG 57.643 47.619 0.00 0.00 34.77 2.67
405 2874 2.644798 ACTAGGGGTGAAAGCAGATTGT 59.355 45.455 0.00 0.00 34.77 2.71
406 2875 1.915141 AGGGGTGAAAGCAGATTGTG 58.085 50.000 0.00 0.00 34.77 3.33
407 2876 1.145738 AGGGGTGAAAGCAGATTGTGT 59.854 47.619 0.00 0.00 34.77 3.72
408 2877 1.963515 GGGGTGAAAGCAGATTGTGTT 59.036 47.619 0.00 0.00 34.77 3.32
409 2878 2.365293 GGGGTGAAAGCAGATTGTGTTT 59.635 45.455 0.00 0.00 34.77 2.83
410 2879 3.181466 GGGGTGAAAGCAGATTGTGTTTT 60.181 43.478 0.00 0.00 41.85 2.43
416 2885 4.595762 AAGCAGATTGTGTTTTCATGCT 57.404 36.364 0.00 0.00 43.92 3.79
417 2886 3.909430 AGCAGATTGTGTTTTCATGCTG 58.091 40.909 0.00 0.00 40.76 4.41
418 2887 2.410730 GCAGATTGTGTTTTCATGCTGC 59.589 45.455 0.00 0.00 40.34 5.25
419 2888 3.859627 GCAGATTGTGTTTTCATGCTGCT 60.860 43.478 0.00 0.00 42.91 4.24
420 2889 4.304110 CAGATTGTGTTTTCATGCTGCTT 58.696 39.130 0.00 0.00 0.00 3.91
421 2890 4.384846 CAGATTGTGTTTTCATGCTGCTTC 59.615 41.667 0.00 0.00 0.00 3.86
422 2891 3.797451 TTGTGTTTTCATGCTGCTTCA 57.203 38.095 0.00 0.00 0.00 3.02
423 2892 3.358707 TGTGTTTTCATGCTGCTTCAG 57.641 42.857 0.00 0.00 34.12 3.02
424 2893 2.689471 TGTGTTTTCATGCTGCTTCAGT 59.311 40.909 0.00 0.00 33.43 3.41
425 2894 3.882288 TGTGTTTTCATGCTGCTTCAGTA 59.118 39.130 0.00 0.00 33.43 2.74
426 2895 4.520111 TGTGTTTTCATGCTGCTTCAGTAT 59.480 37.500 0.00 0.00 37.28 2.12
427 2896 5.704978 TGTGTTTTCATGCTGCTTCAGTATA 59.295 36.000 0.00 0.00 34.76 1.47
428 2897 6.024049 GTGTTTTCATGCTGCTTCAGTATAC 58.976 40.000 0.00 0.00 34.76 1.47
429 2898 5.123820 TGTTTTCATGCTGCTTCAGTATACC 59.876 40.000 0.00 0.00 34.76 2.73
430 2899 4.760530 TTCATGCTGCTTCAGTATACCT 57.239 40.909 0.00 0.00 34.76 3.08
431 2900 4.063998 TCATGCTGCTTCAGTATACCTG 57.936 45.455 0.00 0.00 42.97 4.00
432 2901 3.452264 TCATGCTGCTTCAGTATACCTGT 59.548 43.478 0.00 0.00 42.19 4.00
433 2902 3.981071 TGCTGCTTCAGTATACCTGTT 57.019 42.857 0.00 0.00 42.19 3.16
434 2903 3.599343 TGCTGCTTCAGTATACCTGTTG 58.401 45.455 0.00 0.00 42.19 3.33
435 2904 3.260632 TGCTGCTTCAGTATACCTGTTGA 59.739 43.478 0.00 0.00 42.19 3.18
436 2905 3.619038 GCTGCTTCAGTATACCTGTTGAC 59.381 47.826 0.00 0.00 42.19 3.18
437 2906 4.820897 CTGCTTCAGTATACCTGTTGACA 58.179 43.478 0.00 0.00 42.19 3.58
438 2907 4.566004 TGCTTCAGTATACCTGTTGACAC 58.434 43.478 0.00 0.00 42.19 3.67
439 2908 4.283467 TGCTTCAGTATACCTGTTGACACT 59.717 41.667 0.00 0.00 42.19 3.55
440 2909 4.627467 GCTTCAGTATACCTGTTGACACTG 59.373 45.833 0.00 0.00 42.19 3.66
441 2910 4.188247 TCAGTATACCTGTTGACACTGC 57.812 45.455 0.00 0.00 42.19 4.40
442 2911 3.832490 TCAGTATACCTGTTGACACTGCT 59.168 43.478 0.00 0.00 42.19 4.24
443 2912 4.082190 TCAGTATACCTGTTGACACTGCTC 60.082 45.833 0.00 0.00 42.19 4.26
444 2913 3.832490 AGTATACCTGTTGACACTGCTCA 59.168 43.478 0.00 0.00 0.00 4.26
445 2914 2.820059 TACCTGTTGACACTGCTCAG 57.180 50.000 0.00 0.00 0.00 3.35
446 2915 0.533755 ACCTGTTGACACTGCTCAGC 60.534 55.000 0.00 0.00 0.00 4.26
447 2916 0.250209 CCTGTTGACACTGCTCAGCT 60.250 55.000 0.00 0.00 0.00 4.24
448 2917 0.866427 CTGTTGACACTGCTCAGCTG 59.134 55.000 7.63 7.63 0.00 4.24
449 2918 0.533531 TGTTGACACTGCTCAGCTGG 60.534 55.000 15.13 5.82 0.00 4.85
450 2919 0.533755 GTTGACACTGCTCAGCTGGT 60.534 55.000 15.13 1.75 0.00 4.00
451 2920 0.250038 TTGACACTGCTCAGCTGGTC 60.250 55.000 15.13 12.37 32.81 4.02
452 2921 1.117749 TGACACTGCTCAGCTGGTCT 61.118 55.000 15.13 0.00 33.10 3.85
453 2922 0.669932 GACACTGCTCAGCTGGTCTG 60.670 60.000 15.13 11.91 44.21 3.51
454 2923 1.370437 CACTGCTCAGCTGGTCTGT 59.630 57.895 15.13 12.52 43.32 3.41
455 2924 0.250209 CACTGCTCAGCTGGTCTGTT 60.250 55.000 15.13 0.00 43.32 3.16
456 2925 0.250209 ACTGCTCAGCTGGTCTGTTG 60.250 55.000 15.13 0.95 43.32 3.33
457 2926 1.575576 CTGCTCAGCTGGTCTGTTGC 61.576 60.000 15.13 7.75 43.32 4.17
458 2927 2.331132 GCTCAGCTGGTCTGTTGCC 61.331 63.158 15.13 0.00 43.32 4.52
459 2928 1.673665 CTCAGCTGGTCTGTTGCCC 60.674 63.158 15.13 0.00 43.32 5.36
460 2929 2.121992 CTCAGCTGGTCTGTTGCCCT 62.122 60.000 15.13 0.00 43.32 5.19
461 2930 1.970114 CAGCTGGTCTGTTGCCCTG 60.970 63.158 5.57 0.00 38.02 4.45
462 2931 2.113986 GCTGGTCTGTTGCCCTGT 59.886 61.111 0.00 0.00 0.00 4.00
463 2932 2.263741 GCTGGTCTGTTGCCCTGTG 61.264 63.158 0.00 0.00 0.00 3.66
464 2933 1.149174 CTGGTCTGTTGCCCTGTGT 59.851 57.895 0.00 0.00 0.00 3.72
465 2934 0.466189 CTGGTCTGTTGCCCTGTGTT 60.466 55.000 0.00 0.00 0.00 3.32
466 2935 0.751277 TGGTCTGTTGCCCTGTGTTG 60.751 55.000 0.00 0.00 0.00 3.33
467 2936 1.360192 GTCTGTTGCCCTGTGTTGC 59.640 57.895 0.00 0.00 0.00 4.17
468 2937 1.077140 TCTGTTGCCCTGTGTTGCA 60.077 52.632 0.00 0.00 35.27 4.08
469 2938 1.102809 TCTGTTGCCCTGTGTTGCAG 61.103 55.000 0.00 0.00 44.63 4.41
478 2947 3.474942 TGTGTTGCAGAGTGAAGCA 57.525 47.368 0.00 0.00 39.32 3.91
483 2952 0.670162 TTGCAGAGTGAAGCAAAGGC 59.330 50.000 0.00 0.00 46.65 4.35
484 2953 3.006339 TTGCAGAGTGAAGCAAAGGCG 62.006 52.381 0.00 0.00 46.65 5.52
493 2962 0.318120 AAGCAAAGGCGGGTCATTTG 59.682 50.000 0.00 0.00 46.06 2.32
494 2963 1.079888 GCAAAGGCGGGTCATTTGG 60.080 57.895 4.59 0.00 44.18 3.28
495 2964 1.815817 GCAAAGGCGGGTCATTTGGT 61.816 55.000 4.59 0.00 44.18 3.67
496 2965 0.038343 CAAAGGCGGGTCATTTGGTG 60.038 55.000 0.00 0.00 41.34 4.17
497 2966 1.815817 AAAGGCGGGTCATTTGGTGC 61.816 55.000 0.00 0.00 0.00 5.01
498 2967 3.758931 GGCGGGTCATTTGGTGCC 61.759 66.667 0.00 0.00 35.04 5.01
499 2968 3.758931 GCGGGTCATTTGGTGCCC 61.759 66.667 0.00 0.00 39.43 5.36
500 2969 2.282816 CGGGTCATTTGGTGCCCA 60.283 61.111 0.00 0.00 41.51 5.36
501 2970 1.682005 CGGGTCATTTGGTGCCCAT 60.682 57.895 0.00 0.00 41.51 4.00
502 2971 1.257055 CGGGTCATTTGGTGCCCATT 61.257 55.000 0.00 0.00 41.51 3.16
503 2972 0.249955 GGGTCATTTGGTGCCCATTG 59.750 55.000 0.00 0.00 41.26 2.82
504 2973 0.391528 GGTCATTTGGTGCCCATTGC 60.392 55.000 0.00 0.00 41.77 3.56
505 2974 0.609662 GTCATTTGGTGCCCATTGCT 59.390 50.000 0.00 0.00 42.00 3.91
506 2975 0.609151 TCATTTGGTGCCCATTGCTG 59.391 50.000 0.00 0.00 42.00 4.41
507 2976 1.022451 CATTTGGTGCCCATTGCTGC 61.022 55.000 0.00 0.00 42.00 5.25
508 2977 2.187896 ATTTGGTGCCCATTGCTGCC 62.188 55.000 0.00 0.00 42.00 4.85
509 2978 3.831727 TTGGTGCCCATTGCTGCCT 62.832 57.895 0.00 0.00 42.00 4.75
510 2979 3.766691 GGTGCCCATTGCTGCCTG 61.767 66.667 0.00 0.00 42.00 4.85
511 2980 4.446413 GTGCCCATTGCTGCCTGC 62.446 66.667 0.00 0.00 42.00 4.85
512 2981 4.689549 TGCCCATTGCTGCCTGCT 62.690 61.111 0.00 0.00 43.37 4.24
513 2982 4.143333 GCCCATTGCTGCCTGCTG 62.143 66.667 0.00 0.00 43.37 4.41
514 2983 4.143333 CCCATTGCTGCCTGCTGC 62.143 66.667 13.30 13.30 43.37 5.25
515 2984 4.143333 CCATTGCTGCCTGCTGCC 62.143 66.667 16.77 1.94 43.37 4.85
516 2985 4.492160 CATTGCTGCCTGCTGCCG 62.492 66.667 16.77 3.75 43.37 5.69
524 2993 4.897357 CCTGCTGCCGCGCTGATA 62.897 66.667 5.56 0.00 39.65 2.15
525 2994 2.891936 CTGCTGCCGCGCTGATAA 60.892 61.111 5.56 0.00 39.65 1.75
526 2995 2.203056 TGCTGCCGCGCTGATAAT 60.203 55.556 5.56 0.00 39.65 1.28
527 2996 2.250485 GCTGCCGCGCTGATAATG 59.750 61.111 5.56 0.00 0.00 1.90
528 2997 2.941333 CTGCCGCGCTGATAATGG 59.059 61.111 5.56 0.00 0.00 3.16
529 2998 2.591429 TGCCGCGCTGATAATGGG 60.591 61.111 5.56 0.00 0.00 4.00
530 2999 2.280797 GCCGCGCTGATAATGGGA 60.281 61.111 5.56 0.00 0.00 4.37
531 3000 2.320587 GCCGCGCTGATAATGGGAG 61.321 63.158 5.56 0.00 0.00 4.30
532 3001 1.367471 CCGCGCTGATAATGGGAGA 59.633 57.895 5.56 0.00 0.00 3.71
533 3002 0.668706 CCGCGCTGATAATGGGAGAG 60.669 60.000 5.56 0.00 0.00 3.20
534 3003 0.668706 CGCGCTGATAATGGGAGAGG 60.669 60.000 5.56 0.00 0.00 3.69
535 3004 0.681733 GCGCTGATAATGGGAGAGGA 59.318 55.000 0.00 0.00 0.00 3.71
536 3005 1.337635 GCGCTGATAATGGGAGAGGAG 60.338 57.143 0.00 0.00 0.00 3.69
537 3006 1.337635 CGCTGATAATGGGAGAGGAGC 60.338 57.143 0.00 0.00 0.00 4.70
538 3007 1.337635 GCTGATAATGGGAGAGGAGCG 60.338 57.143 0.00 0.00 0.00 5.03
539 3008 1.274728 CTGATAATGGGAGAGGAGCGG 59.725 57.143 0.00 0.00 0.00 5.52
540 3009 1.343069 GATAATGGGAGAGGAGCGGT 58.657 55.000 0.00 0.00 0.00 5.68
541 3010 1.001406 GATAATGGGAGAGGAGCGGTG 59.999 57.143 0.00 0.00 0.00 4.94
542 3011 0.032515 TAATGGGAGAGGAGCGGTGA 60.033 55.000 0.00 0.00 0.00 4.02
543 3012 0.692419 AATGGGAGAGGAGCGGTGAT 60.692 55.000 0.00 0.00 0.00 3.06
544 3013 0.692419 ATGGGAGAGGAGCGGTGATT 60.692 55.000 0.00 0.00 0.00 2.57
545 3014 0.032515 TGGGAGAGGAGCGGTGATTA 60.033 55.000 0.00 0.00 0.00 1.75
546 3015 1.120530 GGGAGAGGAGCGGTGATTAA 58.879 55.000 0.00 0.00 0.00 1.40
547 3016 1.202545 GGGAGAGGAGCGGTGATTAAC 60.203 57.143 0.00 0.00 0.00 2.01
548 3017 1.757699 GGAGAGGAGCGGTGATTAACT 59.242 52.381 0.00 0.00 0.00 2.24
549 3018 2.168728 GGAGAGGAGCGGTGATTAACTT 59.831 50.000 0.00 0.00 0.00 2.66
550 3019 3.369576 GGAGAGGAGCGGTGATTAACTTT 60.370 47.826 0.00 0.00 0.00 2.66
551 3020 4.254492 GAGAGGAGCGGTGATTAACTTTT 58.746 43.478 0.00 0.00 0.00 2.27
552 3021 4.652822 AGAGGAGCGGTGATTAACTTTTT 58.347 39.130 0.00 0.00 0.00 1.94
573 3042 7.589958 TTTTTGTGGGTGATGTTGTAGTATT 57.410 32.000 0.00 0.00 0.00 1.89
574 3043 8.693120 TTTTTGTGGGTGATGTTGTAGTATTA 57.307 30.769 0.00 0.00 0.00 0.98
575 3044 7.675962 TTTGTGGGTGATGTTGTAGTATTAC 57.324 36.000 0.00 0.00 0.00 1.89
576 3045 6.614694 TGTGGGTGATGTTGTAGTATTACT 57.385 37.500 1.30 1.30 0.00 2.24
577 3046 7.721409 TGTGGGTGATGTTGTAGTATTACTA 57.279 36.000 0.00 0.00 0.00 1.82
578 3047 8.136563 TGTGGGTGATGTTGTAGTATTACTAA 57.863 34.615 5.13 0.00 31.62 2.24
579 3048 8.595421 TGTGGGTGATGTTGTAGTATTACTAAA 58.405 33.333 5.13 0.00 31.62 1.85
580 3049 9.439500 GTGGGTGATGTTGTAGTATTACTAAAA 57.561 33.333 5.13 3.91 31.62 1.52
587 3056 9.811995 ATGTTGTAGTATTACTAAAATCAGCGA 57.188 29.630 9.22 0.00 31.17 4.93
588 3057 9.079833 TGTTGTAGTATTACTAAAATCAGCGAC 57.920 33.333 9.22 4.90 31.17 5.19
589 3058 9.079833 GTTGTAGTATTACTAAAATCAGCGACA 57.920 33.333 9.22 0.00 31.17 4.35
590 3059 9.642327 TTGTAGTATTACTAAAATCAGCGACAA 57.358 29.630 5.13 2.10 31.62 3.18
591 3060 9.811995 TGTAGTATTACTAAAATCAGCGACAAT 57.188 29.630 5.13 0.00 31.62 2.71
600 3069 9.337396 ACTAAAATCAGCGACAATTAATATGGA 57.663 29.630 0.00 0.00 0.00 3.41
605 3074 9.725019 AATCAGCGACAATTAATATGGATAAGA 57.275 29.630 0.00 0.00 0.00 2.10
606 3075 8.763049 TCAGCGACAATTAATATGGATAAGAG 57.237 34.615 0.00 0.00 0.00 2.85
607 3076 7.819415 TCAGCGACAATTAATATGGATAAGAGG 59.181 37.037 0.00 0.00 0.00 3.69
608 3077 7.065085 CAGCGACAATTAATATGGATAAGAGGG 59.935 40.741 0.00 0.00 0.00 4.30
609 3078 7.038302 AGCGACAATTAATATGGATAAGAGGGA 60.038 37.037 0.00 0.00 0.00 4.20
610 3079 7.278868 GCGACAATTAATATGGATAAGAGGGAG 59.721 40.741 0.00 0.00 0.00 4.30
611 3080 8.314751 CGACAATTAATATGGATAAGAGGGAGT 58.685 37.037 0.00 0.00 0.00 3.85
624 3093 9.674068 GGATAAGAGGGAGTATATGATTTTTCC 57.326 37.037 0.00 0.00 0.00 3.13
627 3096 6.538263 AGAGGGAGTATATGATTTTTCCAGC 58.462 40.000 0.00 0.00 0.00 4.85
628 3097 6.101734 AGAGGGAGTATATGATTTTTCCAGCA 59.898 38.462 0.00 0.00 0.00 4.41
629 3098 6.672593 AGGGAGTATATGATTTTTCCAGCAA 58.327 36.000 0.00 0.00 0.00 3.91
630 3099 7.300658 AGGGAGTATATGATTTTTCCAGCAAT 58.699 34.615 0.00 0.00 0.00 3.56
631 3100 7.786464 AGGGAGTATATGATTTTTCCAGCAATT 59.214 33.333 0.00 0.00 0.00 2.32
632 3101 8.424133 GGGAGTATATGATTTTTCCAGCAATTT 58.576 33.333 0.00 0.00 0.00 1.82
633 3102 9.252962 GGAGTATATGATTTTTCCAGCAATTTG 57.747 33.333 0.00 0.00 0.00 2.32
634 3103 9.807649 GAGTATATGATTTTTCCAGCAATTTGT 57.192 29.630 0.00 0.00 0.00 2.83
638 3107 9.729281 ATATGATTTTTCCAGCAATTTGTTTCT 57.271 25.926 0.00 0.00 0.00 2.52
640 3109 9.729281 ATGATTTTTCCAGCAATTTGTTTCTAT 57.271 25.926 0.00 0.00 0.00 1.98
641 3110 8.991026 TGATTTTTCCAGCAATTTGTTTCTATG 58.009 29.630 0.00 0.00 0.00 2.23
642 3111 7.727331 TTTTTCCAGCAATTTGTTTCTATGG 57.273 32.000 0.00 0.00 0.00 2.74
643 3112 6.662865 TTTCCAGCAATTTGTTTCTATGGA 57.337 33.333 0.00 0.00 33.90 3.41
644 3113 6.662865 TTCCAGCAATTTGTTTCTATGGAA 57.337 33.333 0.00 0.00 41.87 3.53
645 3114 6.662865 TCCAGCAATTTGTTTCTATGGAAA 57.337 33.333 0.00 0.00 38.90 3.13
646 3115 7.060383 TCCAGCAATTTGTTTCTATGGAAAA 57.940 32.000 5.74 0.00 42.22 2.29
647 3116 6.928492 TCCAGCAATTTGTTTCTATGGAAAAC 59.072 34.615 5.74 2.11 42.22 2.43
648 3117 6.705381 CCAGCAATTTGTTTCTATGGAAAACA 59.295 34.615 5.74 4.57 42.22 2.83
649 3118 7.388500 CCAGCAATTTGTTTCTATGGAAAACAT 59.612 33.333 5.74 0.00 42.22 2.71
650 3119 8.437742 CAGCAATTTGTTTCTATGGAAAACATC 58.562 33.333 5.74 0.00 42.22 3.06
651 3120 8.149647 AGCAATTTGTTTCTATGGAAAACATCA 58.850 29.630 5.74 0.00 42.22 3.07
652 3121 8.772705 GCAATTTGTTTCTATGGAAAACATCAA 58.227 29.630 5.74 3.82 42.22 2.57
693 3162 8.517062 CCTAGTCAGGAAGAAAATCATGATTT 57.483 34.615 24.83 24.83 45.91 2.17
694 3163 8.964772 CCTAGTCAGGAAGAAAATCATGATTTT 58.035 33.333 35.38 35.38 46.75 1.82
719 3188 5.821516 TTTTGAACGTAGGAAGAAAAGCA 57.178 34.783 0.00 0.00 0.00 3.91
720 3189 6.385649 TTTTGAACGTAGGAAGAAAAGCAT 57.614 33.333 0.00 0.00 0.00 3.79
721 3190 5.356882 TTGAACGTAGGAAGAAAAGCATG 57.643 39.130 0.00 0.00 0.00 4.06
722 3191 4.637276 TGAACGTAGGAAGAAAAGCATGA 58.363 39.130 0.00 0.00 0.00 3.07
723 3192 5.245531 TGAACGTAGGAAGAAAAGCATGAT 58.754 37.500 0.00 0.00 0.00 2.45
724 3193 5.122239 TGAACGTAGGAAGAAAAGCATGATG 59.878 40.000 0.00 0.00 0.00 3.07
725 3194 3.941483 ACGTAGGAAGAAAAGCATGATGG 59.059 43.478 0.00 0.00 0.00 3.51
726 3195 4.191544 CGTAGGAAGAAAAGCATGATGGA 58.808 43.478 0.00 0.00 0.00 3.41
727 3196 4.818546 CGTAGGAAGAAAAGCATGATGGAT 59.181 41.667 0.00 0.00 0.00 3.41
728 3197 5.049818 CGTAGGAAGAAAAGCATGATGGATC 60.050 44.000 0.00 0.00 0.00 3.36
729 3198 5.126699 AGGAAGAAAAGCATGATGGATCT 57.873 39.130 0.00 0.00 0.00 2.75
730 3199 5.131784 AGGAAGAAAAGCATGATGGATCTC 58.868 41.667 0.00 0.00 0.00 2.75
731 3200 5.104024 AGGAAGAAAAGCATGATGGATCTCT 60.104 40.000 0.00 0.00 0.00 3.10
732 3201 5.593502 GGAAGAAAAGCATGATGGATCTCTT 59.406 40.000 0.00 0.00 0.00 2.85
733 3202 6.452494 AAGAAAAGCATGATGGATCTCTTG 57.548 37.500 0.00 0.00 0.00 3.02
734 3203 4.888239 AGAAAAGCATGATGGATCTCTTGG 59.112 41.667 0.00 0.00 0.00 3.61
735 3204 2.273538 AGCATGATGGATCTCTTGGC 57.726 50.000 0.00 0.00 0.00 4.52
736 3205 1.493446 AGCATGATGGATCTCTTGGCA 59.507 47.619 0.00 0.00 0.00 4.92
737 3206 2.092049 AGCATGATGGATCTCTTGGCAA 60.092 45.455 0.00 0.00 0.00 4.52
738 3207 2.293677 GCATGATGGATCTCTTGGCAAG 59.706 50.000 21.17 21.17 0.00 4.01
739 3208 2.723322 TGATGGATCTCTTGGCAAGG 57.277 50.000 25.92 16.67 0.00 3.61
740 3209 1.918262 TGATGGATCTCTTGGCAAGGT 59.082 47.619 25.92 13.08 0.00 3.50
741 3210 2.309755 TGATGGATCTCTTGGCAAGGTT 59.690 45.455 25.92 11.70 0.00 3.50
742 3211 3.523157 TGATGGATCTCTTGGCAAGGTTA 59.477 43.478 25.92 12.62 0.00 2.85
743 3212 4.166725 TGATGGATCTCTTGGCAAGGTTAT 59.833 41.667 25.92 16.47 0.00 1.89
744 3213 4.591321 TGGATCTCTTGGCAAGGTTATT 57.409 40.909 25.92 7.92 0.00 1.40
745 3214 4.272489 TGGATCTCTTGGCAAGGTTATTG 58.728 43.478 25.92 10.24 0.00 1.90
746 3215 4.263905 TGGATCTCTTGGCAAGGTTATTGT 60.264 41.667 25.92 6.64 0.00 2.71
747 3216 4.096984 GGATCTCTTGGCAAGGTTATTGTG 59.903 45.833 25.92 2.06 0.00 3.33
748 3217 4.098914 TCTCTTGGCAAGGTTATTGTGT 57.901 40.909 25.92 0.00 0.00 3.72
749 3218 3.820467 TCTCTTGGCAAGGTTATTGTGTG 59.180 43.478 25.92 0.66 0.00 3.82
750 3219 2.890311 TCTTGGCAAGGTTATTGTGTGG 59.110 45.455 25.92 0.00 0.00 4.17
751 3220 0.965439 TGGCAAGGTTATTGTGTGGC 59.035 50.000 0.00 0.00 35.48 5.01
752 3221 1.256812 GGCAAGGTTATTGTGTGGCT 58.743 50.000 0.00 0.00 0.00 4.75
753 3222 1.067635 GGCAAGGTTATTGTGTGGCTG 60.068 52.381 0.00 0.00 0.00 4.85
754 3223 1.885887 GCAAGGTTATTGTGTGGCTGA 59.114 47.619 0.00 0.00 0.00 4.26
755 3224 2.493278 GCAAGGTTATTGTGTGGCTGAT 59.507 45.455 0.00 0.00 0.00 2.90
756 3225 3.056607 GCAAGGTTATTGTGTGGCTGATT 60.057 43.478 0.00 0.00 0.00 2.57
757 3226 4.737054 CAAGGTTATTGTGTGGCTGATTC 58.263 43.478 0.00 0.00 0.00 2.52
758 3227 4.307032 AGGTTATTGTGTGGCTGATTCT 57.693 40.909 0.00 0.00 0.00 2.40
759 3228 4.666512 AGGTTATTGTGTGGCTGATTCTT 58.333 39.130 0.00 0.00 0.00 2.52
760 3229 4.702131 AGGTTATTGTGTGGCTGATTCTTC 59.298 41.667 0.00 0.00 0.00 2.87
761 3230 4.142381 GGTTATTGTGTGGCTGATTCTTCC 60.142 45.833 0.00 0.00 0.00 3.46
762 3231 2.655090 TTGTGTGGCTGATTCTTCCA 57.345 45.000 0.00 0.00 0.00 3.53
763 3232 2.885135 TGTGTGGCTGATTCTTCCAT 57.115 45.000 1.80 0.00 31.83 3.41
764 3233 3.998913 TGTGTGGCTGATTCTTCCATA 57.001 42.857 1.80 0.00 31.83 2.74
765 3234 3.877559 TGTGTGGCTGATTCTTCCATAG 58.122 45.455 1.80 0.00 31.83 2.23
766 3235 2.615912 GTGTGGCTGATTCTTCCATAGC 59.384 50.000 0.00 0.00 31.83 2.97
767 3236 2.507058 TGTGGCTGATTCTTCCATAGCT 59.493 45.455 0.00 0.00 34.89 3.32
768 3237 3.054139 TGTGGCTGATTCTTCCATAGCTT 60.054 43.478 0.00 0.00 34.89 3.74
769 3238 3.314635 GTGGCTGATTCTTCCATAGCTTG 59.685 47.826 0.00 0.00 34.89 4.01
770 3239 2.292845 GGCTGATTCTTCCATAGCTTGC 59.707 50.000 0.00 0.00 34.89 4.01
771 3240 2.947652 GCTGATTCTTCCATAGCTTGCA 59.052 45.455 0.00 0.00 0.00 4.08
772 3241 3.003482 GCTGATTCTTCCATAGCTTGCAG 59.997 47.826 0.00 0.00 0.00 4.41
773 3242 4.449131 CTGATTCTTCCATAGCTTGCAGA 58.551 43.478 0.00 0.00 0.00 4.26
774 3243 4.449131 TGATTCTTCCATAGCTTGCAGAG 58.551 43.478 0.00 0.00 0.00 3.35
775 3244 3.988976 TTCTTCCATAGCTTGCAGAGT 57.011 42.857 0.00 0.00 0.00 3.24
776 3245 3.988976 TCTTCCATAGCTTGCAGAGTT 57.011 42.857 0.00 0.00 0.00 3.01
777 3246 3.603532 TCTTCCATAGCTTGCAGAGTTG 58.396 45.455 0.00 0.00 0.00 3.16
786 3255 2.669569 GCAGAGTTGCTGGCCGAA 60.670 61.111 0.00 0.00 46.95 4.30
787 3256 2.260869 GCAGAGTTGCTGGCCGAAA 61.261 57.895 0.00 0.00 46.95 3.46
788 3257 1.795170 GCAGAGTTGCTGGCCGAAAA 61.795 55.000 0.00 0.00 46.95 2.29
789 3258 0.883833 CAGAGTTGCTGGCCGAAAAT 59.116 50.000 0.00 0.00 41.07 1.82
790 3259 0.883833 AGAGTTGCTGGCCGAAAATG 59.116 50.000 0.00 0.00 0.00 2.32
791 3260 0.109132 GAGTTGCTGGCCGAAAATGG 60.109 55.000 0.00 0.00 0.00 3.16
792 3261 0.827507 AGTTGCTGGCCGAAAATGGT 60.828 50.000 0.00 0.00 0.00 3.55
793 3262 0.667184 GTTGCTGGCCGAAAATGGTG 60.667 55.000 0.00 0.00 0.00 4.17
794 3263 1.814772 TTGCTGGCCGAAAATGGTGG 61.815 55.000 0.00 0.00 0.00 4.61
805 3274 4.655921 ATGGTGGCCATTACACGG 57.344 55.556 9.72 0.00 42.23 4.94
806 3275 1.688811 ATGGTGGCCATTACACGGT 59.311 52.632 9.72 0.00 42.23 4.83
807 3276 0.679640 ATGGTGGCCATTACACGGTG 60.680 55.000 9.72 6.58 42.23 4.94
808 3277 2.696759 GGTGGCCATTACACGGTGC 61.697 63.158 9.72 0.00 39.69 5.01
809 3278 1.674322 GTGGCCATTACACGGTGCT 60.674 57.895 9.72 0.00 0.00 4.40
810 3279 1.074072 TGGCCATTACACGGTGCTT 59.926 52.632 0.00 0.00 0.00 3.91
811 3280 0.538516 TGGCCATTACACGGTGCTTT 60.539 50.000 0.00 0.00 0.00 3.51
812 3281 0.109319 GGCCATTACACGGTGCTTTG 60.109 55.000 8.30 3.10 0.00 2.77
813 3282 0.596082 GCCATTACACGGTGCTTTGT 59.404 50.000 8.30 0.00 0.00 2.83
814 3283 1.401018 GCCATTACACGGTGCTTTGTC 60.401 52.381 8.30 0.00 0.00 3.18
815 3284 2.151202 CCATTACACGGTGCTTTGTCT 58.849 47.619 8.30 0.00 0.00 3.41
816 3285 2.552315 CCATTACACGGTGCTTTGTCTT 59.448 45.455 8.30 0.00 0.00 3.01
817 3286 3.364964 CCATTACACGGTGCTTTGTCTTC 60.365 47.826 8.30 0.00 0.00 2.87
818 3287 2.902705 TACACGGTGCTTTGTCTTCT 57.097 45.000 8.30 0.00 0.00 2.85
819 3288 2.038387 ACACGGTGCTTTGTCTTCTT 57.962 45.000 8.30 0.00 0.00 2.52
820 3289 1.670811 ACACGGTGCTTTGTCTTCTTG 59.329 47.619 8.30 0.00 0.00 3.02
821 3290 1.670811 CACGGTGCTTTGTCTTCTTGT 59.329 47.619 0.00 0.00 0.00 3.16
822 3291 1.670811 ACGGTGCTTTGTCTTCTTGTG 59.329 47.619 0.00 0.00 0.00 3.33
823 3292 1.670811 CGGTGCTTTGTCTTCTTGTGT 59.329 47.619 0.00 0.00 0.00 3.72
824 3293 2.286418 CGGTGCTTTGTCTTCTTGTGTC 60.286 50.000 0.00 0.00 0.00 3.67
825 3294 2.682856 GGTGCTTTGTCTTCTTGTGTCA 59.317 45.455 0.00 0.00 0.00 3.58
826 3295 3.128589 GGTGCTTTGTCTTCTTGTGTCAA 59.871 43.478 0.00 0.00 0.00 3.18
827 3296 4.346129 GTGCTTTGTCTTCTTGTGTCAAG 58.654 43.478 3.44 3.44 0.00 3.02
828 3297 4.009675 TGCTTTGTCTTCTTGTGTCAAGT 58.990 39.130 8.93 0.00 0.00 3.16
829 3298 4.458989 TGCTTTGTCTTCTTGTGTCAAGTT 59.541 37.500 8.93 0.00 0.00 2.66
830 3299 5.048083 TGCTTTGTCTTCTTGTGTCAAGTTT 60.048 36.000 8.93 0.00 0.00 2.66
831 3300 5.513141 GCTTTGTCTTCTTGTGTCAAGTTTC 59.487 40.000 8.93 1.61 0.00 2.78
832 3301 6.623767 GCTTTGTCTTCTTGTGTCAAGTTTCT 60.624 38.462 8.93 0.00 0.00 2.52
833 3302 5.801350 TGTCTTCTTGTGTCAAGTTTCTG 57.199 39.130 8.93 0.00 0.00 3.02
834 3303 4.094887 TGTCTTCTTGTGTCAAGTTTCTGC 59.905 41.667 8.93 0.00 0.00 4.26
835 3304 4.333926 GTCTTCTTGTGTCAAGTTTCTGCT 59.666 41.667 8.93 0.00 0.00 4.24
836 3305 4.943705 TCTTCTTGTGTCAAGTTTCTGCTT 59.056 37.500 8.93 0.00 0.00 3.91
837 3306 6.037172 GTCTTCTTGTGTCAAGTTTCTGCTTA 59.963 38.462 8.93 0.00 0.00 3.09
838 3307 6.597672 TCTTCTTGTGTCAAGTTTCTGCTTAA 59.402 34.615 8.93 0.00 0.00 1.85
839 3308 6.751514 TCTTGTGTCAAGTTTCTGCTTAAA 57.248 33.333 8.93 0.00 0.00 1.52
840 3309 6.551736 TCTTGTGTCAAGTTTCTGCTTAAAC 58.448 36.000 8.93 6.42 39.22 2.01
841 3310 5.243426 TGTGTCAAGTTTCTGCTTAAACC 57.757 39.130 9.84 0.00 39.66 3.27
842 3311 4.702612 TGTGTCAAGTTTCTGCTTAAACCA 59.297 37.500 9.84 0.97 39.66 3.67
843 3312 5.359576 TGTGTCAAGTTTCTGCTTAAACCAT 59.640 36.000 9.84 0.00 39.66 3.55
844 3313 5.915196 GTGTCAAGTTTCTGCTTAAACCATC 59.085 40.000 9.84 2.32 39.66 3.51
845 3314 5.009610 TGTCAAGTTTCTGCTTAAACCATCC 59.990 40.000 9.84 0.48 39.66 3.51
846 3315 4.522789 TCAAGTTTCTGCTTAAACCATCCC 59.477 41.667 9.84 0.00 39.66 3.85
847 3316 3.431415 AGTTTCTGCTTAAACCATCCCC 58.569 45.455 9.84 0.00 39.66 4.81
848 3317 2.122783 TTCTGCTTAAACCATCCCCG 57.877 50.000 0.00 0.00 0.00 5.73
849 3318 0.254747 TCTGCTTAAACCATCCCCGG 59.745 55.000 0.00 0.00 0.00 5.73
850 3319 0.751643 CTGCTTAAACCATCCCCGGG 60.752 60.000 15.80 15.80 0.00 5.73
851 3320 1.208844 TGCTTAAACCATCCCCGGGA 61.209 55.000 26.32 9.16 35.55 5.14
852 3321 0.033894 GCTTAAACCATCCCCGGGAA 60.034 55.000 26.32 0.00 34.34 3.97
853 3322 1.617533 GCTTAAACCATCCCCGGGAAA 60.618 52.381 26.32 10.61 34.34 3.13
854 3323 2.375146 CTTAAACCATCCCCGGGAAAG 58.625 52.381 26.32 10.83 34.34 2.62
855 3324 1.671293 TAAACCATCCCCGGGAAAGA 58.329 50.000 26.32 11.98 34.34 2.52
856 3325 0.781278 AAACCATCCCCGGGAAAGAA 59.219 50.000 26.32 1.40 34.34 2.52
857 3326 0.781278 AACCATCCCCGGGAAAGAAA 59.219 50.000 26.32 0.00 34.34 2.52
858 3327 0.781278 ACCATCCCCGGGAAAGAAAA 59.219 50.000 26.32 0.00 34.34 2.29
859 3328 1.272480 ACCATCCCCGGGAAAGAAAAG 60.272 52.381 26.32 1.48 34.34 2.27
860 3329 1.005450 CCATCCCCGGGAAAGAAAAGA 59.995 52.381 26.32 8.40 34.34 2.52
861 3330 2.556559 CCATCCCCGGGAAAGAAAAGAA 60.557 50.000 26.32 0.00 34.34 2.52
862 3331 3.161866 CATCCCCGGGAAAGAAAAGAAA 58.838 45.455 26.32 0.00 34.34 2.52
863 3332 3.315880 TCCCCGGGAAAGAAAAGAAAA 57.684 42.857 26.32 0.00 0.00 2.29
864 3333 3.227614 TCCCCGGGAAAGAAAAGAAAAG 58.772 45.455 26.32 0.00 0.00 2.27
865 3334 3.117436 TCCCCGGGAAAGAAAAGAAAAGA 60.117 43.478 26.32 1.33 0.00 2.52
878 3347 8.032952 AGAAAAGAAAAGAAAACAGCAAAAGG 57.967 30.769 0.00 0.00 0.00 3.11
882 3351 7.977789 AGAAAAGAAAACAGCAAAAGGAAAA 57.022 28.000 0.00 0.00 0.00 2.29
884 3353 7.877612 AGAAAAGAAAACAGCAAAAGGAAAAGA 59.122 29.630 0.00 0.00 0.00 2.52
885 3354 7.977789 AAAGAAAACAGCAAAAGGAAAAGAA 57.022 28.000 0.00 0.00 0.00 2.52
886 3355 7.977789 AAGAAAACAGCAAAAGGAAAAGAAA 57.022 28.000 0.00 0.00 0.00 2.52
948 3452 2.445155 GGGCCTTGTTCCCCATGT 59.555 61.111 0.84 0.00 41.13 3.21
953 3457 0.960364 CCTTGTTCCCCATGTGTCGG 60.960 60.000 0.00 0.00 0.00 4.79
961 3465 1.907739 CCATGTGTCGGGAGTCCAT 59.092 57.895 12.30 0.00 0.00 3.41
967 3471 1.052617 TGTCGGGAGTCCATCACAAA 58.947 50.000 12.30 0.00 0.00 2.83
968 3472 1.270625 TGTCGGGAGTCCATCACAAAC 60.271 52.381 12.30 0.00 0.00 2.93
975 3479 3.253432 GGAGTCCATCACAAACAAAGTCC 59.747 47.826 3.60 0.00 0.00 3.85
976 3480 3.222603 AGTCCATCACAAACAAAGTCCC 58.777 45.455 0.00 0.00 0.00 4.46
977 3481 2.296190 GTCCATCACAAACAAAGTCCCC 59.704 50.000 0.00 0.00 0.00 4.81
978 3482 1.618343 CCATCACAAACAAAGTCCCCC 59.382 52.381 0.00 0.00 0.00 5.40
979 3483 2.597455 CATCACAAACAAAGTCCCCCT 58.403 47.619 0.00 0.00 0.00 4.79
980 3484 2.358322 TCACAAACAAAGTCCCCCTC 57.642 50.000 0.00 0.00 0.00 4.30
981 3485 1.566703 TCACAAACAAAGTCCCCCTCA 59.433 47.619 0.00 0.00 0.00 3.86
982 3486 2.024846 TCACAAACAAAGTCCCCCTCAA 60.025 45.455 0.00 0.00 0.00 3.02
983 3487 2.763448 CACAAACAAAGTCCCCCTCAAA 59.237 45.455 0.00 0.00 0.00 2.69
984 3488 3.196685 CACAAACAAAGTCCCCCTCAAAA 59.803 43.478 0.00 0.00 0.00 2.44
985 3489 3.841255 ACAAACAAAGTCCCCCTCAAAAA 59.159 39.130 0.00 0.00 0.00 1.94
1010 3514 3.626028 AATCACAAACAAAGTCGAGGC 57.374 42.857 0.00 0.00 0.00 4.70
1011 3515 1.305201 TCACAAACAAAGTCGAGGCC 58.695 50.000 0.00 0.00 0.00 5.19
1012 3516 1.134220 TCACAAACAAAGTCGAGGCCT 60.134 47.619 3.86 3.86 0.00 5.19
1013 3517 1.264288 CACAAACAAAGTCGAGGCCTC 59.736 52.381 23.79 23.79 0.00 4.70
1014 3518 0.875059 CAAACAAAGTCGAGGCCTCC 59.125 55.000 27.20 14.03 0.00 4.30
1015 3519 0.602905 AAACAAAGTCGAGGCCTCCG 60.603 55.000 27.20 20.79 0.00 4.63
1016 3520 2.815647 CAAAGTCGAGGCCTCCGC 60.816 66.667 27.20 18.90 0.00 5.54
1017 3521 3.311110 AAAGTCGAGGCCTCCGCA 61.311 61.111 27.20 8.44 36.38 5.69
1018 3522 2.660064 AAAGTCGAGGCCTCCGCAT 61.660 57.895 27.20 10.01 36.38 4.73
1029 3533 1.118838 CCTCCGCATCTTCTTCCTCT 58.881 55.000 0.00 0.00 0.00 3.69
1031 3535 0.176680 TCCGCATCTTCTTCCTCTGC 59.823 55.000 0.00 0.00 0.00 4.26
1032 3536 0.813210 CCGCATCTTCTTCCTCTGCC 60.813 60.000 0.00 0.00 0.00 4.85
1033 3537 0.813210 CGCATCTTCTTCCTCTGCCC 60.813 60.000 0.00 0.00 0.00 5.36
1051 3601 4.046998 CACACACGCGCGACAGAC 62.047 66.667 39.36 0.00 0.00 3.51
1055 3605 2.729491 CACGCGCGACAGACAGAA 60.729 61.111 39.36 0.00 0.00 3.02
1168 3726 4.757799 CTCATCGAGAGGTATGTAGGTG 57.242 50.000 0.00 0.00 40.84 4.00
1169 3727 4.390264 CTCATCGAGAGGTATGTAGGTGA 58.610 47.826 0.00 0.00 40.84 4.02
1172 3730 1.955080 CGAGAGGTATGTAGGTGACCC 59.045 57.143 0.00 0.00 33.40 4.46
1173 3731 1.955080 GAGAGGTATGTAGGTGACCCG 59.045 57.143 0.00 0.00 33.40 5.28
1177 3735 2.129146 TATGTAGGTGACCCGCCCG 61.129 63.158 0.00 0.00 33.99 6.13
1191 3749 3.330720 CCCGCCCCTTTCTCACCT 61.331 66.667 0.00 0.00 0.00 4.00
1192 3750 2.045926 CCGCCCCTTTCTCACCTG 60.046 66.667 0.00 0.00 0.00 4.00
1193 3751 2.747855 CGCCCCTTTCTCACCTGC 60.748 66.667 0.00 0.00 0.00 4.85
1194 3752 2.747855 GCCCCTTTCTCACCTGCG 60.748 66.667 0.00 0.00 0.00 5.18
1195 3753 2.045926 CCCCTTTCTCACCTGCGG 60.046 66.667 0.00 0.00 0.00 5.69
1196 3754 2.747855 CCCTTTCTCACCTGCGGC 60.748 66.667 0.00 0.00 0.00 6.53
1197 3755 3.121030 CCTTTCTCACCTGCGGCG 61.121 66.667 0.51 0.51 0.00 6.46
1198 3756 3.121030 CTTTCTCACCTGCGGCGG 61.121 66.667 9.78 0.65 0.00 6.13
1224 3782 3.283684 CGAGATCTCGCCTCGCCT 61.284 66.667 30.41 0.00 46.50 5.52
1225 3783 2.642700 GAGATCTCGCCTCGCCTC 59.357 66.667 7.04 0.00 0.00 4.70
1243 3801 3.046870 GCCTCGCGGATGAGATCT 58.953 61.111 6.13 0.00 38.28 2.75
1244 3802 1.372748 GCCTCGCGGATGAGATCTG 60.373 63.158 6.13 0.00 38.28 2.90
1251 3809 1.579698 CGGATGAGATCTGCCACTTG 58.420 55.000 0.00 0.00 0.00 3.16
1252 3810 1.137675 CGGATGAGATCTGCCACTTGA 59.862 52.381 0.00 0.00 0.00 3.02
1253 3811 2.802415 CGGATGAGATCTGCCACTTGAG 60.802 54.545 0.00 0.00 0.00 3.02
1254 3812 2.211806 GATGAGATCTGCCACTTGAGC 58.788 52.381 0.00 0.00 0.00 4.26
1255 3813 0.108472 TGAGATCTGCCACTTGAGCG 60.108 55.000 0.00 0.00 0.00 5.03
1256 3814 1.427592 GAGATCTGCCACTTGAGCGC 61.428 60.000 0.00 0.00 0.00 5.92
1257 3815 2.437359 ATCTGCCACTTGAGCGCC 60.437 61.111 2.29 0.00 0.00 6.53
1258 3816 2.866085 GATCTGCCACTTGAGCGCCT 62.866 60.000 2.29 0.00 0.00 5.52
1259 3817 2.866085 ATCTGCCACTTGAGCGCCTC 62.866 60.000 2.29 1.22 0.00 4.70
1261 3819 4.742201 GCCACTTGAGCGCCTCGA 62.742 66.667 2.29 0.00 32.35 4.04
1262 3820 2.507992 CCACTTGAGCGCCTCGAG 60.508 66.667 17.44 17.44 45.02 4.04
1266 3824 2.989253 TTGAGCGCCTCGAGTCCA 60.989 61.111 12.31 0.00 32.35 4.02
1270 3828 4.500116 GCGCCTCGAGTCCACCTC 62.500 72.222 12.31 0.00 36.80 3.85
1278 3836 0.811915 CGAGTCCACCTCACGAATCT 59.188 55.000 0.00 0.00 40.48 2.40
1279 3837 1.202200 CGAGTCCACCTCACGAATCTC 60.202 57.143 0.00 0.00 40.48 2.75
1280 3838 0.811915 AGTCCACCTCACGAATCTCG 59.188 55.000 0.00 0.00 46.93 4.04
1281 3839 0.809385 GTCCACCTCACGAATCTCGA 59.191 55.000 2.59 0.00 43.74 4.04
1282 3840 1.405821 GTCCACCTCACGAATCTCGAT 59.594 52.381 2.59 0.00 43.74 3.59
1284 3842 2.496070 TCCACCTCACGAATCTCGATTT 59.504 45.455 2.59 0.00 43.74 2.17
1285 3843 2.860735 CCACCTCACGAATCTCGATTTC 59.139 50.000 2.59 0.00 43.74 2.17
1287 3845 4.177026 CACCTCACGAATCTCGATTTCTT 58.823 43.478 2.59 0.00 43.74 2.52
1289 3847 5.120830 CACCTCACGAATCTCGATTTCTTTT 59.879 40.000 2.59 0.00 43.74 2.27
1290 3848 5.701290 ACCTCACGAATCTCGATTTCTTTTT 59.299 36.000 2.59 0.00 43.74 1.94
1291 3849 6.128526 ACCTCACGAATCTCGATTTCTTTTTC 60.129 38.462 2.59 0.00 43.74 2.29
1294 3852 6.426937 TCACGAATCTCGATTTCTTTTTCCTT 59.573 34.615 2.59 0.00 43.74 3.36
1295 3853 6.738649 CACGAATCTCGATTTCTTTTTCCTTC 59.261 38.462 2.59 0.00 43.74 3.46
1297 3855 7.173390 ACGAATCTCGATTTCTTTTTCCTTCTT 59.827 33.333 2.59 0.00 43.74 2.52
1300 3858 6.888430 TCTCGATTTCTTTTTCCTTCTTTCG 58.112 36.000 0.00 0.00 0.00 3.46
1301 3859 5.449304 TCGATTTCTTTTTCCTTCTTTCGC 58.551 37.500 0.00 0.00 0.00 4.70
1302 3860 5.238650 TCGATTTCTTTTTCCTTCTTTCGCT 59.761 36.000 0.00 0.00 0.00 4.93
1303 3861 5.565638 CGATTTCTTTTTCCTTCTTTCGCTC 59.434 40.000 0.00 0.00 0.00 5.03
1304 3862 6.566753 CGATTTCTTTTTCCTTCTTTCGCTCT 60.567 38.462 0.00 0.00 0.00 4.09
1306 3864 4.451900 TCTTTTTCCTTCTTTCGCTCTGT 58.548 39.130 0.00 0.00 0.00 3.41
1307 3865 4.273480 TCTTTTTCCTTCTTTCGCTCTGTG 59.727 41.667 0.00 0.00 0.00 3.66
1308 3866 1.512926 TTCCTTCTTTCGCTCTGTGC 58.487 50.000 0.00 0.00 38.57 4.57
1310 3868 0.795085 CCTTCTTTCGCTCTGTGCTG 59.205 55.000 0.00 0.00 40.11 4.41
1311 3869 0.795085 CTTCTTTCGCTCTGTGCTGG 59.205 55.000 0.00 0.00 40.11 4.85
1321 3879 3.365868 CGCTCTGTGCTGGATCTATCTAC 60.366 52.174 0.00 0.00 40.11 2.59
1406 3964 2.436824 GCCGAGAACCTCAAGGGC 60.437 66.667 0.29 0.00 40.27 5.19
1449 4007 1.302192 GCCTCCCACAAGTACGCAA 60.302 57.895 0.00 0.00 0.00 4.85
1455 4013 0.442310 CCACAAGTACGCAATCACCG 59.558 55.000 0.00 0.00 0.00 4.94
1465 4023 1.450312 CAATCACCGCTCCACTCCC 60.450 63.158 0.00 0.00 0.00 4.30
1469 4027 3.999285 ACCGCTCCACTCCCCTCT 61.999 66.667 0.00 0.00 0.00 3.69
1471 4029 3.151022 CGCTCCACTCCCCTCTCC 61.151 72.222 0.00 0.00 0.00 3.71
1473 4031 1.760480 GCTCCACTCCCCTCTCCTC 60.760 68.421 0.00 0.00 0.00 3.71
1474 4032 2.015081 CTCCACTCCCCTCTCCTCT 58.985 63.158 0.00 0.00 0.00 3.69
1475 4033 0.338120 CTCCACTCCCCTCTCCTCTT 59.662 60.000 0.00 0.00 0.00 2.85
1476 4034 0.793617 TCCACTCCCCTCTCCTCTTT 59.206 55.000 0.00 0.00 0.00 2.52
1477 4035 1.199615 CCACTCCCCTCTCCTCTTTC 58.800 60.000 0.00 0.00 0.00 2.62
1479 4037 1.830477 CACTCCCCTCTCCTCTTTCAG 59.170 57.143 0.00 0.00 0.00 3.02
1480 4038 1.435168 ACTCCCCTCTCCTCTTTCAGT 59.565 52.381 0.00 0.00 0.00 3.41
1481 4039 2.655407 ACTCCCCTCTCCTCTTTCAGTA 59.345 50.000 0.00 0.00 0.00 2.74
1482 4040 3.077695 ACTCCCCTCTCCTCTTTCAGTAA 59.922 47.826 0.00 0.00 0.00 2.24
1485 4043 3.173965 CCCTCTCCTCTTTCAGTAACCA 58.826 50.000 0.00 0.00 0.00 3.67
1486 4044 3.583086 CCCTCTCCTCTTTCAGTAACCAA 59.417 47.826 0.00 0.00 0.00 3.67
1489 4047 5.073311 TCTCCTCTTTCAGTAACCAATCG 57.927 43.478 0.00 0.00 0.00 3.34
1490 4048 3.596214 TCCTCTTTCAGTAACCAATCGC 58.404 45.455 0.00 0.00 0.00 4.58
1492 4050 2.343101 TCTTTCAGTAACCAATCGCCG 58.657 47.619 0.00 0.00 0.00 6.46
1495 4053 0.818938 TCAGTAACCAATCGCCGCTA 59.181 50.000 0.00 0.00 0.00 4.26
1496 4054 1.202371 TCAGTAACCAATCGCCGCTAG 60.202 52.381 0.00 0.00 0.00 3.42
1497 4055 1.108776 AGTAACCAATCGCCGCTAGA 58.891 50.000 0.00 0.00 0.00 2.43
1498 4056 1.687123 AGTAACCAATCGCCGCTAGAT 59.313 47.619 0.00 0.00 0.00 1.98
1499 4057 1.792949 GTAACCAATCGCCGCTAGATG 59.207 52.381 0.00 0.00 0.00 2.90
1507 4065 1.963338 GCCGCTAGATGCACCCATC 60.963 63.158 0.00 0.00 46.61 3.51
1522 4080 1.750930 CATCGACTGGGATGGGAGG 59.249 63.158 0.00 0.00 40.07 4.30
1527 4085 0.767998 GACTGGGATGGGAGGAATCC 59.232 60.000 0.00 0.00 42.57 3.01
1528 4086 0.046242 ACTGGGATGGGAGGAATCCA 59.954 55.000 0.61 0.00 44.71 3.41
1529 4087 1.225373 CTGGGATGGGAGGAATCCAA 58.775 55.000 0.61 0.00 44.71 3.53
1530 4088 1.785208 CTGGGATGGGAGGAATCCAAT 59.215 52.381 0.61 0.00 44.71 3.16
1531 4089 2.178544 CTGGGATGGGAGGAATCCAATT 59.821 50.000 0.61 0.00 44.71 2.32
1532 4090 2.591560 TGGGATGGGAGGAATCCAATTT 59.408 45.455 0.61 0.00 44.71 1.82
1536 4094 2.722094 TGGGAGGAATCCAATTTGACG 58.278 47.619 0.61 0.00 0.00 4.35
1547 4105 2.916716 CCAATTTGACGCTTCATTTCGG 59.083 45.455 0.00 0.00 0.00 4.30
1557 4115 2.608090 GCTTCATTTCGGTGCTACTACC 59.392 50.000 0.00 0.00 37.37 3.18
1562 4120 0.241749 TTCGGTGCTACTACCACACG 59.758 55.000 0.00 0.00 40.89 4.49
1565 4123 2.442084 GTGCTACTACCACACGCAC 58.558 57.895 0.00 0.00 43.22 5.34
1566 4124 1.012486 GTGCTACTACCACACGCACC 61.012 60.000 0.00 0.00 43.68 5.01
1567 4125 1.290955 GCTACTACCACACGCACCA 59.709 57.895 0.00 0.00 0.00 4.17
1568 4126 0.320073 GCTACTACCACACGCACCAA 60.320 55.000 0.00 0.00 0.00 3.67
1569 4127 1.874739 GCTACTACCACACGCACCAAA 60.875 52.381 0.00 0.00 0.00 3.28
1572 4130 1.071699 ACTACCACACGCACCAAATCT 59.928 47.619 0.00 0.00 0.00 2.40
1602 4170 5.828747 CATTCTCATGCCAATTTAGGACTG 58.171 41.667 0.00 0.00 0.00 3.51
1604 4172 2.360165 CTCATGCCAATTTAGGACTGCC 59.640 50.000 0.00 0.00 0.00 4.85
1606 4174 0.679640 TGCCAATTTAGGACTGCCCG 60.680 55.000 0.00 0.00 40.87 6.13
1607 4175 1.384222 GCCAATTTAGGACTGCCCGG 61.384 60.000 0.00 0.00 40.87 5.73
1608 4176 1.384222 CCAATTTAGGACTGCCCGGC 61.384 60.000 1.04 1.04 40.87 6.13
1609 4177 0.394352 CAATTTAGGACTGCCCGGCT 60.394 55.000 11.61 0.00 40.87 5.52
1610 4178 0.394352 AATTTAGGACTGCCCGGCTG 60.394 55.000 14.39 14.39 40.87 4.85
1632 4207 1.284982 CGAGCGAGTGGTGGAAACAG 61.285 60.000 0.00 0.00 44.46 3.16
1643 4218 5.046520 AGTGGTGGAAACAGTATAGAGTTCC 60.047 44.000 0.00 0.00 44.46 3.62
1644 4219 4.224370 TGGTGGAAACAGTATAGAGTTCCC 59.776 45.833 0.00 0.00 44.46 3.97
1654 4229 6.548622 ACAGTATAGAGTTCCCACGCTAATTA 59.451 38.462 0.00 0.00 38.62 1.40
1655 4230 7.069085 ACAGTATAGAGTTCCCACGCTAATTAA 59.931 37.037 0.00 0.00 38.62 1.40
1676 4251 8.950403 ATTAAGCTGCTTTCTTAACTAAAACG 57.050 30.769 21.29 0.00 38.40 3.60
1677 4252 6.613755 AAGCTGCTTTCTTAACTAAAACGA 57.386 33.333 9.53 0.00 0.00 3.85
1678 4253 6.613755 AGCTGCTTTCTTAACTAAAACGAA 57.386 33.333 0.00 0.00 0.00 3.85
1680 4255 5.339875 GCTGCTTTCTTAACTAAAACGAAGC 59.660 40.000 0.00 0.00 0.00 3.86
1683 4278 5.851703 GCTTTCTTAACTAAAACGAAGCCTG 59.148 40.000 0.00 0.00 0.00 4.85
1687 4282 3.898517 AACTAAAACGAAGCCTGCTTC 57.101 42.857 19.48 19.48 46.41 3.86
1696 4291 0.036858 AAGCCTGCTTCTTCGTCTCC 60.037 55.000 0.00 0.00 0.00 3.71
1704 4299 2.737039 GCTTCTTCGTCTCCATCTCCAC 60.737 54.545 0.00 0.00 0.00 4.02
1706 4301 2.525368 TCTTCGTCTCCATCTCCACAA 58.475 47.619 0.00 0.00 0.00 3.33
1707 4302 2.231478 TCTTCGTCTCCATCTCCACAAC 59.769 50.000 0.00 0.00 0.00 3.32
1709 4304 1.272490 TCGTCTCCATCTCCACAACAC 59.728 52.381 0.00 0.00 0.00 3.32
1712 4307 3.005554 GTCTCCATCTCCACAACACATG 58.994 50.000 0.00 0.00 0.00 3.21
1714 4309 3.327464 TCTCCATCTCCACAACACATGAA 59.673 43.478 0.00 0.00 0.00 2.57
1715 4310 4.019051 TCTCCATCTCCACAACACATGAAT 60.019 41.667 0.00 0.00 0.00 2.57
1716 4311 4.011698 TCCATCTCCACAACACATGAATG 58.988 43.478 0.00 0.00 0.00 2.67
1717 4312 3.760151 CCATCTCCACAACACATGAATGT 59.240 43.478 0.00 0.00 42.84 2.71
1726 4321 3.034924 ACATGAATGTGCCCACGTT 57.965 47.368 0.00 5.61 42.72 3.99
1727 4322 2.192664 ACATGAATGTGCCCACGTTA 57.807 45.000 0.00 0.00 40.35 3.18
1728 4323 1.810151 ACATGAATGTGCCCACGTTAC 59.190 47.619 0.00 2.12 40.35 2.50
1729 4324 1.132262 CATGAATGTGCCCACGTTACC 59.868 52.381 5.90 0.00 40.35 2.85
1731 4326 0.802494 GAATGTGCCCACGTTACCAG 59.198 55.000 5.90 0.00 40.35 4.00
1743 4341 1.066858 CGTTACCAGTGCACTGATCCT 60.067 52.381 41.50 24.39 46.59 3.24
1746 4344 2.770164 ACCAGTGCACTGATCCTTAC 57.230 50.000 41.50 1.54 46.59 2.34
1749 4347 2.027745 CCAGTGCACTGATCCTTACTGT 60.028 50.000 41.50 4.37 46.59 3.55
1751 4349 4.067896 CAGTGCACTGATCCTTACTGTTT 58.932 43.478 38.12 0.00 46.59 2.83
1753 4351 4.516698 AGTGCACTGATCCTTACTGTTTTG 59.483 41.667 20.97 0.00 0.00 2.44
1758 4356 5.299279 CACTGATCCTTACTGTTTTGTTGGT 59.701 40.000 0.00 0.00 0.00 3.67
1759 4357 5.531287 ACTGATCCTTACTGTTTTGTTGGTC 59.469 40.000 0.00 0.00 0.00 4.02
1771 4369 7.395206 ACTGTTTTGTTGGTCTTAGTTACCTTT 59.605 33.333 0.00 0.00 37.91 3.11
1772 4370 7.764331 TGTTTTGTTGGTCTTAGTTACCTTTC 58.236 34.615 0.00 0.00 37.91 2.62
1773 4371 7.393796 TGTTTTGTTGGTCTTAGTTACCTTTCA 59.606 33.333 0.00 0.00 37.91 2.69
1774 4372 7.941431 TTTGTTGGTCTTAGTTACCTTTCAA 57.059 32.000 0.00 0.00 37.91 2.69
1775 4373 6.930667 TGTTGGTCTTAGTTACCTTTCAAC 57.069 37.500 0.00 0.00 37.91 3.18
1776 4374 6.416415 TGTTGGTCTTAGTTACCTTTCAACA 58.584 36.000 0.00 0.00 39.33 3.33
1778 4376 7.558444 TGTTGGTCTTAGTTACCTTTCAACAAT 59.442 33.333 0.00 0.00 38.90 2.71
1779 4377 7.504924 TGGTCTTAGTTACCTTTCAACAATG 57.495 36.000 0.00 0.00 37.91 2.82
1780 4378 7.284074 TGGTCTTAGTTACCTTTCAACAATGA 58.716 34.615 0.00 0.00 37.91 2.57
1781 4379 7.942341 TGGTCTTAGTTACCTTTCAACAATGAT 59.058 33.333 0.00 0.00 37.91 2.45
1783 4381 8.999431 GTCTTAGTTACCTTTCAACAATGATGA 58.001 33.333 0.00 0.00 34.96 2.92
1784 4382 9.739276 TCTTAGTTACCTTTCAACAATGATGAT 57.261 29.630 0.00 0.00 34.96 2.45
1785 4383 9.778993 CTTAGTTACCTTTCAACAATGATGATG 57.221 33.333 0.00 0.00 34.96 3.07
1786 4384 9.513906 TTAGTTACCTTTCAACAATGATGATGA 57.486 29.630 0.00 0.00 36.66 2.92
1793 4391 5.725325 TCAACAATGATGATGAAAAGCCA 57.275 34.783 0.00 0.00 35.66 4.75
1794 4392 6.288941 TCAACAATGATGATGAAAAGCCAT 57.711 33.333 0.00 0.00 35.66 4.40
1798 4396 6.103997 ACAATGATGATGAAAAGCCATTGAC 58.896 36.000 16.62 0.00 41.75 3.18
1799 4397 4.359971 TGATGATGAAAAGCCATTGACG 57.640 40.909 0.00 0.00 0.00 4.35
1800 4398 2.634982 TGATGAAAAGCCATTGACGC 57.365 45.000 0.00 0.00 0.00 5.19
1801 4399 2.161855 TGATGAAAAGCCATTGACGCT 58.838 42.857 0.00 0.00 38.53 5.07
1803 4401 2.704725 TGAAAAGCCATTGACGCTTC 57.295 45.000 1.38 0.00 45.69 3.86
1804 4402 1.069296 TGAAAAGCCATTGACGCTTCG 60.069 47.619 1.38 0.00 45.69 3.79
1805 4403 0.951558 AAAAGCCATTGACGCTTCGT 59.048 45.000 1.38 0.00 45.69 3.85
1806 4404 0.951558 AAAGCCATTGACGCTTCGTT 59.048 45.000 1.38 0.00 45.69 3.85
1807 4405 0.951558 AAGCCATTGACGCTTCGTTT 59.048 45.000 0.00 0.00 42.94 3.60
1808 4406 0.517316 AGCCATTGACGCTTCGTTTC 59.483 50.000 0.00 0.00 41.37 2.78
1809 4407 0.237235 GCCATTGACGCTTCGTTTCA 59.763 50.000 0.00 0.00 41.37 2.69
1810 4408 1.135689 GCCATTGACGCTTCGTTTCAT 60.136 47.619 0.00 0.00 41.37 2.57
1811 4409 2.668279 GCCATTGACGCTTCGTTTCATT 60.668 45.455 0.00 0.00 41.37 2.57
1812 4410 2.910482 CCATTGACGCTTCGTTTCATTG 59.090 45.455 0.00 0.00 41.37 2.82
1813 4411 2.031037 TTGACGCTTCGTTTCATTGC 57.969 45.000 0.00 0.00 41.37 3.56
1814 4412 1.225855 TGACGCTTCGTTTCATTGCT 58.774 45.000 0.00 0.00 41.37 3.91
1815 4413 2.409012 TGACGCTTCGTTTCATTGCTA 58.591 42.857 0.00 0.00 41.37 3.49
1816 4414 2.156891 TGACGCTTCGTTTCATTGCTAC 59.843 45.455 0.00 0.00 41.37 3.58
1817 4415 2.412089 GACGCTTCGTTTCATTGCTACT 59.588 45.455 0.00 0.00 41.37 2.57
1818 4416 2.806244 ACGCTTCGTTTCATTGCTACTT 59.194 40.909 0.00 0.00 36.35 2.24
1819 4417 3.250040 ACGCTTCGTTTCATTGCTACTTT 59.750 39.130 0.00 0.00 36.35 2.66
1820 4418 4.219033 CGCTTCGTTTCATTGCTACTTTT 58.781 39.130 0.00 0.00 0.00 2.27
1821 4419 5.049954 ACGCTTCGTTTCATTGCTACTTTTA 60.050 36.000 0.00 0.00 36.35 1.52
1822 4420 5.280678 CGCTTCGTTTCATTGCTACTTTTAC 59.719 40.000 0.00 0.00 0.00 2.01
1823 4421 6.371389 GCTTCGTTTCATTGCTACTTTTACT 58.629 36.000 0.00 0.00 0.00 2.24
1824 4422 6.856426 GCTTCGTTTCATTGCTACTTTTACTT 59.144 34.615 0.00 0.00 0.00 2.24
1825 4423 7.149128 GCTTCGTTTCATTGCTACTTTTACTTG 60.149 37.037 0.00 0.00 0.00 3.16
1826 4424 6.140110 TCGTTTCATTGCTACTTTTACTTGC 58.860 36.000 0.00 0.00 0.00 4.01
1827 4425 6.017440 TCGTTTCATTGCTACTTTTACTTGCT 60.017 34.615 0.00 0.00 0.00 3.91
1828 4426 6.086765 CGTTTCATTGCTACTTTTACTTGCTG 59.913 38.462 0.00 0.00 0.00 4.41
1829 4427 5.046910 TCATTGCTACTTTTACTTGCTGC 57.953 39.130 0.00 0.00 0.00 5.25
1830 4428 4.761739 TCATTGCTACTTTTACTTGCTGCT 59.238 37.500 0.00 0.00 0.00 4.24
1831 4429 5.937540 TCATTGCTACTTTTACTTGCTGCTA 59.062 36.000 0.00 0.00 0.00 3.49
1832 4430 5.607119 TTGCTACTTTTACTTGCTGCTAC 57.393 39.130 0.00 0.00 0.00 3.58
1833 4431 4.894784 TGCTACTTTTACTTGCTGCTACT 58.105 39.130 0.00 0.00 0.00 2.57
1834 4432 6.032956 TGCTACTTTTACTTGCTGCTACTA 57.967 37.500 0.00 0.00 0.00 1.82
1835 4433 5.867716 TGCTACTTTTACTTGCTGCTACTAC 59.132 40.000 0.00 0.00 0.00 2.73
1836 4434 5.867716 GCTACTTTTACTTGCTGCTACTACA 59.132 40.000 0.00 0.00 0.00 2.74
1837 4435 6.035112 GCTACTTTTACTTGCTGCTACTACAG 59.965 42.308 0.00 0.00 40.80 2.74
1838 4436 5.855045 ACTTTTACTTGCTGCTACTACAGT 58.145 37.500 0.00 0.00 39.96 3.55
1839 4437 6.989659 ACTTTTACTTGCTGCTACTACAGTA 58.010 36.000 0.00 0.00 39.96 2.74
1840 4438 6.867293 ACTTTTACTTGCTGCTACTACAGTAC 59.133 38.462 0.00 0.00 39.96 2.73
1841 4439 5.970317 TTACTTGCTGCTACTACAGTACA 57.030 39.130 0.00 0.00 39.96 2.90
1842 4440 4.175787 ACTTGCTGCTACTACAGTACAC 57.824 45.455 0.00 0.00 39.96 2.90
1843 4441 3.572682 ACTTGCTGCTACTACAGTACACA 59.427 43.478 0.00 0.00 39.96 3.72
1844 4442 3.570926 TGCTGCTACTACAGTACACAC 57.429 47.619 0.00 0.00 39.96 3.82
1845 4443 2.888414 TGCTGCTACTACAGTACACACA 59.112 45.455 0.00 0.00 39.96 3.72
1846 4444 3.509967 TGCTGCTACTACAGTACACACAT 59.490 43.478 0.00 0.00 39.96 3.21
1847 4445 3.859961 GCTGCTACTACAGTACACACATG 59.140 47.826 0.00 0.00 39.96 3.21
1848 4446 3.845178 TGCTACTACAGTACACACATGC 58.155 45.455 0.00 0.00 0.00 4.06
1849 4447 3.509967 TGCTACTACAGTACACACATGCT 59.490 43.478 0.00 0.00 0.00 3.79
1850 4448 4.106197 GCTACTACAGTACACACATGCTC 58.894 47.826 0.00 0.00 0.00 4.26
1851 4449 3.594603 ACTACAGTACACACATGCTCC 57.405 47.619 0.00 0.00 0.00 4.70
1852 4450 2.897326 ACTACAGTACACACATGCTCCA 59.103 45.455 0.00 0.00 0.00 3.86
1853 4451 2.169832 ACAGTACACACATGCTCCAC 57.830 50.000 0.00 0.00 0.00 4.02
1854 4452 1.416030 ACAGTACACACATGCTCCACA 59.584 47.619 0.00 0.00 0.00 4.17
1855 4453 2.158827 ACAGTACACACATGCTCCACAA 60.159 45.455 0.00 0.00 0.00 3.33
1856 4454 2.224079 CAGTACACACATGCTCCACAAC 59.776 50.000 0.00 0.00 0.00 3.32
1857 4455 2.158827 AGTACACACATGCTCCACAACA 60.159 45.455 0.00 0.00 0.00 3.33
1858 4456 1.761449 ACACACATGCTCCACAACAA 58.239 45.000 0.00 0.00 0.00 2.83
1859 4457 2.098614 ACACACATGCTCCACAACAAA 58.901 42.857 0.00 0.00 0.00 2.83
1860 4458 2.694628 ACACACATGCTCCACAACAAAT 59.305 40.909 0.00 0.00 0.00 2.32
1861 4459 3.054166 CACACATGCTCCACAACAAATG 58.946 45.455 0.00 0.00 0.00 2.32
1862 4460 2.063266 CACATGCTCCACAACAAATGC 58.937 47.619 0.00 0.00 0.00 3.56
1863 4461 1.687660 ACATGCTCCACAACAAATGCA 59.312 42.857 0.00 0.00 34.88 3.96
1864 4462 2.288579 ACATGCTCCACAACAAATGCAG 60.289 45.455 0.00 0.00 33.87 4.41
1865 4463 1.689984 TGCTCCACAACAAATGCAGA 58.310 45.000 0.00 0.00 0.00 4.26
1866 4464 2.241160 TGCTCCACAACAAATGCAGAT 58.759 42.857 0.00 0.00 0.00 2.90
1867 4465 2.029739 TGCTCCACAACAAATGCAGATG 60.030 45.455 0.00 0.00 0.00 2.90
1868 4466 2.602878 CTCCACAACAAATGCAGATGC 58.397 47.619 0.00 0.00 42.50 3.91
1890 4488 3.891422 TTTTCATGCAGCCCATTTAGG 57.109 42.857 0.00 0.00 29.71 2.69
1902 4500 3.127425 CCATTTAGGGCTAGTAGGTGC 57.873 52.381 0.00 0.00 0.00 5.01
1908 4506 3.290776 GGCTAGTAGGTGCCGATTG 57.709 57.895 0.00 0.00 39.71 2.67
1909 4507 0.880718 GGCTAGTAGGTGCCGATTGC 60.881 60.000 0.00 0.00 39.71 3.56
1910 4508 0.105039 GCTAGTAGGTGCCGATTGCT 59.895 55.000 0.00 0.00 42.00 3.91
1911 4509 1.473434 GCTAGTAGGTGCCGATTGCTT 60.473 52.381 0.00 0.00 42.00 3.91
1912 4510 2.205074 CTAGTAGGTGCCGATTGCTTG 58.795 52.381 0.00 0.00 42.00 4.01
1913 4511 0.392998 AGTAGGTGCCGATTGCTTGG 60.393 55.000 0.00 0.00 42.00 3.61
1914 4512 0.676782 GTAGGTGCCGATTGCTTGGT 60.677 55.000 0.00 0.00 42.00 3.67
1915 4513 0.676466 TAGGTGCCGATTGCTTGGTG 60.676 55.000 0.00 0.00 42.00 4.17
1916 4514 2.568090 GTGCCGATTGCTTGGTGG 59.432 61.111 0.00 0.00 42.00 4.61
1917 4515 1.971167 GTGCCGATTGCTTGGTGGA 60.971 57.895 0.00 0.00 42.00 4.02
1918 4516 1.228398 TGCCGATTGCTTGGTGGAA 60.228 52.632 0.00 0.00 42.00 3.53
1919 4517 0.825425 TGCCGATTGCTTGGTGGAAA 60.825 50.000 0.00 0.00 42.00 3.13
1920 4518 0.388520 GCCGATTGCTTGGTGGAAAC 60.389 55.000 0.00 0.00 36.87 2.78
1921 4519 0.958091 CCGATTGCTTGGTGGAAACA 59.042 50.000 0.00 0.00 38.70 2.83
1922 4520 1.068333 CCGATTGCTTGGTGGAAACAG 60.068 52.381 0.00 0.00 44.46 3.16
1923 4521 1.608590 CGATTGCTTGGTGGAAACAGT 59.391 47.619 0.00 0.00 44.46 3.55
1924 4522 2.034558 CGATTGCTTGGTGGAAACAGTT 59.965 45.455 0.00 0.00 44.46 3.16
1925 4523 3.490761 CGATTGCTTGGTGGAAACAGTTT 60.491 43.478 0.00 0.00 44.46 2.66
1926 4524 4.261405 CGATTGCTTGGTGGAAACAGTTTA 60.261 41.667 0.00 0.00 44.46 2.01
1927 4525 4.647424 TTGCTTGGTGGAAACAGTTTAG 57.353 40.909 0.00 0.00 44.46 1.85
1928 4526 3.892284 TGCTTGGTGGAAACAGTTTAGA 58.108 40.909 0.00 0.00 44.46 2.10
1929 4527 3.882888 TGCTTGGTGGAAACAGTTTAGAG 59.117 43.478 0.00 0.00 44.46 2.43
1930 4528 3.883489 GCTTGGTGGAAACAGTTTAGAGT 59.117 43.478 0.00 0.00 44.46 3.24
1931 4529 4.261197 GCTTGGTGGAAACAGTTTAGAGTG 60.261 45.833 0.00 0.00 44.46 3.51
1932 4530 3.211045 TGGTGGAAACAGTTTAGAGTGC 58.789 45.455 0.00 0.00 44.46 4.40
1933 4531 2.552743 GGTGGAAACAGTTTAGAGTGCC 59.447 50.000 0.00 0.00 44.46 5.01
1934 4532 2.552743 GTGGAAACAGTTTAGAGTGCCC 59.447 50.000 0.00 0.00 44.46 5.36
1935 4533 2.173782 TGGAAACAGTTTAGAGTGCCCA 59.826 45.455 0.00 0.00 35.01 5.36
1936 4534 3.181434 TGGAAACAGTTTAGAGTGCCCAT 60.181 43.478 0.00 0.00 35.01 4.00
1937 4535 3.826729 GGAAACAGTTTAGAGTGCCCATT 59.173 43.478 0.00 0.00 0.00 3.16
1938 4536 5.007682 GGAAACAGTTTAGAGTGCCCATTA 58.992 41.667 0.00 0.00 0.00 1.90
1939 4537 5.475564 GGAAACAGTTTAGAGTGCCCATTAA 59.524 40.000 0.00 0.00 0.00 1.40
1940 4538 5.959618 AACAGTTTAGAGTGCCCATTAAC 57.040 39.130 0.00 0.00 0.00 2.01
1941 4539 4.000988 ACAGTTTAGAGTGCCCATTAACG 58.999 43.478 0.00 0.00 0.00 3.18
1942 4540 3.007635 AGTTTAGAGTGCCCATTAACGC 58.992 45.455 0.00 0.00 0.00 4.84
1943 4541 2.032680 TTAGAGTGCCCATTAACGCC 57.967 50.000 0.00 0.00 0.00 5.68
1944 4542 0.179094 TAGAGTGCCCATTAACGCCG 60.179 55.000 0.00 0.00 0.00 6.46
1945 4543 1.448893 GAGTGCCCATTAACGCCGA 60.449 57.895 0.00 0.00 0.00 5.54
1946 4544 0.814010 GAGTGCCCATTAACGCCGAT 60.814 55.000 0.00 0.00 0.00 4.18
1947 4545 0.466543 AGTGCCCATTAACGCCGATA 59.533 50.000 0.00 0.00 0.00 2.92
1948 4546 1.134340 AGTGCCCATTAACGCCGATAA 60.134 47.619 0.00 0.00 0.00 1.75
1949 4547 1.263217 GTGCCCATTAACGCCGATAAG 59.737 52.381 0.00 0.00 0.00 1.73
1950 4548 0.237498 GCCCATTAACGCCGATAAGC 59.763 55.000 0.00 0.00 0.00 3.09
1951 4549 1.878953 CCCATTAACGCCGATAAGCT 58.121 50.000 0.00 0.00 0.00 3.74
1952 4550 2.868839 GCCCATTAACGCCGATAAGCTA 60.869 50.000 0.00 0.00 0.00 3.32
1953 4551 3.395639 CCCATTAACGCCGATAAGCTAA 58.604 45.455 0.00 0.00 0.00 3.09
1954 4552 4.000988 CCCATTAACGCCGATAAGCTAAT 58.999 43.478 0.00 0.00 0.00 1.73
1955 4553 4.454504 CCCATTAACGCCGATAAGCTAATT 59.545 41.667 0.00 0.00 0.00 1.40
1956 4554 5.048991 CCCATTAACGCCGATAAGCTAATTT 60.049 40.000 0.00 0.00 0.00 1.82
1957 4555 6.148150 CCCATTAACGCCGATAAGCTAATTTA 59.852 38.462 0.00 0.00 0.00 1.40
1958 4556 7.308109 CCCATTAACGCCGATAAGCTAATTTAA 60.308 37.037 0.00 0.00 0.00 1.52
1959 4557 7.532884 CCATTAACGCCGATAAGCTAATTTAAC 59.467 37.037 0.00 0.00 0.00 2.01
1960 4558 7.775397 TTAACGCCGATAAGCTAATTTAACT 57.225 32.000 0.00 0.00 0.00 2.24
1961 4559 8.870160 TTAACGCCGATAAGCTAATTTAACTA 57.130 30.769 0.00 0.00 0.00 2.24
1962 4560 7.404139 AACGCCGATAAGCTAATTTAACTAG 57.596 36.000 0.00 0.00 0.00 2.57
1963 4561 6.742109 ACGCCGATAAGCTAATTTAACTAGA 58.258 36.000 0.00 0.00 0.00 2.43
1964 4562 7.376615 ACGCCGATAAGCTAATTTAACTAGAT 58.623 34.615 0.00 0.00 0.00 1.98
1965 4563 7.871463 ACGCCGATAAGCTAATTTAACTAGATT 59.129 33.333 0.00 0.00 0.00 2.40
1966 4564 8.709646 CGCCGATAAGCTAATTTAACTAGATTT 58.290 33.333 0.00 0.00 0.00 2.17
1983 4581 8.095937 ACTAGATTTTAAAAACAGAGTTCCGG 57.904 34.615 4.44 0.00 0.00 5.14
1984 4582 6.954487 AGATTTTAAAAACAGAGTTCCGGT 57.046 33.333 4.44 0.00 0.00 5.28
1985 4583 6.967135 AGATTTTAAAAACAGAGTTCCGGTC 58.033 36.000 4.44 0.00 0.00 4.79
1986 4584 4.799419 TTTAAAAACAGAGTTCCGGTCG 57.201 40.909 0.00 0.00 0.00 4.79
1987 4585 2.320745 AAAAACAGAGTTCCGGTCGT 57.679 45.000 0.00 0.00 0.00 4.34
1990 4588 0.462789 AACAGAGTTCCGGTCGTGTT 59.537 50.000 0.00 8.91 0.00 3.32
1996 4594 3.119708 AGAGTTCCGGTCGTGTTATACAC 60.120 47.826 0.00 0.00 45.26 2.90
2003 4601 6.397272 TCCGGTCGTGTTATACACTTTTAAT 58.603 36.000 0.00 0.00 46.46 1.40
2008 4606 9.369904 GGTCGTGTTATACACTTTTAATTCCTA 57.630 33.333 8.18 0.00 46.46 2.94
2024 4622 8.810652 TTAATTCCTATTTGATTAATTGCGGC 57.189 30.769 0.00 0.00 0.00 6.53
2026 4624 2.979813 CCTATTTGATTAATTGCGGCGC 59.020 45.455 27.44 27.44 0.00 6.53
2027 4625 2.869233 ATTTGATTAATTGCGGCGCT 57.131 40.000 33.26 15.80 0.00 5.92
2028 4626 1.906757 TTTGATTAATTGCGGCGCTG 58.093 45.000 33.26 13.18 0.00 5.18
2030 4628 1.029408 TGATTAATTGCGGCGCTGGT 61.029 50.000 33.26 19.06 0.00 4.00
2031 4629 0.100503 GATTAATTGCGGCGCTGGTT 59.899 50.000 33.26 24.14 0.00 3.67
2032 4630 0.100503 ATTAATTGCGGCGCTGGTTC 59.899 50.000 33.26 2.78 0.00 3.62
2033 4631 2.246993 TTAATTGCGGCGCTGGTTCG 62.247 55.000 33.26 8.65 0.00 3.95
2038 4636 3.788766 CGGCGCTGGTTCGGAAAG 61.789 66.667 8.83 0.00 0.00 2.62
2039 4637 4.103103 GGCGCTGGTTCGGAAAGC 62.103 66.667 7.64 4.66 0.00 3.51
2040 4638 4.103103 GCGCTGGTTCGGAAAGCC 62.103 66.667 0.00 0.38 33.24 4.35
2041 4639 2.358737 CGCTGGTTCGGAAAGCCT 60.359 61.111 8.43 0.00 33.24 4.58
2042 4640 2.680913 CGCTGGTTCGGAAAGCCTG 61.681 63.158 8.43 4.83 33.24 4.85
2043 4641 2.982744 GCTGGTTCGGAAAGCCTGC 61.983 63.158 11.59 11.59 39.38 4.85
2044 4642 1.600636 CTGGTTCGGAAAGCCTGCA 60.601 57.895 0.00 0.00 31.73 4.41
2045 4643 0.962356 CTGGTTCGGAAAGCCTGCAT 60.962 55.000 0.00 0.00 31.73 3.96
2046 4644 0.326595 TGGTTCGGAAAGCCTGCATA 59.673 50.000 0.00 0.00 31.73 3.14
2047 4645 0.733150 GGTTCGGAAAGCCTGCATAC 59.267 55.000 0.00 0.00 0.00 2.39
2048 4646 1.448985 GTTCGGAAAGCCTGCATACA 58.551 50.000 0.00 0.00 0.00 2.29
2049 4647 1.130561 GTTCGGAAAGCCTGCATACAC 59.869 52.381 0.00 0.00 0.00 2.90
2050 4648 0.613260 TCGGAAAGCCTGCATACACT 59.387 50.000 0.00 0.00 0.00 3.55
2051 4649 1.009829 CGGAAAGCCTGCATACACTC 58.990 55.000 0.00 0.00 0.00 3.51
2052 4650 1.406069 CGGAAAGCCTGCATACACTCT 60.406 52.381 0.00 0.00 0.00 3.24
2053 4651 2.716217 GGAAAGCCTGCATACACTCTT 58.284 47.619 0.00 0.00 0.00 2.85
2054 4652 3.084786 GGAAAGCCTGCATACACTCTTT 58.915 45.455 0.00 0.00 0.00 2.52
2055 4653 4.261801 GGAAAGCCTGCATACACTCTTTA 58.738 43.478 0.00 0.00 0.00 1.85
2056 4654 4.333926 GGAAAGCCTGCATACACTCTTTAG 59.666 45.833 0.00 0.00 0.00 1.85
2057 4655 4.559862 AAGCCTGCATACACTCTTTAGT 57.440 40.909 0.00 0.00 35.91 2.24
2058 4656 4.559862 AGCCTGCATACACTCTTTAGTT 57.440 40.909 0.00 0.00 31.97 2.24
2059 4657 5.677319 AGCCTGCATACACTCTTTAGTTA 57.323 39.130 0.00 0.00 31.97 2.24
2060 4658 6.049955 AGCCTGCATACACTCTTTAGTTAA 57.950 37.500 0.00 0.00 31.97 2.01
2061 4659 5.875359 AGCCTGCATACACTCTTTAGTTAAC 59.125 40.000 0.00 0.00 31.97 2.01
2062 4660 5.064834 GCCTGCATACACTCTTTAGTTAACC 59.935 44.000 0.88 0.00 31.97 2.85
2063 4661 6.170506 CCTGCATACACTCTTTAGTTAACCA 58.829 40.000 0.88 0.00 31.97 3.67
2064 4662 6.653320 CCTGCATACACTCTTTAGTTAACCAA 59.347 38.462 0.88 0.00 31.97 3.67
2065 4663 7.174253 CCTGCATACACTCTTTAGTTAACCAAA 59.826 37.037 0.88 0.01 31.97 3.28
2066 4664 8.453238 TGCATACACTCTTTAGTTAACCAAAA 57.547 30.769 0.88 2.97 31.97 2.44
2067 4665 8.347035 TGCATACACTCTTTAGTTAACCAAAAC 58.653 33.333 0.88 0.00 31.97 2.43
2068 4666 7.532884 GCATACACTCTTTAGTTAACCAAAACG 59.467 37.037 0.88 0.00 31.97 3.60
2069 4667 6.990341 ACACTCTTTAGTTAACCAAAACGT 57.010 33.333 0.88 0.00 31.97 3.99
2070 4668 7.381766 ACACTCTTTAGTTAACCAAAACGTT 57.618 32.000 0.88 0.00 31.97 3.99
2071 4669 7.245604 ACACTCTTTAGTTAACCAAAACGTTG 58.754 34.615 0.00 0.00 31.97 4.10
2072 4670 7.094677 ACACTCTTTAGTTAACCAAAACGTTGT 60.095 33.333 0.00 0.00 31.97 3.32
2073 4671 7.751793 CACTCTTTAGTTAACCAAAACGTTGTT 59.248 33.333 0.00 4.53 31.97 2.83
2074 4672 7.751793 ACTCTTTAGTTAACCAAAACGTTGTTG 59.248 33.333 0.00 8.73 34.46 3.33
2075 4673 7.814642 TCTTTAGTTAACCAAAACGTTGTTGA 58.185 30.769 18.57 7.34 34.46 3.18
2076 4674 8.460428 TCTTTAGTTAACCAAAACGTTGTTGAT 58.540 29.630 18.57 12.15 34.46 2.57
2077 4675 8.983307 TTTAGTTAACCAAAACGTTGTTGATT 57.017 26.923 18.57 13.22 34.46 2.57
2078 4676 8.983307 TTAGTTAACCAAAACGTTGTTGATTT 57.017 26.923 18.57 14.42 34.46 2.17
2079 4677 7.892778 AGTTAACCAAAACGTTGTTGATTTT 57.107 28.000 18.57 12.82 34.46 1.82
2080 4678 8.312896 AGTTAACCAAAACGTTGTTGATTTTT 57.687 26.923 18.57 11.25 34.46 1.94
2102 4700 5.473796 TTTTAAACAACTGACTGGTCGAC 57.526 39.130 7.13 7.13 0.00 4.20
2103 4701 2.684001 AAACAACTGACTGGTCGACA 57.316 45.000 18.91 2.63 0.00 4.35
2112 4710 3.217242 CTGGTCGACAGTTCCAAGG 57.783 57.895 18.91 0.00 42.42 3.61
2113 4711 0.679505 CTGGTCGACAGTTCCAAGGA 59.320 55.000 18.91 0.00 42.42 3.36
2114 4712 0.679505 TGGTCGACAGTTCCAAGGAG 59.320 55.000 18.91 0.00 0.00 3.69
2115 4713 0.037232 GGTCGACAGTTCCAAGGAGG 60.037 60.000 18.91 0.00 39.47 4.30
2116 4714 0.037232 GTCGACAGTTCCAAGGAGGG 60.037 60.000 11.55 0.00 38.24 4.30
2117 4715 0.178944 TCGACAGTTCCAAGGAGGGA 60.179 55.000 0.00 0.00 38.24 4.20
2122 4720 3.341263 GTTCCAAGGAGGGACAACC 57.659 57.895 0.00 0.00 46.18 3.77
2123 4721 0.476771 GTTCCAAGGAGGGACAACCA 59.523 55.000 0.00 0.00 46.18 3.67
2124 4722 1.075536 GTTCCAAGGAGGGACAACCAT 59.924 52.381 0.00 0.00 46.18 3.55
2125 4723 2.307686 GTTCCAAGGAGGGACAACCATA 59.692 50.000 0.00 0.00 46.18 2.74
2126 4724 1.913419 TCCAAGGAGGGACAACCATAC 59.087 52.381 0.00 0.00 43.89 2.39
2127 4725 1.633432 CCAAGGAGGGACAACCATACA 59.367 52.381 0.00 0.00 43.89 2.29
2128 4726 2.041081 CCAAGGAGGGACAACCATACAA 59.959 50.000 0.00 0.00 43.89 2.41
2129 4727 3.347216 CAAGGAGGGACAACCATACAAG 58.653 50.000 0.00 0.00 43.89 3.16
2130 4728 2.632537 AGGAGGGACAACCATACAAGT 58.367 47.619 0.00 0.00 43.89 3.16
2131 4729 2.305927 AGGAGGGACAACCATACAAGTG 59.694 50.000 0.00 0.00 43.89 3.16
2132 4730 2.039879 GGAGGGACAACCATACAAGTGT 59.960 50.000 0.00 0.00 43.89 3.55
2133 4731 3.497942 GGAGGGACAACCATACAAGTGTT 60.498 47.826 0.00 0.00 43.89 3.32
2134 4732 4.263156 GGAGGGACAACCATACAAGTGTTA 60.263 45.833 0.00 0.00 43.89 2.41
2135 4733 5.497474 GAGGGACAACCATACAAGTGTTAT 58.503 41.667 0.00 0.00 43.89 1.89
2136 4734 6.352394 GGAGGGACAACCATACAAGTGTTATA 60.352 42.308 0.00 0.00 43.89 0.98
2137 4735 6.650120 AGGGACAACCATACAAGTGTTATAG 58.350 40.000 0.00 0.00 43.89 1.31
2138 4736 6.214819 AGGGACAACCATACAAGTGTTATAGT 59.785 38.462 0.00 0.00 43.89 2.12
2139 4737 6.882678 GGGACAACCATACAAGTGTTATAGTT 59.117 38.462 0.00 0.00 39.85 2.24
2140 4738 7.392393 GGGACAACCATACAAGTGTTATAGTTT 59.608 37.037 0.00 0.00 39.85 2.66
2141 4739 9.439500 GGACAACCATACAAGTGTTATAGTTTA 57.561 33.333 0.00 0.00 35.97 2.01
2143 4741 9.223099 ACAACCATACAAGTGTTATAGTTTACC 57.777 33.333 0.00 0.00 0.00 2.85
2144 4742 8.671028 CAACCATACAAGTGTTATAGTTTACCC 58.329 37.037 0.00 0.00 0.00 3.69
2145 4743 8.154420 ACCATACAAGTGTTATAGTTTACCCT 57.846 34.615 0.00 0.00 0.00 4.34
2146 4744 8.044908 ACCATACAAGTGTTATAGTTTACCCTG 58.955 37.037 0.00 0.00 0.00 4.45
2147 4745 8.262227 CCATACAAGTGTTATAGTTTACCCTGA 58.738 37.037 0.00 0.00 0.00 3.86
2148 4746 9.832445 CATACAAGTGTTATAGTTTACCCTGAT 57.168 33.333 0.00 0.00 0.00 2.90
2151 4749 9.662947 ACAAGTGTTATAGTTTACCCTGATTAC 57.337 33.333 0.00 0.00 0.00 1.89
2152 4750 9.661563 CAAGTGTTATAGTTTACCCTGATTACA 57.338 33.333 0.00 0.00 0.00 2.41
2161 4759 8.561738 AGTTTACCCTGATTACAATACACAAG 57.438 34.615 0.00 0.00 0.00 3.16
2162 4760 8.380099 AGTTTACCCTGATTACAATACACAAGA 58.620 33.333 0.00 0.00 0.00 3.02
2163 4761 9.005777 GTTTACCCTGATTACAATACACAAGAA 57.994 33.333 0.00 0.00 0.00 2.52
2164 4762 9.575868 TTTACCCTGATTACAATACACAAGAAA 57.424 29.630 0.00 0.00 0.00 2.52
2165 4763 9.575868 TTACCCTGATTACAATACACAAGAAAA 57.424 29.630 0.00 0.00 0.00 2.29
2166 4764 8.472007 ACCCTGATTACAATACACAAGAAAAA 57.528 30.769 0.00 0.00 0.00 1.94
2197 4795 9.739276 ATGTGACTATCCATTTTCTTACTGAAA 57.261 29.630 0.00 0.00 42.33 2.69
2219 4817 6.959639 AAAAAGGCTCTTCACTGTTCATAA 57.040 33.333 0.00 0.00 0.00 1.90
2220 4818 6.566197 AAAAGGCTCTTCACTGTTCATAAG 57.434 37.500 0.00 0.00 0.00 1.73
2221 4819 4.899352 AGGCTCTTCACTGTTCATAAGT 57.101 40.909 0.00 0.00 0.00 2.24
2222 4820 6.360370 AAGGCTCTTCACTGTTCATAAGTA 57.640 37.500 0.00 0.00 0.00 2.24
2223 4821 6.552445 AGGCTCTTCACTGTTCATAAGTAT 57.448 37.500 0.00 0.00 0.00 2.12
2224 4822 6.951971 AGGCTCTTCACTGTTCATAAGTATT 58.048 36.000 0.00 0.00 0.00 1.89
2225 4823 7.044798 AGGCTCTTCACTGTTCATAAGTATTC 58.955 38.462 0.00 0.00 0.00 1.75
2226 4824 6.818644 GGCTCTTCACTGTTCATAAGTATTCA 59.181 38.462 0.00 0.00 0.00 2.57
2227 4825 7.010923 GGCTCTTCACTGTTCATAAGTATTCAG 59.989 40.741 0.00 0.00 0.00 3.02
2228 4826 7.010923 GCTCTTCACTGTTCATAAGTATTCAGG 59.989 40.741 0.00 0.00 0.00 3.86
2229 4827 6.818644 TCTTCACTGTTCATAAGTATTCAGGC 59.181 38.462 0.00 0.00 0.00 4.85
2230 4828 5.428253 TCACTGTTCATAAGTATTCAGGCC 58.572 41.667 0.00 0.00 0.00 5.19
2249 4847 6.040054 TCAGGCCTATTGTCATTTGATGAATG 59.960 38.462 3.98 0.00 45.31 2.67
2283 4881 1.031235 TTCACGTCGTTGGTACTGGA 58.969 50.000 0.00 0.00 0.00 3.86
2286 4884 1.068125 CACGTCGTTGGTACTGGATCA 60.068 52.381 0.00 0.00 0.00 2.92
2294 4892 5.244402 TCGTTGGTACTGGATCAGTTTCTAA 59.756 40.000 5.86 2.73 42.59 2.10
2302 4900 7.973048 ACTGGATCAGTTTCTAACTACCATA 57.027 36.000 0.00 0.00 42.59 2.74
2304 4902 8.993424 ACTGGATCAGTTTCTAACTACCATATT 58.007 33.333 0.00 0.00 42.59 1.28
2305 4903 9.265901 CTGGATCAGTTTCTAACTACCATATTG 57.734 37.037 0.00 0.00 40.46 1.90
2306 4904 7.715249 TGGATCAGTTTCTAACTACCATATTGC 59.285 37.037 0.00 0.00 40.46 3.56
2308 4906 8.668510 ATCAGTTTCTAACTACCATATTGCTG 57.331 34.615 0.00 0.00 40.46 4.41
2309 4907 7.620880 TCAGTTTCTAACTACCATATTGCTGT 58.379 34.615 0.00 0.00 40.46 4.40
2312 4910 8.537016 AGTTTCTAACTACCATATTGCTGTACA 58.463 33.333 0.00 0.00 40.69 2.90
2313 4911 8.601476 GTTTCTAACTACCATATTGCTGTACAC 58.399 37.037 0.00 0.00 0.00 2.90
2314 4912 6.812998 TCTAACTACCATATTGCTGTACACC 58.187 40.000 0.00 0.00 0.00 4.16
2315 4913 5.693769 AACTACCATATTGCTGTACACCT 57.306 39.130 0.00 0.00 0.00 4.00
2316 4914 5.023533 ACTACCATATTGCTGTACACCTG 57.976 43.478 0.00 0.00 0.00 4.00
2317 4915 4.469945 ACTACCATATTGCTGTACACCTGT 59.530 41.667 0.00 0.00 0.00 4.00
2318 4916 5.659525 ACTACCATATTGCTGTACACCTGTA 59.340 40.000 0.00 0.00 0.00 2.74
2336 4934 4.122776 CTGTATCTGTATGTTGGCTCCAC 58.877 47.826 0.00 0.00 0.00 4.02
2343 4941 4.980573 TGTATGTTGGCTCCACTAGTTTT 58.019 39.130 0.00 0.00 0.00 2.43
2372 4970 0.804364 GCAGATGTGCCGTTTCATGA 59.196 50.000 2.79 0.00 44.72 3.07
2394 4992 9.778993 CATGACTTGTTATTCTTATTCAAGTGG 57.221 33.333 12.43 1.01 45.30 4.00
2400 4998 4.965119 ATTCTTATTCAAGTGGGCGAAC 57.035 40.909 0.00 0.00 33.20 3.95
2402 5000 4.811969 TCTTATTCAAGTGGGCGAACTA 57.188 40.909 0.00 0.00 33.20 2.24
2403 5001 4.755411 TCTTATTCAAGTGGGCGAACTAG 58.245 43.478 0.00 0.00 33.20 2.57
2404 5002 2.403252 ATTCAAGTGGGCGAACTAGG 57.597 50.000 0.00 0.00 0.00 3.02
2405 5003 1.053424 TTCAAGTGGGCGAACTAGGT 58.947 50.000 0.00 0.00 0.00 3.08
2406 5004 0.606604 TCAAGTGGGCGAACTAGGTC 59.393 55.000 0.00 0.00 0.00 3.85
2407 5005 0.320374 CAAGTGGGCGAACTAGGTCA 59.680 55.000 8.85 0.00 0.00 4.02
2408 5006 1.066143 CAAGTGGGCGAACTAGGTCAT 60.066 52.381 8.85 0.00 0.00 3.06
2409 5007 1.276622 AGTGGGCGAACTAGGTCATT 58.723 50.000 8.85 0.00 0.00 2.57
2410 5008 1.628846 AGTGGGCGAACTAGGTCATTT 59.371 47.619 8.85 0.00 0.00 2.32
2411 5009 2.039879 AGTGGGCGAACTAGGTCATTTT 59.960 45.455 8.85 0.00 0.00 1.82
2412 5010 2.817844 GTGGGCGAACTAGGTCATTTTT 59.182 45.455 8.85 0.00 0.00 1.94
2413 5011 4.004982 GTGGGCGAACTAGGTCATTTTTA 58.995 43.478 8.85 0.00 0.00 1.52
2414 5012 4.638865 GTGGGCGAACTAGGTCATTTTTAT 59.361 41.667 8.85 0.00 0.00 1.40
2415 5013 5.124936 GTGGGCGAACTAGGTCATTTTTATT 59.875 40.000 8.85 0.00 0.00 1.40
2416 5014 5.355910 TGGGCGAACTAGGTCATTTTTATTC 59.644 40.000 8.85 0.00 0.00 1.75
2417 5015 5.355910 GGGCGAACTAGGTCATTTTTATTCA 59.644 40.000 8.85 0.00 0.00 2.57
2418 5016 6.458342 GGGCGAACTAGGTCATTTTTATTCAG 60.458 42.308 8.85 0.00 0.00 3.02
2419 5017 6.093633 GGCGAACTAGGTCATTTTTATTCAGT 59.906 38.462 8.85 0.00 0.00 3.41
2420 5018 7.361799 GGCGAACTAGGTCATTTTTATTCAGTT 60.362 37.037 8.85 0.00 0.00 3.16
2421 5019 8.021396 GCGAACTAGGTCATTTTTATTCAGTTT 58.979 33.333 8.85 0.00 0.00 2.66
2422 5020 9.329913 CGAACTAGGTCATTTTTATTCAGTTTG 57.670 33.333 8.85 0.00 0.00 2.93
2423 5021 9.129209 GAACTAGGTCATTTTTATTCAGTTTGC 57.871 33.333 1.90 0.00 0.00 3.68
2424 5022 8.409358 ACTAGGTCATTTTTATTCAGTTTGCT 57.591 30.769 0.00 0.00 0.00 3.91
2425 5023 8.860088 ACTAGGTCATTTTTATTCAGTTTGCTT 58.140 29.630 0.00 0.00 0.00 3.91
2426 5024 9.346725 CTAGGTCATTTTTATTCAGTTTGCTTC 57.653 33.333 0.00 0.00 0.00 3.86
2427 5025 7.154656 AGGTCATTTTTATTCAGTTTGCTTCC 58.845 34.615 0.00 0.00 0.00 3.46
2428 5026 7.015584 AGGTCATTTTTATTCAGTTTGCTTCCT 59.984 33.333 0.00 0.00 0.00 3.36
2429 5027 7.116805 GGTCATTTTTATTCAGTTTGCTTCCTG 59.883 37.037 0.00 0.00 0.00 3.86
2430 5028 6.646240 TCATTTTTATTCAGTTTGCTTCCTGC 59.354 34.615 0.00 0.00 43.25 4.85
2431 5029 5.789643 TTTTATTCAGTTTGCTTCCTGCT 57.210 34.783 0.00 0.00 43.37 4.24
2432 5030 6.892658 TTTTATTCAGTTTGCTTCCTGCTA 57.107 33.333 0.00 0.00 43.37 3.49
2433 5031 7.466746 TTTTATTCAGTTTGCTTCCTGCTAT 57.533 32.000 0.00 0.00 43.37 2.97
2434 5032 7.466746 TTTATTCAGTTTGCTTCCTGCTATT 57.533 32.000 0.00 0.00 43.37 1.73
2435 5033 5.990120 ATTCAGTTTGCTTCCTGCTATTT 57.010 34.783 0.00 0.00 43.37 1.40
2436 5034 5.376854 TTCAGTTTGCTTCCTGCTATTTC 57.623 39.130 0.00 0.00 43.37 2.17
2437 5035 3.758554 TCAGTTTGCTTCCTGCTATTTCC 59.241 43.478 0.00 0.00 43.37 3.13
2438 5036 3.507233 CAGTTTGCTTCCTGCTATTTCCA 59.493 43.478 0.00 0.00 43.37 3.53
2439 5037 4.022068 CAGTTTGCTTCCTGCTATTTCCAA 60.022 41.667 0.00 0.00 43.37 3.53
2440 5038 4.588528 AGTTTGCTTCCTGCTATTTCCAAA 59.411 37.500 0.00 0.00 43.37 3.28
2441 5039 4.789012 TTGCTTCCTGCTATTTCCAAAG 57.211 40.909 0.00 0.00 43.37 2.77
2442 5040 2.493278 TGCTTCCTGCTATTTCCAAAGC 59.507 45.455 0.00 0.00 43.37 3.51
2443 5041 2.159184 GCTTCCTGCTATTTCCAAAGCC 60.159 50.000 0.00 0.00 37.97 4.35
2444 5042 2.897271 TCCTGCTATTTCCAAAGCCA 57.103 45.000 0.00 0.00 37.97 4.75
2445 5043 2.726821 TCCTGCTATTTCCAAAGCCAG 58.273 47.619 0.00 0.00 37.97 4.85
2446 5044 1.135721 CCTGCTATTTCCAAAGCCAGC 59.864 52.381 0.00 0.00 37.97 4.85
2447 5045 1.820519 CTGCTATTTCCAAAGCCAGCA 59.179 47.619 0.00 0.00 37.97 4.41
2448 5046 2.429610 CTGCTATTTCCAAAGCCAGCAT 59.570 45.455 0.00 0.00 38.27 3.79
2449 5047 3.630168 TGCTATTTCCAAAGCCAGCATA 58.370 40.909 0.00 0.00 37.97 3.14
2450 5048 3.381272 TGCTATTTCCAAAGCCAGCATAC 59.619 43.478 0.00 0.00 37.97 2.39
2451 5049 3.633986 GCTATTTCCAAAGCCAGCATACT 59.366 43.478 0.00 0.00 32.40 2.12
2452 5050 4.821805 GCTATTTCCAAAGCCAGCATACTA 59.178 41.667 0.00 0.00 32.40 1.82
2453 5051 5.299279 GCTATTTCCAAAGCCAGCATACTAA 59.701 40.000 0.00 0.00 32.40 2.24
2454 5052 5.841957 ATTTCCAAAGCCAGCATACTAAG 57.158 39.130 0.00 0.00 0.00 2.18
2455 5053 4.301072 TTCCAAAGCCAGCATACTAAGT 57.699 40.909 0.00 0.00 0.00 2.24
2456 5054 3.873910 TCCAAAGCCAGCATACTAAGTC 58.126 45.455 0.00 0.00 0.00 3.01
2457 5055 3.263170 TCCAAAGCCAGCATACTAAGTCA 59.737 43.478 0.00 0.00 0.00 3.41
2458 5056 4.080356 TCCAAAGCCAGCATACTAAGTCAT 60.080 41.667 0.00 0.00 0.00 3.06
2459 5057 4.641989 CCAAAGCCAGCATACTAAGTCATT 59.358 41.667 0.00 0.00 0.00 2.57
2460 5058 5.126061 CCAAAGCCAGCATACTAAGTCATTT 59.874 40.000 0.00 0.00 0.00 2.32
2461 5059 6.350445 CCAAAGCCAGCATACTAAGTCATTTT 60.350 38.462 0.00 0.00 0.00 1.82
2462 5060 6.840780 AAGCCAGCATACTAAGTCATTTTT 57.159 33.333 0.00 0.00 0.00 1.94
2463 5061 7.938140 AAGCCAGCATACTAAGTCATTTTTA 57.062 32.000 0.00 0.00 0.00 1.52
2464 5062 8.525290 AAGCCAGCATACTAAGTCATTTTTAT 57.475 30.769 0.00 0.00 0.00 1.40
2465 5063 8.525290 AGCCAGCATACTAAGTCATTTTTATT 57.475 30.769 0.00 0.00 0.00 1.40
2466 5064 8.624776 AGCCAGCATACTAAGTCATTTTTATTC 58.375 33.333 0.00 0.00 0.00 1.75
2467 5065 8.405531 GCCAGCATACTAAGTCATTTTTATTCA 58.594 33.333 0.00 0.00 0.00 2.57
2468 5066 9.941664 CCAGCATACTAAGTCATTTTTATTCAG 57.058 33.333 0.00 0.00 0.00 3.02
2477 5075 8.593492 AAGTCATTTTTATTCAGTTTGCTTCC 57.407 30.769 0.00 0.00 0.00 3.46
2478 5076 7.955918 AGTCATTTTTATTCAGTTTGCTTCCT 58.044 30.769 0.00 0.00 0.00 3.36
2479 5077 7.869429 AGTCATTTTTATTCAGTTTGCTTCCTG 59.131 33.333 0.00 0.00 0.00 3.86
2480 5078 6.646240 TCATTTTTATTCAGTTTGCTTCCTGC 59.354 34.615 0.00 0.00 43.25 4.85
2481 5079 5.789643 TTTTATTCAGTTTGCTTCCTGCT 57.210 34.783 0.00 0.00 43.37 4.24
2482 5080 6.892658 TTTTATTCAGTTTGCTTCCTGCTA 57.107 33.333 0.00 0.00 43.37 3.49
2483 5081 7.466746 TTTTATTCAGTTTGCTTCCTGCTAT 57.533 32.000 0.00 0.00 43.37 2.97
2484 5082 7.466746 TTTATTCAGTTTGCTTCCTGCTATT 57.533 32.000 0.00 0.00 43.37 1.73
2485 5083 5.990120 ATTCAGTTTGCTTCCTGCTATTT 57.010 34.783 0.00 0.00 43.37 1.40
2486 5084 5.376854 TTCAGTTTGCTTCCTGCTATTTC 57.623 39.130 0.00 0.00 43.37 2.17
2487 5085 3.758554 TCAGTTTGCTTCCTGCTATTTCC 59.241 43.478 0.00 0.00 43.37 3.13
2488 5086 3.507233 CAGTTTGCTTCCTGCTATTTCCA 59.493 43.478 0.00 0.00 43.37 3.53
2489 5087 4.022068 CAGTTTGCTTCCTGCTATTTCCAA 60.022 41.667 0.00 0.00 43.37 3.53
2490 5088 4.588528 AGTTTGCTTCCTGCTATTTCCAAA 59.411 37.500 0.00 0.00 43.37 3.28
2491 5089 4.789012 TTGCTTCCTGCTATTTCCAAAG 57.211 40.909 0.00 0.00 43.37 2.77
2492 5090 2.493278 TGCTTCCTGCTATTTCCAAAGC 59.507 45.455 0.00 0.00 43.37 3.51
2493 5091 2.159184 GCTTCCTGCTATTTCCAAAGCC 60.159 50.000 0.00 0.00 37.97 4.35
2494 5092 2.897271 TCCTGCTATTTCCAAAGCCA 57.103 45.000 0.00 0.00 37.97 4.75
2495 5093 2.726821 TCCTGCTATTTCCAAAGCCAG 58.273 47.619 0.00 0.00 37.97 4.85
2496 5094 1.135721 CCTGCTATTTCCAAAGCCAGC 59.864 52.381 0.00 0.00 37.97 4.85
2497 5095 1.820519 CTGCTATTTCCAAAGCCAGCA 59.179 47.619 0.00 0.00 37.97 4.41
2498 5096 2.429610 CTGCTATTTCCAAAGCCAGCAT 59.570 45.455 0.00 0.00 38.27 3.79
2499 5097 3.630168 TGCTATTTCCAAAGCCAGCATA 58.370 40.909 0.00 0.00 37.97 3.14
2500 5098 3.381272 TGCTATTTCCAAAGCCAGCATAC 59.619 43.478 0.00 0.00 37.97 2.39
2501 5099 3.633986 GCTATTTCCAAAGCCAGCATACT 59.366 43.478 0.00 0.00 32.40 2.12
2502 5100 4.821805 GCTATTTCCAAAGCCAGCATACTA 59.178 41.667 0.00 0.00 32.40 1.82
2503 5101 5.299279 GCTATTTCCAAAGCCAGCATACTAA 59.701 40.000 0.00 0.00 32.40 2.24
2504 5102 5.841957 ATTTCCAAAGCCAGCATACTAAG 57.158 39.130 0.00 0.00 0.00 2.18
2505 5103 4.301072 TTCCAAAGCCAGCATACTAAGT 57.699 40.909 0.00 0.00 0.00 2.24
2506 5104 3.873910 TCCAAAGCCAGCATACTAAGTC 58.126 45.455 0.00 0.00 0.00 3.01
2507 5105 3.263170 TCCAAAGCCAGCATACTAAGTCA 59.737 43.478 0.00 0.00 0.00 3.41
2508 5106 4.080356 TCCAAAGCCAGCATACTAAGTCAT 60.080 41.667 0.00 0.00 0.00 3.06
2509 5107 4.641989 CCAAAGCCAGCATACTAAGTCATT 59.358 41.667 0.00 0.00 0.00 2.57
2510 5108 5.126061 CCAAAGCCAGCATACTAAGTCATTT 59.874 40.000 0.00 0.00 0.00 2.32
2511 5109 6.350445 CCAAAGCCAGCATACTAAGTCATTTT 60.350 38.462 0.00 0.00 0.00 1.82
2512 5110 6.840780 AAGCCAGCATACTAAGTCATTTTT 57.159 33.333 0.00 0.00 0.00 1.94
2513 5111 7.938140 AAGCCAGCATACTAAGTCATTTTTA 57.062 32.000 0.00 0.00 0.00 1.52
2514 5112 8.525290 AAGCCAGCATACTAAGTCATTTTTAT 57.475 30.769 0.00 0.00 0.00 1.40
2515 5113 8.525290 AGCCAGCATACTAAGTCATTTTTATT 57.475 30.769 0.00 0.00 0.00 1.40
2516 5114 8.624776 AGCCAGCATACTAAGTCATTTTTATTC 58.375 33.333 0.00 0.00 0.00 1.75
2517 5115 8.405531 GCCAGCATACTAAGTCATTTTTATTCA 58.594 33.333 0.00 0.00 0.00 2.57
2518 5116 9.941664 CCAGCATACTAAGTCATTTTTATTCAG 57.058 33.333 0.00 0.00 0.00 3.02
2527 5125 8.593492 AAGTCATTTTTATTCAGTTTGCTTCC 57.407 30.769 0.00 0.00 0.00 3.46
2528 5126 7.955918 AGTCATTTTTATTCAGTTTGCTTCCT 58.044 30.769 0.00 0.00 0.00 3.36
2529 5127 7.869429 AGTCATTTTTATTCAGTTTGCTTCCTG 59.131 33.333 0.00 0.00 0.00 3.86
2530 5128 6.646240 TCATTTTTATTCAGTTTGCTTCCTGC 59.354 34.615 0.00 0.00 43.25 4.85
2531 5129 5.789643 TTTTATTCAGTTTGCTTCCTGCT 57.210 34.783 0.00 0.00 43.37 4.24
2532 5130 6.892658 TTTTATTCAGTTTGCTTCCTGCTA 57.107 33.333 0.00 0.00 43.37 3.49
2533 5131 7.466746 TTTTATTCAGTTTGCTTCCTGCTAT 57.533 32.000 0.00 0.00 43.37 2.97
2534 5132 7.466746 TTTATTCAGTTTGCTTCCTGCTATT 57.533 32.000 0.00 0.00 43.37 1.73
2535 5133 5.990120 ATTCAGTTTGCTTCCTGCTATTT 57.010 34.783 0.00 0.00 43.37 1.40
2536 5134 5.376854 TTCAGTTTGCTTCCTGCTATTTC 57.623 39.130 0.00 0.00 43.37 2.17
2537 5135 3.758554 TCAGTTTGCTTCCTGCTATTTCC 59.241 43.478 0.00 0.00 43.37 3.13
2538 5136 3.507233 CAGTTTGCTTCCTGCTATTTCCA 59.493 43.478 0.00 0.00 43.37 3.53
2539 5137 4.022068 CAGTTTGCTTCCTGCTATTTCCAA 60.022 41.667 0.00 0.00 43.37 3.53
2540 5138 4.588528 AGTTTGCTTCCTGCTATTTCCAAA 59.411 37.500 0.00 0.00 43.37 3.28
2541 5139 4.789012 TTGCTTCCTGCTATTTCCAAAG 57.211 40.909 0.00 0.00 43.37 2.77
2542 5140 2.493278 TGCTTCCTGCTATTTCCAAAGC 59.507 45.455 0.00 0.00 43.37 3.51
2543 5141 2.159184 GCTTCCTGCTATTTCCAAAGCC 60.159 50.000 0.00 0.00 37.97 4.35
2544 5142 2.897271 TCCTGCTATTTCCAAAGCCA 57.103 45.000 0.00 0.00 37.97 4.75
2545 5143 2.726821 TCCTGCTATTTCCAAAGCCAG 58.273 47.619 0.00 0.00 37.97 4.85
2546 5144 1.135721 CCTGCTATTTCCAAAGCCAGC 59.864 52.381 0.00 0.00 37.97 4.85
2547 5145 1.820519 CTGCTATTTCCAAAGCCAGCA 59.179 47.619 0.00 0.00 37.97 4.41
2548 5146 2.429610 CTGCTATTTCCAAAGCCAGCAT 59.570 45.455 0.00 0.00 38.27 3.79
2549 5147 3.630168 TGCTATTTCCAAAGCCAGCATA 58.370 40.909 0.00 0.00 37.97 3.14
2550 5148 3.381272 TGCTATTTCCAAAGCCAGCATAC 59.619 43.478 0.00 0.00 37.97 2.39
2551 5149 3.633986 GCTATTTCCAAAGCCAGCATACT 59.366 43.478 0.00 0.00 32.40 2.12
2552 5150 4.821805 GCTATTTCCAAAGCCAGCATACTA 59.178 41.667 0.00 0.00 32.40 1.82
2553 5151 5.299279 GCTATTTCCAAAGCCAGCATACTAA 59.701 40.000 0.00 0.00 32.40 2.24
2554 5152 5.841957 ATTTCCAAAGCCAGCATACTAAG 57.158 39.130 0.00 0.00 0.00 2.18
2555 5153 4.301072 TTCCAAAGCCAGCATACTAAGT 57.699 40.909 0.00 0.00 0.00 2.24
2556 5154 3.873910 TCCAAAGCCAGCATACTAAGTC 58.126 45.455 0.00 0.00 0.00 3.01
2557 5155 3.263170 TCCAAAGCCAGCATACTAAGTCA 59.737 43.478 0.00 0.00 0.00 3.41
2558 5156 4.080356 TCCAAAGCCAGCATACTAAGTCAT 60.080 41.667 0.00 0.00 0.00 3.06
2559 5157 4.641989 CCAAAGCCAGCATACTAAGTCATT 59.358 41.667 0.00 0.00 0.00 2.57
2560 5158 5.126061 CCAAAGCCAGCATACTAAGTCATTT 59.874 40.000 0.00 0.00 0.00 2.32
2561 5159 6.350445 CCAAAGCCAGCATACTAAGTCATTTT 60.350 38.462 0.00 0.00 0.00 1.82
2562 5160 6.840780 AAGCCAGCATACTAAGTCATTTTT 57.159 33.333 0.00 0.00 0.00 1.94
2563 5161 7.938140 AAGCCAGCATACTAAGTCATTTTTA 57.062 32.000 0.00 0.00 0.00 1.52
2564 5162 8.525290 AAGCCAGCATACTAAGTCATTTTTAT 57.475 30.769 0.00 0.00 0.00 1.40
2565 5163 8.525290 AGCCAGCATACTAAGTCATTTTTATT 57.475 30.769 0.00 0.00 0.00 1.40
2566 5164 8.624776 AGCCAGCATACTAAGTCATTTTTATTC 58.375 33.333 0.00 0.00 0.00 1.75
2567 5165 8.405531 GCCAGCATACTAAGTCATTTTTATTCA 58.594 33.333 0.00 0.00 0.00 2.57
2568 5166 9.941664 CCAGCATACTAAGTCATTTTTATTCAG 57.058 33.333 0.00 0.00 0.00 3.02
2577 5175 8.593492 AAGTCATTTTTATTCAGTTTGCTTCC 57.407 30.769 0.00 0.00 0.00 3.46
2578 5176 7.955918 AGTCATTTTTATTCAGTTTGCTTCCT 58.044 30.769 0.00 0.00 0.00 3.36
2579 5177 7.869429 AGTCATTTTTATTCAGTTTGCTTCCTG 59.131 33.333 0.00 0.00 0.00 3.86
2580 5178 6.646240 TCATTTTTATTCAGTTTGCTTCCTGC 59.354 34.615 0.00 0.00 43.25 4.85
2581 5179 5.789643 TTTTATTCAGTTTGCTTCCTGCT 57.210 34.783 0.00 0.00 43.37 4.24
2582 5180 6.892658 TTTTATTCAGTTTGCTTCCTGCTA 57.107 33.333 0.00 0.00 43.37 3.49
2583 5181 7.466746 TTTTATTCAGTTTGCTTCCTGCTAT 57.533 32.000 0.00 0.00 43.37 2.97
2584 5182 7.466746 TTTATTCAGTTTGCTTCCTGCTATT 57.533 32.000 0.00 0.00 43.37 1.73
2585 5183 5.990120 ATTCAGTTTGCTTCCTGCTATTT 57.010 34.783 0.00 0.00 43.37 1.40
2586 5184 5.376854 TTCAGTTTGCTTCCTGCTATTTC 57.623 39.130 0.00 0.00 43.37 2.17
2587 5185 3.758554 TCAGTTTGCTTCCTGCTATTTCC 59.241 43.478 0.00 0.00 43.37 3.13
2588 5186 3.507233 CAGTTTGCTTCCTGCTATTTCCA 59.493 43.478 0.00 0.00 43.37 3.53
2589 5187 4.022068 CAGTTTGCTTCCTGCTATTTCCAA 60.022 41.667 0.00 0.00 43.37 3.53
2590 5188 4.588528 AGTTTGCTTCCTGCTATTTCCAAA 59.411 37.500 0.00 0.00 43.37 3.28
2591 5189 4.789012 TTGCTTCCTGCTATTTCCAAAG 57.211 40.909 0.00 0.00 43.37 2.77
2592 5190 2.493278 TGCTTCCTGCTATTTCCAAAGC 59.507 45.455 0.00 0.00 43.37 3.51
2593 5191 2.159184 GCTTCCTGCTATTTCCAAAGCC 60.159 50.000 0.00 0.00 37.97 4.35
2594 5192 2.897271 TCCTGCTATTTCCAAAGCCA 57.103 45.000 0.00 0.00 37.97 4.75
2595 5193 2.726821 TCCTGCTATTTCCAAAGCCAG 58.273 47.619 0.00 0.00 37.97 4.85
2596 5194 1.135721 CCTGCTATTTCCAAAGCCAGC 59.864 52.381 0.00 0.00 37.97 4.85
2597 5195 1.820519 CTGCTATTTCCAAAGCCAGCA 59.179 47.619 0.00 0.00 37.97 4.41
2598 5196 2.429610 CTGCTATTTCCAAAGCCAGCAT 59.570 45.455 0.00 0.00 38.27 3.79
2599 5197 3.630168 TGCTATTTCCAAAGCCAGCATA 58.370 40.909 0.00 0.00 37.97 3.14
2600 5198 3.381272 TGCTATTTCCAAAGCCAGCATAC 59.619 43.478 0.00 0.00 37.97 2.39
2601 5199 3.633986 GCTATTTCCAAAGCCAGCATACT 59.366 43.478 0.00 0.00 32.40 2.12
2602 5200 4.821805 GCTATTTCCAAAGCCAGCATACTA 59.178 41.667 0.00 0.00 32.40 1.82
2606 5204 3.873910 TCCAAAGCCAGCATACTAAGTC 58.126 45.455 0.00 0.00 0.00 3.01
2614 5212 8.525290 AAGCCAGCATACTAAGTCATTTTTAT 57.475 30.769 0.00 0.00 0.00 1.40
2643 5241 1.820519 CTTTCTGCTATGCCAAAGCCA 59.179 47.619 0.24 0.00 39.30 4.75
2644 5242 1.466856 TTCTGCTATGCCAAAGCCAG 58.533 50.000 0.24 0.00 39.30 4.85
2645 5243 1.033746 TCTGCTATGCCAAAGCCAGC 61.034 55.000 0.24 2.73 43.12 4.85
2646 5244 3.607163 GCTATGCCAAAGCCAGCA 58.393 55.556 4.44 0.00 42.63 4.41
2652 5250 2.505650 TGCCAAAGCCAGCATACTAA 57.494 45.000 0.00 0.00 38.69 2.24
2653 5251 2.368439 TGCCAAAGCCAGCATACTAAG 58.632 47.619 0.00 0.00 38.69 2.18
2654 5252 2.290896 TGCCAAAGCCAGCATACTAAGT 60.291 45.455 0.00 0.00 38.69 2.24
2655 5253 2.356069 GCCAAAGCCAGCATACTAAGTC 59.644 50.000 0.00 0.00 0.00 3.01
2656 5254 3.609853 CCAAAGCCAGCATACTAAGTCA 58.390 45.455 0.00 0.00 0.00 3.41
2657 5255 4.009675 CCAAAGCCAGCATACTAAGTCAA 58.990 43.478 0.00 0.00 0.00 3.18
2658 5256 4.641989 CCAAAGCCAGCATACTAAGTCAAT 59.358 41.667 0.00 0.00 0.00 2.57
2659 5257 5.126061 CCAAAGCCAGCATACTAAGTCAATT 59.874 40.000 0.00 0.00 0.00 2.32
2660 5258 6.350445 CCAAAGCCAGCATACTAAGTCAATTT 60.350 38.462 0.00 0.00 0.00 1.82
2661 5259 6.840780 AAGCCAGCATACTAAGTCAATTTT 57.159 33.333 0.00 0.00 0.00 1.82
2662 5260 7.938140 AAGCCAGCATACTAAGTCAATTTTA 57.062 32.000 0.00 0.00 0.00 1.52
2663 5261 8.525290 AAGCCAGCATACTAAGTCAATTTTAT 57.475 30.769 0.00 0.00 0.00 1.40
2664 5262 8.525290 AGCCAGCATACTAAGTCAATTTTATT 57.475 30.769 0.00 0.00 0.00 1.40
2665 5263 8.624776 AGCCAGCATACTAAGTCAATTTTATTC 58.375 33.333 0.00 0.00 0.00 1.75
2666 5264 8.624776 GCCAGCATACTAAGTCAATTTTATTCT 58.375 33.333 0.00 0.00 0.00 2.40
2667 5265 9.941664 CCAGCATACTAAGTCAATTTTATTCTG 57.058 33.333 0.00 0.00 0.00 3.02
2677 5275 9.822185 AAGTCAATTTTATTCTGTTTGCTTTCT 57.178 25.926 0.00 0.00 0.00 2.52
2678 5276 9.252962 AGTCAATTTTATTCTGTTTGCTTTCTG 57.747 29.630 0.00 0.00 0.00 3.02
2679 5277 8.006027 GTCAATTTTATTCTGTTTGCTTTCTGC 58.994 33.333 0.00 0.00 43.25 4.26
2680 5278 7.927629 TCAATTTTATTCTGTTTGCTTTCTGCT 59.072 29.630 0.00 0.00 43.37 4.24
2681 5279 9.195411 CAATTTTATTCTGTTTGCTTTCTGCTA 57.805 29.630 0.00 0.00 43.37 3.49
2682 5280 9.933723 AATTTTATTCTGTTTGCTTTCTGCTAT 57.066 25.926 0.00 0.00 43.37 2.97
2683 5281 8.746922 TTTTATTCTGTTTGCTTTCTGCTATG 57.253 30.769 0.00 0.00 43.37 2.23
2684 5282 3.837213 TCTGTTTGCTTTCTGCTATGC 57.163 42.857 0.00 0.00 43.37 3.14
2685 5283 3.415212 TCTGTTTGCTTTCTGCTATGCT 58.585 40.909 0.00 0.00 43.37 3.79
2686 5284 4.578871 TCTGTTTGCTTTCTGCTATGCTA 58.421 39.130 0.00 0.00 43.37 3.49
2687 5285 5.003160 TCTGTTTGCTTTCTGCTATGCTAA 58.997 37.500 0.00 0.00 43.37 3.09
2734 5332 5.598005 ACACACATTTCTCCAGAATTCCAAA 59.402 36.000 0.65 0.00 33.54 3.28
2749 5349 6.426328 AGAATTCCAAATAGATCGCAGACATC 59.574 38.462 0.65 0.00 42.51 3.06
2755 5355 5.543507 AATAGATCGCAGACATCCTTCTT 57.456 39.130 0.00 0.00 42.51 2.52
2758 5358 4.187694 AGATCGCAGACATCCTTCTTTTC 58.812 43.478 0.00 0.00 42.51 2.29
2762 5362 4.821805 TCGCAGACATCCTTCTTTTCTTTT 59.178 37.500 0.00 0.00 0.00 2.27
2798 5398 2.991540 GCAGGCCCCCAGTTTCAC 60.992 66.667 0.00 0.00 0.00 3.18
2800 5400 1.604593 CAGGCCCCCAGTTTCACTG 60.605 63.158 0.00 0.00 45.53 3.66
2814 5414 4.218417 AGTTTCACTGAGTGCAACAAAACT 59.782 37.500 25.36 21.50 40.88 2.66
2849 5450 9.667107 TTTATATAGGTTCACTTTGTTCAGGAG 57.333 33.333 0.00 0.00 0.00 3.69
2876 5485 2.036604 GAGTAGCTACCCAGAATGAGGC 59.963 54.545 20.31 0.00 39.69 4.70
2887 5496 3.076621 CAGAATGAGGCACTTAACAGCA 58.923 45.455 0.00 0.00 41.55 4.41
2888 5497 3.126514 CAGAATGAGGCACTTAACAGCAG 59.873 47.826 0.00 0.00 41.55 4.24
2915 5524 2.886523 CCCAGTGAAACAGCAGAATGAA 59.113 45.455 0.00 0.00 41.43 2.57
2916 5525 3.508793 CCCAGTGAAACAGCAGAATGAAT 59.491 43.478 0.00 0.00 41.43 2.57
2917 5526 4.380233 CCCAGTGAAACAGCAGAATGAATC 60.380 45.833 0.00 0.00 41.43 2.52
2919 5528 5.391449 CAGTGAAACAGCAGAATGAATCAG 58.609 41.667 0.00 0.00 41.43 2.90
2920 5529 5.180680 CAGTGAAACAGCAGAATGAATCAGA 59.819 40.000 0.00 0.00 41.43 3.27
2921 5530 5.411977 AGTGAAACAGCAGAATGAATCAGAG 59.588 40.000 0.00 0.00 41.43 3.35
2924 5533 6.657966 TGAAACAGCAGAATGAATCAGAGAAT 59.342 34.615 0.00 0.00 39.69 2.40
2925 5534 7.176165 TGAAACAGCAGAATGAATCAGAGAATT 59.824 33.333 0.00 0.00 39.69 2.17
2970 5601 3.487372 AGCAACCTTGAGTAGTTTTCCC 58.513 45.455 0.00 0.00 0.00 3.97
2973 5604 1.350019 ACCTTGAGTAGTTTTCCCCGG 59.650 52.381 0.00 0.00 0.00 5.73
3002 5633 1.550524 CAGCAGTAGTAGACAGCCCAA 59.449 52.381 0.00 0.00 41.35 4.12
3039 5670 5.485353 TGAGAATTGTCCATCAGTACCTTCT 59.515 40.000 0.00 0.00 0.00 2.85
3046 5677 3.327757 TCCATCAGTACCTTCTGTTGCTT 59.672 43.478 0.00 0.00 35.23 3.91
3058 5689 3.047280 TTGCTTAGCCACCGCGTG 61.047 61.111 4.92 3.32 41.18 5.34
3072 5703 0.389817 CGCGTGGATCTTGTTCCAGA 60.390 55.000 0.00 0.00 46.31 3.86
3099 5888 2.602217 CGAATGCTTACCTATTTGCGGC 60.602 50.000 0.00 0.00 0.00 6.53
3106 5897 2.120909 CCTATTTGCGGCCCACAGG 61.121 63.158 0.00 0.00 0.00 4.00
3124 5915 7.312899 CCCACAGGAAAACTCATTATGTAAAC 58.687 38.462 0.00 0.00 33.47 2.01
3129 5920 8.960591 CAGGAAAACTCATTATGTAAACTCCAT 58.039 33.333 0.00 0.00 0.00 3.41
3159 5950 4.399303 ACCATAGTCCAGCTGCATAAAAAC 59.601 41.667 8.66 0.00 0.00 2.43
3161 5952 5.068198 CCATAGTCCAGCTGCATAAAAACAT 59.932 40.000 8.66 0.00 0.00 2.71
3226 6017 6.427441 TCAGTTCAGAGATAGATACAGGTGT 58.573 40.000 0.00 0.00 0.00 4.16
3284 6093 7.654022 TTTGGGGACAGGATTTGTATTATTC 57.346 36.000 0.00 0.00 44.54 1.75
3300 6109 2.418368 ATTCGCTGTTGATAGCCCAA 57.582 45.000 0.00 0.00 40.59 4.12
3305 6114 4.460263 TCGCTGTTGATAGCCCAATAAAT 58.540 39.130 0.00 0.00 40.59 1.40
3311 6120 6.105333 TGTTGATAGCCCAATAAATTGCAAC 58.895 36.000 0.00 11.46 35.63 4.17
3312 6121 4.930963 TGATAGCCCAATAAATTGCAACG 58.069 39.130 0.00 0.00 36.48 4.10
3319 6128 5.351189 GCCCAATAAATTGCAACGATTCTTT 59.649 36.000 0.00 0.00 36.48 2.52
3322 6131 8.542132 CCCAATAAATTGCAACGATTCTTTATG 58.458 33.333 0.00 3.17 36.48 1.90
3349 6158 7.886629 AACTAACCTATAGACGTCCATACAA 57.113 36.000 13.01 0.00 0.00 2.41
3396 6207 4.514441 AGCTGCTACAACATATGCATCTTC 59.486 41.667 0.19 0.00 34.79 2.87
3398 6209 5.739752 TGCTACAACATATGCATCTTCAC 57.260 39.130 0.19 0.00 0.00 3.18
3399 6210 4.576053 TGCTACAACATATGCATCTTCACC 59.424 41.667 0.19 0.00 0.00 4.02
3408 6220 0.107459 GCATCTTCACCTCCAGTCCC 60.107 60.000 0.00 0.00 0.00 4.46
3413 6225 0.475632 TTCACCTCCAGTCCCATGGT 60.476 55.000 11.73 0.00 41.43 3.55
3430 6246 3.507103 TGGTTGCCATGATTTGAATCG 57.493 42.857 0.00 0.00 38.26 3.34
3448 6264 0.244450 CGGAACCAAGCATGTGCATT 59.756 50.000 7.83 0.00 45.16 3.56
3486 6305 5.928264 TCCATAAATATCTGATGTGCTGACG 59.072 40.000 0.00 0.00 0.00 4.35
3575 6394 5.632118 AGGATGAATATGATGAGCTTGCTT 58.368 37.500 0.00 0.00 0.00 3.91
3599 6424 8.450578 TTGTGAGTATTGAGTTTCAGACATTT 57.549 30.769 0.00 0.00 0.00 2.32
3603 6428 7.604164 TGAGTATTGAGTTTCAGACATTTCTCC 59.396 37.037 0.00 0.00 0.00 3.71
3606 6431 4.067896 TGAGTTTCAGACATTTCTCCTGC 58.932 43.478 0.00 0.00 0.00 4.85
3650 6485 6.322201 CCTTCATTATCACTTTGGCCTTATGT 59.678 38.462 3.32 0.00 0.00 2.29
3654 6489 6.909550 TTATCACTTTGGCCTTATGTTTGT 57.090 33.333 3.32 0.00 0.00 2.83
3655 6490 5.806654 ATCACTTTGGCCTTATGTTTGTT 57.193 34.783 3.32 0.00 0.00 2.83
3660 6495 7.502895 TCACTTTGGCCTTATGTTTGTTACTAA 59.497 33.333 3.32 0.00 0.00 2.24
3720 6555 2.735857 GCTGTTACGTCGGCGGTT 60.736 61.111 16.39 0.00 43.45 4.44
3744 6579 0.465460 ATGTGTGTGCGAAACCACCT 60.465 50.000 0.00 0.00 34.85 4.00
3771 6606 1.405821 CGCCTCTTCCTCGACAAGTAT 59.594 52.381 0.41 0.00 0.00 2.12
3784 6619 2.703007 GACAAGTATGGGAGGATCTGCT 59.297 50.000 0.00 0.00 33.73 4.24
3792 6627 0.034670 GGAGGATCTGCTTGTGCCTT 60.035 55.000 0.00 0.00 38.71 4.35
3828 6663 4.141711 TGGCAGGTAAGCTTCGATCTAATT 60.142 41.667 0.00 0.00 34.17 1.40
3829 6664 4.816925 GGCAGGTAAGCTTCGATCTAATTT 59.183 41.667 0.00 0.00 34.17 1.82
3830 6665 5.050023 GGCAGGTAAGCTTCGATCTAATTTC 60.050 44.000 0.00 0.00 34.17 2.17
3831 6666 5.050023 GCAGGTAAGCTTCGATCTAATTTCC 60.050 44.000 0.00 0.00 0.00 3.13
3834 6669 5.050972 GGTAAGCTTCGATCTAATTTCCGTG 60.051 44.000 0.00 0.00 0.00 4.94
3835 6670 2.866762 AGCTTCGATCTAATTTCCGTGC 59.133 45.455 0.00 0.00 0.00 5.34
3836 6671 2.032808 GCTTCGATCTAATTTCCGTGCC 60.033 50.000 0.00 0.00 0.00 5.01
3837 6672 2.971660 TCGATCTAATTTCCGTGCCA 57.028 45.000 0.00 0.00 0.00 4.92
3838 6673 3.469008 TCGATCTAATTTCCGTGCCAT 57.531 42.857 0.00 0.00 0.00 4.40
3839 6674 3.130633 TCGATCTAATTTCCGTGCCATG 58.869 45.455 0.00 0.00 0.00 3.66
3840 6675 2.872245 CGATCTAATTTCCGTGCCATGT 59.128 45.455 0.00 0.00 0.00 3.21
3841 6676 4.055360 CGATCTAATTTCCGTGCCATGTA 58.945 43.478 0.00 0.00 0.00 2.29
3842 6677 4.084537 CGATCTAATTTCCGTGCCATGTAC 60.085 45.833 0.00 0.00 0.00 2.90
3843 6678 4.481368 TCTAATTTCCGTGCCATGTACT 57.519 40.909 0.00 0.00 0.00 2.73
3844 6679 4.839121 TCTAATTTCCGTGCCATGTACTT 58.161 39.130 0.00 0.00 0.00 2.24
3845 6680 5.979993 TCTAATTTCCGTGCCATGTACTTA 58.020 37.500 0.00 0.00 0.00 2.24
3846 6681 6.046593 TCTAATTTCCGTGCCATGTACTTAG 58.953 40.000 0.00 0.00 0.00 2.18
3847 6682 2.018542 TTCCGTGCCATGTACTTAGC 57.981 50.000 0.00 0.00 0.00 3.09
3848 6683 1.191535 TCCGTGCCATGTACTTAGCT 58.808 50.000 0.00 0.00 0.00 3.32
3849 6684 1.136305 TCCGTGCCATGTACTTAGCTC 59.864 52.381 0.00 0.00 0.00 4.09
3850 6685 1.571919 CGTGCCATGTACTTAGCTCC 58.428 55.000 0.00 0.00 0.00 4.70
3851 6686 1.571919 GTGCCATGTACTTAGCTCCG 58.428 55.000 0.00 0.00 0.00 4.63
3852 6687 1.134788 GTGCCATGTACTTAGCTCCGT 60.135 52.381 0.00 0.00 0.00 4.69
3853 6688 1.553248 TGCCATGTACTTAGCTCCGTT 59.447 47.619 0.00 0.00 0.00 4.44
3854 6689 2.202566 GCCATGTACTTAGCTCCGTTC 58.797 52.381 0.00 0.00 0.00 3.95
3855 6690 2.822764 CCATGTACTTAGCTCCGTTCC 58.177 52.381 0.00 0.00 0.00 3.62
3856 6691 2.460918 CATGTACTTAGCTCCGTTCCG 58.539 52.381 0.00 0.00 0.00 4.30
3866 6701 3.690745 CCGTTCCGGTACTGGTCT 58.309 61.111 20.40 0.00 42.73 3.85
3867 6702 2.872408 CCGTTCCGGTACTGGTCTA 58.128 57.895 20.40 4.87 42.73 2.59
3868 6703 0.453390 CCGTTCCGGTACTGGTCTAC 59.547 60.000 20.40 14.90 42.73 2.59
3869 6704 0.453390 CGTTCCGGTACTGGTCTACC 59.547 60.000 20.40 4.55 33.87 3.18
3870 6705 1.549203 GTTCCGGTACTGGTCTACCA 58.451 55.000 20.40 1.13 45.30 3.25
3871 6706 1.895131 GTTCCGGTACTGGTCTACCAA 59.105 52.381 20.40 3.42 46.97 3.67
3872 6707 2.299867 GTTCCGGTACTGGTCTACCAAA 59.700 50.000 20.40 2.67 46.97 3.28
3873 6708 2.607499 TCCGGTACTGGTCTACCAAAA 58.393 47.619 20.40 0.00 46.97 2.44
3874 6709 2.299867 TCCGGTACTGGTCTACCAAAAC 59.700 50.000 20.40 4.40 46.97 2.43
3875 6710 2.331194 CGGTACTGGTCTACCAAAACG 58.669 52.381 2.97 5.36 46.97 3.60
3876 6711 2.071540 GGTACTGGTCTACCAAAACGC 58.928 52.381 2.97 0.00 46.97 4.84
3877 6712 2.071540 GTACTGGTCTACCAAAACGCC 58.928 52.381 2.97 0.00 46.97 5.68
3878 6713 0.470766 ACTGGTCTACCAAAACGCCA 59.529 50.000 2.97 0.00 46.97 5.69
3879 6714 1.073284 ACTGGTCTACCAAAACGCCAT 59.927 47.619 2.97 0.00 46.97 4.40
3880 6715 2.303600 ACTGGTCTACCAAAACGCCATA 59.696 45.455 2.97 0.00 46.97 2.74
3881 6716 3.054655 ACTGGTCTACCAAAACGCCATAT 60.055 43.478 2.97 0.00 46.97 1.78
3882 6717 4.162698 ACTGGTCTACCAAAACGCCATATA 59.837 41.667 2.97 0.00 46.97 0.86
3883 6718 5.163237 ACTGGTCTACCAAAACGCCATATAT 60.163 40.000 2.97 0.00 46.97 0.86
3884 6719 5.686753 TGGTCTACCAAAACGCCATATATT 58.313 37.500 0.00 0.00 44.35 1.28
3885 6720 6.123651 TGGTCTACCAAAACGCCATATATTT 58.876 36.000 0.00 0.00 44.35 1.40
3886 6721 6.603997 TGGTCTACCAAAACGCCATATATTTT 59.396 34.615 0.00 0.00 44.35 1.82
3887 6722 6.915843 GGTCTACCAAAACGCCATATATTTTG 59.084 38.462 0.00 0.00 41.10 2.44
3892 6727 6.254600 CAAAACGCCATATATTTTGGAACG 57.745 37.500 8.24 5.95 38.88 3.95
3893 6728 4.561735 AACGCCATATATTTTGGAACGG 57.438 40.909 8.24 0.00 36.26 4.44
3894 6729 3.811083 ACGCCATATATTTTGGAACGGA 58.189 40.909 8.24 0.00 36.26 4.69
3895 6730 3.813166 ACGCCATATATTTTGGAACGGAG 59.187 43.478 8.24 0.00 36.26 4.63
3899 6734 5.411669 GCCATATATTTTGGAACGGAGGTAG 59.588 44.000 8.24 0.00 36.26 3.18
3923 6758 2.352715 GCAGTTAAACATGCCTTCACCC 60.353 50.000 0.00 0.00 36.41 4.61
3931 6766 2.361104 GCCTTCACCCAATCGCCA 60.361 61.111 0.00 0.00 0.00 5.69
3967 6811 3.681593 TGGTACTCCAATACAAACTGGC 58.318 45.455 0.00 0.00 41.25 4.85
3968 6812 3.014623 GGTACTCCAATACAAACTGGCC 58.985 50.000 0.00 0.00 32.33 5.36
3995 6839 2.582959 GCTGTCGGAGCGATAACAG 58.417 57.895 6.09 6.09 38.15 3.16
3998 6842 0.459899 TGTCGGAGCGATAACAGCAT 59.540 50.000 0.00 0.00 38.42 3.79
3999 6843 1.132588 GTCGGAGCGATAACAGCATC 58.867 55.000 0.00 0.00 38.42 3.91
4000 6844 0.032130 TCGGAGCGATAACAGCATCC 59.968 55.000 0.00 0.00 37.01 3.51
4001 6845 1.278172 CGGAGCGATAACAGCATCCG 61.278 60.000 12.02 12.02 43.25 4.18
4002 6846 0.249489 GGAGCGATAACAGCATCCGT 60.249 55.000 0.00 0.00 37.01 4.69
4003 6847 1.132588 GAGCGATAACAGCATCCGTC 58.867 55.000 0.00 0.00 37.01 4.79
4004 6848 0.747255 AGCGATAACAGCATCCGTCT 59.253 50.000 0.00 0.00 37.01 4.18
4012 6860 0.529337 CAGCATCCGTCTGTAGCTGG 60.529 60.000 0.00 0.00 46.55 4.85
4021 6869 2.031919 TGTAGCTGGCCGTTGTGG 59.968 61.111 0.00 0.00 42.50 4.17
4030 6878 1.644786 GGCCGTTGTGGATTCCTTCG 61.645 60.000 3.95 3.80 42.00 3.79
4184 7141 3.204526 GCAGTTGAGAGATGGATCCTTG 58.795 50.000 14.23 0.00 0.00 3.61
4227 7186 4.414337 AGAGCCTTGATGATAACTCACC 57.586 45.455 0.00 0.00 33.22 4.02
4234 7193 5.122869 CCTTGATGATAACTCACCAACACTG 59.877 44.000 0.00 0.00 29.48 3.66
4253 7212 2.227388 CTGGGCACTTGTGTGATTCTTC 59.773 50.000 2.61 0.00 46.55 2.87
4259 7218 4.384056 CACTTGTGTGATTCTTCTGTCCT 58.616 43.478 0.00 0.00 46.55 3.85
4260 7219 4.212847 CACTTGTGTGATTCTTCTGTCCTG 59.787 45.833 0.00 0.00 46.55 3.86
4261 7220 2.771089 TGTGTGATTCTTCTGTCCTGC 58.229 47.619 0.00 0.00 0.00 4.85
4262 7221 2.079925 GTGTGATTCTTCTGTCCTGCC 58.920 52.381 0.00 0.00 0.00 4.85
4280 7240 4.065088 CTGCCTGTACTGTGTACAACAAT 58.935 43.478 11.04 0.00 38.67 2.71
4281 7241 4.456535 TGCCTGTACTGTGTACAACAATT 58.543 39.130 11.04 0.00 38.67 2.32
4282 7242 4.884744 TGCCTGTACTGTGTACAACAATTT 59.115 37.500 11.04 0.00 38.67 1.82
4283 7243 5.008217 TGCCTGTACTGTGTACAACAATTTC 59.992 40.000 11.04 0.00 38.67 2.17
4284 7244 5.238650 GCCTGTACTGTGTACAACAATTTCT 59.761 40.000 11.04 0.00 38.67 2.52
4292 7252 7.068103 ACTGTGTACAACAATTTCTTTGATGGA 59.932 33.333 0.00 0.00 41.15 3.41
4306 7266 6.690530 TCTTTGATGGAAATGTGATTTGGTC 58.309 36.000 0.00 0.00 31.47 4.02
4307 7267 6.267242 TCTTTGATGGAAATGTGATTTGGTCA 59.733 34.615 0.00 0.00 31.47 4.02
4308 7268 5.648178 TGATGGAAATGTGATTTGGTCAG 57.352 39.130 0.00 0.00 37.56 3.51
4309 7269 5.323581 TGATGGAAATGTGATTTGGTCAGA 58.676 37.500 0.00 0.00 37.56 3.27
4310 7270 5.953548 TGATGGAAATGTGATTTGGTCAGAT 59.046 36.000 0.00 0.00 42.19 2.90
4312 7272 4.463539 TGGAAATGTGATTTGGTCAGATGG 59.536 41.667 0.00 0.00 39.71 3.51
4315 7275 6.423776 AAATGTGATTTGGTCAGATGGTTT 57.576 33.333 0.00 0.00 39.71 3.27
4316 7276 5.649782 ATGTGATTTGGTCAGATGGTTTC 57.350 39.130 0.00 0.00 39.20 2.78
4318 7278 4.520111 TGTGATTTGGTCAGATGGTTTCAG 59.480 41.667 0.00 0.00 37.56 3.02
4336 7304 5.471556 TTCAGTTTCATGGCATGTGATTT 57.528 34.783 25.62 7.72 0.00 2.17
4340 7308 6.015603 TCAGTTTCATGGCATGTGATTTGTAA 60.016 34.615 25.62 8.47 0.00 2.41
4346 7315 6.379417 TCATGGCATGTGATTTGTAATAACCA 59.621 34.615 25.62 0.00 0.00 3.67
4351 7320 7.700656 GGCATGTGATTTGTAATAACCAAGTAC 59.299 37.037 0.00 0.00 0.00 2.73
4367 7336 7.440523 ACCAAGTACAAATTCTCATCAGTTC 57.559 36.000 0.00 0.00 0.00 3.01
4368 7337 6.998074 ACCAAGTACAAATTCTCATCAGTTCA 59.002 34.615 0.00 0.00 0.00 3.18
4371 7340 9.338291 CAAGTACAAATTCTCATCAGTTCATTG 57.662 33.333 0.00 0.00 0.00 2.82
4372 7341 8.627208 AGTACAAATTCTCATCAGTTCATTGT 57.373 30.769 0.00 0.00 33.53 2.71
4387 7356 1.749063 CATTGTCCTGCTCATGCACAT 59.251 47.619 0.00 0.00 45.31 3.21
4388 7357 1.170442 TTGTCCTGCTCATGCACATG 58.830 50.000 4.18 4.18 45.31 3.21
4389 7358 0.325602 TGTCCTGCTCATGCACATGA 59.674 50.000 12.51 12.51 45.31 3.07
4417 7386 8.800231 AAAATGTTTGCATGAAATAAAAAGCC 57.200 26.923 0.00 0.00 35.15 4.35
4420 7389 7.188468 TGTTTGCATGAAATAAAAAGCCTTC 57.812 32.000 0.00 0.00 0.00 3.46
4421 7390 6.765036 TGTTTGCATGAAATAAAAAGCCTTCA 59.235 30.769 0.00 0.00 32.67 3.02
4422 7391 6.783892 TTGCATGAAATAAAAAGCCTTCAC 57.216 33.333 0.00 0.00 31.00 3.18
4423 7392 5.851720 TGCATGAAATAAAAAGCCTTCACA 58.148 33.333 0.00 0.00 31.00 3.58
4424 7393 5.695816 TGCATGAAATAAAAAGCCTTCACAC 59.304 36.000 0.00 0.00 31.00 3.82
4425 7394 5.695816 GCATGAAATAAAAAGCCTTCACACA 59.304 36.000 0.00 0.00 31.00 3.72
4426 7395 6.346838 GCATGAAATAAAAAGCCTTCACACAC 60.347 38.462 0.00 0.00 31.00 3.82
4427 7396 6.214191 TGAAATAAAAAGCCTTCACACACA 57.786 33.333 0.00 0.00 0.00 3.72
4428 7397 6.039616 TGAAATAAAAAGCCTTCACACACAC 58.960 36.000 0.00 0.00 0.00 3.82
4429 7398 5.590530 AATAAAAAGCCTTCACACACACA 57.409 34.783 0.00 0.00 0.00 3.72
4430 7399 2.939460 AAAAGCCTTCACACACACAC 57.061 45.000 0.00 0.00 0.00 3.82
4431 7400 1.832883 AAAGCCTTCACACACACACA 58.167 45.000 0.00 0.00 0.00 3.72
4432 7401 1.832883 AAGCCTTCACACACACACAA 58.167 45.000 0.00 0.00 0.00 3.33
4433 7402 1.832883 AGCCTTCACACACACACAAA 58.167 45.000 0.00 0.00 0.00 2.83
4434 7403 1.472480 AGCCTTCACACACACACAAAC 59.528 47.619 0.00 0.00 0.00 2.93
4435 7404 1.201181 GCCTTCACACACACACAAACA 59.799 47.619 0.00 0.00 0.00 2.83
4436 7405 2.862512 CCTTCACACACACACAAACAC 58.137 47.619 0.00 0.00 0.00 3.32
4437 7406 2.504868 CTTCACACACACACAAACACG 58.495 47.619 0.00 0.00 0.00 4.49
4438 7407 1.797025 TCACACACACACAAACACGA 58.203 45.000 0.00 0.00 0.00 4.35
4439 7408 1.729517 TCACACACACACAAACACGAG 59.270 47.619 0.00 0.00 0.00 4.18
4440 7409 1.463056 CACACACACACAAACACGAGT 59.537 47.619 0.00 0.00 0.00 4.18
4441 7410 1.463056 ACACACACACAAACACGAGTG 59.537 47.619 1.13 1.13 41.40 3.51
4443 7412 2.668945 CACACACACAAACACGAGTGTA 59.331 45.455 9.46 0.00 46.44 2.90
4444 7413 2.669434 ACACACACAAACACGAGTGTAC 59.331 45.455 9.46 0.00 46.44 2.90
4445 7414 2.668945 CACACACAAACACGAGTGTACA 59.331 45.455 9.46 0.00 46.44 2.90
4446 7415 2.927477 ACACACAAACACGAGTGTACAG 59.073 45.455 9.46 5.38 46.44 2.74
4447 7416 2.927477 CACACAAACACGAGTGTACAGT 59.073 45.455 9.46 1.90 46.44 3.55
4448 7417 3.369756 CACACAAACACGAGTGTACAGTT 59.630 43.478 9.46 0.00 46.44 3.16
4449 7418 4.563580 CACACAAACACGAGTGTACAGTTA 59.436 41.667 9.46 0.00 46.44 2.24
4450 7419 5.062433 CACACAAACACGAGTGTACAGTTAA 59.938 40.000 9.46 0.00 46.44 2.01
4451 7420 5.638657 ACACAAACACGAGTGTACAGTTAAA 59.361 36.000 9.46 0.00 46.32 1.52
4452 7421 6.314400 ACACAAACACGAGTGTACAGTTAAAT 59.686 34.615 9.46 0.00 46.32 1.40
4453 7422 7.492020 ACACAAACACGAGTGTACAGTTAAATA 59.508 33.333 9.46 0.00 46.32 1.40
4454 7423 8.329583 CACAAACACGAGTGTACAGTTAAATAA 58.670 33.333 9.46 0.00 44.13 1.40
4455 7424 8.881743 ACAAACACGAGTGTACAGTTAAATAAA 58.118 29.630 9.46 0.00 44.13 1.40
4456 7425 9.150653 CAAACACGAGTGTACAGTTAAATAAAC 57.849 33.333 9.46 0.00 44.13 2.01
4457 7426 8.652810 AACACGAGTGTACAGTTAAATAAACT 57.347 30.769 9.46 0.00 45.67 2.66
4492 7461 8.736751 TTTTTGTCTGAAGTCAAACTTTGTAC 57.263 30.769 1.44 0.00 38.80 2.90
4494 7463 7.681939 TTGTCTGAAGTCAAACTTTGTACTT 57.318 32.000 14.23 14.23 38.80 2.24
4495 7464 7.681939 TGTCTGAAGTCAAACTTTGTACTTT 57.318 32.000 14.94 3.28 38.80 2.66
4497 7466 9.391006 TGTCTGAAGTCAAACTTTGTACTTTAT 57.609 29.630 14.94 1.50 38.80 1.40
4529 7498 9.453572 AATATCAACATTCACACAAGTAGATGT 57.546 29.630 0.00 0.00 35.33 3.06
4543 7512 8.939929 CACAAGTAGATGTGTCATGAATTTACT 58.060 33.333 0.00 0.11 44.46 2.24
4567 7536 8.931568 ACTTTTTATATTGTATACTCCCTCCGT 58.068 33.333 4.17 0.00 0.00 4.69
4568 7537 9.774413 CTTTTTATATTGTATACTCCCTCCGTT 57.226 33.333 4.17 0.00 0.00 4.44
4570 7539 9.550406 TTTTATATTGTATACTCCCTCCGTTTG 57.450 33.333 4.17 0.00 0.00 2.93
4571 7540 6.989155 ATATTGTATACTCCCTCCGTTTGA 57.011 37.500 4.17 0.00 0.00 2.69
4572 7541 5.687166 ATTGTATACTCCCTCCGTTTGAA 57.313 39.130 4.17 0.00 0.00 2.69
4573 7542 5.486735 TTGTATACTCCCTCCGTTTGAAA 57.513 39.130 4.17 0.00 0.00 2.69
4574 7543 5.687166 TGTATACTCCCTCCGTTTGAAAT 57.313 39.130 4.17 0.00 0.00 2.17
4575 7544 6.057321 TGTATACTCCCTCCGTTTGAAATT 57.943 37.500 4.17 0.00 0.00 1.82
4576 7545 7.185318 TGTATACTCCCTCCGTTTGAAATTA 57.815 36.000 4.17 0.00 0.00 1.40
4577 7546 7.043565 TGTATACTCCCTCCGTTTGAAATTAC 58.956 38.462 4.17 0.00 0.00 1.89
4578 7547 4.635699 ACTCCCTCCGTTTGAAATTACT 57.364 40.909 0.00 0.00 0.00 2.24
4579 7548 4.981812 ACTCCCTCCGTTTGAAATTACTT 58.018 39.130 0.00 0.00 0.00 2.24
4580 7549 6.117975 ACTCCCTCCGTTTGAAATTACTTA 57.882 37.500 0.00 0.00 0.00 2.24
4581 7550 6.718294 ACTCCCTCCGTTTGAAATTACTTAT 58.282 36.000 0.00 0.00 0.00 1.73
4582 7551 6.822170 ACTCCCTCCGTTTGAAATTACTTATC 59.178 38.462 0.00 0.00 0.00 1.75
4583 7552 6.713276 TCCCTCCGTTTGAAATTACTTATCA 58.287 36.000 0.00 0.00 0.00 2.15
4584 7553 6.596497 TCCCTCCGTTTGAAATTACTTATCAC 59.404 38.462 0.00 0.00 0.00 3.06
4585 7554 6.373216 CCCTCCGTTTGAAATTACTTATCACA 59.627 38.462 0.00 0.00 0.00 3.58
4586 7555 7.094549 CCCTCCGTTTGAAATTACTTATCACAA 60.095 37.037 0.00 0.00 0.00 3.33
4587 7556 8.293867 CCTCCGTTTGAAATTACTTATCACAAA 58.706 33.333 0.00 0.00 0.00 2.83
4588 7557 9.672086 CTCCGTTTGAAATTACTTATCACAAAA 57.328 29.630 0.00 0.00 0.00 2.44
4651 7620 9.993454 TCTAGATACATTCATTTCTTGGATGAG 57.007 33.333 0.97 0.00 43.19 2.90
4652 7621 9.775854 CTAGATACATTCATTTCTTGGATGAGT 57.224 33.333 0.97 0.00 43.19 3.41
4658 7627 9.471702 ACATTCATTTCTTGGATGAGTAATTCT 57.528 29.630 0.97 0.00 43.19 2.40
4659 7628 9.731819 CATTCATTTCTTGGATGAGTAATTCTG 57.268 33.333 0.00 0.00 43.19 3.02
4660 7629 9.690913 ATTCATTTCTTGGATGAGTAATTCTGA 57.309 29.630 0.00 0.00 35.17 3.27
4661 7630 9.519191 TTCATTTCTTGGATGAGTAATTCTGAA 57.481 29.630 0.00 0.00 35.17 3.02
4662 7631 8.950210 TCATTTCTTGGATGAGTAATTCTGAAC 58.050 33.333 0.00 0.00 0.00 3.18
4663 7632 6.968131 TTCTTGGATGAGTAATTCTGAACG 57.032 37.500 0.00 0.00 0.00 3.95
4664 7633 5.419542 TCTTGGATGAGTAATTCTGAACGG 58.580 41.667 0.00 0.00 0.00 4.44
4665 7634 5.186992 TCTTGGATGAGTAATTCTGAACGGA 59.813 40.000 0.00 0.00 0.00 4.69
4666 7635 5.011090 TGGATGAGTAATTCTGAACGGAG 57.989 43.478 0.00 0.00 0.00 4.63
4667 7636 4.709886 TGGATGAGTAATTCTGAACGGAGA 59.290 41.667 0.00 0.00 0.00 3.71
4668 7637 5.163509 TGGATGAGTAATTCTGAACGGAGAG 60.164 44.000 0.00 0.00 0.00 3.20
4669 7638 5.067936 GGATGAGTAATTCTGAACGGAGAGA 59.932 44.000 0.00 0.00 0.00 3.10
4670 7639 5.568685 TGAGTAATTCTGAACGGAGAGAG 57.431 43.478 0.00 0.00 0.00 3.20
4671 7640 5.010933 TGAGTAATTCTGAACGGAGAGAGT 58.989 41.667 0.00 0.00 0.00 3.24
4672 7641 6.178324 TGAGTAATTCTGAACGGAGAGAGTA 58.822 40.000 0.00 0.00 0.00 2.59
4673 7642 6.829298 TGAGTAATTCTGAACGGAGAGAGTAT 59.171 38.462 0.00 0.00 0.00 2.12
4674 7643 7.991460 TGAGTAATTCTGAACGGAGAGAGTATA 59.009 37.037 0.00 0.00 0.00 1.47
4675 7644 8.749026 AGTAATTCTGAACGGAGAGAGTATAA 57.251 34.615 0.00 0.00 0.00 0.98
4676 7645 8.623030 AGTAATTCTGAACGGAGAGAGTATAAC 58.377 37.037 0.00 0.00 0.00 1.89
4677 7646 7.648039 AATTCTGAACGGAGAGAGTATAACT 57.352 36.000 0.00 0.00 0.00 2.24
4678 7647 7.648039 ATTCTGAACGGAGAGAGTATAACTT 57.352 36.000 0.00 0.00 0.00 2.66
4679 7648 7.463961 TTCTGAACGGAGAGAGTATAACTTT 57.536 36.000 0.00 0.00 0.00 2.66
4680 7649 8.571461 TTCTGAACGGAGAGAGTATAACTTTA 57.429 34.615 0.00 0.00 0.00 1.85
4681 7650 8.211116 TCTGAACGGAGAGAGTATAACTTTAG 57.789 38.462 0.00 0.00 0.00 1.85
4682 7651 7.828223 TCTGAACGGAGAGAGTATAACTTTAGT 59.172 37.037 0.00 0.00 0.00 2.24
4683 7652 9.107177 CTGAACGGAGAGAGTATAACTTTAGTA 57.893 37.037 0.00 0.00 0.00 1.82
4684 7653 8.887717 TGAACGGAGAGAGTATAACTTTAGTAC 58.112 37.037 0.00 0.00 0.00 2.73
4685 7654 9.108284 GAACGGAGAGAGTATAACTTTAGTACT 57.892 37.037 0.00 0.00 0.00 2.73
4686 7655 9.460019 AACGGAGAGAGTATAACTTTAGTACTT 57.540 33.333 0.00 0.00 0.00 2.24
4687 7656 8.891720 ACGGAGAGAGTATAACTTTAGTACTTG 58.108 37.037 0.00 0.00 0.00 3.16
4688 7657 8.891720 CGGAGAGAGTATAACTTTAGTACTTGT 58.108 37.037 0.00 0.00 0.00 3.16
4698 7667 5.303165 ACTTTAGTACTTGTAGGTGTTGGC 58.697 41.667 0.00 0.00 0.00 4.52
4699 7668 4.959560 TTAGTACTTGTAGGTGTTGGCA 57.040 40.909 0.00 0.00 0.00 4.92
4700 7669 3.121738 AGTACTTGTAGGTGTTGGCAC 57.878 47.619 0.00 0.00 44.53 5.01
4701 7670 2.704065 AGTACTTGTAGGTGTTGGCACT 59.296 45.455 0.00 0.00 44.65 4.40
4702 7671 2.729028 ACTTGTAGGTGTTGGCACTT 57.271 45.000 0.00 0.00 44.65 3.16
4703 7672 3.012934 ACTTGTAGGTGTTGGCACTTT 57.987 42.857 0.00 0.00 44.65 2.66
4704 7673 3.361786 ACTTGTAGGTGTTGGCACTTTT 58.638 40.909 0.00 0.00 44.65 2.27
4705 7674 3.767131 ACTTGTAGGTGTTGGCACTTTTT 59.233 39.130 0.00 0.00 44.65 1.94
4787 7756 8.691661 AAGAAATGTAGAGTTAAAAAGGAGCA 57.308 30.769 0.00 0.00 0.00 4.26
4788 7757 8.329203 AGAAATGTAGAGTTAAAAAGGAGCAG 57.671 34.615 0.00 0.00 0.00 4.24
4789 7758 6.502136 AATGTAGAGTTAAAAAGGAGCAGC 57.498 37.500 0.00 0.00 0.00 5.25
4790 7759 3.994392 TGTAGAGTTAAAAAGGAGCAGCG 59.006 43.478 0.00 0.00 0.00 5.18
4791 7760 2.427506 AGAGTTAAAAAGGAGCAGCGG 58.572 47.619 0.00 0.00 0.00 5.52
4792 7761 1.468914 GAGTTAAAAAGGAGCAGCGGG 59.531 52.381 0.00 0.00 0.00 6.13
4793 7762 1.073284 AGTTAAAAAGGAGCAGCGGGA 59.927 47.619 0.00 0.00 0.00 5.14
4794 7763 1.468914 GTTAAAAAGGAGCAGCGGGAG 59.531 52.381 0.00 0.00 0.00 4.30
4795 7764 0.981183 TAAAAAGGAGCAGCGGGAGA 59.019 50.000 0.00 0.00 0.00 3.71
4796 7765 0.322008 AAAAAGGAGCAGCGGGAGAG 60.322 55.000 0.00 0.00 0.00 3.20
4797 7766 2.811542 AAAAGGAGCAGCGGGAGAGC 62.812 60.000 0.00 0.00 37.41 4.09
4800 7769 4.828925 GAGCAGCGGGAGAGCCAC 62.829 72.222 0.00 0.00 38.01 5.01
4802 7771 4.704833 GCAGCGGGAGAGCCACAA 62.705 66.667 0.00 0.00 38.01 3.33
4803 7772 2.032528 CAGCGGGAGAGCCACAAA 59.967 61.111 0.00 0.00 38.01 2.83
4804 7773 1.600636 CAGCGGGAGAGCCACAAAA 60.601 57.895 0.00 0.00 38.01 2.44
4805 7774 1.150536 AGCGGGAGAGCCACAAAAA 59.849 52.632 0.00 0.00 38.01 1.94
4806 7775 1.172812 AGCGGGAGAGCCACAAAAAC 61.173 55.000 0.00 0.00 38.01 2.43
4807 7776 1.452145 GCGGGAGAGCCACAAAAACA 61.452 55.000 0.00 0.00 35.15 2.83
4808 7777 1.028905 CGGGAGAGCCACAAAAACAA 58.971 50.000 0.00 0.00 35.15 2.83
4809 7778 1.613437 CGGGAGAGCCACAAAAACAAT 59.387 47.619 0.00 0.00 35.15 2.71
4810 7779 2.817258 CGGGAGAGCCACAAAAACAATA 59.183 45.455 0.00 0.00 35.15 1.90
4811 7780 3.443681 CGGGAGAGCCACAAAAACAATAT 59.556 43.478 0.00 0.00 35.15 1.28
4812 7781 4.082245 CGGGAGAGCCACAAAAACAATATT 60.082 41.667 0.00 0.00 35.15 1.28
4813 7782 5.566627 CGGGAGAGCCACAAAAACAATATTT 60.567 40.000 0.00 0.00 35.15 1.40
4814 7783 5.869344 GGGAGAGCCACAAAAACAATATTTC 59.131 40.000 0.00 0.00 35.15 2.17
4815 7784 5.869344 GGAGAGCCACAAAAACAATATTTCC 59.131 40.000 0.00 0.00 0.00 3.13
4816 7785 6.295292 GGAGAGCCACAAAAACAATATTTCCT 60.295 38.462 0.00 0.00 0.00 3.36
4817 7786 7.066307 AGAGCCACAAAAACAATATTTCCTT 57.934 32.000 0.00 0.00 0.00 3.36
4818 7787 7.154656 AGAGCCACAAAAACAATATTTCCTTC 58.845 34.615 0.00 0.00 0.00 3.46
4819 7788 6.230472 AGCCACAAAAACAATATTTCCTTCC 58.770 36.000 0.00 0.00 0.00 3.46
4820 7789 5.994668 GCCACAAAAACAATATTTCCTTCCA 59.005 36.000 0.00 0.00 0.00 3.53
4821 7790 6.073276 GCCACAAAAACAATATTTCCTTCCAC 60.073 38.462 0.00 0.00 0.00 4.02
4822 7791 6.989169 CCACAAAAACAATATTTCCTTCCACA 59.011 34.615 0.00 0.00 0.00 4.17
4823 7792 7.497249 CCACAAAAACAATATTTCCTTCCACAA 59.503 33.333 0.00 0.00 0.00 3.33
4824 7793 8.550376 CACAAAAACAATATTTCCTTCCACAAG 58.450 33.333 0.00 0.00 0.00 3.16
4833 7802 2.758736 CCTTCCACAAGGTGAGAGAG 57.241 55.000 0.00 0.00 44.11 3.20
4834 7803 1.338579 CCTTCCACAAGGTGAGAGAGC 60.339 57.143 0.00 0.00 44.11 4.09
4835 7804 0.687354 TTCCACAAGGTGAGAGAGCC 59.313 55.000 0.00 0.00 35.23 4.70
4836 7805 0.471780 TCCACAAGGTGAGAGAGCCA 60.472 55.000 0.00 0.00 35.23 4.75
4837 7806 0.321122 CCACAAGGTGAGAGAGCCAC 60.321 60.000 0.00 0.00 35.23 5.01
4842 7811 3.798758 GTGAGAGAGCCACCACCT 58.201 61.111 0.00 0.00 0.00 4.00
4843 7812 1.594310 GTGAGAGAGCCACCACCTC 59.406 63.158 0.00 0.00 0.00 3.85
4844 7813 1.156095 TGAGAGAGCCACCACCTCA 59.844 57.895 0.00 0.00 0.00 3.86
4880 7849 3.842923 CCCACCGCATCGAGAGCT 61.843 66.667 10.42 0.00 0.00 4.09
4882 7851 2.780094 CCACCGCATCGAGAGCTCT 61.780 63.158 18.28 18.28 0.00 4.09
4884 7853 2.334653 CCGCATCGAGAGCTCTCC 59.665 66.667 32.86 20.00 39.79 3.71
4886 7855 2.354539 GCATCGAGAGCTCTCCGC 60.355 66.667 32.86 27.85 39.79 5.54
4897 7866 4.816984 TCTCCGCTCGGTCCCTCC 62.817 72.222 8.28 0.00 36.47 4.30
4901 7870 3.068691 CGCTCGGTCCCTCCAGAA 61.069 66.667 0.00 0.00 35.57 3.02
4902 7871 2.896443 GCTCGGTCCCTCCAGAAG 59.104 66.667 0.00 0.00 35.57 2.85
4924 7896 0.321653 CCTTTCCTCCCTTCCACGTG 60.322 60.000 9.08 9.08 0.00 4.49
4935 7908 0.537653 TTCCACGTGTCAACACCAGA 59.462 50.000 15.65 0.00 43.66 3.86
4937 7910 0.104120 CCACGTGTCAACACCAGAGA 59.896 55.000 15.65 0.00 43.66 3.10
4939 7912 1.794701 CACGTGTCAACACCAGAGATG 59.205 52.381 7.58 0.00 43.66 2.90
5007 7986 4.731612 CGAGCGGCAGAGCACACT 62.732 66.667 1.45 0.00 40.15 3.55
5008 7987 2.358003 GAGCGGCAGAGCACACTT 60.358 61.111 1.45 0.00 40.15 3.16
5025 8041 1.079503 CTTTTCTGTAGCCACCTCGC 58.920 55.000 0.00 0.00 0.00 5.03
5032 8048 0.461961 GTAGCCACCTCGCTTCTCAT 59.538 55.000 0.00 0.00 40.39 2.90
5033 8049 0.747255 TAGCCACCTCGCTTCTCATC 59.253 55.000 0.00 0.00 40.39 2.92
5034 8050 0.975040 AGCCACCTCGCTTCTCATCT 60.975 55.000 0.00 0.00 34.73 2.90
5035 8051 0.107945 GCCACCTCGCTTCTCATCTT 60.108 55.000 0.00 0.00 0.00 2.40
5036 8052 1.933247 CCACCTCGCTTCTCATCTTC 58.067 55.000 0.00 0.00 0.00 2.87
5037 8053 1.205655 CCACCTCGCTTCTCATCTTCA 59.794 52.381 0.00 0.00 0.00 3.02
5038 8054 2.158986 CCACCTCGCTTCTCATCTTCAT 60.159 50.000 0.00 0.00 0.00 2.57
5039 8055 3.122297 CACCTCGCTTCTCATCTTCATC 58.878 50.000 0.00 0.00 0.00 2.92
5041 8057 3.450457 ACCTCGCTTCTCATCTTCATCTT 59.550 43.478 0.00 0.00 0.00 2.40
5043 8059 4.507388 CCTCGCTTCTCATCTTCATCTTTC 59.493 45.833 0.00 0.00 0.00 2.62
5044 8060 5.077134 TCGCTTCTCATCTTCATCTTTCA 57.923 39.130 0.00 0.00 0.00 2.69
5045 8061 5.107824 TCGCTTCTCATCTTCATCTTTCAG 58.892 41.667 0.00 0.00 0.00 3.02
5047 8063 4.035441 GCTTCTCATCTTCATCTTTCAGGC 59.965 45.833 0.00 0.00 0.00 4.85
5050 8066 1.332997 CATCTTCATCTTTCAGGCCGC 59.667 52.381 0.00 0.00 0.00 6.53
5051 8067 0.615331 TCTTCATCTTTCAGGCCGCT 59.385 50.000 0.00 0.00 0.00 5.52
5052 8068 1.003580 TCTTCATCTTTCAGGCCGCTT 59.996 47.619 0.00 0.00 0.00 4.68
5053 8069 1.131883 CTTCATCTTTCAGGCCGCTTG 59.868 52.381 0.00 0.00 0.00 4.01
5054 8070 0.677731 TCATCTTTCAGGCCGCTTGG 60.678 55.000 2.23 0.00 0.00 3.61
5055 8071 0.962356 CATCTTTCAGGCCGCTTGGT 60.962 55.000 2.23 0.00 34.16 3.67
5056 8072 0.678048 ATCTTTCAGGCCGCTTGGTC 60.678 55.000 2.23 0.00 37.78 4.02
5057 8073 1.600636 CTTTCAGGCCGCTTGGTCA 60.601 57.895 2.23 0.00 41.02 4.02
5058 8074 1.580845 CTTTCAGGCCGCTTGGTCAG 61.581 60.000 2.23 0.00 41.02 3.51
5059 8075 2.050836 TTTCAGGCCGCTTGGTCAGA 62.051 55.000 2.23 0.00 41.02 3.27
5060 8076 2.435586 CAGGCCGCTTGGTCAGAG 60.436 66.667 0.00 0.00 41.02 3.35
5061 8077 2.925170 AGGCCGCTTGGTCAGAGT 60.925 61.111 0.00 0.00 41.02 3.24
5062 8078 1.609501 AGGCCGCTTGGTCAGAGTA 60.610 57.895 0.00 0.00 41.02 2.59
5064 8080 1.153549 GCCGCTTGGTCAGAGTAGG 60.154 63.158 0.00 0.00 34.16 3.18
5065 8081 1.889530 GCCGCTTGGTCAGAGTAGGT 61.890 60.000 0.00 0.00 34.16 3.08
5067 8083 0.603569 CGCTTGGTCAGAGTAGGTGT 59.396 55.000 0.00 0.00 0.00 4.16
5068 8084 1.670087 CGCTTGGTCAGAGTAGGTGTG 60.670 57.143 0.00 0.00 0.00 3.82
5069 8085 1.344763 GCTTGGTCAGAGTAGGTGTGT 59.655 52.381 0.00 0.00 0.00 3.72
5071 8087 2.375014 TGGTCAGAGTAGGTGTGTGA 57.625 50.000 0.00 0.00 0.00 3.58
5072 8088 2.239400 TGGTCAGAGTAGGTGTGTGAG 58.761 52.381 0.00 0.00 0.00 3.51
5073 8089 1.067495 GGTCAGAGTAGGTGTGTGAGC 60.067 57.143 0.00 0.00 0.00 4.26
5074 8090 1.067495 GTCAGAGTAGGTGTGTGAGCC 60.067 57.143 0.00 0.00 0.00 4.70
5082 8098 1.214062 GTGTGTGAGCCGAGAGAGG 59.786 63.158 0.00 0.00 0.00 3.69
5083 8099 1.074951 TGTGTGAGCCGAGAGAGGA 59.925 57.895 0.00 0.00 0.00 3.71
5189 8214 2.359169 CCTGCTCTTCTACCCGCCA 61.359 63.158 0.00 0.00 0.00 5.69
5302 8327 1.299468 GCATCGGCGAGGTCACTAG 60.299 63.158 23.12 2.65 0.00 2.57
5303 8328 2.005960 GCATCGGCGAGGTCACTAGT 62.006 60.000 23.12 0.00 0.00 2.57
5304 8329 0.029567 CATCGGCGAGGTCACTAGTC 59.970 60.000 17.22 0.00 0.00 2.59
5305 8330 0.393944 ATCGGCGAGGTCACTAGTCA 60.394 55.000 17.22 0.00 0.00 3.41
5306 8331 0.607217 TCGGCGAGGTCACTAGTCAA 60.607 55.000 4.99 0.00 0.00 3.18
5307 8332 0.456312 CGGCGAGGTCACTAGTCAAC 60.456 60.000 0.00 0.00 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
14 15 3.827898 CCGACCTGGGACTCGCTC 61.828 72.222 0.00 0.00 0.00 5.03
191 2624 6.303839 ACAGATACTGAAGCAACCCTAAAAA 58.696 36.000 5.76 0.00 35.18 1.94
192 2625 5.876357 ACAGATACTGAAGCAACCCTAAAA 58.124 37.500 5.76 0.00 35.18 1.52
193 2626 5.499004 ACAGATACTGAAGCAACCCTAAA 57.501 39.130 5.76 0.00 35.18 1.85
209 2642 2.093816 CAGCTCTCAGTGCCAACAGATA 60.094 50.000 0.00 0.00 0.00 1.98
222 2655 1.227943 GGCAACACACCAGCTCTCA 60.228 57.895 0.00 0.00 0.00 3.27
246 2679 0.813821 GCTCCCAACATCAAAGCCTC 59.186 55.000 0.00 0.00 0.00 4.70
249 2682 0.961019 TGTGCTCCCAACATCAAAGC 59.039 50.000 0.00 0.00 0.00 3.51
257 2690 2.480555 CGCGATTGTGCTCCCAAC 59.519 61.111 0.00 0.00 0.00 3.77
258 2691 2.745884 CCGCGATTGTGCTCCCAA 60.746 61.111 8.23 0.00 0.00 4.12
268 2737 0.819259 CCACCAATCATCCCGCGATT 60.819 55.000 8.23 0.00 33.33 3.34
278 2747 1.133823 ACACAAGCAGTCCACCAATCA 60.134 47.619 0.00 0.00 0.00 2.57
279 2748 1.609208 ACACAAGCAGTCCACCAATC 58.391 50.000 0.00 0.00 0.00 2.67
284 2753 2.225019 CAGATCAACACAAGCAGTCCAC 59.775 50.000 0.00 0.00 0.00 4.02
288 2757 2.158769 TGACCAGATCAACACAAGCAGT 60.159 45.455 0.00 0.00 33.02 4.40
290 2759 2.158769 AGTGACCAGATCAACACAAGCA 60.159 45.455 0.00 0.00 39.72 3.91
291 2760 2.225019 CAGTGACCAGATCAACACAAGC 59.775 50.000 0.00 0.00 39.72 4.01
292 2761 3.732212 TCAGTGACCAGATCAACACAAG 58.268 45.455 0.00 0.00 39.72 3.16
293 2762 3.836365 TCAGTGACCAGATCAACACAA 57.164 42.857 0.00 0.00 39.72 3.33
294 2763 5.423290 AGATATCAGTGACCAGATCAACACA 59.577 40.000 5.32 0.00 39.72 3.72
295 2764 5.752472 CAGATATCAGTGACCAGATCAACAC 59.248 44.000 5.32 0.00 39.72 3.32
297 2766 5.911752 ACAGATATCAGTGACCAGATCAAC 58.088 41.667 5.32 0.00 39.72 3.18
298 2767 5.658190 TGACAGATATCAGTGACCAGATCAA 59.342 40.000 5.37 0.00 39.72 2.57
299 2768 5.203528 TGACAGATATCAGTGACCAGATCA 58.796 41.667 5.37 0.00 33.79 2.92
301 2770 4.039004 GCTGACAGATATCAGTGACCAGAT 59.961 45.833 15.40 0.00 46.65 2.90
302 2771 3.382865 GCTGACAGATATCAGTGACCAGA 59.617 47.826 15.40 0.00 46.65 3.86
303 2772 3.715495 GCTGACAGATATCAGTGACCAG 58.285 50.000 6.65 8.04 46.65 4.00
304 2773 3.808466 GCTGACAGATATCAGTGACCA 57.192 47.619 6.65 0.00 46.65 4.02
309 2778 4.615949 GATGAACGCTGACAGATATCAGT 58.384 43.478 6.65 2.43 46.65 3.41
311 2780 3.632189 CGATGAACGCTGACAGATATCA 58.368 45.455 6.65 6.79 34.51 2.15
324 2793 0.512518 TCTGCTGTTTGCGATGAACG 59.487 50.000 0.00 0.00 46.63 3.95
325 2794 2.907910 ATCTGCTGTTTGCGATGAAC 57.092 45.000 0.00 0.00 46.63 3.18
326 2795 2.553602 ACAATCTGCTGTTTGCGATGAA 59.446 40.909 12.71 0.00 46.63 2.57
327 2796 2.095617 CACAATCTGCTGTTTGCGATGA 60.096 45.455 12.71 0.00 46.63 2.92
328 2797 2.247637 CACAATCTGCTGTTTGCGATG 58.752 47.619 12.71 2.85 46.63 3.84
329 2798 1.881973 ACACAATCTGCTGTTTGCGAT 59.118 42.857 12.71 0.00 46.63 4.58
330 2799 1.308047 ACACAATCTGCTGTTTGCGA 58.692 45.000 12.71 0.00 46.63 5.10
331 2800 2.124011 AACACAATCTGCTGTTTGCG 57.876 45.000 12.71 7.38 46.63 4.85
332 2801 3.847037 CAAACACAATCTGCTGTTTGC 57.153 42.857 12.31 0.00 46.11 3.68
334 2803 6.207691 ACTAACAAACACAATCTGCTGTTT 57.792 33.333 0.00 0.00 40.47 2.83
335 2804 5.835113 ACTAACAAACACAATCTGCTGTT 57.165 34.783 0.00 0.00 34.86 3.16
336 2805 5.835113 AACTAACAAACACAATCTGCTGT 57.165 34.783 0.00 0.00 0.00 4.40
337 2806 6.803320 CCATAACTAACAAACACAATCTGCTG 59.197 38.462 0.00 0.00 0.00 4.41
338 2807 6.071952 CCCATAACTAACAAACACAATCTGCT 60.072 38.462 0.00 0.00 0.00 4.24
339 2808 6.092748 CCCATAACTAACAAACACAATCTGC 58.907 40.000 0.00 0.00 0.00 4.26
340 2809 6.432783 TCCCCATAACTAACAAACACAATCTG 59.567 38.462 0.00 0.00 0.00 2.90
341 2810 6.548321 TCCCCATAACTAACAAACACAATCT 58.452 36.000 0.00 0.00 0.00 2.40
342 2811 6.827586 TCCCCATAACTAACAAACACAATC 57.172 37.500 0.00 0.00 0.00 2.67
343 2812 7.604657 TTTCCCCATAACTAACAAACACAAT 57.395 32.000 0.00 0.00 0.00 2.71
344 2813 7.604657 ATTTCCCCATAACTAACAAACACAA 57.395 32.000 0.00 0.00 0.00 3.33
345 2814 7.070074 ACAATTTCCCCATAACTAACAAACACA 59.930 33.333 0.00 0.00 0.00 3.72
346 2815 7.383843 CACAATTTCCCCATAACTAACAAACAC 59.616 37.037 0.00 0.00 0.00 3.32
347 2816 7.437748 CACAATTTCCCCATAACTAACAAACA 58.562 34.615 0.00 0.00 0.00 2.83
348 2817 6.871492 CCACAATTTCCCCATAACTAACAAAC 59.129 38.462 0.00 0.00 0.00 2.93
349 2818 6.014156 CCCACAATTTCCCCATAACTAACAAA 60.014 38.462 0.00 0.00 0.00 2.83
350 2819 5.482175 CCCACAATTTCCCCATAACTAACAA 59.518 40.000 0.00 0.00 0.00 2.83
351 2820 5.020132 CCCACAATTTCCCCATAACTAACA 58.980 41.667 0.00 0.00 0.00 2.41
352 2821 5.020795 ACCCACAATTTCCCCATAACTAAC 58.979 41.667 0.00 0.00 0.00 2.34
353 2822 5.278127 ACCCACAATTTCCCCATAACTAA 57.722 39.130 0.00 0.00 0.00 2.24
354 2823 4.957606 ACCCACAATTTCCCCATAACTA 57.042 40.909 0.00 0.00 0.00 2.24
355 2824 3.845109 ACCCACAATTTCCCCATAACT 57.155 42.857 0.00 0.00 0.00 2.24
356 2825 4.081697 CAGAACCCACAATTTCCCCATAAC 60.082 45.833 0.00 0.00 0.00 1.89
357 2826 4.093011 CAGAACCCACAATTTCCCCATAA 58.907 43.478 0.00 0.00 0.00 1.90
358 2827 3.076785 ACAGAACCCACAATTTCCCCATA 59.923 43.478 0.00 0.00 0.00 2.74
359 2828 2.158173 ACAGAACCCACAATTTCCCCAT 60.158 45.455 0.00 0.00 0.00 4.00
360 2829 1.219213 ACAGAACCCACAATTTCCCCA 59.781 47.619 0.00 0.00 0.00 4.96
361 2830 2.009681 ACAGAACCCACAATTTCCCC 57.990 50.000 0.00 0.00 0.00 4.81
362 2831 5.069914 AGTTTTACAGAACCCACAATTTCCC 59.930 40.000 0.00 0.00 0.00 3.97
363 2832 6.156748 AGTTTTACAGAACCCACAATTTCC 57.843 37.500 0.00 0.00 0.00 3.13
364 2833 7.368059 CCTAGTTTTACAGAACCCACAATTTC 58.632 38.462 0.00 0.00 0.00 2.17
365 2834 6.266786 CCCTAGTTTTACAGAACCCACAATTT 59.733 38.462 0.00 0.00 0.00 1.82
366 2835 5.773176 CCCTAGTTTTACAGAACCCACAATT 59.227 40.000 0.00 0.00 0.00 2.32
367 2836 5.321927 CCCTAGTTTTACAGAACCCACAAT 58.678 41.667 0.00 0.00 0.00 2.71
368 2837 4.446600 CCCCTAGTTTTACAGAACCCACAA 60.447 45.833 0.00 0.00 0.00 3.33
369 2838 3.073356 CCCCTAGTTTTACAGAACCCACA 59.927 47.826 0.00 0.00 0.00 4.17
370 2839 3.073503 ACCCCTAGTTTTACAGAACCCAC 59.926 47.826 0.00 0.00 0.00 4.61
371 2840 3.073356 CACCCCTAGTTTTACAGAACCCA 59.927 47.826 0.00 0.00 0.00 4.51
372 2841 3.328637 TCACCCCTAGTTTTACAGAACCC 59.671 47.826 0.00 0.00 0.00 4.11
373 2842 4.628963 TCACCCCTAGTTTTACAGAACC 57.371 45.455 0.00 0.00 0.00 3.62
374 2843 5.048921 GCTTTCACCCCTAGTTTTACAGAAC 60.049 44.000 0.00 0.00 0.00 3.01
375 2844 5.067954 GCTTTCACCCCTAGTTTTACAGAA 58.932 41.667 0.00 0.00 0.00 3.02
376 2845 4.103469 TGCTTTCACCCCTAGTTTTACAGA 59.897 41.667 0.00 0.00 0.00 3.41
377 2846 4.394729 TGCTTTCACCCCTAGTTTTACAG 58.605 43.478 0.00 0.00 0.00 2.74
378 2847 4.103469 TCTGCTTTCACCCCTAGTTTTACA 59.897 41.667 0.00 0.00 0.00 2.41
379 2848 4.648651 TCTGCTTTCACCCCTAGTTTTAC 58.351 43.478 0.00 0.00 0.00 2.01
380 2849 4.986054 TCTGCTTTCACCCCTAGTTTTA 57.014 40.909 0.00 0.00 0.00 1.52
381 2850 3.876309 TCTGCTTTCACCCCTAGTTTT 57.124 42.857 0.00 0.00 0.00 2.43
382 2851 4.082125 CAATCTGCTTTCACCCCTAGTTT 58.918 43.478 0.00 0.00 0.00 2.66
383 2852 3.074538 ACAATCTGCTTTCACCCCTAGTT 59.925 43.478 0.00 0.00 0.00 2.24
384 2853 2.644798 ACAATCTGCTTTCACCCCTAGT 59.355 45.455 0.00 0.00 0.00 2.57
385 2854 3.012518 CACAATCTGCTTTCACCCCTAG 58.987 50.000 0.00 0.00 0.00 3.02
386 2855 2.375174 ACACAATCTGCTTTCACCCCTA 59.625 45.455 0.00 0.00 0.00 3.53
387 2856 1.145738 ACACAATCTGCTTTCACCCCT 59.854 47.619 0.00 0.00 0.00 4.79
388 2857 1.620822 ACACAATCTGCTTTCACCCC 58.379 50.000 0.00 0.00 0.00 4.95
389 2858 3.733443 AAACACAATCTGCTTTCACCC 57.267 42.857 0.00 0.00 0.00 4.61
390 2859 4.681744 TGAAAACACAATCTGCTTTCACC 58.318 39.130 0.00 0.00 0.00 4.02
391 2860 5.332808 GCATGAAAACACAATCTGCTTTCAC 60.333 40.000 0.00 0.00 0.00 3.18
392 2861 4.746115 GCATGAAAACACAATCTGCTTTCA 59.254 37.500 0.00 2.35 0.00 2.69
393 2862 4.986659 AGCATGAAAACACAATCTGCTTTC 59.013 37.500 0.00 0.00 35.06 2.62
394 2863 4.748102 CAGCATGAAAACACAATCTGCTTT 59.252 37.500 0.00 0.00 39.69 3.51
395 2864 4.304110 CAGCATGAAAACACAATCTGCTT 58.696 39.130 0.00 0.00 39.69 3.91
396 2865 3.859627 GCAGCATGAAAACACAATCTGCT 60.860 43.478 0.00 0.00 41.36 4.24
397 2866 2.410730 GCAGCATGAAAACACAATCTGC 59.589 45.455 0.00 0.00 39.69 4.26
398 2867 3.909430 AGCAGCATGAAAACACAATCTG 58.091 40.909 0.00 0.00 39.69 2.90
399 2868 4.038282 TGAAGCAGCATGAAAACACAATCT 59.962 37.500 0.00 0.00 39.69 2.40
400 2869 4.300803 TGAAGCAGCATGAAAACACAATC 58.699 39.130 0.00 0.00 39.69 2.67
401 2870 4.202182 ACTGAAGCAGCATGAAAACACAAT 60.202 37.500 0.00 0.00 39.69 2.71
402 2871 3.130869 ACTGAAGCAGCATGAAAACACAA 59.869 39.130 0.00 0.00 39.69 3.33
403 2872 2.689471 ACTGAAGCAGCATGAAAACACA 59.311 40.909 0.00 0.00 39.69 3.72
404 2873 3.360249 ACTGAAGCAGCATGAAAACAC 57.640 42.857 0.00 0.00 39.69 3.32
405 2874 5.123820 GGTATACTGAAGCAGCATGAAAACA 59.876 40.000 2.25 0.00 39.69 2.83
406 2875 5.355350 AGGTATACTGAAGCAGCATGAAAAC 59.645 40.000 2.25 0.00 39.69 2.43
407 2876 5.500234 AGGTATACTGAAGCAGCATGAAAA 58.500 37.500 2.25 0.00 39.69 2.29
408 2877 5.102953 AGGTATACTGAAGCAGCATGAAA 57.897 39.130 2.25 0.00 39.69 2.69
409 2878 4.760530 AGGTATACTGAAGCAGCATGAA 57.239 40.909 2.25 0.00 39.69 2.57
422 2891 3.832490 TGAGCAGTGTCAACAGGTATACT 59.168 43.478 2.25 0.00 0.00 2.12
423 2892 4.177026 CTGAGCAGTGTCAACAGGTATAC 58.823 47.826 0.00 0.00 0.00 1.47
424 2893 3.368427 GCTGAGCAGTGTCAACAGGTATA 60.368 47.826 0.00 0.00 0.00 1.47
425 2894 2.613977 GCTGAGCAGTGTCAACAGGTAT 60.614 50.000 0.00 0.00 0.00 2.73
426 2895 1.270305 GCTGAGCAGTGTCAACAGGTA 60.270 52.381 0.00 0.00 0.00 3.08
427 2896 0.533755 GCTGAGCAGTGTCAACAGGT 60.534 55.000 0.00 0.00 0.00 4.00
428 2897 0.250209 AGCTGAGCAGTGTCAACAGG 60.250 55.000 7.39 0.00 0.00 4.00
429 2898 0.866427 CAGCTGAGCAGTGTCAACAG 59.134 55.000 8.42 0.00 0.00 3.16
430 2899 0.533531 CCAGCTGAGCAGTGTCAACA 60.534 55.000 17.39 0.00 0.00 3.33
431 2900 0.533755 ACCAGCTGAGCAGTGTCAAC 60.534 55.000 17.39 0.00 0.00 3.18
432 2901 0.250038 GACCAGCTGAGCAGTGTCAA 60.250 55.000 17.39 0.00 0.00 3.18
433 2902 1.117749 AGACCAGCTGAGCAGTGTCA 61.118 55.000 17.39 0.00 0.00 3.58
434 2903 1.670590 AGACCAGCTGAGCAGTGTC 59.329 57.895 17.39 12.72 0.00 3.67
435 2904 3.882825 AGACCAGCTGAGCAGTGT 58.117 55.556 17.39 2.44 0.00 3.55
444 2913 2.433446 CAGGGCAACAGACCAGCT 59.567 61.111 0.00 0.00 39.74 4.24
445 2914 2.113986 ACAGGGCAACAGACCAGC 59.886 61.111 0.00 0.00 39.74 4.85
446 2915 0.466189 AACACAGGGCAACAGACCAG 60.466 55.000 0.00 0.00 39.74 4.00
447 2916 0.751277 CAACACAGGGCAACAGACCA 60.751 55.000 0.00 0.00 39.74 4.02
448 2917 2.032981 CAACACAGGGCAACAGACC 58.967 57.895 0.00 0.00 39.74 3.85
449 2918 1.360192 GCAACACAGGGCAACAGAC 59.640 57.895 0.00 0.00 39.74 3.51
450 2919 1.077140 TGCAACACAGGGCAACAGA 60.077 52.632 0.00 0.00 37.03 3.41
451 2920 1.361271 CTGCAACACAGGGCAACAG 59.639 57.895 0.00 0.00 43.19 3.16
452 2921 3.524014 CTGCAACACAGGGCAACA 58.476 55.556 0.00 0.00 43.19 3.33
458 2927 5.037457 TTTGCTTCACTCTGCAACACAGG 62.037 47.826 0.00 0.00 46.91 4.00
459 2928 2.097954 TTTGCTTCACTCTGCAACACAG 59.902 45.455 0.00 0.00 46.91 3.66
460 2929 1.748950 TTGCTTCACTCTGCAACACA 58.251 45.000 0.00 0.00 43.17 3.72
461 2930 2.542411 CCTTTGCTTCACTCTGCAACAC 60.542 50.000 0.00 0.00 46.91 3.32
462 2931 1.677576 CCTTTGCTTCACTCTGCAACA 59.322 47.619 0.00 0.00 46.91 3.33
463 2932 1.601412 GCCTTTGCTTCACTCTGCAAC 60.601 52.381 0.00 0.00 46.91 4.17
464 2933 0.670162 GCCTTTGCTTCACTCTGCAA 59.330 50.000 0.00 0.00 45.83 4.08
465 2934 1.509644 CGCCTTTGCTTCACTCTGCA 61.510 55.000 0.00 0.00 37.42 4.41
466 2935 1.208614 CGCCTTTGCTTCACTCTGC 59.791 57.895 0.00 0.00 34.43 4.26
467 2936 1.580845 CCCGCCTTTGCTTCACTCTG 61.581 60.000 0.00 0.00 34.43 3.35
468 2937 1.302832 CCCGCCTTTGCTTCACTCT 60.303 57.895 0.00 0.00 34.43 3.24
469 2938 1.578206 GACCCGCCTTTGCTTCACTC 61.578 60.000 0.00 0.00 34.43 3.51
470 2939 1.600916 GACCCGCCTTTGCTTCACT 60.601 57.895 0.00 0.00 34.43 3.41
471 2940 1.244019 ATGACCCGCCTTTGCTTCAC 61.244 55.000 0.00 0.00 34.43 3.18
472 2941 0.539438 AATGACCCGCCTTTGCTTCA 60.539 50.000 0.00 0.00 34.43 3.02
473 2942 0.603065 AAATGACCCGCCTTTGCTTC 59.397 50.000 0.00 0.00 34.43 3.86
474 2943 0.318120 CAAATGACCCGCCTTTGCTT 59.682 50.000 0.00 0.00 34.43 3.91
475 2944 1.535204 CCAAATGACCCGCCTTTGCT 61.535 55.000 0.00 0.00 34.43 3.91
476 2945 1.079888 CCAAATGACCCGCCTTTGC 60.080 57.895 0.00 0.00 0.00 3.68
477 2946 0.038343 CACCAAATGACCCGCCTTTG 60.038 55.000 0.00 0.00 0.00 2.77
478 2947 1.815817 GCACCAAATGACCCGCCTTT 61.816 55.000 0.00 0.00 0.00 3.11
479 2948 2.275380 GCACCAAATGACCCGCCTT 61.275 57.895 0.00 0.00 0.00 4.35
480 2949 2.676471 GCACCAAATGACCCGCCT 60.676 61.111 0.00 0.00 0.00 5.52
481 2950 3.758931 GGCACCAAATGACCCGCC 61.759 66.667 0.00 0.00 0.00 6.13
507 2976 4.897357 TATCAGCGCGGCAGCAGG 62.897 66.667 8.83 9.71 45.49 4.85
508 2977 2.249535 ATTATCAGCGCGGCAGCAG 61.250 57.895 8.83 10.23 45.49 4.24
509 2978 2.203056 ATTATCAGCGCGGCAGCA 60.203 55.556 8.83 0.00 45.49 4.41
510 2979 2.250485 CATTATCAGCGCGGCAGC 59.750 61.111 8.83 0.00 40.74 5.25
511 2980 2.610694 CCCATTATCAGCGCGGCAG 61.611 63.158 8.83 0.00 0.00 4.85
512 2981 2.591429 CCCATTATCAGCGCGGCA 60.591 61.111 8.83 0.00 0.00 5.69
513 2982 2.280797 TCCCATTATCAGCGCGGC 60.281 61.111 8.83 0.00 0.00 6.53
514 2983 0.668706 CTCTCCCATTATCAGCGCGG 60.669 60.000 8.83 0.00 0.00 6.46
515 2984 0.668706 CCTCTCCCATTATCAGCGCG 60.669 60.000 0.00 0.00 0.00 6.86
516 2985 0.681733 TCCTCTCCCATTATCAGCGC 59.318 55.000 0.00 0.00 0.00 5.92
517 2986 1.337635 GCTCCTCTCCCATTATCAGCG 60.338 57.143 0.00 0.00 0.00 5.18
518 2987 1.337635 CGCTCCTCTCCCATTATCAGC 60.338 57.143 0.00 0.00 0.00 4.26
519 2988 1.274728 CCGCTCCTCTCCCATTATCAG 59.725 57.143 0.00 0.00 0.00 2.90
520 2989 1.342074 CCGCTCCTCTCCCATTATCA 58.658 55.000 0.00 0.00 0.00 2.15
521 2990 1.001406 CACCGCTCCTCTCCCATTATC 59.999 57.143 0.00 0.00 0.00 1.75
522 2991 1.051812 CACCGCTCCTCTCCCATTAT 58.948 55.000 0.00 0.00 0.00 1.28
523 2992 0.032515 TCACCGCTCCTCTCCCATTA 60.033 55.000 0.00 0.00 0.00 1.90
524 2993 0.692419 ATCACCGCTCCTCTCCCATT 60.692 55.000 0.00 0.00 0.00 3.16
525 2994 0.692419 AATCACCGCTCCTCTCCCAT 60.692 55.000 0.00 0.00 0.00 4.00
526 2995 0.032515 TAATCACCGCTCCTCTCCCA 60.033 55.000 0.00 0.00 0.00 4.37
527 2996 1.120530 TTAATCACCGCTCCTCTCCC 58.879 55.000 0.00 0.00 0.00 4.30
528 2997 1.757699 AGTTAATCACCGCTCCTCTCC 59.242 52.381 0.00 0.00 0.00 3.71
529 2998 3.528597 AAGTTAATCACCGCTCCTCTC 57.471 47.619 0.00 0.00 0.00 3.20
530 2999 3.983044 AAAGTTAATCACCGCTCCTCT 57.017 42.857 0.00 0.00 0.00 3.69
549 3018 7.589958 AATACTACAACATCACCCACAAAAA 57.410 32.000 0.00 0.00 0.00 1.94
550 3019 7.940137 AGTAATACTACAACATCACCCACAAAA 59.060 33.333 0.00 0.00 0.00 2.44
551 3020 7.455058 AGTAATACTACAACATCACCCACAAA 58.545 34.615 0.00 0.00 0.00 2.83
552 3021 7.011499 AGTAATACTACAACATCACCCACAA 57.989 36.000 0.00 0.00 0.00 3.33
553 3022 6.614694 AGTAATACTACAACATCACCCACA 57.385 37.500 0.00 0.00 0.00 4.17
554 3023 9.439500 TTTTAGTAATACTACAACATCACCCAC 57.561 33.333 0.00 0.00 28.93 4.61
561 3030 9.811995 TCGCTGATTTTAGTAATACTACAACAT 57.188 29.630 0.00 0.00 28.93 2.71
562 3031 9.079833 GTCGCTGATTTTAGTAATACTACAACA 57.920 33.333 0.00 1.82 28.93 3.33
563 3032 9.079833 TGTCGCTGATTTTAGTAATACTACAAC 57.920 33.333 0.00 0.00 28.93 3.32
564 3033 9.642327 TTGTCGCTGATTTTAGTAATACTACAA 57.358 29.630 0.00 0.53 28.93 2.41
565 3034 9.811995 ATTGTCGCTGATTTTAGTAATACTACA 57.188 29.630 0.00 0.00 28.93 2.74
574 3043 9.337396 TCCATATTAATTGTCGCTGATTTTAGT 57.663 29.630 0.00 0.00 0.00 2.24
579 3048 9.725019 TCTTATCCATATTAATTGTCGCTGATT 57.275 29.630 0.00 0.00 0.00 2.57
580 3049 9.376075 CTCTTATCCATATTAATTGTCGCTGAT 57.624 33.333 0.00 0.00 0.00 2.90
581 3050 7.819415 CCTCTTATCCATATTAATTGTCGCTGA 59.181 37.037 0.00 0.00 0.00 4.26
582 3051 7.065085 CCCTCTTATCCATATTAATTGTCGCTG 59.935 40.741 0.00 0.00 0.00 5.18
583 3052 7.038302 TCCCTCTTATCCATATTAATTGTCGCT 60.038 37.037 0.00 0.00 0.00 4.93
584 3053 7.103641 TCCCTCTTATCCATATTAATTGTCGC 58.896 38.462 0.00 0.00 0.00 5.19
585 3054 8.314751 ACTCCCTCTTATCCATATTAATTGTCG 58.685 37.037 0.00 0.00 0.00 4.35
598 3067 9.674068 GGAAAAATCATATACTCCCTCTTATCC 57.326 37.037 0.00 0.00 0.00 2.59
601 3070 8.157476 GCTGGAAAAATCATATACTCCCTCTTA 58.843 37.037 0.00 0.00 0.00 2.10
602 3071 7.001073 GCTGGAAAAATCATATACTCCCTCTT 58.999 38.462 0.00 0.00 0.00 2.85
603 3072 6.101734 TGCTGGAAAAATCATATACTCCCTCT 59.898 38.462 0.00 0.00 0.00 3.69
604 3073 6.299141 TGCTGGAAAAATCATATACTCCCTC 58.701 40.000 0.00 0.00 0.00 4.30
605 3074 6.266131 TGCTGGAAAAATCATATACTCCCT 57.734 37.500 0.00 0.00 0.00 4.20
606 3075 6.959639 TTGCTGGAAAAATCATATACTCCC 57.040 37.500 0.00 0.00 0.00 4.30
607 3076 9.252962 CAAATTGCTGGAAAAATCATATACTCC 57.747 33.333 0.00 0.00 0.00 3.85
608 3077 9.807649 ACAAATTGCTGGAAAAATCATATACTC 57.192 29.630 0.00 0.00 0.00 2.59
612 3081 9.729281 AGAAACAAATTGCTGGAAAAATCATAT 57.271 25.926 0.00 0.00 0.00 1.78
614 3083 9.729281 ATAGAAACAAATTGCTGGAAAAATCAT 57.271 25.926 0.00 0.00 0.00 2.45
615 3084 8.991026 CATAGAAACAAATTGCTGGAAAAATCA 58.009 29.630 0.00 0.00 0.00 2.57
616 3085 8.445493 CCATAGAAACAAATTGCTGGAAAAATC 58.555 33.333 0.00 0.00 0.00 2.17
617 3086 8.156165 TCCATAGAAACAAATTGCTGGAAAAAT 58.844 29.630 0.00 0.00 0.00 1.82
618 3087 7.504403 TCCATAGAAACAAATTGCTGGAAAAA 58.496 30.769 0.00 0.00 0.00 1.94
619 3088 7.060383 TCCATAGAAACAAATTGCTGGAAAA 57.940 32.000 0.00 0.00 0.00 2.29
620 3089 6.662865 TCCATAGAAACAAATTGCTGGAAA 57.337 33.333 0.00 0.00 0.00 3.13
621 3090 6.662865 TTCCATAGAAACAAATTGCTGGAA 57.337 33.333 0.00 0.00 38.76 3.53
622 3091 6.662865 TTTCCATAGAAACAAATTGCTGGA 57.337 33.333 0.00 0.00 37.07 3.86
623 3092 6.705381 TGTTTTCCATAGAAACAAATTGCTGG 59.295 34.615 0.00 0.00 42.25 4.85
624 3093 7.712264 TGTTTTCCATAGAAACAAATTGCTG 57.288 32.000 0.00 0.00 42.25 4.41
625 3094 8.149647 TGATGTTTTCCATAGAAACAAATTGCT 58.850 29.630 6.51 0.00 46.43 3.91
626 3095 8.309163 TGATGTTTTCCATAGAAACAAATTGC 57.691 30.769 6.51 0.00 46.43 3.56
667 3136 8.331740 AAATCATGATTTTCTTCCTGACTAGGA 58.668 33.333 24.83 0.00 43.33 2.94
668 3137 8.517062 AAATCATGATTTTCTTCCTGACTAGG 57.483 34.615 24.83 0.00 40.44 3.02
696 3165 6.197364 TGCTTTTCTTCCTACGTTCAAAAA 57.803 33.333 0.00 0.00 0.00 1.94
697 3166 5.821516 TGCTTTTCTTCCTACGTTCAAAA 57.178 34.783 0.00 0.00 0.00 2.44
698 3167 5.529430 TCATGCTTTTCTTCCTACGTTCAAA 59.471 36.000 0.00 0.00 0.00 2.69
699 3168 5.060506 TCATGCTTTTCTTCCTACGTTCAA 58.939 37.500 0.00 0.00 0.00 2.69
700 3169 4.637276 TCATGCTTTTCTTCCTACGTTCA 58.363 39.130 0.00 0.00 0.00 3.18
701 3170 5.447818 CCATCATGCTTTTCTTCCTACGTTC 60.448 44.000 0.00 0.00 0.00 3.95
702 3171 4.396166 CCATCATGCTTTTCTTCCTACGTT 59.604 41.667 0.00 0.00 0.00 3.99
703 3172 3.941483 CCATCATGCTTTTCTTCCTACGT 59.059 43.478 0.00 0.00 0.00 3.57
704 3173 4.191544 TCCATCATGCTTTTCTTCCTACG 58.808 43.478 0.00 0.00 0.00 3.51
705 3174 6.060788 AGATCCATCATGCTTTTCTTCCTAC 58.939 40.000 0.00 0.00 0.00 3.18
706 3175 6.100859 AGAGATCCATCATGCTTTTCTTCCTA 59.899 38.462 0.00 0.00 0.00 2.94
707 3176 5.104024 AGAGATCCATCATGCTTTTCTTCCT 60.104 40.000 0.00 0.00 0.00 3.36
708 3177 5.131784 AGAGATCCATCATGCTTTTCTTCC 58.868 41.667 0.00 0.00 0.00 3.46
709 3178 6.459848 CCAAGAGATCCATCATGCTTTTCTTC 60.460 42.308 0.00 0.00 0.00 2.87
710 3179 5.360144 CCAAGAGATCCATCATGCTTTTCTT 59.640 40.000 0.00 0.00 0.00 2.52
711 3180 4.888239 CCAAGAGATCCATCATGCTTTTCT 59.112 41.667 0.00 0.00 0.00 2.52
712 3181 4.499357 GCCAAGAGATCCATCATGCTTTTC 60.499 45.833 0.00 0.00 0.00 2.29
713 3182 3.383825 GCCAAGAGATCCATCATGCTTTT 59.616 43.478 0.00 0.00 0.00 2.27
714 3183 2.957006 GCCAAGAGATCCATCATGCTTT 59.043 45.455 0.00 0.00 0.00 3.51
715 3184 2.092049 TGCCAAGAGATCCATCATGCTT 60.092 45.455 0.00 0.00 0.00 3.91
716 3185 1.493446 TGCCAAGAGATCCATCATGCT 59.507 47.619 0.00 0.00 0.00 3.79
717 3186 1.977056 TGCCAAGAGATCCATCATGC 58.023 50.000 0.00 0.00 0.00 4.06
718 3187 2.885266 CCTTGCCAAGAGATCCATCATG 59.115 50.000 5.89 0.00 0.00 3.07
719 3188 2.512896 ACCTTGCCAAGAGATCCATCAT 59.487 45.455 5.89 0.00 0.00 2.45
720 3189 1.918262 ACCTTGCCAAGAGATCCATCA 59.082 47.619 5.89 0.00 0.00 3.07
721 3190 2.725221 ACCTTGCCAAGAGATCCATC 57.275 50.000 5.89 0.00 0.00 3.51
722 3191 4.803329 ATAACCTTGCCAAGAGATCCAT 57.197 40.909 5.89 0.00 0.00 3.41
723 3192 4.263905 ACAATAACCTTGCCAAGAGATCCA 60.264 41.667 5.89 0.00 0.00 3.41
724 3193 4.096984 CACAATAACCTTGCCAAGAGATCC 59.903 45.833 5.89 0.00 0.00 3.36
725 3194 4.702131 ACACAATAACCTTGCCAAGAGATC 59.298 41.667 5.89 0.00 0.00 2.75
726 3195 4.460382 CACACAATAACCTTGCCAAGAGAT 59.540 41.667 5.89 0.00 0.00 2.75
727 3196 3.820467 CACACAATAACCTTGCCAAGAGA 59.180 43.478 5.89 0.00 0.00 3.10
728 3197 3.057315 CCACACAATAACCTTGCCAAGAG 60.057 47.826 5.89 0.00 0.00 2.85
729 3198 2.890311 CCACACAATAACCTTGCCAAGA 59.110 45.455 5.89 0.00 0.00 3.02
730 3199 2.610232 GCCACACAATAACCTTGCCAAG 60.610 50.000 0.00 0.00 0.00 3.61
731 3200 1.342819 GCCACACAATAACCTTGCCAA 59.657 47.619 0.00 0.00 0.00 4.52
732 3201 0.965439 GCCACACAATAACCTTGCCA 59.035 50.000 0.00 0.00 0.00 4.92
733 3202 1.067635 CAGCCACACAATAACCTTGCC 60.068 52.381 0.00 0.00 0.00 4.52
734 3203 1.885887 TCAGCCACACAATAACCTTGC 59.114 47.619 0.00 0.00 0.00 4.01
735 3204 4.460382 AGAATCAGCCACACAATAACCTTG 59.540 41.667 0.00 0.00 0.00 3.61
736 3205 4.666512 AGAATCAGCCACACAATAACCTT 58.333 39.130 0.00 0.00 0.00 3.50
737 3206 4.307032 AGAATCAGCCACACAATAACCT 57.693 40.909 0.00 0.00 0.00 3.50
738 3207 4.142381 GGAAGAATCAGCCACACAATAACC 60.142 45.833 0.00 0.00 0.00 2.85
739 3208 4.458989 TGGAAGAATCAGCCACACAATAAC 59.541 41.667 0.00 0.00 0.00 1.89
740 3209 4.661222 TGGAAGAATCAGCCACACAATAA 58.339 39.130 0.00 0.00 0.00 1.40
741 3210 4.299586 TGGAAGAATCAGCCACACAATA 57.700 40.909 0.00 0.00 0.00 1.90
742 3211 3.159213 TGGAAGAATCAGCCACACAAT 57.841 42.857 0.00 0.00 0.00 2.71
743 3212 2.655090 TGGAAGAATCAGCCACACAA 57.345 45.000 0.00 0.00 0.00 3.33
744 3213 2.885135 ATGGAAGAATCAGCCACACA 57.115 45.000 0.00 0.00 33.93 3.72
745 3214 2.615912 GCTATGGAAGAATCAGCCACAC 59.384 50.000 0.00 0.00 33.93 3.82
746 3215 2.507058 AGCTATGGAAGAATCAGCCACA 59.493 45.455 0.00 0.00 33.93 4.17
747 3216 3.205784 AGCTATGGAAGAATCAGCCAC 57.794 47.619 0.00 0.00 33.93 5.01
748 3217 3.548770 CAAGCTATGGAAGAATCAGCCA 58.451 45.455 0.00 0.00 35.91 4.75
749 3218 2.292845 GCAAGCTATGGAAGAATCAGCC 59.707 50.000 0.00 0.00 32.58 4.85
750 3219 2.947652 TGCAAGCTATGGAAGAATCAGC 59.052 45.455 0.00 0.00 0.00 4.26
751 3220 4.449131 TCTGCAAGCTATGGAAGAATCAG 58.551 43.478 0.00 0.00 0.00 2.90
752 3221 4.080695 ACTCTGCAAGCTATGGAAGAATCA 60.081 41.667 0.00 0.00 0.00 2.57
753 3222 4.450053 ACTCTGCAAGCTATGGAAGAATC 58.550 43.478 0.00 0.00 0.00 2.52
754 3223 4.500499 ACTCTGCAAGCTATGGAAGAAT 57.500 40.909 0.00 0.00 0.00 2.40
755 3224 3.988976 ACTCTGCAAGCTATGGAAGAA 57.011 42.857 0.00 0.00 0.00 2.52
756 3225 3.603532 CAACTCTGCAAGCTATGGAAGA 58.396 45.455 0.00 0.00 0.00 2.87
770 3239 0.883833 ATTTTCGGCCAGCAACTCTG 59.116 50.000 2.24 0.00 42.49 3.35
771 3240 0.883833 CATTTTCGGCCAGCAACTCT 59.116 50.000 2.24 0.00 0.00 3.24
772 3241 0.109132 CCATTTTCGGCCAGCAACTC 60.109 55.000 2.24 0.00 0.00 3.01
773 3242 0.827507 ACCATTTTCGGCCAGCAACT 60.828 50.000 2.24 0.00 0.00 3.16
774 3243 0.667184 CACCATTTTCGGCCAGCAAC 60.667 55.000 2.24 0.00 0.00 4.17
775 3244 1.664873 CACCATTTTCGGCCAGCAA 59.335 52.632 2.24 0.00 0.00 3.91
776 3245 2.274645 CCACCATTTTCGGCCAGCA 61.275 57.895 2.24 0.00 0.00 4.41
777 3246 2.573340 CCACCATTTTCGGCCAGC 59.427 61.111 2.24 0.00 0.00 4.85
778 3247 2.573340 GCCACCATTTTCGGCCAG 59.427 61.111 2.24 0.00 40.07 4.85
781 3250 3.297904 ATGGCCACCATTTTCGGC 58.702 55.556 8.16 0.00 42.23 5.54
796 3265 3.498397 AGAAGACAAAGCACCGTGTAATG 59.502 43.478 0.00 0.00 0.00 1.90
797 3266 3.740115 AGAAGACAAAGCACCGTGTAAT 58.260 40.909 0.00 0.00 0.00 1.89
798 3267 3.188159 AGAAGACAAAGCACCGTGTAA 57.812 42.857 0.00 0.00 0.00 2.41
799 3268 2.869801 CAAGAAGACAAAGCACCGTGTA 59.130 45.455 0.00 0.00 0.00 2.90
800 3269 1.670811 CAAGAAGACAAAGCACCGTGT 59.329 47.619 0.00 0.00 0.00 4.49
801 3270 1.670811 ACAAGAAGACAAAGCACCGTG 59.329 47.619 0.00 0.00 0.00 4.94
802 3271 1.670811 CACAAGAAGACAAAGCACCGT 59.329 47.619 0.00 0.00 0.00 4.83
803 3272 1.670811 ACACAAGAAGACAAAGCACCG 59.329 47.619 0.00 0.00 0.00 4.94
804 3273 2.682856 TGACACAAGAAGACAAAGCACC 59.317 45.455 0.00 0.00 0.00 5.01
805 3274 4.142600 ACTTGACACAAGAAGACAAAGCAC 60.143 41.667 16.65 0.00 0.00 4.40
806 3275 4.009675 ACTTGACACAAGAAGACAAAGCA 58.990 39.130 16.65 0.00 0.00 3.91
807 3276 4.622701 ACTTGACACAAGAAGACAAAGC 57.377 40.909 16.65 0.00 0.00 3.51
808 3277 6.744537 CAGAAACTTGACACAAGAAGACAAAG 59.255 38.462 16.65 0.00 0.00 2.77
809 3278 6.611381 CAGAAACTTGACACAAGAAGACAAA 58.389 36.000 16.65 0.00 0.00 2.83
810 3279 5.391950 GCAGAAACTTGACACAAGAAGACAA 60.392 40.000 16.65 0.00 0.00 3.18
811 3280 4.094887 GCAGAAACTTGACACAAGAAGACA 59.905 41.667 16.65 0.00 0.00 3.41
812 3281 4.333926 AGCAGAAACTTGACACAAGAAGAC 59.666 41.667 16.65 6.58 0.00 3.01
813 3282 4.517285 AGCAGAAACTTGACACAAGAAGA 58.483 39.130 16.65 0.00 0.00 2.87
814 3283 4.889832 AGCAGAAACTTGACACAAGAAG 57.110 40.909 16.65 0.00 0.00 2.85
815 3284 6.751514 TTAAGCAGAAACTTGACACAAGAA 57.248 33.333 16.65 0.00 0.00 2.52
816 3285 6.404293 GGTTTAAGCAGAAACTTGACACAAGA 60.404 38.462 16.65 0.00 38.97 3.02
817 3286 5.743872 GGTTTAAGCAGAAACTTGACACAAG 59.256 40.000 11.78 9.51 38.97 3.16
818 3287 5.184096 TGGTTTAAGCAGAAACTTGACACAA 59.816 36.000 11.78 0.00 38.97 3.33
819 3288 4.702612 TGGTTTAAGCAGAAACTTGACACA 59.297 37.500 11.78 0.59 38.97 3.72
820 3289 5.243426 TGGTTTAAGCAGAAACTTGACAC 57.757 39.130 11.78 0.00 38.97 3.67
821 3290 5.009610 GGATGGTTTAAGCAGAAACTTGACA 59.990 40.000 11.78 3.97 38.97 3.58
822 3291 5.461526 GGATGGTTTAAGCAGAAACTTGAC 58.538 41.667 11.78 4.00 38.97 3.18
823 3292 4.522789 GGGATGGTTTAAGCAGAAACTTGA 59.477 41.667 11.78 0.41 38.97 3.02
824 3293 4.321974 GGGGATGGTTTAAGCAGAAACTTG 60.322 45.833 11.78 0.00 38.97 3.16
825 3294 3.832490 GGGGATGGTTTAAGCAGAAACTT 59.168 43.478 11.78 2.67 38.97 2.66
826 3295 3.431415 GGGGATGGTTTAAGCAGAAACT 58.569 45.455 11.78 0.00 38.97 2.66
827 3296 2.163613 CGGGGATGGTTTAAGCAGAAAC 59.836 50.000 2.68 5.21 38.38 2.78
828 3297 2.442413 CGGGGATGGTTTAAGCAGAAA 58.558 47.619 2.68 0.00 0.00 2.52
829 3298 1.340600 CCGGGGATGGTTTAAGCAGAA 60.341 52.381 2.68 0.00 0.00 3.02
830 3299 0.254747 CCGGGGATGGTTTAAGCAGA 59.745 55.000 2.68 0.00 0.00 4.26
831 3300 0.751643 CCCGGGGATGGTTTAAGCAG 60.752 60.000 14.71 0.00 0.00 4.24
832 3301 1.208844 TCCCGGGGATGGTTTAAGCA 61.209 55.000 23.50 0.00 0.00 3.91
833 3302 0.033894 TTCCCGGGGATGGTTTAAGC 60.034 55.000 23.50 0.00 0.00 3.09
834 3303 2.025699 TCTTTCCCGGGGATGGTTTAAG 60.026 50.000 23.50 15.88 0.00 1.85
835 3304 1.994047 TCTTTCCCGGGGATGGTTTAA 59.006 47.619 23.50 6.00 0.00 1.52
836 3305 1.671293 TCTTTCCCGGGGATGGTTTA 58.329 50.000 23.50 0.00 0.00 2.01
837 3306 0.781278 TTCTTTCCCGGGGATGGTTT 59.219 50.000 23.50 0.00 0.00 3.27
838 3307 0.781278 TTTCTTTCCCGGGGATGGTT 59.219 50.000 23.50 0.00 0.00 3.67
839 3308 0.781278 TTTTCTTTCCCGGGGATGGT 59.219 50.000 23.50 0.00 0.00 3.55
840 3309 1.005450 TCTTTTCTTTCCCGGGGATGG 59.995 52.381 23.50 12.69 0.00 3.51
841 3310 2.507407 TCTTTTCTTTCCCGGGGATG 57.493 50.000 23.50 15.56 0.00 3.51
842 3311 3.536075 TTTCTTTTCTTTCCCGGGGAT 57.464 42.857 23.50 0.00 0.00 3.85
843 3312 3.117436 TCTTTTCTTTTCTTTCCCGGGGA 60.117 43.478 23.50 12.99 0.00 4.81
844 3313 3.227614 TCTTTTCTTTTCTTTCCCGGGG 58.772 45.455 23.50 6.77 0.00 5.73
845 3314 4.929819 TTCTTTTCTTTTCTTTCCCGGG 57.070 40.909 16.85 16.85 0.00 5.73
846 3315 6.103330 TGTTTTCTTTTCTTTTCTTTCCCGG 58.897 36.000 0.00 0.00 0.00 5.73
847 3316 6.237835 GCTGTTTTCTTTTCTTTTCTTTCCCG 60.238 38.462 0.00 0.00 0.00 5.14
848 3317 6.593770 TGCTGTTTTCTTTTCTTTTCTTTCCC 59.406 34.615 0.00 0.00 0.00 3.97
849 3318 7.595311 TGCTGTTTTCTTTTCTTTTCTTTCC 57.405 32.000 0.00 0.00 0.00 3.13
850 3319 9.877137 TTTTGCTGTTTTCTTTTCTTTTCTTTC 57.123 25.926 0.00 0.00 0.00 2.62
851 3320 9.882996 CTTTTGCTGTTTTCTTTTCTTTTCTTT 57.117 25.926 0.00 0.00 0.00 2.52
852 3321 8.506437 CCTTTTGCTGTTTTCTTTTCTTTTCTT 58.494 29.630 0.00 0.00 0.00 2.52
853 3322 7.877612 TCCTTTTGCTGTTTTCTTTTCTTTTCT 59.122 29.630 0.00 0.00 0.00 2.52
854 3323 8.028540 TCCTTTTGCTGTTTTCTTTTCTTTTC 57.971 30.769 0.00 0.00 0.00 2.29
855 3324 7.977789 TCCTTTTGCTGTTTTCTTTTCTTTT 57.022 28.000 0.00 0.00 0.00 2.27
856 3325 7.977789 TTCCTTTTGCTGTTTTCTTTTCTTT 57.022 28.000 0.00 0.00 0.00 2.52
857 3326 7.977789 TTTCCTTTTGCTGTTTTCTTTTCTT 57.022 28.000 0.00 0.00 0.00 2.52
858 3327 7.877612 TCTTTTCCTTTTGCTGTTTTCTTTTCT 59.122 29.630 0.00 0.00 0.00 2.52
859 3328 8.028540 TCTTTTCCTTTTGCTGTTTTCTTTTC 57.971 30.769 0.00 0.00 0.00 2.29
860 3329 7.977789 TCTTTTCCTTTTGCTGTTTTCTTTT 57.022 28.000 0.00 0.00 0.00 2.27
861 3330 7.977789 TTCTTTTCCTTTTGCTGTTTTCTTT 57.022 28.000 0.00 0.00 0.00 2.52
862 3331 7.977789 TTTCTTTTCCTTTTGCTGTTTTCTT 57.022 28.000 0.00 0.00 0.00 2.52
863 3332 7.977789 TTTTCTTTTCCTTTTGCTGTTTTCT 57.022 28.000 0.00 0.00 0.00 2.52
893 3362 2.032981 GGCCGAGCCCATACAATTG 58.967 57.895 3.24 3.24 44.06 2.32
906 3400 2.419990 CCATTTGTGAGTATGAGGCCGA 60.420 50.000 0.00 0.00 0.00 5.54
907 3401 1.942657 CCATTTGTGAGTATGAGGCCG 59.057 52.381 0.00 0.00 0.00 6.13
914 3408 1.686115 GCCCAGCCCATTTGTGAGTAT 60.686 52.381 0.00 0.00 0.00 2.12
937 3441 2.753701 CCCGACACATGGGGAACA 59.246 61.111 0.00 0.00 46.95 3.18
943 3447 0.179073 GATGGACTCCCGACACATGG 60.179 60.000 0.00 0.00 34.29 3.66
944 3448 0.536724 TGATGGACTCCCGACACATG 59.463 55.000 0.00 0.00 34.29 3.21
945 3449 0.537188 GTGATGGACTCCCGACACAT 59.463 55.000 9.88 0.00 39.30 3.21
946 3450 0.830023 TGTGATGGACTCCCGACACA 60.830 55.000 12.19 12.19 43.38 3.72
948 3452 1.052617 TTTGTGATGGACTCCCGACA 58.947 50.000 0.00 0.00 34.29 4.35
953 3457 3.253432 GGACTTTGTTTGTGATGGACTCC 59.747 47.826 0.00 0.00 0.00 3.85
961 3465 1.566703 TGAGGGGGACTTTGTTTGTGA 59.433 47.619 0.00 0.00 0.00 3.58
987 3491 4.803613 GCCTCGACTTTGTTTGTGATTTTT 59.196 37.500 0.00 0.00 0.00 1.94
988 3492 4.359706 GCCTCGACTTTGTTTGTGATTTT 58.640 39.130 0.00 0.00 0.00 1.82
989 3493 3.243401 GGCCTCGACTTTGTTTGTGATTT 60.243 43.478 0.00 0.00 0.00 2.17
990 3494 2.293399 GGCCTCGACTTTGTTTGTGATT 59.707 45.455 0.00 0.00 0.00 2.57
991 3495 1.880027 GGCCTCGACTTTGTTTGTGAT 59.120 47.619 0.00 0.00 0.00 3.06
992 3496 1.134220 AGGCCTCGACTTTGTTTGTGA 60.134 47.619 0.00 0.00 0.00 3.58
993 3497 1.264288 GAGGCCTCGACTTTGTTTGTG 59.736 52.381 19.06 0.00 0.00 3.33
994 3498 1.594331 GAGGCCTCGACTTTGTTTGT 58.406 50.000 19.06 0.00 0.00 2.83
995 3499 0.875059 GGAGGCCTCGACTTTGTTTG 59.125 55.000 26.36 0.00 0.00 2.93
996 3500 0.602905 CGGAGGCCTCGACTTTGTTT 60.603 55.000 26.36 0.00 0.00 2.83
997 3501 1.004918 CGGAGGCCTCGACTTTGTT 60.005 57.895 26.36 0.00 0.00 2.83
998 3502 2.657237 CGGAGGCCTCGACTTTGT 59.343 61.111 26.36 0.00 0.00 2.83
999 3503 2.815647 GCGGAGGCCTCGACTTTG 60.816 66.667 26.36 12.19 0.00 2.77
1000 3504 2.579684 GATGCGGAGGCCTCGACTTT 62.580 60.000 26.36 9.96 38.85 2.66
1001 3505 3.077556 ATGCGGAGGCCTCGACTT 61.078 61.111 26.36 15.28 38.85 3.01
1002 3506 3.532155 GATGCGGAGGCCTCGACT 61.532 66.667 26.36 10.89 38.85 4.18
1003 3507 2.962697 GAAGATGCGGAGGCCTCGAC 62.963 65.000 26.36 20.24 38.64 4.20
1004 3508 2.759973 AAGATGCGGAGGCCTCGA 60.760 61.111 26.36 13.18 38.64 4.04
1005 3509 2.279784 GAAGATGCGGAGGCCTCG 60.280 66.667 26.36 21.16 38.64 4.63
1006 3510 0.531753 GAAGAAGATGCGGAGGCCTC 60.532 60.000 25.59 25.59 38.85 4.70
1007 3511 1.524482 GAAGAAGATGCGGAGGCCT 59.476 57.895 3.86 3.86 38.85 5.19
1008 3512 1.524849 GGAAGAAGATGCGGAGGCC 60.525 63.158 0.00 0.00 38.85 5.19
1009 3513 0.531753 GAGGAAGAAGATGCGGAGGC 60.532 60.000 0.00 0.00 40.52 4.70
1010 3514 1.118838 AGAGGAAGAAGATGCGGAGG 58.881 55.000 0.00 0.00 0.00 4.30
1011 3515 1.805871 GCAGAGGAAGAAGATGCGGAG 60.806 57.143 0.00 0.00 0.00 4.63
1012 3516 0.176680 GCAGAGGAAGAAGATGCGGA 59.823 55.000 0.00 0.00 0.00 5.54
1013 3517 0.813210 GGCAGAGGAAGAAGATGCGG 60.813 60.000 0.00 0.00 37.76 5.69
1014 3518 0.813210 GGGCAGAGGAAGAAGATGCG 60.813 60.000 0.00 0.00 37.76 4.73
1015 3519 0.465278 GGGGCAGAGGAAGAAGATGC 60.465 60.000 0.00 0.00 36.16 3.91
1016 3520 0.914644 TGGGGCAGAGGAAGAAGATG 59.085 55.000 0.00 0.00 0.00 2.90
1017 3521 0.915364 GTGGGGCAGAGGAAGAAGAT 59.085 55.000 0.00 0.00 0.00 2.40
1018 3522 0.473694 TGTGGGGCAGAGGAAGAAGA 60.474 55.000 0.00 0.00 0.00 2.87
1044 3570 1.469940 CCCTCCGATTTCTGTCTGTCG 60.470 57.143 0.00 0.00 0.00 4.35
1047 3597 1.195115 TCCCCTCCGATTTCTGTCTG 58.805 55.000 0.00 0.00 0.00 3.51
1051 3601 0.601311 GCGATCCCCTCCGATTTCTG 60.601 60.000 0.00 0.00 0.00 3.02
1055 3605 3.616721 CGGCGATCCCCTCCGATT 61.617 66.667 0.00 0.00 45.53 3.34
1081 3631 3.680920 TTCTCCCTCTCCGGCCTCC 62.681 68.421 0.00 0.00 0.00 4.30
1083 3633 2.042435 CTTCTCCCTCTCCGGCCT 60.042 66.667 0.00 0.00 0.00 5.19
1177 3735 2.747855 CGCAGGTGAGAAAGGGGC 60.748 66.667 0.00 0.00 0.00 5.80
1229 3787 2.127232 TGGCAGATCTCATCCGCGA 61.127 57.895 8.23 0.00 33.53 5.87
1232 3790 1.137675 TCAAGTGGCAGATCTCATCCG 59.862 52.381 0.00 0.00 0.00 4.18
1234 3792 2.211806 GCTCAAGTGGCAGATCTCATC 58.788 52.381 0.00 0.00 0.00 2.92
1235 3793 1.472904 CGCTCAAGTGGCAGATCTCAT 60.473 52.381 0.00 0.00 0.00 2.90
1236 3794 0.108472 CGCTCAAGTGGCAGATCTCA 60.108 55.000 0.00 0.00 0.00 3.27
1237 3795 1.427592 GCGCTCAAGTGGCAGATCTC 61.428 60.000 0.00 0.00 0.00 2.75
1238 3796 1.449246 GCGCTCAAGTGGCAGATCT 60.449 57.895 0.00 0.00 0.00 2.75
1239 3797 3.096791 GCGCTCAAGTGGCAGATC 58.903 61.111 0.00 0.00 0.00 2.75
1245 3803 2.507992 CTCGAGGCGCTCAAGTGG 60.508 66.667 7.64 0.00 0.00 4.00
1246 3804 1.803519 GACTCGAGGCGCTCAAGTG 60.804 63.158 18.41 0.35 0.00 3.16
1247 3805 2.569134 GACTCGAGGCGCTCAAGT 59.431 61.111 18.41 3.54 0.00 3.16
1248 3806 2.202676 GGACTCGAGGCGCTCAAG 60.203 66.667 18.41 0.00 0.00 3.02
1249 3807 2.989253 TGGACTCGAGGCGCTCAA 60.989 61.111 18.41 0.00 0.00 3.02
1250 3808 3.749064 GTGGACTCGAGGCGCTCA 61.749 66.667 18.41 4.27 0.00 4.26
1251 3809 4.500116 GGTGGACTCGAGGCGCTC 62.500 72.222 18.41 8.66 0.00 5.03
1253 3811 4.500116 GAGGTGGACTCGAGGCGC 62.500 72.222 18.41 10.18 36.29 6.53
1260 3818 1.202200 CGAGATTCGTGAGGTGGACTC 60.202 57.143 0.00 0.00 46.78 3.36
1261 3819 0.811915 CGAGATTCGTGAGGTGGACT 59.188 55.000 0.00 0.00 34.72 3.85
1262 3820 0.809385 TCGAGATTCGTGAGGTGGAC 59.191 55.000 0.00 0.00 41.35 4.02
1263 3821 1.763968 ATCGAGATTCGTGAGGTGGA 58.236 50.000 0.00 0.00 41.35 4.02
1266 3824 4.457834 AAGAAATCGAGATTCGTGAGGT 57.542 40.909 7.78 0.00 41.35 3.85
1270 3828 6.170675 AGGAAAAAGAAATCGAGATTCGTG 57.829 37.500 7.78 0.00 41.35 4.35
1278 3836 5.238650 AGCGAAAGAAGGAAAAAGAAATCGA 59.761 36.000 0.00 0.00 0.00 3.59
1279 3837 5.452777 AGCGAAAGAAGGAAAAAGAAATCG 58.547 37.500 0.00 0.00 0.00 3.34
1280 3838 6.580416 CAGAGCGAAAGAAGGAAAAAGAAATC 59.420 38.462 0.00 0.00 0.00 2.17
1281 3839 6.039829 ACAGAGCGAAAGAAGGAAAAAGAAAT 59.960 34.615 0.00 0.00 0.00 2.17
1282 3840 5.357032 ACAGAGCGAAAGAAGGAAAAAGAAA 59.643 36.000 0.00 0.00 0.00 2.52
1284 3842 4.273480 CACAGAGCGAAAGAAGGAAAAAGA 59.727 41.667 0.00 0.00 0.00 2.52
1285 3843 4.531332 CACAGAGCGAAAGAAGGAAAAAG 58.469 43.478 0.00 0.00 0.00 2.27
1287 3845 2.290641 GCACAGAGCGAAAGAAGGAAAA 59.709 45.455 0.00 0.00 0.00 2.29
1289 3847 1.512926 GCACAGAGCGAAAGAAGGAA 58.487 50.000 0.00 0.00 0.00 3.36
1290 3848 3.217242 GCACAGAGCGAAAGAAGGA 57.783 52.632 0.00 0.00 0.00 3.36
1300 3858 3.056891 GGTAGATAGATCCAGCACAGAGC 60.057 52.174 0.00 0.00 46.19 4.09
1301 3859 4.218200 CAGGTAGATAGATCCAGCACAGAG 59.782 50.000 0.00 0.00 0.00 3.35
1302 3860 4.148079 CAGGTAGATAGATCCAGCACAGA 58.852 47.826 0.00 0.00 0.00 3.41
1303 3861 3.305950 GCAGGTAGATAGATCCAGCACAG 60.306 52.174 0.00 0.00 34.62 3.66
1304 3862 2.630098 GCAGGTAGATAGATCCAGCACA 59.370 50.000 0.00 0.00 34.62 4.57
1306 3864 2.896044 CTGCAGGTAGATAGATCCAGCA 59.104 50.000 5.57 0.00 40.42 4.41
1307 3865 2.233431 CCTGCAGGTAGATAGATCCAGC 59.767 54.545 25.53 0.00 34.97 4.85
1321 3879 3.136123 CGCCATGGAACCTGCAGG 61.136 66.667 31.60 31.60 42.17 4.85
1406 3964 3.708220 GAGCTCCTCGGACTTGGCG 62.708 68.421 0.87 0.00 0.00 5.69
1449 4007 3.083997 GGGGAGTGGAGCGGTGAT 61.084 66.667 0.00 0.00 0.00 3.06
1455 4013 1.760480 GAGGAGAGGGGAGTGGAGC 60.760 68.421 0.00 0.00 0.00 4.70
1465 4023 4.891992 TTGGTTACTGAAAGAGGAGAGG 57.108 45.455 0.00 0.00 37.43 3.69
1469 4027 3.596214 GCGATTGGTTACTGAAAGAGGA 58.404 45.455 0.00 0.00 37.43 3.71
1471 4029 2.348666 CGGCGATTGGTTACTGAAAGAG 59.651 50.000 0.00 0.00 37.43 2.85
1473 4031 1.202031 GCGGCGATTGGTTACTGAAAG 60.202 52.381 12.98 0.00 42.29 2.62
1474 4032 0.800012 GCGGCGATTGGTTACTGAAA 59.200 50.000 12.98 0.00 0.00 2.69
1475 4033 0.036765 AGCGGCGATTGGTTACTGAA 60.037 50.000 12.98 0.00 0.00 3.02
1476 4034 0.818938 TAGCGGCGATTGGTTACTGA 59.181 50.000 12.98 0.00 0.00 3.41
1477 4035 1.202371 TCTAGCGGCGATTGGTTACTG 60.202 52.381 12.98 0.00 0.00 2.74
1479 4037 1.792949 CATCTAGCGGCGATTGGTTAC 59.207 52.381 12.98 0.00 0.00 2.50
1480 4038 1.872237 GCATCTAGCGGCGATTGGTTA 60.872 52.381 12.98 0.00 0.00 2.85
1481 4039 1.160329 GCATCTAGCGGCGATTGGTT 61.160 55.000 12.98 0.00 0.00 3.67
1482 4040 1.595382 GCATCTAGCGGCGATTGGT 60.595 57.895 12.98 0.00 0.00 3.67
1492 4050 0.390860 AGTCGATGGGTGCATCTAGC 59.609 55.000 0.00 0.00 45.96 3.42
1495 4053 1.524002 CCAGTCGATGGGTGCATCT 59.476 57.895 0.00 0.00 46.36 2.90
1496 4054 4.131376 CCAGTCGATGGGTGCATC 57.869 61.111 0.00 0.00 46.36 3.91
1507 4065 0.394565 GATTCCTCCCATCCCAGTCG 59.605 60.000 0.00 0.00 0.00 4.18
1511 4069 1.925623 ATTGGATTCCTCCCATCCCA 58.074 50.000 3.95 0.00 41.29 4.37
1516 4074 2.722094 CGTCAAATTGGATTCCTCCCA 58.278 47.619 3.95 0.00 41.29 4.37
1517 4075 1.405463 GCGTCAAATTGGATTCCTCCC 59.595 52.381 3.95 0.00 41.29 4.30
1518 4076 2.369394 AGCGTCAAATTGGATTCCTCC 58.631 47.619 3.95 0.00 42.45 4.30
1519 4077 3.440173 TGAAGCGTCAAATTGGATTCCTC 59.560 43.478 0.00 0.00 0.00 3.71
1520 4078 3.420893 TGAAGCGTCAAATTGGATTCCT 58.579 40.909 0.00 0.00 0.00 3.36
1521 4079 3.848272 TGAAGCGTCAAATTGGATTCC 57.152 42.857 0.00 0.00 0.00 3.01
1522 4080 5.003778 CGAAATGAAGCGTCAAATTGGATTC 59.996 40.000 6.39 2.92 37.30 2.52
1527 4085 3.361644 CACCGAAATGAAGCGTCAAATTG 59.638 43.478 6.39 2.63 37.30 2.32
1528 4086 3.564511 CACCGAAATGAAGCGTCAAATT 58.435 40.909 6.39 5.10 37.30 1.82
1529 4087 2.668279 GCACCGAAATGAAGCGTCAAAT 60.668 45.455 6.39 0.00 37.30 2.32
1530 4088 1.334599 GCACCGAAATGAAGCGTCAAA 60.335 47.619 6.39 0.00 37.30 2.69
1531 4089 0.237235 GCACCGAAATGAAGCGTCAA 59.763 50.000 6.39 0.00 37.30 3.18
1532 4090 0.602638 AGCACCGAAATGAAGCGTCA 60.603 50.000 4.40 4.40 38.41 4.35
1536 4094 2.608090 GGTAGTAGCACCGAAATGAAGC 59.392 50.000 0.00 0.00 0.00 3.86
1547 4105 4.979204 TGCGTGTGGTAGTAGCAC 57.021 55.556 22.69 22.69 46.05 4.40
1557 4115 1.603802 AGTTGAGATTTGGTGCGTGTG 59.396 47.619 0.00 0.00 0.00 3.82
1562 4120 3.057033 AGAATGCAGTTGAGATTTGGTGC 60.057 43.478 0.00 0.00 0.00 5.01
1565 4123 5.340803 CATGAGAATGCAGTTGAGATTTGG 58.659 41.667 0.00 0.00 0.00 3.28
1566 4124 4.798907 GCATGAGAATGCAGTTGAGATTTG 59.201 41.667 5.83 0.00 46.25 2.32
1567 4125 4.995124 GCATGAGAATGCAGTTGAGATTT 58.005 39.130 5.83 0.00 46.25 2.17
1568 4126 4.634184 GCATGAGAATGCAGTTGAGATT 57.366 40.909 5.83 0.00 46.25 2.40
1607 4175 4.427661 ACCACTCGCTCGCTCAGC 62.428 66.667 0.00 0.00 45.85 4.26
1608 4176 2.505777 CACCACTCGCTCGCTCAG 60.506 66.667 0.00 0.00 0.00 3.35
1609 4177 4.056125 CCACCACTCGCTCGCTCA 62.056 66.667 0.00 0.00 0.00 4.26
1610 4178 2.765250 TTTCCACCACTCGCTCGCTC 62.765 60.000 0.00 0.00 0.00 5.03
1613 4181 1.284982 CTGTTTCCACCACTCGCTCG 61.285 60.000 0.00 0.00 0.00 5.03
1614 4182 0.249911 ACTGTTTCCACCACTCGCTC 60.250 55.000 0.00 0.00 0.00 5.03
1615 4183 1.045407 TACTGTTTCCACCACTCGCT 58.955 50.000 0.00 0.00 0.00 4.93
1616 4184 2.094762 ATACTGTTTCCACCACTCGC 57.905 50.000 0.00 0.00 0.00 5.03
1619 4187 5.046520 GGAACTCTATACTGTTTCCACCACT 60.047 44.000 2.60 0.00 0.00 4.00
1620 4188 5.176592 GGAACTCTATACTGTTTCCACCAC 58.823 45.833 2.60 0.00 0.00 4.16
1632 4207 6.365518 GCTTAATTAGCGTGGGAACTCTATAC 59.634 42.308 0.00 0.00 40.71 1.47
1654 4229 6.613755 TCGTTTTAGTTAAGAAAGCAGCTT 57.386 33.333 0.21 0.21 0.00 3.74
1655 4230 6.613755 TTCGTTTTAGTTAAGAAAGCAGCT 57.386 33.333 0.00 0.00 0.00 4.24
1660 4235 5.851703 GCAGGCTTCGTTTTAGTTAAGAAAG 59.148 40.000 0.00 0.00 0.00 2.62
1664 4239 5.358298 AAGCAGGCTTCGTTTTAGTTAAG 57.642 39.130 0.00 0.00 0.00 1.85
1665 4240 5.352643 GAAGCAGGCTTCGTTTTAGTTAA 57.647 39.130 17.26 0.00 42.23 2.01
1667 4242 3.898517 GAAGCAGGCTTCGTTTTAGTT 57.101 42.857 17.26 0.00 42.23 2.24
1677 4252 0.036858 GGAGACGAAGAAGCAGGCTT 60.037 55.000 6.17 6.17 39.23 4.35
1678 4253 1.188219 TGGAGACGAAGAAGCAGGCT 61.188 55.000 0.00 0.00 0.00 4.58
1680 4255 1.480137 AGATGGAGACGAAGAAGCAGG 59.520 52.381 0.00 0.00 0.00 4.85
1683 4278 1.478510 TGGAGATGGAGACGAAGAAGC 59.521 52.381 0.00 0.00 0.00 3.86
1687 4282 2.029020 TGTTGTGGAGATGGAGACGAAG 60.029 50.000 0.00 0.00 0.00 3.79
1688 4283 1.967779 TGTTGTGGAGATGGAGACGAA 59.032 47.619 0.00 0.00 0.00 3.85
1690 4285 1.000843 TGTGTTGTGGAGATGGAGACG 59.999 52.381 0.00 0.00 0.00 4.18
1693 4288 3.339253 TCATGTGTTGTGGAGATGGAG 57.661 47.619 0.00 0.00 0.00 3.86
1709 4304 1.132262 GGTAACGTGGGCACATTCATG 59.868 52.381 0.00 0.00 0.00 3.07
1712 4307 0.802494 CTGGTAACGTGGGCACATTC 59.198 55.000 0.00 0.00 42.51 2.67
1714 4309 0.605319 CACTGGTAACGTGGGCACAT 60.605 55.000 0.00 0.00 37.42 3.21
1715 4310 1.227704 CACTGGTAACGTGGGCACA 60.228 57.895 0.00 0.00 37.42 4.57
1716 4311 2.613506 GCACTGGTAACGTGGGCAC 61.614 63.158 0.00 0.00 41.02 5.01
1717 4312 2.281208 GCACTGGTAACGTGGGCA 60.281 61.111 0.00 0.00 41.02 5.36
1718 4313 2.281208 TGCACTGGTAACGTGGGC 60.281 61.111 0.00 0.00 41.61 5.36
1719 4314 1.070786 AGTGCACTGGTAACGTGGG 59.929 57.895 20.97 0.00 40.09 4.61
1720 4315 0.249699 TCAGTGCACTGGTAACGTGG 60.250 55.000 39.04 16.57 43.91 4.94
1721 4316 1.726791 GATCAGTGCACTGGTAACGTG 59.273 52.381 39.04 18.04 43.91 4.49
1722 4317 1.337823 GGATCAGTGCACTGGTAACGT 60.338 52.381 39.04 21.45 43.91 3.99
1724 4319 2.770164 AGGATCAGTGCACTGGTAAC 57.230 50.000 39.04 29.54 43.91 2.50
1726 4321 3.195610 CAGTAAGGATCAGTGCACTGGTA 59.804 47.826 39.04 25.65 43.91 3.25
1727 4322 2.027745 CAGTAAGGATCAGTGCACTGGT 60.028 50.000 39.04 36.03 43.91 4.00
1728 4323 2.027745 ACAGTAAGGATCAGTGCACTGG 60.028 50.000 39.04 24.61 43.91 4.00
1729 4324 3.325293 ACAGTAAGGATCAGTGCACTG 57.675 47.619 36.07 36.07 45.08 3.66
1731 4326 4.275936 ACAAAACAGTAAGGATCAGTGCAC 59.724 41.667 9.40 9.40 0.00 4.57
1743 4341 8.212317 GGTAACTAAGACCAACAAAACAGTAA 57.788 34.615 0.00 0.00 36.91 2.24
1758 4356 9.739276 ATCATCATTGTTGAAAGGTAACTAAGA 57.261 29.630 1.73 0.00 39.88 2.10
1759 4357 9.778993 CATCATCATTGTTGAAAGGTAACTAAG 57.221 33.333 1.73 0.00 39.88 2.18
1771 4369 5.725325 TGGCTTTTCATCATCATTGTTGA 57.275 34.783 0.11 0.11 36.00 3.18
1772 4370 6.592220 TCAATGGCTTTTCATCATCATTGTTG 59.408 34.615 11.81 0.00 40.99 3.33
1773 4371 6.592607 GTCAATGGCTTTTCATCATCATTGTT 59.407 34.615 11.81 0.00 40.99 2.83
1774 4372 6.103997 GTCAATGGCTTTTCATCATCATTGT 58.896 36.000 11.81 0.00 40.99 2.71
1775 4373 5.231357 CGTCAATGGCTTTTCATCATCATTG 59.769 40.000 0.00 0.00 41.33 2.82
1776 4374 5.345702 CGTCAATGGCTTTTCATCATCATT 58.654 37.500 0.00 0.00 0.00 2.57
1778 4376 3.427909 GCGTCAATGGCTTTTCATCATCA 60.428 43.478 0.00 0.00 0.00 3.07
1779 4377 3.111098 GCGTCAATGGCTTTTCATCATC 58.889 45.455 0.00 0.00 0.00 2.92
1780 4378 2.756760 AGCGTCAATGGCTTTTCATCAT 59.243 40.909 0.00 0.00 37.50 2.45
1781 4379 2.161855 AGCGTCAATGGCTTTTCATCA 58.838 42.857 0.00 0.00 37.50 3.07
1790 4388 0.237235 TGAAACGAAGCGTCAATGGC 59.763 50.000 0.00 0.00 39.99 4.40
1791 4389 2.900122 ATGAAACGAAGCGTCAATGG 57.100 45.000 0.00 0.00 39.99 3.16
1792 4390 2.339400 GCAATGAAACGAAGCGTCAATG 59.661 45.455 0.00 0.00 39.99 2.82
1793 4391 2.226437 AGCAATGAAACGAAGCGTCAAT 59.774 40.909 0.00 0.00 39.99 2.57
1794 4392 1.601903 AGCAATGAAACGAAGCGTCAA 59.398 42.857 0.00 0.00 39.99 3.18
1798 4396 3.455619 AAGTAGCAATGAAACGAAGCG 57.544 42.857 0.00 0.00 0.00 4.68
1799 4397 6.371389 AGTAAAAGTAGCAATGAAACGAAGC 58.629 36.000 0.00 0.00 0.00 3.86
1800 4398 7.149128 GCAAGTAAAAGTAGCAATGAAACGAAG 60.149 37.037 0.00 0.00 0.00 3.79
1801 4399 6.635239 GCAAGTAAAAGTAGCAATGAAACGAA 59.365 34.615 0.00 0.00 0.00 3.85
1802 4400 6.017440 AGCAAGTAAAAGTAGCAATGAAACGA 60.017 34.615 0.00 0.00 0.00 3.85
1803 4401 6.086765 CAGCAAGTAAAAGTAGCAATGAAACG 59.913 38.462 0.00 0.00 0.00 3.60
1804 4402 6.129088 GCAGCAAGTAAAAGTAGCAATGAAAC 60.129 38.462 0.00 0.00 0.00 2.78
1805 4403 5.920273 GCAGCAAGTAAAAGTAGCAATGAAA 59.080 36.000 0.00 0.00 0.00 2.69
1806 4404 5.241506 AGCAGCAAGTAAAAGTAGCAATGAA 59.758 36.000 0.00 0.00 0.00 2.57
1807 4405 4.761739 AGCAGCAAGTAAAAGTAGCAATGA 59.238 37.500 0.00 0.00 0.00 2.57
1808 4406 5.051891 AGCAGCAAGTAAAAGTAGCAATG 57.948 39.130 0.00 0.00 0.00 2.82
1809 4407 5.940470 AGTAGCAGCAAGTAAAAGTAGCAAT 59.060 36.000 0.00 0.00 0.00 3.56
1810 4408 5.305585 AGTAGCAGCAAGTAAAAGTAGCAA 58.694 37.500 0.00 0.00 0.00 3.91
1811 4409 4.894784 AGTAGCAGCAAGTAAAAGTAGCA 58.105 39.130 0.00 0.00 0.00 3.49
1812 4410 5.867716 TGTAGTAGCAGCAAGTAAAAGTAGC 59.132 40.000 0.00 0.00 0.00 3.58
1813 4411 7.091443 ACTGTAGTAGCAGCAAGTAAAAGTAG 58.909 38.462 0.00 0.00 39.96 2.57
1814 4412 6.989659 ACTGTAGTAGCAGCAAGTAAAAGTA 58.010 36.000 0.00 0.00 39.96 2.24
1815 4413 5.855045 ACTGTAGTAGCAGCAAGTAAAAGT 58.145 37.500 0.00 0.00 39.96 2.66
1816 4414 6.866770 TGTACTGTAGTAGCAGCAAGTAAAAG 59.133 38.462 0.00 0.00 39.96 2.27
1817 4415 6.643770 GTGTACTGTAGTAGCAGCAAGTAAAA 59.356 38.462 0.00 0.00 39.96 1.52
1818 4416 6.154445 GTGTACTGTAGTAGCAGCAAGTAAA 58.846 40.000 0.00 0.00 39.96 2.01
1819 4417 5.242171 TGTGTACTGTAGTAGCAGCAAGTAA 59.758 40.000 0.00 0.00 39.96 2.24
1820 4418 4.763279 TGTGTACTGTAGTAGCAGCAAGTA 59.237 41.667 0.00 0.00 39.96 2.24
1821 4419 3.572682 TGTGTACTGTAGTAGCAGCAAGT 59.427 43.478 0.00 0.00 39.96 3.16
1822 4420 3.921021 GTGTGTACTGTAGTAGCAGCAAG 59.079 47.826 0.00 0.00 39.96 4.01
1823 4421 3.319689 TGTGTGTACTGTAGTAGCAGCAA 59.680 43.478 0.00 0.00 39.96 3.91
1824 4422 2.888414 TGTGTGTACTGTAGTAGCAGCA 59.112 45.455 0.00 0.00 39.96 4.41
1825 4423 3.570926 TGTGTGTACTGTAGTAGCAGC 57.429 47.619 0.00 0.00 39.96 5.25
1826 4424 3.859961 GCATGTGTGTACTGTAGTAGCAG 59.140 47.826 0.00 0.00 41.92 4.24
1827 4425 3.509967 AGCATGTGTGTACTGTAGTAGCA 59.490 43.478 0.00 0.00 0.00 3.49
1828 4426 4.106197 GAGCATGTGTGTACTGTAGTAGC 58.894 47.826 0.00 0.00 0.00 3.58
1829 4427 4.157840 TGGAGCATGTGTGTACTGTAGTAG 59.842 45.833 0.00 0.00 0.00 2.57
1830 4428 4.082408 GTGGAGCATGTGTGTACTGTAGTA 60.082 45.833 0.00 0.00 0.00 1.82
1831 4429 2.897326 TGGAGCATGTGTGTACTGTAGT 59.103 45.455 0.00 0.00 0.00 2.73
1832 4430 3.254060 GTGGAGCATGTGTGTACTGTAG 58.746 50.000 0.00 0.00 0.00 2.74
1833 4431 2.630580 TGTGGAGCATGTGTGTACTGTA 59.369 45.455 0.00 0.00 0.00 2.74
1834 4432 1.416030 TGTGGAGCATGTGTGTACTGT 59.584 47.619 0.00 0.00 0.00 3.55
1835 4433 2.168326 TGTGGAGCATGTGTGTACTG 57.832 50.000 0.00 0.00 0.00 2.74
1836 4434 2.158827 TGTTGTGGAGCATGTGTGTACT 60.159 45.455 0.00 0.00 0.00 2.73
1837 4435 2.217750 TGTTGTGGAGCATGTGTGTAC 58.782 47.619 0.00 0.00 0.00 2.90
1838 4436 2.629336 TGTTGTGGAGCATGTGTGTA 57.371 45.000 0.00 0.00 0.00 2.90
1839 4437 1.761449 TTGTTGTGGAGCATGTGTGT 58.239 45.000 0.00 0.00 0.00 3.72
1840 4438 2.867287 TTTGTTGTGGAGCATGTGTG 57.133 45.000 0.00 0.00 0.00 3.82
1841 4439 2.546373 GCATTTGTTGTGGAGCATGTGT 60.546 45.455 0.00 0.00 0.00 3.72
1842 4440 2.063266 GCATTTGTTGTGGAGCATGTG 58.937 47.619 0.00 0.00 0.00 3.21
1843 4441 1.687660 TGCATTTGTTGTGGAGCATGT 59.312 42.857 0.00 0.00 0.00 3.21
1844 4442 2.029739 TCTGCATTTGTTGTGGAGCATG 60.030 45.455 0.00 0.00 35.32 4.06
1845 4443 2.241160 TCTGCATTTGTTGTGGAGCAT 58.759 42.857 0.00 0.00 35.32 3.79
1846 4444 1.689984 TCTGCATTTGTTGTGGAGCA 58.310 45.000 0.00 0.00 35.32 4.26
1847 4445 2.602878 CATCTGCATTTGTTGTGGAGC 58.397 47.619 0.00 0.00 35.32 4.70
1848 4446 2.602878 GCATCTGCATTTGTTGTGGAG 58.397 47.619 0.00 0.00 41.59 3.86
1849 4447 2.728690 GCATCTGCATTTGTTGTGGA 57.271 45.000 0.00 0.00 41.59 4.02
1868 4466 4.124238 CCTAAATGGGCTGCATGAAAATG 58.876 43.478 0.50 0.00 0.00 2.32
1869 4467 4.411256 CCTAAATGGGCTGCATGAAAAT 57.589 40.909 0.50 0.00 0.00 1.82
1870 4468 3.891422 CCTAAATGGGCTGCATGAAAA 57.109 42.857 0.50 0.00 0.00 2.29
1882 4480 2.224548 GGCACCTACTAGCCCTAAATGG 60.225 54.545 0.00 0.00 45.18 3.16
1883 4481 3.127425 GGCACCTACTAGCCCTAAATG 57.873 52.381 0.00 0.00 45.18 2.32
1891 4489 2.606275 GCAATCGGCACCTACTAGC 58.394 57.895 0.00 0.00 43.97 3.42
1901 4499 0.388520 GTTTCCACCAAGCAATCGGC 60.389 55.000 0.00 0.00 45.30 5.54
1902 4500 0.958091 TGTTTCCACCAAGCAATCGG 59.042 50.000 0.00 0.00 0.00 4.18
1903 4501 1.608590 ACTGTTTCCACCAAGCAATCG 59.391 47.619 0.00 0.00 0.00 3.34
1904 4502 3.733443 AACTGTTTCCACCAAGCAATC 57.267 42.857 0.00 0.00 0.00 2.67
1905 4503 4.892934 TCTAAACTGTTTCCACCAAGCAAT 59.107 37.500 9.38 0.00 0.00 3.56
1906 4504 4.274147 TCTAAACTGTTTCCACCAAGCAA 58.726 39.130 9.38 0.00 0.00 3.91
1907 4505 3.882888 CTCTAAACTGTTTCCACCAAGCA 59.117 43.478 9.38 0.00 0.00 3.91
1908 4506 3.883489 ACTCTAAACTGTTTCCACCAAGC 59.117 43.478 9.38 0.00 0.00 4.01
1909 4507 4.261197 GCACTCTAAACTGTTTCCACCAAG 60.261 45.833 9.38 0.71 0.00 3.61
1910 4508 3.630312 GCACTCTAAACTGTTTCCACCAA 59.370 43.478 9.38 0.00 0.00 3.67
1911 4509 3.211045 GCACTCTAAACTGTTTCCACCA 58.789 45.455 9.38 0.00 0.00 4.17
1912 4510 2.552743 GGCACTCTAAACTGTTTCCACC 59.447 50.000 9.38 1.12 0.00 4.61
1913 4511 2.552743 GGGCACTCTAAACTGTTTCCAC 59.447 50.000 9.38 0.00 0.00 4.02
1914 4512 2.173782 TGGGCACTCTAAACTGTTTCCA 59.826 45.455 9.38 6.30 0.00 3.53
1915 4513 2.858745 TGGGCACTCTAAACTGTTTCC 58.141 47.619 9.38 3.60 0.00 3.13
1916 4514 6.379386 GTTAATGGGCACTCTAAACTGTTTC 58.621 40.000 9.38 0.00 0.00 2.78
1917 4515 5.048991 CGTTAATGGGCACTCTAAACTGTTT 60.049 40.000 10.98 10.98 0.00 2.83
1918 4516 4.454504 CGTTAATGGGCACTCTAAACTGTT 59.545 41.667 0.00 0.00 0.00 3.16
1919 4517 4.000988 CGTTAATGGGCACTCTAAACTGT 58.999 43.478 0.00 0.00 0.00 3.55
1920 4518 3.181510 GCGTTAATGGGCACTCTAAACTG 60.182 47.826 0.00 0.00 0.00 3.16
1921 4519 3.007635 GCGTTAATGGGCACTCTAAACT 58.992 45.455 0.00 0.00 0.00 2.66
1922 4520 2.096980 GGCGTTAATGGGCACTCTAAAC 59.903 50.000 0.00 0.00 0.00 2.01
1923 4521 2.361789 GGCGTTAATGGGCACTCTAAA 58.638 47.619 0.00 0.00 0.00 1.85
1924 4522 1.741055 CGGCGTTAATGGGCACTCTAA 60.741 52.381 0.00 0.00 0.00 2.10
1925 4523 0.179094 CGGCGTTAATGGGCACTCTA 60.179 55.000 0.00 0.00 0.00 2.43
1926 4524 1.449601 CGGCGTTAATGGGCACTCT 60.450 57.895 0.00 0.00 0.00 3.24
1927 4525 0.814010 ATCGGCGTTAATGGGCACTC 60.814 55.000 6.85 0.00 0.00 3.51
1928 4526 0.466543 TATCGGCGTTAATGGGCACT 59.533 50.000 6.85 0.00 0.00 4.40
1929 4527 1.263217 CTTATCGGCGTTAATGGGCAC 59.737 52.381 6.85 0.00 0.00 5.01
1930 4528 1.588674 CTTATCGGCGTTAATGGGCA 58.411 50.000 6.85 0.00 0.00 5.36
1931 4529 0.237498 GCTTATCGGCGTTAATGGGC 59.763 55.000 6.85 5.78 0.00 5.36
1932 4530 1.878953 AGCTTATCGGCGTTAATGGG 58.121 50.000 6.85 0.00 37.29 4.00
1933 4531 5.607119 AATTAGCTTATCGGCGTTAATGG 57.393 39.130 6.85 0.00 37.29 3.16
1934 4532 8.280497 AGTTAAATTAGCTTATCGGCGTTAATG 58.720 33.333 6.85 5.01 37.29 1.90
1935 4533 8.374327 AGTTAAATTAGCTTATCGGCGTTAAT 57.626 30.769 6.85 0.00 37.29 1.40
1936 4534 7.775397 AGTTAAATTAGCTTATCGGCGTTAA 57.225 32.000 6.85 8.61 37.29 2.01
1937 4535 8.352201 TCTAGTTAAATTAGCTTATCGGCGTTA 58.648 33.333 6.85 0.00 37.29 3.18
1938 4536 7.205297 TCTAGTTAAATTAGCTTATCGGCGTT 58.795 34.615 6.85 0.00 37.29 4.84
1939 4537 6.742109 TCTAGTTAAATTAGCTTATCGGCGT 58.258 36.000 6.85 0.00 37.29 5.68
1940 4538 7.813852 ATCTAGTTAAATTAGCTTATCGGCG 57.186 36.000 0.00 0.00 37.29 6.46
1957 4555 8.565416 CCGGAACTCTGTTTTTAAAATCTAGTT 58.435 33.333 19.30 19.30 0.00 2.24
1958 4556 7.718314 ACCGGAACTCTGTTTTTAAAATCTAGT 59.282 33.333 9.46 6.61 0.00 2.57
1959 4557 8.095937 ACCGGAACTCTGTTTTTAAAATCTAG 57.904 34.615 9.46 6.07 0.00 2.43
1960 4558 7.095523 CGACCGGAACTCTGTTTTTAAAATCTA 60.096 37.037 9.46 0.00 0.00 1.98
1961 4559 6.293244 CGACCGGAACTCTGTTTTTAAAATCT 60.293 38.462 9.46 0.00 0.00 2.40
1962 4560 5.849604 CGACCGGAACTCTGTTTTTAAAATC 59.150 40.000 9.46 1.73 0.00 2.17
1963 4561 5.297527 ACGACCGGAACTCTGTTTTTAAAAT 59.702 36.000 9.46 0.00 0.00 1.82
1964 4562 4.635324 ACGACCGGAACTCTGTTTTTAAAA 59.365 37.500 9.46 0.00 0.00 1.52
1965 4563 4.034279 CACGACCGGAACTCTGTTTTTAAA 59.966 41.667 9.46 0.00 0.00 1.52
1966 4564 3.556775 CACGACCGGAACTCTGTTTTTAA 59.443 43.478 9.46 0.00 0.00 1.52
1967 4565 3.125316 CACGACCGGAACTCTGTTTTTA 58.875 45.455 9.46 0.00 0.00 1.52
1968 4566 1.937899 CACGACCGGAACTCTGTTTTT 59.062 47.619 9.46 0.00 0.00 1.94
1969 4567 1.134610 ACACGACCGGAACTCTGTTTT 60.135 47.619 9.46 0.00 0.00 2.43
1970 4568 0.462789 ACACGACCGGAACTCTGTTT 59.537 50.000 9.46 0.00 0.00 2.83
1971 4569 0.462789 AACACGACCGGAACTCTGTT 59.537 50.000 9.46 9.08 0.00 3.16
1972 4570 1.321474 TAACACGACCGGAACTCTGT 58.679 50.000 9.46 3.33 0.00 3.41
1973 4571 2.649331 ATAACACGACCGGAACTCTG 57.351 50.000 9.46 2.70 0.00 3.35
1974 4572 3.084039 TGTATAACACGACCGGAACTCT 58.916 45.455 9.46 0.00 0.00 3.24
1975 4573 3.174375 GTGTATAACACGACCGGAACTC 58.826 50.000 9.46 0.00 39.53 3.01
1976 4574 3.221964 GTGTATAACACGACCGGAACT 57.778 47.619 9.46 0.00 39.53 3.01
2003 4601 4.791411 GCGCCGCAATTAATCAAATAGGAA 60.791 41.667 3.15 0.00 0.00 3.36
2008 4606 2.462889 CAGCGCCGCAATTAATCAAAT 58.537 42.857 13.36 0.00 0.00 2.32
2011 4609 1.029408 ACCAGCGCCGCAATTAATCA 61.029 50.000 13.36 0.00 0.00 2.57
2012 4610 0.100503 AACCAGCGCCGCAATTAATC 59.899 50.000 13.36 0.00 0.00 1.75
2013 4611 0.100503 GAACCAGCGCCGCAATTAAT 59.899 50.000 13.36 0.00 0.00 1.40
2014 4612 1.504446 GAACCAGCGCCGCAATTAA 59.496 52.632 13.36 0.00 0.00 1.40
2015 4613 2.745785 CGAACCAGCGCCGCAATTA 61.746 57.895 13.36 0.00 0.00 1.40
2016 4614 4.101790 CGAACCAGCGCCGCAATT 62.102 61.111 13.36 1.30 0.00 2.32
2021 4619 3.788766 CTTTCCGAACCAGCGCCG 61.789 66.667 2.29 0.00 0.00 6.46
2024 4622 2.358737 AGGCTTTCCGAACCAGCG 60.359 61.111 0.00 0.00 37.47 5.18
2026 4624 0.962356 ATGCAGGCTTTCCGAACCAG 60.962 55.000 0.00 0.00 37.47 4.00
2027 4625 0.326595 TATGCAGGCTTTCCGAACCA 59.673 50.000 0.00 0.00 37.47 3.67
2028 4626 0.733150 GTATGCAGGCTTTCCGAACC 59.267 55.000 0.00 0.00 37.47 3.62
2030 4628 1.003118 AGTGTATGCAGGCTTTCCGAA 59.997 47.619 0.00 0.00 37.47 4.30
2031 4629 0.613260 AGTGTATGCAGGCTTTCCGA 59.387 50.000 0.00 0.00 37.47 4.55
2032 4630 1.009829 GAGTGTATGCAGGCTTTCCG 58.990 55.000 0.00 0.00 37.47 4.30
2033 4631 2.409948 AGAGTGTATGCAGGCTTTCC 57.590 50.000 0.00 0.00 0.00 3.13
2034 4632 4.938226 ACTAAAGAGTGTATGCAGGCTTTC 59.062 41.667 12.11 0.00 33.41 2.62
2035 4633 4.911390 ACTAAAGAGTGTATGCAGGCTTT 58.089 39.130 12.96 12.96 33.41 3.51
2036 4634 4.559862 ACTAAAGAGTGTATGCAGGCTT 57.440 40.909 0.00 0.00 33.41 4.35
2037 4635 4.559862 AACTAAAGAGTGTATGCAGGCT 57.440 40.909 0.00 0.00 35.52 4.58
2038 4636 5.064834 GGTTAACTAAAGAGTGTATGCAGGC 59.935 44.000 5.42 0.00 35.52 4.85
2039 4637 6.170506 TGGTTAACTAAAGAGTGTATGCAGG 58.829 40.000 5.42 0.00 35.52 4.85
2040 4638 7.667043 TTGGTTAACTAAAGAGTGTATGCAG 57.333 36.000 5.42 0.00 35.52 4.41
2041 4639 8.347035 GTTTTGGTTAACTAAAGAGTGTATGCA 58.653 33.333 15.53 0.00 35.52 3.96
2042 4640 7.532884 CGTTTTGGTTAACTAAAGAGTGTATGC 59.467 37.037 15.53 1.68 35.52 3.14
2043 4641 8.553696 ACGTTTTGGTTAACTAAAGAGTGTATG 58.446 33.333 15.53 8.98 35.52 2.39
2044 4642 8.667076 ACGTTTTGGTTAACTAAAGAGTGTAT 57.333 30.769 15.53 0.00 35.52 2.29
2045 4643 8.389603 CAACGTTTTGGTTAACTAAAGAGTGTA 58.610 33.333 19.51 4.59 35.52 2.90
2046 4644 6.990341 ACGTTTTGGTTAACTAAAGAGTGT 57.010 33.333 15.53 10.65 35.52 3.55
2047 4645 7.245604 ACAACGTTTTGGTTAACTAAAGAGTG 58.754 34.615 19.51 16.24 37.00 3.51
2048 4646 7.381766 ACAACGTTTTGGTTAACTAAAGAGT 57.618 32.000 15.53 15.65 37.00 3.24
2049 4647 7.964011 TCAACAACGTTTTGGTTAACTAAAGAG 59.036 33.333 15.53 15.13 37.00 2.85
2050 4648 7.814642 TCAACAACGTTTTGGTTAACTAAAGA 58.185 30.769 15.53 6.08 37.00 2.52
2051 4649 8.623310 ATCAACAACGTTTTGGTTAACTAAAG 57.377 30.769 15.53 9.08 37.00 1.85
2052 4650 8.983307 AATCAACAACGTTTTGGTTAACTAAA 57.017 26.923 12.58 12.58 37.00 1.85
2053 4651 8.983307 AAATCAACAACGTTTTGGTTAACTAA 57.017 26.923 16.59 2.43 37.00 2.24
2054 4652 8.983307 AAAATCAACAACGTTTTGGTTAACTA 57.017 26.923 16.59 0.00 37.00 2.24
2055 4653 7.892778 AAAATCAACAACGTTTTGGTTAACT 57.107 28.000 16.59 4.95 37.00 2.24
2079 4677