Multiple sequence alignment - TraesCS5B01G558800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G558800 chr5B 100.000 4125 0 0 1 4125 706021166 706025290 0.000000e+00 7618
1 TraesCS5B01G558800 chr5B 95.364 302 14 0 3623 3924 18671030 18670729 8.020000e-132 481
2 TraesCS5B01G558800 chr5B 86.081 273 38 0 1030 1302 706685898 706685626 1.120000e-75 294
3 TraesCS5B01G558800 chr5B 86.585 164 22 0 2638 2801 706490036 706489873 9.110000e-42 182
4 TraesCS5B01G558800 chr5B 81.507 146 27 0 2639 2784 706685303 706685158 2.010000e-23 121
5 TraesCS5B01G558800 chr4D 88.764 890 93 7 2 889 503147390 503146506 0.000000e+00 1083
6 TraesCS5B01G558800 chr4D 85.881 857 107 10 53 900 12591217 12590366 0.000000e+00 900
7 TraesCS5B01G558800 chr4D 83.729 295 41 6 2185 2473 93437043 93436750 5.250000e-69 272
8 TraesCS5B01G558800 chr7D 86.674 893 109 7 2 889 616205688 616204801 0.000000e+00 981
9 TraesCS5B01G558800 chr7D 86.025 873 106 13 30 898 538168207 538167347 0.000000e+00 922
10 TraesCS5B01G558800 chr7D 85.649 878 107 15 26 898 219897603 219898466 0.000000e+00 905
11 TraesCS5B01G558800 chr7D 84.416 308 47 1 2166 2473 500618973 500618667 6.700000e-78 302
12 TraesCS5B01G558800 chr7D 90.678 118 9 2 3921 4038 614411320 614411205 5.520000e-34 156
13 TraesCS5B01G558800 chr4B 86.629 890 107 10 20 901 647600031 647599146 0.000000e+00 974
14 TraesCS5B01G558800 chr4B 95.960 297 12 0 3625 3921 107803627 107803923 2.230000e-132 483
15 TraesCS5B01G558800 chr4B 86.598 194 20 5 3921 4113 212532008 212532196 4.180000e-50 209
16 TraesCS5B01G558800 chr1B 84.949 877 117 8 28 899 612925827 612926693 0.000000e+00 874
17 TraesCS5B01G558800 chr5A 84.607 877 118 14 28 900 663101497 663100634 0.000000e+00 856
18 TraesCS5B01G558800 chr5A 88.401 319 22 10 3607 3921 542312936 542313243 1.810000e-98 370
19 TraesCS5B01G558800 chr5A 85.128 195 22 4 3921 4113 301931123 301930934 4.210000e-45 193
20 TraesCS5B01G558800 chr7A 84.343 875 124 8 28 899 678118211 678119075 0.000000e+00 845
21 TraesCS5B01G558800 chr7A 89.076 119 11 2 3921 4038 50579065 50579182 3.320000e-31 147
22 TraesCS5B01G558800 chr3B 96.296 297 10 1 3625 3921 462598187 462598482 1.720000e-133 486
23 TraesCS5B01G558800 chr3B 95.638 298 13 0 3624 3921 729729630 729729927 2.880000e-131 479
24 TraesCS5B01G558800 chr3B 94.276 297 17 0 3625 3921 93689340 93689636 4.860000e-124 455
25 TraesCS5B01G558800 chr3B 87.374 198 19 4 3326 3518 108895966 108895770 5.370000e-54 222
26 TraesCS5B01G558800 chr3B 80.503 159 31 0 2640 2798 8035551 8035709 5.600000e-24 122
27 TraesCS5B01G558800 chr6B 94.276 297 17 0 3625 3921 439047680 439047384 4.860000e-124 455
28 TraesCS5B01G558800 chr2D 92.593 297 19 3 3625 3919 649876014 649876309 1.370000e-114 424
29 TraesCS5B01G558800 chr2D 78.199 211 29 11 3429 3626 142704795 142704589 7.240000e-23 119
30 TraesCS5B01G558800 chr3A 91.176 306 23 4 3618 3921 490173212 490172909 2.970000e-111 412
31 TraesCS5B01G558800 chr3A 83.934 305 43 5 2168 2468 490622890 490622588 1.880000e-73 287
32 TraesCS5B01G558800 chr3A 88.811 143 14 2 3921 4063 517447097 517446957 1.520000e-39 174
33 TraesCS5B01G558800 chr6A 90.415 313 26 4 3623 3934 16588377 16588686 3.840000e-110 409
34 TraesCS5B01G558800 chr2B 86.275 306 38 3 2168 2473 1978744 1978443 3.070000e-86 329
35 TraesCS5B01G558800 chr5D 85.235 298 41 3 2176 2473 317386792 317387086 1.860000e-78 303
36 TraesCS5B01G558800 chr5D 86.545 275 37 0 1030 1304 564124160 564123886 1.860000e-78 303
37 TraesCS5B01G558800 chr5D 83.642 324 43 5 2162 2483 409491590 409491275 3.120000e-76 296
38 TraesCS5B01G558800 chr5D 81.548 336 34 14 3316 3626 317408966 317409298 6.850000e-63 252
39 TraesCS5B01G558800 chr5D 89.583 192 18 2 3921 4112 317409296 317409485 4.120000e-60 243
40 TraesCS5B01G558800 chr5D 86.408 206 21 4 3922 4125 517050851 517050651 6.940000e-53 219
41 TraesCS5B01G558800 chr5D 84.932 146 22 0 2639 2784 564122612 564122467 9.240000e-32 148
42 TraesCS5B01G558800 chr7B 85.172 290 38 5 2185 2473 528751558 528751273 4.030000e-75 292
43 TraesCS5B01G558800 chr7B 92.073 164 12 1 3316 3478 701474852 701475015 3.210000e-56 230
44 TraesCS5B01G558800 chr7B 91.525 118 9 1 3921 4038 14985945 14985829 1.190000e-35 161
45 TraesCS5B01G558800 chr2A 82.727 330 49 7 2147 2473 391106565 391106241 1.880000e-73 287
46 TraesCS5B01G558800 chr4A 83.607 305 43 7 2153 2454 650020319 650020619 3.140000e-71 279
47 TraesCS5B01G558800 chr4A 84.364 275 39 1 1032 1302 608374144 608374418 2.440000e-67 267
48 TraesCS5B01G558800 chr4A 79.781 183 35 2 2639 2820 608260783 608260964 9.300000e-27 132
49 TraesCS5B01G558800 chr4A 82.192 146 26 0 2639 2784 608374729 608374874 4.330000e-25 126
50 TraesCS5B01G558800 chr1A 84.783 184 16 6 3326 3498 148656525 148656343 1.520000e-39 174
51 TraesCS5B01G558800 chrUn 91.818 110 8 1 3929 4038 458407601 458407709 7.140000e-33 152


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G558800 chr5B 706021166 706025290 4124 False 7618.0 7618 100.0000 1 4125 1 chr5B.!!$F1 4124
1 TraesCS5B01G558800 chr5B 706685158 706685898 740 True 207.5 294 83.7940 1030 2784 2 chr5B.!!$R3 1754
2 TraesCS5B01G558800 chr4D 503146506 503147390 884 True 1083.0 1083 88.7640 2 889 1 chr4D.!!$R3 887
3 TraesCS5B01G558800 chr4D 12590366 12591217 851 True 900.0 900 85.8810 53 900 1 chr4D.!!$R1 847
4 TraesCS5B01G558800 chr7D 616204801 616205688 887 True 981.0 981 86.6740 2 889 1 chr7D.!!$R4 887
5 TraesCS5B01G558800 chr7D 538167347 538168207 860 True 922.0 922 86.0250 30 898 1 chr7D.!!$R2 868
6 TraesCS5B01G558800 chr7D 219897603 219898466 863 False 905.0 905 85.6490 26 898 1 chr7D.!!$F1 872
7 TraesCS5B01G558800 chr4B 647599146 647600031 885 True 974.0 974 86.6290 20 901 1 chr4B.!!$R1 881
8 TraesCS5B01G558800 chr1B 612925827 612926693 866 False 874.0 874 84.9490 28 899 1 chr1B.!!$F1 871
9 TraesCS5B01G558800 chr5A 663100634 663101497 863 True 856.0 856 84.6070 28 900 1 chr5A.!!$R2 872
10 TraesCS5B01G558800 chr7A 678118211 678119075 864 False 845.0 845 84.3430 28 899 1 chr7A.!!$F2 871
11 TraesCS5B01G558800 chr5D 317408966 317409485 519 False 247.5 252 85.5655 3316 4112 2 chr5D.!!$F2 796
12 TraesCS5B01G558800 chr5D 564122467 564124160 1693 True 225.5 303 85.7385 1030 2784 2 chr5D.!!$R3 1754


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
928 957 0.251209 GGGGGCCGGAGATTAATTCC 60.251 60.0 5.05 0.0 0.0 3.01 F
1682 2681 0.033504 TGCGTCAGTCACTTCCTTCC 59.966 55.0 0.00 0.0 0.0 3.46 F
2031 3030 0.034059 GATGGATCGGATCGTGGCTT 59.966 55.0 11.62 0.0 0.0 4.35 F
3036 4035 0.035317 ACGGCTGCAGAAGATGTTGA 59.965 50.0 20.43 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2012 3011 0.034059 AAGCCACGATCCGATCCATC 59.966 55.0 2.69 0.0 0.00 3.51 R
3017 4016 0.035317 TCAACATCTTCTGCAGCCGT 59.965 50.0 9.47 0.0 0.00 5.68 R
3047 4046 0.036671 TGCAGCTCCTCACACTCATG 60.037 55.0 0.00 0.0 0.00 3.07 R
3888 4912 0.450184 GCACGTTGTTGCGGGAATAT 59.550 50.0 0.00 0.0 37.48 1.28 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
47 48 0.393944 ATCTGACCTCGGTACTGCGA 60.394 55.000 0.00 0.00 0.00 5.10
50 51 2.359107 ACCTCGGTACTGCGACGA 60.359 61.111 0.00 0.00 35.14 4.20
166 177 0.687757 CTGGATGGAGGGTCCTCGAA 60.688 60.000 10.55 2.70 43.59 3.71
185 196 3.528532 GAACGTATCCGGGTGAAAATCT 58.471 45.455 0.00 0.00 38.78 2.40
217 228 0.608035 GTTCCCAAGGTCGGCAATGA 60.608 55.000 0.00 0.00 0.00 2.57
258 270 3.118112 TCTCCTTCTTGAAGGCATCATCC 60.118 47.826 21.16 0.00 39.80 3.51
267 279 5.024455 TGAAGGCATCATCCTGGAGAAGG 62.024 52.174 1.52 0.00 39.39 3.46
295 307 0.481567 CCTATCCACTACCTCCGGGA 59.518 60.000 0.00 0.00 36.25 5.14
317 329 6.595682 GGAGAAACCCTAGATCAATCAATCA 58.404 40.000 0.00 0.00 0.00 2.57
318 330 7.230027 GGAGAAACCCTAGATCAATCAATCAT 58.770 38.462 0.00 0.00 0.00 2.45
324 337 6.328410 ACCCTAGATCAATCAATCATCTGACA 59.672 38.462 0.00 0.00 0.00 3.58
330 343 3.639672 ATCAATCATCTGACAGTGGCA 57.360 42.857 0.00 0.00 0.00 4.92
345 358 3.814577 GGCACTCATGTGTCGTACT 57.185 52.632 0.00 0.00 45.44 2.73
348 361 1.067846 GCACTCATGTGTCGTACTCCA 60.068 52.381 0.00 0.00 45.44 3.86
378 391 1.537202 GTCATTCTTGGAGGTGTGCAC 59.463 52.381 10.75 10.75 0.00 4.57
398 411 2.352805 GCTCAAGGGACCAGTGGG 59.647 66.667 15.21 0.00 41.29 4.61
417 430 1.807226 CGACATCTACGGTGGAGCA 59.193 57.895 0.00 0.00 0.00 4.26
496 509 0.458543 AGCGACGGATGTGTGATGAC 60.459 55.000 0.00 0.00 0.00 3.06
514 528 2.968206 GAACGTGCGTAGGGAGGT 59.032 61.111 0.00 0.00 33.86 3.85
521 535 2.831742 CGTAGGGAGGTGGCGCTA 60.832 66.667 7.64 0.00 32.86 4.26
578 593 1.731433 GGTCGATGCGCCAGTACCTA 61.731 60.000 4.18 0.00 0.00 3.08
720 741 2.959707 GGTGAGAGATCTGGGTATTCGT 59.040 50.000 0.00 0.00 0.00 3.85
855 878 3.756933 AAAGTGGTTGCATGCATCTTT 57.243 38.095 23.37 22.88 0.00 2.52
872 901 1.552799 TTTCAGATGCAGAGCCCGGA 61.553 55.000 0.73 0.00 0.00 5.14
913 942 3.550692 AAAAACTGGGAACTGGGGG 57.449 52.632 0.00 0.00 0.00 5.40
914 943 0.762842 AAAAACTGGGAACTGGGGGC 60.763 55.000 0.00 0.00 0.00 5.80
915 944 2.673027 AAAACTGGGAACTGGGGGCC 62.673 60.000 0.00 0.00 0.00 5.80
921 950 3.090532 GAACTGGGGGCCGGAGAT 61.091 66.667 5.05 0.00 33.36 2.75
922 951 2.614013 AACTGGGGGCCGGAGATT 60.614 61.111 5.05 0.00 33.36 2.40
923 952 1.307517 AACTGGGGGCCGGAGATTA 60.308 57.895 5.05 0.00 33.36 1.75
924 953 0.917333 AACTGGGGGCCGGAGATTAA 60.917 55.000 5.05 0.00 33.36 1.40
925 954 0.697854 ACTGGGGGCCGGAGATTAAT 60.698 55.000 5.05 0.00 33.36 1.40
926 955 0.478507 CTGGGGGCCGGAGATTAATT 59.521 55.000 5.05 0.00 29.82 1.40
927 956 0.476771 TGGGGGCCGGAGATTAATTC 59.523 55.000 5.05 0.00 0.00 2.17
928 957 0.251209 GGGGGCCGGAGATTAATTCC 60.251 60.000 5.05 0.00 0.00 3.01
929 958 0.476771 GGGGCCGGAGATTAATTCCA 59.523 55.000 5.05 0.00 34.24 3.53
930 959 1.075536 GGGGCCGGAGATTAATTCCAT 59.924 52.381 5.05 0.00 34.24 3.41
931 960 2.162681 GGGCCGGAGATTAATTCCATG 58.837 52.381 5.05 0.00 34.24 3.66
932 961 2.224769 GGGCCGGAGATTAATTCCATGA 60.225 50.000 5.05 0.00 34.24 3.07
933 962 2.814336 GGCCGGAGATTAATTCCATGAC 59.186 50.000 5.05 5.81 34.24 3.06
934 963 3.496870 GGCCGGAGATTAATTCCATGACT 60.497 47.826 5.05 0.00 34.24 3.41
935 964 4.137543 GCCGGAGATTAATTCCATGACTT 58.862 43.478 5.05 0.00 34.24 3.01
936 965 4.023707 GCCGGAGATTAATTCCATGACTTG 60.024 45.833 5.05 0.00 34.24 3.16
937 966 4.023707 CCGGAGATTAATTCCATGACTTGC 60.024 45.833 0.00 0.00 34.24 4.01
938 967 4.023707 CGGAGATTAATTCCATGACTTGCC 60.024 45.833 13.60 0.00 34.24 4.52
939 968 4.279420 GGAGATTAATTCCATGACTTGCCC 59.721 45.833 0.00 0.00 34.74 5.36
940 969 4.870636 AGATTAATTCCATGACTTGCCCA 58.129 39.130 0.00 0.00 0.00 5.36
941 970 5.461327 AGATTAATTCCATGACTTGCCCAT 58.539 37.500 0.00 0.00 0.00 4.00
942 971 6.613699 AGATTAATTCCATGACTTGCCCATA 58.386 36.000 0.00 0.00 0.00 2.74
943 972 7.243824 AGATTAATTCCATGACTTGCCCATAT 58.756 34.615 0.00 0.00 0.00 1.78
944 973 8.393259 AGATTAATTCCATGACTTGCCCATATA 58.607 33.333 0.00 0.00 0.00 0.86
945 974 9.193806 GATTAATTCCATGACTTGCCCATATAT 57.806 33.333 0.00 0.00 0.00 0.86
946 975 6.845758 AATTCCATGACTTGCCCATATATG 57.154 37.500 5.68 5.68 0.00 1.78
947 976 3.689347 TCCATGACTTGCCCATATATGC 58.311 45.455 7.24 0.00 0.00 3.14
948 977 3.074242 TCCATGACTTGCCCATATATGCA 59.926 43.478 7.24 0.25 35.27 3.96
949 978 3.827876 CCATGACTTGCCCATATATGCAA 59.172 43.478 7.24 8.51 44.64 4.08
955 984 2.507484 TGCCCATATATGCAAGTGAGC 58.493 47.619 7.24 2.19 33.87 4.26
956 985 1.466167 GCCCATATATGCAAGTGAGCG 59.534 52.381 7.24 0.00 37.31 5.03
957 986 1.466167 CCCATATATGCAAGTGAGCGC 59.534 52.381 7.24 0.00 37.31 5.92
958 987 1.127397 CCATATATGCAAGTGAGCGCG 59.873 52.381 0.00 0.00 37.31 6.86
959 988 1.794701 CATATATGCAAGTGAGCGCGT 59.205 47.619 8.43 0.00 37.31 6.01
960 989 1.208259 TATATGCAAGTGAGCGCGTG 58.792 50.000 8.43 0.00 37.31 5.34
961 990 0.740868 ATATGCAAGTGAGCGCGTGT 60.741 50.000 8.43 0.00 37.31 4.49
962 991 1.625759 TATGCAAGTGAGCGCGTGTG 61.626 55.000 8.43 0.00 37.31 3.82
985 1014 2.480555 CGGTTGCATTCGCTGACC 59.519 61.111 0.00 0.00 39.92 4.02
986 1015 2.877691 GGTTGCATTCGCTGACCC 59.122 61.111 0.00 0.00 38.40 4.46
987 1016 2.480555 GTTGCATTCGCTGACCCG 59.519 61.111 0.00 0.00 39.64 5.28
988 1017 2.032634 GTTGCATTCGCTGACCCGA 61.033 57.895 0.00 0.00 39.64 5.14
996 1025 2.579207 TCGCTGACCCGAAAGATAAG 57.421 50.000 0.00 0.00 33.77 1.73
997 1026 2.097036 TCGCTGACCCGAAAGATAAGA 58.903 47.619 0.00 0.00 33.77 2.10
998 1027 2.099263 TCGCTGACCCGAAAGATAAGAG 59.901 50.000 0.00 0.00 33.77 2.85
999 1028 2.205911 GCTGACCCGAAAGATAAGAGC 58.794 52.381 0.00 0.00 0.00 4.09
1000 1029 2.418746 GCTGACCCGAAAGATAAGAGCA 60.419 50.000 0.00 0.00 0.00 4.26
1001 1030 3.742640 GCTGACCCGAAAGATAAGAGCAT 60.743 47.826 0.00 0.00 0.00 3.79
1002 1031 3.797039 TGACCCGAAAGATAAGAGCATG 58.203 45.455 0.00 0.00 0.00 4.06
1003 1032 3.134458 GACCCGAAAGATAAGAGCATGG 58.866 50.000 0.00 0.00 0.00 3.66
1004 1033 2.771943 ACCCGAAAGATAAGAGCATGGA 59.228 45.455 0.00 0.00 0.00 3.41
1005 1034 3.181461 ACCCGAAAGATAAGAGCATGGAG 60.181 47.826 0.00 0.00 0.00 3.86
1006 1035 2.805099 CCGAAAGATAAGAGCATGGAGC 59.195 50.000 0.00 0.00 46.19 4.70
1015 1044 3.991999 GCATGGAGCAGTCAAGCA 58.008 55.556 0.00 0.00 44.79 3.91
1016 1045 2.260247 GCATGGAGCAGTCAAGCAA 58.740 52.632 0.00 0.00 44.79 3.91
1017 1046 0.170561 GCATGGAGCAGTCAAGCAAG 59.829 55.000 0.00 0.00 44.79 4.01
1018 1047 0.809385 CATGGAGCAGTCAAGCAAGG 59.191 55.000 0.00 0.00 36.85 3.61
1019 1048 0.694771 ATGGAGCAGTCAAGCAAGGA 59.305 50.000 0.00 0.00 36.85 3.36
1020 1049 0.473755 TGGAGCAGTCAAGCAAGGAA 59.526 50.000 0.00 0.00 36.85 3.36
1021 1050 1.133823 TGGAGCAGTCAAGCAAGGAAA 60.134 47.619 0.00 0.00 36.85 3.13
1022 1051 1.956477 GGAGCAGTCAAGCAAGGAAAA 59.044 47.619 0.00 0.00 36.85 2.29
1023 1052 2.287849 GGAGCAGTCAAGCAAGGAAAAC 60.288 50.000 0.00 0.00 36.85 2.43
1024 1053 1.334869 AGCAGTCAAGCAAGGAAAACG 59.665 47.619 0.00 0.00 36.85 3.60
1025 1054 1.600413 GCAGTCAAGCAAGGAAAACGG 60.600 52.381 0.00 0.00 0.00 4.44
1026 1055 1.946768 CAGTCAAGCAAGGAAAACGGA 59.053 47.619 0.00 0.00 0.00 4.69
1027 1056 2.554032 CAGTCAAGCAAGGAAAACGGAT 59.446 45.455 0.00 0.00 0.00 4.18
1028 1057 3.004734 CAGTCAAGCAAGGAAAACGGATT 59.995 43.478 0.00 0.00 0.00 3.01
1064 1093 1.460305 AGGAGTGCCTGACCACAGT 60.460 57.895 0.00 0.00 44.90 3.55
1169 1198 3.394836 GGAGCGGTTCCTGCCTCT 61.395 66.667 3.33 0.00 43.16 3.69
1179 1208 2.729479 CCTGCCTCTGGACTGCGAT 61.729 63.158 0.00 0.00 0.00 4.58
1223 1252 1.137872 CTTCGTGGATTCCTCCTCCAG 59.862 57.143 3.95 0.00 43.33 3.86
1278 1307 2.257371 CTCCTCGACGACGGCAAA 59.743 61.111 7.55 0.00 40.21 3.68
1293 1322 2.171003 GGCAAAAGGGTGAGTGCTAAT 58.829 47.619 0.00 0.00 37.17 1.73
1304 1333 4.439289 GGTGAGTGCTAATTTTCCTGATGC 60.439 45.833 0.00 0.00 0.00 3.91
1305 1334 4.397417 GTGAGTGCTAATTTTCCTGATGCT 59.603 41.667 0.00 0.00 0.00 3.79
1306 1335 5.586243 GTGAGTGCTAATTTTCCTGATGCTA 59.414 40.000 0.00 0.00 0.00 3.49
1307 1336 6.094048 GTGAGTGCTAATTTTCCTGATGCTAA 59.906 38.462 0.00 0.00 0.00 3.09
1308 1337 6.317140 TGAGTGCTAATTTTCCTGATGCTAAG 59.683 38.462 0.00 0.00 0.00 2.18
1309 1338 6.418101 AGTGCTAATTTTCCTGATGCTAAGA 58.582 36.000 0.00 0.00 0.00 2.10
1310 1339 6.317391 AGTGCTAATTTTCCTGATGCTAAGAC 59.683 38.462 0.00 0.00 0.00 3.01
1311 1340 5.294306 TGCTAATTTTCCTGATGCTAAGACG 59.706 40.000 0.00 0.00 0.00 4.18
1321 1350 4.385825 TGATGCTAAGACGACAAAAAGGT 58.614 39.130 0.00 0.00 0.00 3.50
1323 1352 5.637810 TGATGCTAAGACGACAAAAAGGTAG 59.362 40.000 0.00 0.00 0.00 3.18
1324 1353 5.204409 TGCTAAGACGACAAAAAGGTAGA 57.796 39.130 0.00 0.00 0.00 2.59
1325 1354 5.790593 TGCTAAGACGACAAAAAGGTAGAT 58.209 37.500 0.00 0.00 0.00 1.98
1326 1355 5.867716 TGCTAAGACGACAAAAAGGTAGATC 59.132 40.000 0.00 0.00 0.00 2.75
1330 1359 5.103000 AGACGACAAAAAGGTAGATCATCG 58.897 41.667 0.00 0.00 0.00 3.84
1331 1360 5.068234 ACGACAAAAAGGTAGATCATCGA 57.932 39.130 0.00 0.00 0.00 3.59
1332 1361 5.661458 ACGACAAAAAGGTAGATCATCGAT 58.339 37.500 0.00 0.00 0.00 3.59
1333 1362 6.106673 ACGACAAAAAGGTAGATCATCGATT 58.893 36.000 0.00 0.00 0.00 3.34
1335 1364 6.901887 CGACAAAAAGGTAGATCATCGATTTG 59.098 38.462 0.00 0.00 0.00 2.32
1353 2346 4.772046 TTTGTTCGTCGTTTTCTCTGAG 57.228 40.909 0.00 0.00 0.00 3.35
1357 2350 3.473093 TCGTCGTTTTCTCTGAGCTAG 57.527 47.619 0.00 0.00 0.00 3.42
1358 2351 2.812591 TCGTCGTTTTCTCTGAGCTAGT 59.187 45.455 0.00 0.00 0.00 2.57
1360 2353 4.093115 TCGTCGTTTTCTCTGAGCTAGTAG 59.907 45.833 0.00 0.00 0.00 2.57
1362 2355 5.090083 GTCGTTTTCTCTGAGCTAGTAGTG 58.910 45.833 0.00 0.00 0.00 2.74
1364 2357 5.648526 TCGTTTTCTCTGAGCTAGTAGTGAT 59.351 40.000 0.00 0.00 0.00 3.06
1365 2358 6.151312 TCGTTTTCTCTGAGCTAGTAGTGATT 59.849 38.462 0.00 0.00 0.00 2.57
1366 2359 7.336176 TCGTTTTCTCTGAGCTAGTAGTGATTA 59.664 37.037 0.00 0.00 0.00 1.75
1367 2360 7.968956 CGTTTTCTCTGAGCTAGTAGTGATTAA 59.031 37.037 0.00 0.00 0.00 1.40
1368 2361 9.810545 GTTTTCTCTGAGCTAGTAGTGATTAAT 57.189 33.333 0.00 0.00 0.00 1.40
1370 2363 7.428282 TCTCTGAGCTAGTAGTGATTAATCG 57.572 40.000 10.80 0.00 0.00 3.34
1371 2364 7.217906 TCTCTGAGCTAGTAGTGATTAATCGA 58.782 38.462 10.80 0.00 0.00 3.59
1372 2365 7.880713 TCTCTGAGCTAGTAGTGATTAATCGAT 59.119 37.037 10.80 0.00 0.00 3.59
1373 2366 8.397575 TCTGAGCTAGTAGTGATTAATCGATT 57.602 34.615 16.15 16.15 0.00 3.34
1374 2367 8.293157 TCTGAGCTAGTAGTGATTAATCGATTG 58.707 37.037 20.87 0.28 0.00 2.67
1375 2368 7.371159 TGAGCTAGTAGTGATTAATCGATTGG 58.629 38.462 20.87 0.00 0.00 3.16
1376 2369 7.230712 TGAGCTAGTAGTGATTAATCGATTGGA 59.769 37.037 20.87 9.50 0.00 3.53
1377 2370 8.128322 AGCTAGTAGTGATTAATCGATTGGAT 57.872 34.615 20.87 13.76 36.78 3.41
1378 2371 9.244292 AGCTAGTAGTGATTAATCGATTGGATA 57.756 33.333 20.87 3.96 34.08 2.59
1379 2372 9.291664 GCTAGTAGTGATTAATCGATTGGATAC 57.708 37.037 20.87 13.53 34.08 2.24
1396 2389 5.538118 TGGATACATACATGGCTTCTAACG 58.462 41.667 0.00 0.00 46.17 3.18
1408 2401 5.116180 TGGCTTCTAACGATCTGGTTAATG 58.884 41.667 0.00 0.00 32.39 1.90
1409 2402 5.116882 GGCTTCTAACGATCTGGTTAATGT 58.883 41.667 0.00 0.00 32.39 2.71
1410 2403 6.127281 TGGCTTCTAACGATCTGGTTAATGTA 60.127 38.462 0.00 0.00 32.39 2.29
1411 2404 6.200475 GGCTTCTAACGATCTGGTTAATGTAC 59.800 42.308 0.00 0.00 32.39 2.90
1412 2405 6.755141 GCTTCTAACGATCTGGTTAATGTACA 59.245 38.462 0.00 0.00 32.39 2.90
1414 2407 9.961265 CTTCTAACGATCTGGTTAATGTACATA 57.039 33.333 9.21 0.00 32.39 2.29
1443 2442 1.275291 TGTTAGAGTTTCGGGCTCCAG 59.725 52.381 0.00 0.00 33.69 3.86
1449 2448 3.716539 TTTCGGGCTCCAGCGATCG 62.717 63.158 11.69 11.69 43.26 3.69
1451 2450 4.637489 CGGGCTCCAGCGATCGAG 62.637 72.222 21.57 10.27 43.26 4.04
1471 2470 0.964860 TGGCGCCAAATGCTACATGT 60.965 50.000 30.74 2.69 38.05 3.21
1473 2472 1.403679 GGCGCCAAATGCTACATGTTA 59.596 47.619 24.80 0.00 38.05 2.41
1476 2475 3.003689 GCGCCAAATGCTACATGTTATCT 59.996 43.478 2.30 0.00 38.05 1.98
1478 2477 4.035558 CGCCAAATGCTACATGTTATCTGT 59.964 41.667 2.30 0.00 38.05 3.41
1479 2478 5.276270 GCCAAATGCTACATGTTATCTGTG 58.724 41.667 2.30 0.00 36.87 3.66
1482 2481 6.238566 CCAAATGCTACATGTTATCTGTGAGG 60.239 42.308 2.30 0.00 0.00 3.86
1486 2485 4.342378 GCTACATGTTATCTGTGAGGGAGA 59.658 45.833 2.30 0.00 0.00 3.71
1509 2508 3.764434 TGGCAATCGCTTGGGTTAAAATA 59.236 39.130 0.60 0.00 38.60 1.40
1532 2531 5.445964 AGATCTTTACTGGAGAGAGAGGTC 58.554 45.833 0.00 0.00 0.00 3.85
1539 2538 1.303615 GAGAGAGAGGTCGGACCCA 59.696 63.158 23.21 0.00 39.75 4.51
1545 2544 1.038130 AGAGGTCGGACCCAGATTCG 61.038 60.000 23.21 0.00 39.75 3.34
1555 2554 3.134081 GGACCCAGATTCGAGGTAATTCA 59.866 47.826 1.20 0.00 32.81 2.57
1556 2555 4.202367 GGACCCAGATTCGAGGTAATTCAT 60.202 45.833 1.20 0.00 32.81 2.57
1558 2557 5.368989 ACCCAGATTCGAGGTAATTCATTC 58.631 41.667 0.00 0.00 30.13 2.67
1560 2559 4.757149 CCAGATTCGAGGTAATTCATTCCC 59.243 45.833 0.00 0.00 0.00 3.97
1561 2560 5.368145 CAGATTCGAGGTAATTCATTCCCA 58.632 41.667 0.00 0.00 0.00 4.37
1562 2561 6.000219 CAGATTCGAGGTAATTCATTCCCAT 59.000 40.000 0.00 0.00 0.00 4.00
1563 2562 6.000219 AGATTCGAGGTAATTCATTCCCATG 59.000 40.000 0.00 0.00 0.00 3.66
1564 2563 4.771114 TCGAGGTAATTCATTCCCATGT 57.229 40.909 0.00 0.00 0.00 3.21
1565 2564 5.880164 TCGAGGTAATTCATTCCCATGTA 57.120 39.130 0.00 0.00 0.00 2.29
1566 2565 5.607477 TCGAGGTAATTCATTCCCATGTAC 58.393 41.667 0.00 0.00 0.00 2.90
1567 2566 5.365605 TCGAGGTAATTCATTCCCATGTACT 59.634 40.000 0.00 0.00 0.00 2.73
1568 2567 6.551975 TCGAGGTAATTCATTCCCATGTACTA 59.448 38.462 0.00 0.00 0.00 1.82
1569 2568 6.868864 CGAGGTAATTCATTCCCATGTACTAG 59.131 42.308 0.00 0.00 0.00 2.57
1570 2569 7.255836 CGAGGTAATTCATTCCCATGTACTAGA 60.256 40.741 0.00 0.00 0.00 2.43
1571 2570 8.331931 AGGTAATTCATTCCCATGTACTAGAA 57.668 34.615 0.00 0.00 0.00 2.10
1572 2571 8.432805 AGGTAATTCATTCCCATGTACTAGAAG 58.567 37.037 0.00 0.00 0.00 2.85
1573 2572 8.429641 GGTAATTCATTCCCATGTACTAGAAGA 58.570 37.037 0.00 0.00 0.00 2.87
1574 2573 9.832445 GTAATTCATTCCCATGTACTAGAAGAA 57.168 33.333 0.00 0.00 0.00 2.52
1576 2575 9.927081 AATTCATTCCCATGTACTAGAAGAATT 57.073 29.630 0.00 0.00 30.32 2.17
1614 2613 8.908903 AGAAGTCTATGTACAGGAATTCTACTG 58.091 37.037 27.36 7.71 40.81 2.74
1615 2614 7.045126 AGTCTATGTACAGGAATTCTACTGC 57.955 40.000 5.23 0.00 38.25 4.40
1616 2615 6.607600 AGTCTATGTACAGGAATTCTACTGCA 59.392 38.462 5.23 0.77 38.25 4.41
1617 2616 6.697892 GTCTATGTACAGGAATTCTACTGCAC 59.302 42.308 5.23 6.75 38.25 4.57
1618 2617 4.202245 TGTACAGGAATTCTACTGCACC 57.798 45.455 5.23 0.00 38.25 5.01
1619 2618 3.580895 TGTACAGGAATTCTACTGCACCA 59.419 43.478 5.23 1.01 38.25 4.17
1620 2619 3.059352 ACAGGAATTCTACTGCACCAC 57.941 47.619 5.23 0.00 38.25 4.16
1621 2620 2.371841 ACAGGAATTCTACTGCACCACA 59.628 45.455 5.23 0.00 38.25 4.17
1622 2621 3.009473 ACAGGAATTCTACTGCACCACAT 59.991 43.478 5.23 0.00 38.25 3.21
1623 2622 4.225042 ACAGGAATTCTACTGCACCACATA 59.775 41.667 5.23 0.00 38.25 2.29
1624 2623 5.185454 CAGGAATTCTACTGCACCACATAA 58.815 41.667 5.23 0.00 0.00 1.90
1625 2624 5.647658 CAGGAATTCTACTGCACCACATAAA 59.352 40.000 5.23 0.00 0.00 1.40
1626 2625 5.648092 AGGAATTCTACTGCACCACATAAAC 59.352 40.000 5.23 0.00 0.00 2.01
1627 2626 5.414454 GGAATTCTACTGCACCACATAAACA 59.586 40.000 5.23 0.00 0.00 2.83
1628 2627 6.072175 GGAATTCTACTGCACCACATAAACAA 60.072 38.462 5.23 0.00 0.00 2.83
1629 2628 5.940192 TTCTACTGCACCACATAAACAAG 57.060 39.130 0.00 0.00 0.00 3.16
1630 2629 4.323417 TCTACTGCACCACATAAACAAGG 58.677 43.478 0.00 0.00 0.00 3.61
1631 2630 1.613437 ACTGCACCACATAAACAAGGC 59.387 47.619 0.00 0.00 0.00 4.35
1632 2631 1.888512 CTGCACCACATAAACAAGGCT 59.111 47.619 0.00 0.00 0.00 4.58
1633 2632 3.081061 CTGCACCACATAAACAAGGCTA 58.919 45.455 0.00 0.00 0.00 3.93
1634 2633 3.696045 TGCACCACATAAACAAGGCTAT 58.304 40.909 0.00 0.00 0.00 2.97
1635 2634 4.849518 TGCACCACATAAACAAGGCTATA 58.150 39.130 0.00 0.00 0.00 1.31
1636 2635 5.445069 TGCACCACATAAACAAGGCTATAT 58.555 37.500 0.00 0.00 0.00 0.86
1637 2636 6.596621 TGCACCACATAAACAAGGCTATATA 58.403 36.000 0.00 0.00 0.00 0.86
1638 2637 7.230747 TGCACCACATAAACAAGGCTATATAT 58.769 34.615 0.00 0.00 0.00 0.86
1639 2638 8.379331 TGCACCACATAAACAAGGCTATATATA 58.621 33.333 0.00 0.00 0.00 0.86
1640 2639 9.226606 GCACCACATAAACAAGGCTATATATAA 57.773 33.333 0.00 0.00 0.00 0.98
1667 2666 8.773404 ACTACTCTAGATTTTTGTTATTGCGT 57.227 30.769 0.00 0.00 0.00 5.24
1668 2667 8.870879 ACTACTCTAGATTTTTGTTATTGCGTC 58.129 33.333 0.00 0.00 0.00 5.19
1669 2668 7.667043 ACTCTAGATTTTTGTTATTGCGTCA 57.333 32.000 0.00 0.00 0.00 4.35
1670 2669 7.743104 ACTCTAGATTTTTGTTATTGCGTCAG 58.257 34.615 0.00 0.00 0.00 3.51
1671 2670 7.387948 ACTCTAGATTTTTGTTATTGCGTCAGT 59.612 33.333 0.00 0.00 0.00 3.41
1672 2671 7.739295 TCTAGATTTTTGTTATTGCGTCAGTC 58.261 34.615 0.00 0.00 0.00 3.51
1673 2672 6.312399 AGATTTTTGTTATTGCGTCAGTCA 57.688 33.333 0.00 0.00 0.00 3.41
1674 2673 6.142817 AGATTTTTGTTATTGCGTCAGTCAC 58.857 36.000 0.00 0.00 0.00 3.67
1675 2674 5.493133 TTTTTGTTATTGCGTCAGTCACT 57.507 34.783 0.00 0.00 0.00 3.41
1676 2675 5.493133 TTTTGTTATTGCGTCAGTCACTT 57.507 34.783 0.00 0.00 0.00 3.16
1677 2676 4.725556 TTGTTATTGCGTCAGTCACTTC 57.274 40.909 0.00 0.00 0.00 3.01
1678 2677 3.064207 TGTTATTGCGTCAGTCACTTCC 58.936 45.455 0.00 0.00 0.00 3.46
1679 2678 3.244078 TGTTATTGCGTCAGTCACTTCCT 60.244 43.478 0.00 0.00 0.00 3.36
1680 2679 2.550830 ATTGCGTCAGTCACTTCCTT 57.449 45.000 0.00 0.00 0.00 3.36
1681 2680 1.865865 TTGCGTCAGTCACTTCCTTC 58.134 50.000 0.00 0.00 0.00 3.46
1682 2681 0.033504 TGCGTCAGTCACTTCCTTCC 59.966 55.000 0.00 0.00 0.00 3.46
1683 2682 0.318762 GCGTCAGTCACTTCCTTCCT 59.681 55.000 0.00 0.00 0.00 3.36
1684 2683 1.270358 GCGTCAGTCACTTCCTTCCTT 60.270 52.381 0.00 0.00 0.00 3.36
1685 2684 2.678324 CGTCAGTCACTTCCTTCCTTC 58.322 52.381 0.00 0.00 0.00 3.46
1686 2685 2.297597 CGTCAGTCACTTCCTTCCTTCT 59.702 50.000 0.00 0.00 0.00 2.85
1687 2686 3.243907 CGTCAGTCACTTCCTTCCTTCTT 60.244 47.826 0.00 0.00 0.00 2.52
1688 2687 4.311606 GTCAGTCACTTCCTTCCTTCTTC 58.688 47.826 0.00 0.00 0.00 2.87
1689 2688 3.325135 TCAGTCACTTCCTTCCTTCTTCC 59.675 47.826 0.00 0.00 0.00 3.46
1690 2689 2.640332 AGTCACTTCCTTCCTTCTTCCC 59.360 50.000 0.00 0.00 0.00 3.97
1691 2690 2.372172 GTCACTTCCTTCCTTCTTCCCA 59.628 50.000 0.00 0.00 0.00 4.37
1692 2691 3.053077 TCACTTCCTTCCTTCTTCCCAA 58.947 45.455 0.00 0.00 0.00 4.12
1693 2692 3.149981 CACTTCCTTCCTTCTTCCCAAC 58.850 50.000 0.00 0.00 0.00 3.77
1694 2693 2.108425 ACTTCCTTCCTTCTTCCCAACC 59.892 50.000 0.00 0.00 0.00 3.77
1695 2694 2.133858 TCCTTCCTTCTTCCCAACCT 57.866 50.000 0.00 0.00 0.00 3.50
1696 2695 2.428901 TCCTTCCTTCTTCCCAACCTT 58.571 47.619 0.00 0.00 0.00 3.50
1697 2696 2.108250 TCCTTCCTTCTTCCCAACCTTG 59.892 50.000 0.00 0.00 0.00 3.61
1698 2697 1.889170 CTTCCTTCTTCCCAACCTTGC 59.111 52.381 0.00 0.00 0.00 4.01
1699 2698 1.149101 TCCTTCTTCCCAACCTTGCT 58.851 50.000 0.00 0.00 0.00 3.91
1700 2699 1.202927 TCCTTCTTCCCAACCTTGCTG 60.203 52.381 0.00 0.00 0.00 4.41
1701 2700 1.251251 CTTCTTCCCAACCTTGCTGG 58.749 55.000 0.00 0.00 42.93 4.85
1702 2701 0.850100 TTCTTCCCAACCTTGCTGGA 59.150 50.000 3.40 0.00 39.71 3.86
1703 2702 0.401738 TCTTCCCAACCTTGCTGGAG 59.598 55.000 3.40 0.00 39.71 3.86
1704 2703 0.401738 CTTCCCAACCTTGCTGGAGA 59.598 55.000 3.40 0.00 39.71 3.71
1705 2704 0.850100 TTCCCAACCTTGCTGGAGAA 59.150 50.000 3.40 0.00 39.71 2.87
1706 2705 0.401738 TCCCAACCTTGCTGGAGAAG 59.598 55.000 3.40 0.00 39.71 2.85
1707 2706 0.401738 CCCAACCTTGCTGGAGAAGA 59.598 55.000 3.40 0.00 39.71 2.87
1708 2707 1.202927 CCCAACCTTGCTGGAGAAGAA 60.203 52.381 3.40 0.00 39.71 2.52
1709 2708 2.556114 CCCAACCTTGCTGGAGAAGAAT 60.556 50.000 3.40 0.00 39.71 2.40
1710 2709 2.751806 CCAACCTTGCTGGAGAAGAATC 59.248 50.000 3.40 0.00 39.71 2.52
1711 2710 3.415212 CAACCTTGCTGGAGAAGAATCA 58.585 45.455 3.40 0.00 39.71 2.57
1712 2711 3.347077 ACCTTGCTGGAGAAGAATCAG 57.653 47.619 3.40 0.00 39.71 2.90
1715 2714 3.092851 GCTGGAGAAGAATCAGCCC 57.907 57.895 0.00 0.00 45.67 5.19
1716 2715 0.465278 GCTGGAGAAGAATCAGCCCC 60.465 60.000 0.00 0.00 45.67 5.80
1717 2716 0.914644 CTGGAGAAGAATCAGCCCCA 59.085 55.000 0.00 0.00 0.00 4.96
1718 2717 0.620556 TGGAGAAGAATCAGCCCCAC 59.379 55.000 0.00 0.00 0.00 4.61
1719 2718 0.915364 GGAGAAGAATCAGCCCCACT 59.085 55.000 0.00 0.00 0.00 4.00
1720 2719 2.119495 GGAGAAGAATCAGCCCCACTA 58.881 52.381 0.00 0.00 0.00 2.74
1721 2720 2.708325 GGAGAAGAATCAGCCCCACTAT 59.292 50.000 0.00 0.00 0.00 2.12
1722 2721 3.244387 GGAGAAGAATCAGCCCCACTATC 60.244 52.174 0.00 0.00 0.00 2.08
1723 2722 3.645687 GAGAAGAATCAGCCCCACTATCT 59.354 47.826 0.00 0.00 0.00 1.98
1724 2723 4.820775 AGAAGAATCAGCCCCACTATCTA 58.179 43.478 0.00 0.00 0.00 1.98
1725 2724 5.410602 AGAAGAATCAGCCCCACTATCTAT 58.589 41.667 0.00 0.00 0.00 1.98
1726 2725 5.248020 AGAAGAATCAGCCCCACTATCTATG 59.752 44.000 0.00 0.00 0.00 2.23
1727 2726 3.262915 AGAATCAGCCCCACTATCTATGC 59.737 47.826 0.00 0.00 0.00 3.14
1728 2727 2.405618 TCAGCCCCACTATCTATGCT 57.594 50.000 0.00 0.00 0.00 3.79
1729 2728 3.542969 TCAGCCCCACTATCTATGCTA 57.457 47.619 0.00 0.00 0.00 3.49
1730 2729 3.435275 TCAGCCCCACTATCTATGCTAG 58.565 50.000 0.00 0.00 0.00 3.42
1731 2730 2.499289 CAGCCCCACTATCTATGCTAGG 59.501 54.545 0.00 0.00 0.00 3.02
1732 2731 1.834263 GCCCCACTATCTATGCTAGGG 59.166 57.143 0.00 0.00 36.32 3.53
1733 2732 2.559931 GCCCCACTATCTATGCTAGGGA 60.560 54.545 0.00 0.00 36.96 4.20
1734 2733 3.791320 CCCCACTATCTATGCTAGGGAA 58.209 50.000 0.00 0.00 36.96 3.97
1735 2734 4.168101 CCCCACTATCTATGCTAGGGAAA 58.832 47.826 0.00 0.00 36.96 3.13
1736 2735 4.597507 CCCCACTATCTATGCTAGGGAAAA 59.402 45.833 0.00 0.00 36.96 2.29
1737 2736 5.280215 CCCCACTATCTATGCTAGGGAAAAG 60.280 48.000 0.00 0.00 36.96 2.27
1738 2737 5.308237 CCCACTATCTATGCTAGGGAAAAGT 59.692 44.000 0.00 0.00 36.96 2.66
1739 2738 6.459923 CCACTATCTATGCTAGGGAAAAGTC 58.540 44.000 0.00 0.00 0.00 3.01
1740 2739 6.042093 CCACTATCTATGCTAGGGAAAAGTCA 59.958 42.308 0.00 0.00 0.00 3.41
1741 2740 7.256475 CCACTATCTATGCTAGGGAAAAGTCAT 60.256 40.741 0.00 0.00 0.00 3.06
1742 2741 8.807118 CACTATCTATGCTAGGGAAAAGTCATA 58.193 37.037 0.00 0.00 0.00 2.15
1743 2742 9.030452 ACTATCTATGCTAGGGAAAAGTCATAG 57.970 37.037 0.00 0.00 35.13 2.23
1744 2743 7.863901 ATCTATGCTAGGGAAAAGTCATAGT 57.136 36.000 0.00 0.00 35.24 2.12
1745 2744 7.291411 TCTATGCTAGGGAAAAGTCATAGTC 57.709 40.000 0.00 0.00 35.24 2.59
1746 2745 7.069986 TCTATGCTAGGGAAAAGTCATAGTCT 58.930 38.462 0.00 0.00 35.24 3.24
1747 2746 5.599999 TGCTAGGGAAAAGTCATAGTCTC 57.400 43.478 0.00 0.00 0.00 3.36
1748 2747 5.023452 TGCTAGGGAAAAGTCATAGTCTCA 58.977 41.667 0.00 0.00 0.00 3.27
1749 2748 5.663106 TGCTAGGGAAAAGTCATAGTCTCAT 59.337 40.000 0.00 0.00 0.00 2.90
1750 2749 6.183360 TGCTAGGGAAAAGTCATAGTCTCATC 60.183 42.308 0.00 0.00 0.00 2.92
1751 2750 6.183360 GCTAGGGAAAAGTCATAGTCTCATCA 60.183 42.308 0.00 0.00 0.00 3.07
1752 2751 6.821616 AGGGAAAAGTCATAGTCTCATCAT 57.178 37.500 0.00 0.00 0.00 2.45
1753 2752 6.825610 AGGGAAAAGTCATAGTCTCATCATC 58.174 40.000 0.00 0.00 0.00 2.92
1754 2753 6.614906 AGGGAAAAGTCATAGTCTCATCATCT 59.385 38.462 0.00 0.00 0.00 2.90
1755 2754 7.786943 AGGGAAAAGTCATAGTCTCATCATCTA 59.213 37.037 0.00 0.00 0.00 1.98
1756 2755 8.592809 GGGAAAAGTCATAGTCTCATCATCTAT 58.407 37.037 0.00 0.00 0.00 1.98
1757 2756 9.638239 GGAAAAGTCATAGTCTCATCATCTATC 57.362 37.037 0.00 0.00 0.00 2.08
1768 2767 8.281531 AGTCTCATCATCTATCTATCTTAGGGG 58.718 40.741 0.00 0.00 0.00 4.79
1769 2768 8.278639 GTCTCATCATCTATCTATCTTAGGGGA 58.721 40.741 0.00 0.00 0.00 4.81
1770 2769 8.850860 TCTCATCATCTATCTATCTTAGGGGAA 58.149 37.037 0.00 0.00 0.00 3.97
1771 2770 9.486123 CTCATCATCTATCTATCTTAGGGGAAA 57.514 37.037 0.00 0.00 0.00 3.13
1772 2771 9.486123 TCATCATCTATCTATCTTAGGGGAAAG 57.514 37.037 0.00 0.00 0.00 2.62
1773 2772 7.726033 TCATCTATCTATCTTAGGGGAAAGC 57.274 40.000 0.00 0.00 0.00 3.51
1774 2773 7.483018 TCATCTATCTATCTTAGGGGAAAGCT 58.517 38.462 0.00 0.00 0.00 3.74
1775 2774 8.624670 TCATCTATCTATCTTAGGGGAAAGCTA 58.375 37.037 0.00 0.00 0.00 3.32
1776 2775 9.261035 CATCTATCTATCTTAGGGGAAAGCTAA 57.739 37.037 0.00 0.00 0.00 3.09
1777 2776 8.887264 TCTATCTATCTTAGGGGAAAGCTAAG 57.113 38.462 0.00 0.00 33.38 2.18
1778 2777 8.457757 TCTATCTATCTTAGGGGAAAGCTAAGT 58.542 37.037 0.00 0.00 33.70 2.24
1779 2778 6.980416 TCTATCTTAGGGGAAAGCTAAGTC 57.020 41.667 0.00 0.00 33.70 3.01
1780 2779 6.441222 TCTATCTTAGGGGAAAGCTAAGTCA 58.559 40.000 0.00 0.00 33.70 3.41
1781 2780 4.820894 TCTTAGGGGAAAGCTAAGTCAC 57.179 45.455 0.00 0.00 33.70 3.67
1782 2781 4.164981 TCTTAGGGGAAAGCTAAGTCACA 58.835 43.478 0.00 0.00 33.70 3.58
1783 2782 4.595781 TCTTAGGGGAAAGCTAAGTCACAA 59.404 41.667 0.00 0.00 33.70 3.33
1784 2783 3.141767 AGGGGAAAGCTAAGTCACAAC 57.858 47.619 0.00 0.00 0.00 3.32
1785 2784 2.160205 GGGGAAAGCTAAGTCACAACC 58.840 52.381 0.00 0.00 0.00 3.77
1786 2785 2.160205 GGGAAAGCTAAGTCACAACCC 58.840 52.381 0.00 0.00 0.00 4.11
1787 2786 2.160205 GGAAAGCTAAGTCACAACCCC 58.840 52.381 0.00 0.00 0.00 4.95
1788 2787 2.488347 GGAAAGCTAAGTCACAACCCCA 60.488 50.000 0.00 0.00 0.00 4.96
1789 2788 3.421844 GAAAGCTAAGTCACAACCCCAT 58.578 45.455 0.00 0.00 0.00 4.00
1790 2789 3.525800 AAGCTAAGTCACAACCCCATT 57.474 42.857 0.00 0.00 0.00 3.16
1791 2790 4.650972 AAGCTAAGTCACAACCCCATTA 57.349 40.909 0.00 0.00 0.00 1.90
1792 2791 4.862641 AGCTAAGTCACAACCCCATTAT 57.137 40.909 0.00 0.00 0.00 1.28
1793 2792 4.781934 AGCTAAGTCACAACCCCATTATC 58.218 43.478 0.00 0.00 0.00 1.75
1794 2793 3.883489 GCTAAGTCACAACCCCATTATCC 59.117 47.826 0.00 0.00 0.00 2.59
1795 2794 4.627741 GCTAAGTCACAACCCCATTATCCA 60.628 45.833 0.00 0.00 0.00 3.41
1796 2795 4.608170 AAGTCACAACCCCATTATCCAT 57.392 40.909 0.00 0.00 0.00 3.41
1797 2796 4.170468 AGTCACAACCCCATTATCCATC 57.830 45.455 0.00 0.00 0.00 3.51
1798 2797 3.788142 AGTCACAACCCCATTATCCATCT 59.212 43.478 0.00 0.00 0.00 2.90
1799 2798 4.230502 AGTCACAACCCCATTATCCATCTT 59.769 41.667 0.00 0.00 0.00 2.40
1800 2799 5.431731 AGTCACAACCCCATTATCCATCTTA 59.568 40.000 0.00 0.00 0.00 2.10
1801 2800 5.765182 GTCACAACCCCATTATCCATCTTAG 59.235 44.000 0.00 0.00 0.00 2.18
1802 2801 5.072741 CACAACCCCATTATCCATCTTAGG 58.927 45.833 0.00 0.00 0.00 2.69
1803 2802 4.106341 ACAACCCCATTATCCATCTTAGGG 59.894 45.833 0.00 0.00 39.33 3.53
1807 2806 4.666512 CCCATTATCCATCTTAGGGGTTG 58.333 47.826 0.00 0.00 0.00 3.77
1808 2807 4.106341 CCCATTATCCATCTTAGGGGTTGT 59.894 45.833 0.00 0.00 0.00 3.32
1809 2808 5.072741 CCATTATCCATCTTAGGGGTTGTG 58.927 45.833 0.00 0.00 0.00 3.33
1810 2809 4.788925 TTATCCATCTTAGGGGTTGTGG 57.211 45.455 0.00 0.00 0.00 4.17
1811 2810 1.295020 TCCATCTTAGGGGTTGTGGG 58.705 55.000 0.00 0.00 0.00 4.61
1812 2811 0.258774 CCATCTTAGGGGTTGTGGGG 59.741 60.000 0.00 0.00 0.00 4.96
1813 2812 0.999712 CATCTTAGGGGTTGTGGGGT 59.000 55.000 0.00 0.00 0.00 4.95
1814 2813 0.999712 ATCTTAGGGGTTGTGGGGTG 59.000 55.000 0.00 0.00 0.00 4.61
1815 2814 1.137594 TCTTAGGGGTTGTGGGGTGG 61.138 60.000 0.00 0.00 0.00 4.61
1816 2815 2.150014 CTTAGGGGTTGTGGGGTGGG 62.150 65.000 0.00 0.00 0.00 4.61
1832 2831 3.958860 GGGGGATGCAGGGGATCG 61.959 72.222 0.00 0.00 0.00 3.69
1833 2832 4.650377 GGGGATGCAGGGGATCGC 62.650 72.222 0.06 0.06 33.20 4.58
1834 2833 4.650377 GGGATGCAGGGGATCGCC 62.650 72.222 20.86 20.86 0.00 5.54
1835 2834 4.996434 GGATGCAGGGGATCGCCG 62.996 72.222 21.98 17.34 33.83 6.46
1836 2835 4.996434 GATGCAGGGGATCGCCGG 62.996 72.222 22.11 22.11 33.83 6.13
1840 2839 2.919856 CAGGGGATCGCCGGAGAT 60.920 66.667 21.54 21.54 33.83 2.75
1841 2840 2.122813 AGGGGATCGCCGGAGATT 60.123 61.111 22.26 2.99 33.83 2.40
1842 2841 2.210711 AGGGGATCGCCGGAGATTC 61.211 63.158 22.26 19.93 33.83 2.52
1843 2842 2.210711 GGGGATCGCCGGAGATTCT 61.211 63.158 23.85 2.70 33.83 2.40
1844 2843 1.290639 GGGATCGCCGGAGATTCTC 59.709 63.158 23.85 12.04 33.83 2.87
1845 2844 1.464376 GGGATCGCCGGAGATTCTCA 61.464 60.000 23.85 0.00 33.83 3.27
1846 2845 0.319125 GGATCGCCGGAGATTCTCAC 60.319 60.000 22.26 8.62 31.08 3.51
1847 2846 0.319125 GATCGCCGGAGATTCTCACC 60.319 60.000 22.26 4.35 31.08 4.02
1851 2850 4.814900 CGGAGATTCTCACCGGTG 57.185 61.111 29.26 29.26 44.94 4.94
1852 2851 1.141881 CGGAGATTCTCACCGGTGG 59.858 63.158 33.40 23.32 44.94 4.61
1853 2852 1.605058 CGGAGATTCTCACCGGTGGT 61.605 60.000 33.40 17.38 44.94 4.16
1862 2861 3.168528 ACCGGTGGTGCAGGACTT 61.169 61.111 6.12 0.00 36.26 3.01
1863 2862 2.113139 CCGGTGGTGCAGGACTTT 59.887 61.111 0.00 0.00 34.10 2.66
1864 2863 2.260869 CCGGTGGTGCAGGACTTTG 61.261 63.158 0.00 0.00 34.10 2.77
1865 2864 1.227823 CGGTGGTGCAGGACTTTGA 60.228 57.895 0.00 0.00 0.00 2.69
1866 2865 1.230635 CGGTGGTGCAGGACTTTGAG 61.231 60.000 0.00 0.00 0.00 3.02
1867 2866 0.890996 GGTGGTGCAGGACTTTGAGG 60.891 60.000 0.00 0.00 0.00 3.86
1868 2867 0.890996 GTGGTGCAGGACTTTGAGGG 60.891 60.000 0.00 0.00 0.00 4.30
1869 2868 1.059584 TGGTGCAGGACTTTGAGGGA 61.060 55.000 0.00 0.00 0.00 4.20
1870 2869 0.329596 GGTGCAGGACTTTGAGGGAT 59.670 55.000 0.00 0.00 0.00 3.85
1871 2870 1.457346 GTGCAGGACTTTGAGGGATG 58.543 55.000 0.00 0.00 0.00 3.51
1872 2871 0.329261 TGCAGGACTTTGAGGGATGG 59.671 55.000 0.00 0.00 0.00 3.51
1873 2872 1.034292 GCAGGACTTTGAGGGATGGC 61.034 60.000 0.00 0.00 0.00 4.40
1874 2873 0.622665 CAGGACTTTGAGGGATGGCT 59.377 55.000 0.00 0.00 0.00 4.75
1875 2874 0.622665 AGGACTTTGAGGGATGGCTG 59.377 55.000 0.00 0.00 0.00 4.85
1876 2875 0.394899 GGACTTTGAGGGATGGCTGG 60.395 60.000 0.00 0.00 0.00 4.85
1877 2876 0.394899 GACTTTGAGGGATGGCTGGG 60.395 60.000 0.00 0.00 0.00 4.45
1878 2877 1.076485 CTTTGAGGGATGGCTGGGG 60.076 63.158 0.00 0.00 0.00 4.96
1879 2878 3.301222 TTTGAGGGATGGCTGGGGC 62.301 63.158 0.00 0.00 37.82 5.80
1906 2905 3.361977 CAACGGCGGTGGGGAAAG 61.362 66.667 19.01 0.00 0.00 2.62
1907 2906 4.653888 AACGGCGGTGGGGAAAGG 62.654 66.667 13.24 0.00 0.00 3.11
1909 2908 4.653888 CGGCGGTGGGGAAAGGTT 62.654 66.667 0.00 0.00 0.00 3.50
1910 2909 2.989253 GGCGGTGGGGAAAGGTTG 60.989 66.667 0.00 0.00 0.00 3.77
1911 2910 2.114411 GCGGTGGGGAAAGGTTGA 59.886 61.111 0.00 0.00 0.00 3.18
1912 2911 1.971695 GCGGTGGGGAAAGGTTGAG 60.972 63.158 0.00 0.00 0.00 3.02
1913 2912 1.303317 CGGTGGGGAAAGGTTGAGG 60.303 63.158 0.00 0.00 0.00 3.86
1914 2913 1.076727 GGTGGGGAAAGGTTGAGGG 59.923 63.158 0.00 0.00 0.00 4.30
1915 2914 1.432023 GGTGGGGAAAGGTTGAGGGA 61.432 60.000 0.00 0.00 0.00 4.20
1916 2915 0.481128 GTGGGGAAAGGTTGAGGGAA 59.519 55.000 0.00 0.00 0.00 3.97
1917 2916 1.133294 GTGGGGAAAGGTTGAGGGAAA 60.133 52.381 0.00 0.00 0.00 3.13
1918 2917 1.146982 TGGGGAAAGGTTGAGGGAAAG 59.853 52.381 0.00 0.00 0.00 2.62
1919 2918 1.550179 GGGGAAAGGTTGAGGGAAAGG 60.550 57.143 0.00 0.00 0.00 3.11
1920 2919 1.257743 GGAAAGGTTGAGGGAAAGGC 58.742 55.000 0.00 0.00 0.00 4.35
1921 2920 0.881796 GAAAGGTTGAGGGAAAGGCG 59.118 55.000 0.00 0.00 0.00 5.52
1922 2921 0.539669 AAAGGTTGAGGGAAAGGCGG 60.540 55.000 0.00 0.00 0.00 6.13
1923 2922 2.361230 GGTTGAGGGAAAGGCGGG 60.361 66.667 0.00 0.00 0.00 6.13
1924 2923 2.361230 GTTGAGGGAAAGGCGGGG 60.361 66.667 0.00 0.00 0.00 5.73
1925 2924 4.360405 TTGAGGGAAAGGCGGGGC 62.360 66.667 0.00 0.00 0.00 5.80
1927 2926 4.803908 GAGGGAAAGGCGGGGCAG 62.804 72.222 0.00 0.00 0.00 4.85
1979 2978 2.687566 GGGTGGGGACAGACGGAT 60.688 66.667 0.00 0.00 44.46 4.18
1980 2979 2.584608 GGTGGGGACAGACGGATG 59.415 66.667 0.00 0.00 44.46 3.51
1981 2980 2.584608 GTGGGGACAGACGGATGG 59.415 66.667 0.00 0.00 44.46 3.51
1982 2981 2.687200 TGGGGACAGACGGATGGG 60.687 66.667 0.00 0.00 35.01 4.00
1983 2982 3.480133 GGGGACAGACGGATGGGG 61.480 72.222 0.00 0.00 0.00 4.96
1984 2983 4.176752 GGGACAGACGGATGGGGC 62.177 72.222 0.00 0.00 0.00 5.80
1985 2984 4.530857 GGACAGACGGATGGGGCG 62.531 72.222 0.00 0.00 0.00 6.13
1986 2985 4.530857 GACAGACGGATGGGGCGG 62.531 72.222 0.00 0.00 0.00 6.13
2009 3008 3.972276 GCCGGCGGTTGCAGAAAA 61.972 61.111 28.82 0.00 45.35 2.29
2010 3009 2.725008 CCGGCGGTTGCAGAAAAA 59.275 55.556 19.97 0.00 45.35 1.94
2011 3010 1.371635 CCGGCGGTTGCAGAAAAAG 60.372 57.895 19.97 0.00 45.35 2.27
2012 3011 1.371635 CGGCGGTTGCAGAAAAAGG 60.372 57.895 0.00 0.00 45.35 3.11
2013 3012 1.791103 CGGCGGTTGCAGAAAAAGGA 61.791 55.000 0.00 0.00 45.35 3.36
2014 3013 0.603065 GGCGGTTGCAGAAAAAGGAT 59.397 50.000 0.00 0.00 45.35 3.24
2015 3014 1.669795 GGCGGTTGCAGAAAAAGGATG 60.670 52.381 0.00 0.00 45.35 3.51
2016 3015 1.669795 GCGGTTGCAGAAAAAGGATGG 60.670 52.381 0.00 0.00 42.15 3.51
2017 3016 1.885887 CGGTTGCAGAAAAAGGATGGA 59.114 47.619 0.00 0.00 0.00 3.41
2018 3017 2.493278 CGGTTGCAGAAAAAGGATGGAT 59.507 45.455 0.00 0.00 0.00 3.41
2019 3018 3.428045 CGGTTGCAGAAAAAGGATGGATC 60.428 47.826 0.00 0.00 0.00 3.36
2020 3019 3.428045 GGTTGCAGAAAAAGGATGGATCG 60.428 47.826 0.00 0.00 0.00 3.69
2021 3020 2.368439 TGCAGAAAAAGGATGGATCGG 58.632 47.619 0.00 0.00 0.00 4.18
2022 3021 2.026356 TGCAGAAAAAGGATGGATCGGA 60.026 45.455 0.00 0.00 0.00 4.55
2023 3022 3.217626 GCAGAAAAAGGATGGATCGGAT 58.782 45.455 0.00 0.00 0.00 4.18
2024 3023 3.251972 GCAGAAAAAGGATGGATCGGATC 59.748 47.826 9.54 9.54 0.00 3.36
2025 3024 3.496130 CAGAAAAAGGATGGATCGGATCG 59.504 47.826 11.62 0.00 0.00 3.69
2026 3025 3.134804 AGAAAAAGGATGGATCGGATCGT 59.865 43.478 11.62 3.31 0.00 3.73
2027 3026 2.533266 AAAGGATGGATCGGATCGTG 57.467 50.000 11.62 0.00 0.00 4.35
2028 3027 0.681733 AAGGATGGATCGGATCGTGG 59.318 55.000 11.62 0.00 0.00 4.94
2029 3028 1.374758 GGATGGATCGGATCGTGGC 60.375 63.158 11.62 0.00 0.00 5.01
2030 3029 1.668294 GATGGATCGGATCGTGGCT 59.332 57.895 11.62 0.00 0.00 4.75
2031 3030 0.034059 GATGGATCGGATCGTGGCTT 59.966 55.000 11.62 0.00 0.00 4.35
2032 3031 0.250038 ATGGATCGGATCGTGGCTTG 60.250 55.000 11.62 0.00 0.00 4.01
2033 3032 1.326951 TGGATCGGATCGTGGCTTGA 61.327 55.000 11.62 0.00 0.00 3.02
2034 3033 0.598680 GGATCGGATCGTGGCTTGAG 60.599 60.000 11.62 0.00 0.00 3.02
2035 3034 0.598680 GATCGGATCGTGGCTTGAGG 60.599 60.000 1.62 0.00 0.00 3.86
2036 3035 1.043116 ATCGGATCGTGGCTTGAGGA 61.043 55.000 0.00 0.00 0.00 3.71
2037 3036 1.227089 CGGATCGTGGCTTGAGGAG 60.227 63.158 0.00 0.00 0.00 3.69
2038 3037 1.144936 GGATCGTGGCTTGAGGAGG 59.855 63.158 0.00 0.00 0.00 4.30
2039 3038 1.330655 GGATCGTGGCTTGAGGAGGA 61.331 60.000 0.00 0.00 0.00 3.71
2040 3039 0.537188 GATCGTGGCTTGAGGAGGAA 59.463 55.000 0.00 0.00 0.00 3.36
2041 3040 0.539051 ATCGTGGCTTGAGGAGGAAG 59.461 55.000 0.00 0.00 0.00 3.46
2042 3041 0.541998 TCGTGGCTTGAGGAGGAAGA 60.542 55.000 0.00 0.00 0.00 2.87
2043 3042 0.390472 CGTGGCTTGAGGAGGAAGAC 60.390 60.000 0.00 0.00 0.00 3.01
2044 3043 0.390472 GTGGCTTGAGGAGGAAGACG 60.390 60.000 0.00 0.00 30.20 4.18
2045 3044 1.219393 GGCTTGAGGAGGAAGACGG 59.781 63.158 0.00 0.00 0.00 4.79
2046 3045 1.545706 GGCTTGAGGAGGAAGACGGT 61.546 60.000 0.00 0.00 0.00 4.83
2047 3046 0.321996 GCTTGAGGAGGAAGACGGTT 59.678 55.000 0.00 0.00 0.00 4.44
2048 3047 1.941668 GCTTGAGGAGGAAGACGGTTG 60.942 57.143 0.00 0.00 0.00 3.77
2049 3048 0.685097 TTGAGGAGGAAGACGGTTGG 59.315 55.000 0.00 0.00 0.00 3.77
2050 3049 1.192146 TGAGGAGGAAGACGGTTGGG 61.192 60.000 0.00 0.00 0.00 4.12
2051 3050 0.903454 GAGGAGGAAGACGGTTGGGA 60.903 60.000 0.00 0.00 0.00 4.37
2052 3051 0.905337 AGGAGGAAGACGGTTGGGAG 60.905 60.000 0.00 0.00 0.00 4.30
2053 3052 1.597461 GAGGAAGACGGTTGGGAGG 59.403 63.158 0.00 0.00 0.00 4.30
2054 3053 0.903454 GAGGAAGACGGTTGGGAGGA 60.903 60.000 0.00 0.00 0.00 3.71
2055 3054 0.473117 AGGAAGACGGTTGGGAGGAA 60.473 55.000 0.00 0.00 0.00 3.36
2056 3055 0.036294 GGAAGACGGTTGGGAGGAAG 60.036 60.000 0.00 0.00 0.00 3.46
2057 3056 0.974383 GAAGACGGTTGGGAGGAAGA 59.026 55.000 0.00 0.00 0.00 2.87
2058 3057 1.346722 GAAGACGGTTGGGAGGAAGAA 59.653 52.381 0.00 0.00 0.00 2.52
2059 3058 0.685660 AGACGGTTGGGAGGAAGAAC 59.314 55.000 0.00 0.00 0.00 3.01
2060 3059 0.669625 GACGGTTGGGAGGAAGAACG 60.670 60.000 0.00 0.00 0.00 3.95
2061 3060 1.370064 CGGTTGGGAGGAAGAACGT 59.630 57.895 0.00 0.00 0.00 3.99
2062 3061 0.949105 CGGTTGGGAGGAAGAACGTG 60.949 60.000 0.00 0.00 0.00 4.49
2063 3062 0.605589 GGTTGGGAGGAAGAACGTGG 60.606 60.000 0.00 0.00 0.00 4.94
2064 3063 1.072505 TTGGGAGGAAGAACGTGGC 59.927 57.895 0.00 0.00 0.00 5.01
2065 3064 1.701031 TTGGGAGGAAGAACGTGGCA 61.701 55.000 0.00 0.00 0.00 4.92
2066 3065 1.299976 GGGAGGAAGAACGTGGCAT 59.700 57.895 0.00 0.00 0.00 4.40
2067 3066 1.026718 GGGAGGAAGAACGTGGCATG 61.027 60.000 4.87 4.87 0.00 4.06
2068 3067 0.321653 GGAGGAAGAACGTGGCATGT 60.322 55.000 6.51 6.51 0.00 3.21
2069 3068 0.798776 GAGGAAGAACGTGGCATGTG 59.201 55.000 14.06 0.00 0.00 3.21
2070 3069 0.396435 AGGAAGAACGTGGCATGTGA 59.604 50.000 14.06 0.00 0.00 3.58
2071 3070 0.798776 GGAAGAACGTGGCATGTGAG 59.201 55.000 14.06 0.00 0.00 3.51
2072 3071 1.512926 GAAGAACGTGGCATGTGAGT 58.487 50.000 14.06 0.00 0.00 3.41
2073 3072 1.195448 GAAGAACGTGGCATGTGAGTG 59.805 52.381 14.06 0.00 0.00 3.51
2074 3073 0.603707 AGAACGTGGCATGTGAGTGG 60.604 55.000 14.06 0.00 0.00 4.00
2075 3074 0.884704 GAACGTGGCATGTGAGTGGT 60.885 55.000 14.06 0.00 0.00 4.16
2076 3075 0.465460 AACGTGGCATGTGAGTGGTT 60.465 50.000 14.06 0.00 0.00 3.67
2077 3076 0.394938 ACGTGGCATGTGAGTGGTTA 59.605 50.000 12.39 0.00 0.00 2.85
2078 3077 1.078709 CGTGGCATGTGAGTGGTTAG 58.921 55.000 0.00 0.00 0.00 2.34
2079 3078 1.337728 CGTGGCATGTGAGTGGTTAGA 60.338 52.381 0.00 0.00 0.00 2.10
2080 3079 2.677902 CGTGGCATGTGAGTGGTTAGAT 60.678 50.000 0.00 0.00 0.00 1.98
2081 3080 2.679837 GTGGCATGTGAGTGGTTAGATG 59.320 50.000 0.00 0.00 0.00 2.90
2082 3081 1.672881 GGCATGTGAGTGGTTAGATGC 59.327 52.381 0.00 0.00 41.34 3.91
2083 3082 2.358957 GCATGTGAGTGGTTAGATGCA 58.641 47.619 0.00 0.00 41.59 3.96
2084 3083 2.947652 GCATGTGAGTGGTTAGATGCAT 59.052 45.455 0.00 0.00 41.59 3.96
2085 3084 4.129380 GCATGTGAGTGGTTAGATGCATA 58.871 43.478 0.00 0.00 41.59 3.14
2086 3085 4.758674 GCATGTGAGTGGTTAGATGCATAT 59.241 41.667 0.00 0.00 41.59 1.78
2087 3086 5.106791 GCATGTGAGTGGTTAGATGCATATC 60.107 44.000 0.00 0.00 41.59 1.63
2088 3087 5.612725 TGTGAGTGGTTAGATGCATATCA 57.387 39.130 0.00 0.00 35.70 2.15
2089 3088 5.604565 TGTGAGTGGTTAGATGCATATCAG 58.395 41.667 0.00 0.00 35.70 2.90
2090 3089 5.363580 TGTGAGTGGTTAGATGCATATCAGA 59.636 40.000 0.00 0.00 35.70 3.27
2091 3090 6.042437 TGTGAGTGGTTAGATGCATATCAGAT 59.958 38.462 0.00 0.00 35.70 2.90
2092 3091 7.233348 TGTGAGTGGTTAGATGCATATCAGATA 59.767 37.037 0.00 0.00 35.70 1.98
2093 3092 7.758980 GTGAGTGGTTAGATGCATATCAGATAG 59.241 40.741 0.00 0.00 35.70 2.08
2094 3093 7.671398 TGAGTGGTTAGATGCATATCAGATAGA 59.329 37.037 0.00 0.00 35.70 1.98
2095 3094 7.835822 AGTGGTTAGATGCATATCAGATAGAC 58.164 38.462 0.00 0.00 35.70 2.59
2096 3095 7.452813 AGTGGTTAGATGCATATCAGATAGACA 59.547 37.037 0.00 0.00 35.70 3.41
2097 3096 8.090831 GTGGTTAGATGCATATCAGATAGACAA 58.909 37.037 0.00 0.00 35.70 3.18
2098 3097 8.650490 TGGTTAGATGCATATCAGATAGACAAA 58.350 33.333 0.00 0.00 35.70 2.83
2099 3098 9.494271 GGTTAGATGCATATCAGATAGACAAAA 57.506 33.333 0.00 0.00 35.70 2.44
2130 3129 8.159344 AGTTACTGATGAAACTTTTCTTCTGG 57.841 34.615 19.56 13.86 40.89 3.86
2131 3130 5.444663 ACTGATGAAACTTTTCTTCTGGC 57.555 39.130 19.56 0.00 40.89 4.85
2132 3131 4.889409 ACTGATGAAACTTTTCTTCTGGCA 59.111 37.500 19.56 0.00 40.89 4.92
2133 3132 5.186996 TGATGAAACTTTTCTTCTGGCAC 57.813 39.130 15.01 0.00 40.21 5.01
2134 3133 4.037923 TGATGAAACTTTTCTTCTGGCACC 59.962 41.667 15.01 0.00 40.21 5.01
2135 3134 3.631250 TGAAACTTTTCTTCTGGCACCT 58.369 40.909 3.48 0.00 38.02 4.00
2136 3135 3.381272 TGAAACTTTTCTTCTGGCACCTG 59.619 43.478 3.48 0.00 38.02 4.00
2137 3136 2.736670 ACTTTTCTTCTGGCACCTGT 57.263 45.000 0.00 0.00 0.00 4.00
2138 3137 2.576615 ACTTTTCTTCTGGCACCTGTC 58.423 47.619 0.00 0.00 0.00 3.51
2139 3138 2.173569 ACTTTTCTTCTGGCACCTGTCT 59.826 45.455 0.00 0.00 0.00 3.41
2140 3139 2.550830 TTTCTTCTGGCACCTGTCTC 57.449 50.000 0.00 0.00 0.00 3.36
2141 3140 0.687354 TTCTTCTGGCACCTGTCTCC 59.313 55.000 0.00 0.00 0.00 3.71
2142 3141 0.178921 TCTTCTGGCACCTGTCTCCT 60.179 55.000 0.00 0.00 0.00 3.69
2143 3142 0.689623 CTTCTGGCACCTGTCTCCTT 59.310 55.000 0.00 0.00 0.00 3.36
2144 3143 1.072965 CTTCTGGCACCTGTCTCCTTT 59.927 52.381 0.00 0.00 0.00 3.11
2145 3144 2.024176 TCTGGCACCTGTCTCCTTTA 57.976 50.000 0.00 0.00 0.00 1.85
2146 3145 2.551270 TCTGGCACCTGTCTCCTTTAT 58.449 47.619 0.00 0.00 0.00 1.40
2147 3146 3.719871 TCTGGCACCTGTCTCCTTTATA 58.280 45.455 0.00 0.00 0.00 0.98
2148 3147 3.706594 TCTGGCACCTGTCTCCTTTATAG 59.293 47.826 0.00 0.00 0.00 1.31
2149 3148 2.170607 TGGCACCTGTCTCCTTTATAGC 59.829 50.000 0.00 0.00 0.00 2.97
2150 3149 2.436173 GGCACCTGTCTCCTTTATAGCT 59.564 50.000 0.00 0.00 0.00 3.32
2151 3150 3.641906 GGCACCTGTCTCCTTTATAGCTA 59.358 47.826 0.00 0.00 0.00 3.32
2152 3151 4.262249 GGCACCTGTCTCCTTTATAGCTAG 60.262 50.000 0.00 0.00 0.00 3.42
2153 3152 4.342665 GCACCTGTCTCCTTTATAGCTAGT 59.657 45.833 0.00 0.00 0.00 2.57
2154 3153 5.535406 GCACCTGTCTCCTTTATAGCTAGTA 59.465 44.000 0.00 0.00 0.00 1.82
2155 3154 6.515365 GCACCTGTCTCCTTTATAGCTAGTAC 60.515 46.154 0.00 0.00 0.00 2.73
2156 3155 6.773685 CACCTGTCTCCTTTATAGCTAGTACT 59.226 42.308 0.00 0.00 0.00 2.73
2157 3156 7.937942 CACCTGTCTCCTTTATAGCTAGTACTA 59.062 40.741 1.89 1.89 0.00 1.82
2158 3157 8.671409 ACCTGTCTCCTTTATAGCTAGTACTAT 58.329 37.037 2.33 0.00 36.77 2.12
2159 3158 9.523168 CCTGTCTCCTTTATAGCTAGTACTATT 57.477 37.037 2.33 0.00 34.66 1.73
2178 3177 9.936759 GTACTATTATACTAGTACTTCCTCCGT 57.063 37.037 23.39 0.00 45.52 4.69
2180 3179 8.100164 ACTATTATACTAGTACTTCCTCCGTCC 58.900 40.741 4.31 0.00 30.16 4.79
2181 3180 4.785346 ATACTAGTACTTCCTCCGTCCA 57.215 45.455 4.31 0.00 0.00 4.02
2182 3181 3.002038 ACTAGTACTTCCTCCGTCCAG 57.998 52.381 0.00 0.00 0.00 3.86
2183 3182 2.575279 ACTAGTACTTCCTCCGTCCAGA 59.425 50.000 0.00 0.00 0.00 3.86
2184 3183 2.599408 AGTACTTCCTCCGTCCAGAA 57.401 50.000 0.00 0.00 0.00 3.02
2185 3184 2.885616 AGTACTTCCTCCGTCCAGAAA 58.114 47.619 0.00 0.00 0.00 2.52
2186 3185 3.442076 AGTACTTCCTCCGTCCAGAAAT 58.558 45.455 0.00 0.00 0.00 2.17
2187 3186 4.607239 AGTACTTCCTCCGTCCAGAAATA 58.393 43.478 0.00 0.00 0.00 1.40
2188 3187 5.021458 AGTACTTCCTCCGTCCAGAAATAA 58.979 41.667 0.00 0.00 0.00 1.40
2189 3188 4.473477 ACTTCCTCCGTCCAGAAATAAG 57.527 45.455 0.00 0.00 0.00 1.73
2190 3189 3.838903 ACTTCCTCCGTCCAGAAATAAGT 59.161 43.478 0.00 0.00 0.00 2.24
2191 3190 4.081586 ACTTCCTCCGTCCAGAAATAAGTC 60.082 45.833 0.00 0.00 0.00 3.01
2192 3191 3.709587 TCCTCCGTCCAGAAATAAGTCT 58.290 45.455 0.00 0.00 0.00 3.24
2193 3192 4.863548 TCCTCCGTCCAGAAATAAGTCTA 58.136 43.478 0.00 0.00 0.00 2.59
2194 3193 4.643784 TCCTCCGTCCAGAAATAAGTCTAC 59.356 45.833 0.00 0.00 0.00 2.59
2195 3194 4.401519 CCTCCGTCCAGAAATAAGTCTACA 59.598 45.833 0.00 0.00 0.00 2.74
2196 3195 5.069251 CCTCCGTCCAGAAATAAGTCTACAT 59.931 44.000 0.00 0.00 0.00 2.29
2199 3198 6.816640 TCCGTCCAGAAATAAGTCTACATTTG 59.183 38.462 0.00 0.00 0.00 2.32
2204 3203 7.615365 TCCAGAAATAAGTCTACATTTGGCATT 59.385 33.333 0.00 0.00 0.00 3.56
2219 3218 9.512588 ACATTTGGCATTTAAAATTTATCCACA 57.487 25.926 0.00 0.00 0.00 4.17
2247 3246 9.899226 AAAAGTGTAGTTTTATCTTCTCAATGC 57.101 29.630 0.00 0.00 0.00 3.56
2248 3247 8.621532 AAGTGTAGTTTTATCTTCTCAATGCA 57.378 30.769 0.00 0.00 0.00 3.96
2249 3248 8.034058 AGTGTAGTTTTATCTTCTCAATGCAC 57.966 34.615 0.00 0.00 0.00 4.57
2251 3250 8.507249 GTGTAGTTTTATCTTCTCAATGCACTT 58.493 33.333 0.00 0.00 0.00 3.16
2252 3251 9.066892 TGTAGTTTTATCTTCTCAATGCACTTT 57.933 29.630 0.00 0.00 0.00 2.66
2286 3285 6.683974 AAAATATTTCCCTCTCATCACACG 57.316 37.500 0.10 0.00 0.00 4.49
2287 3286 5.614324 AATATTTCCCTCTCATCACACGA 57.386 39.130 0.00 0.00 0.00 4.35
2288 3287 5.815233 ATATTTCCCTCTCATCACACGAT 57.185 39.130 0.00 0.00 0.00 3.73
2289 3288 6.918067 ATATTTCCCTCTCATCACACGATA 57.082 37.500 0.00 0.00 0.00 2.92
2290 3289 5.614324 ATTTCCCTCTCATCACACGATAA 57.386 39.130 0.00 0.00 0.00 1.75
2291 3290 5.614324 TTTCCCTCTCATCACACGATAAT 57.386 39.130 0.00 0.00 0.00 1.28
2292 3291 4.855715 TCCCTCTCATCACACGATAATC 57.144 45.455 0.00 0.00 0.00 1.75
2293 3292 4.215109 TCCCTCTCATCACACGATAATCA 58.785 43.478 0.00 0.00 0.00 2.57
2294 3293 4.649218 TCCCTCTCATCACACGATAATCAA 59.351 41.667 0.00 0.00 0.00 2.57
2295 3294 4.987285 CCCTCTCATCACACGATAATCAAG 59.013 45.833 0.00 0.00 0.00 3.02
2296 3295 5.221322 CCCTCTCATCACACGATAATCAAGA 60.221 44.000 0.00 0.00 0.00 3.02
2297 3296 5.689514 CCTCTCATCACACGATAATCAAGAC 59.310 44.000 0.00 0.00 0.00 3.01
2298 3297 5.592054 TCTCATCACACGATAATCAAGACC 58.408 41.667 0.00 0.00 0.00 3.85
2299 3298 5.127031 TCTCATCACACGATAATCAAGACCA 59.873 40.000 0.00 0.00 0.00 4.02
2300 3299 5.729510 TCATCACACGATAATCAAGACCAA 58.270 37.500 0.00 0.00 0.00 3.67
2301 3300 6.348498 TCATCACACGATAATCAAGACCAAT 58.652 36.000 0.00 0.00 0.00 3.16
2302 3301 7.496747 TCATCACACGATAATCAAGACCAATA 58.503 34.615 0.00 0.00 0.00 1.90
2303 3302 7.984617 TCATCACACGATAATCAAGACCAATAA 59.015 33.333 0.00 0.00 0.00 1.40
2304 3303 7.534085 TCACACGATAATCAAGACCAATAAC 57.466 36.000 0.00 0.00 0.00 1.89
2305 3304 7.100409 TCACACGATAATCAAGACCAATAACA 58.900 34.615 0.00 0.00 0.00 2.41
2306 3305 7.768582 TCACACGATAATCAAGACCAATAACAT 59.231 33.333 0.00 0.00 0.00 2.71
2307 3306 8.397906 CACACGATAATCAAGACCAATAACATT 58.602 33.333 0.00 0.00 0.00 2.71
2308 3307 8.612619 ACACGATAATCAAGACCAATAACATTC 58.387 33.333 0.00 0.00 0.00 2.67
2309 3308 8.611757 CACGATAATCAAGACCAATAACATTCA 58.388 33.333 0.00 0.00 0.00 2.57
2310 3309 9.173021 ACGATAATCAAGACCAATAACATTCAA 57.827 29.630 0.00 0.00 0.00 2.69
2311 3310 9.438291 CGATAATCAAGACCAATAACATTCAAC 57.562 33.333 0.00 0.00 0.00 3.18
2314 3313 6.951062 TCAAGACCAATAACATTCAACACA 57.049 33.333 0.00 0.00 0.00 3.72
2315 3314 7.523293 TCAAGACCAATAACATTCAACACAT 57.477 32.000 0.00 0.00 0.00 3.21
2316 3315 7.369607 TCAAGACCAATAACATTCAACACATG 58.630 34.615 0.00 0.00 0.00 3.21
2317 3316 6.271488 AGACCAATAACATTCAACACATGG 57.729 37.500 0.00 0.00 0.00 3.66
2318 3317 5.774690 AGACCAATAACATTCAACACATGGT 59.225 36.000 0.00 0.00 41.10 3.55
2319 3318 6.024552 ACCAATAACATTCAACACATGGTC 57.975 37.500 0.00 0.00 33.59 4.02
2320 3319 5.774690 ACCAATAACATTCAACACATGGTCT 59.225 36.000 0.00 0.00 33.59 3.85
2321 3320 6.267471 ACCAATAACATTCAACACATGGTCTT 59.733 34.615 0.00 0.00 33.59 3.01
2322 3321 6.808212 CCAATAACATTCAACACATGGTCTTC 59.192 38.462 0.00 0.00 0.00 2.87
2323 3322 7.309377 CCAATAACATTCAACACATGGTCTTCT 60.309 37.037 0.00 0.00 0.00 2.85
2324 3323 5.695851 AACATTCAACACATGGTCTTCTC 57.304 39.130 0.00 0.00 0.00 2.87
2325 3324 4.717877 ACATTCAACACATGGTCTTCTCA 58.282 39.130 0.00 0.00 0.00 3.27
2326 3325 4.516698 ACATTCAACACATGGTCTTCTCAC 59.483 41.667 0.00 0.00 0.00 3.51
2327 3326 4.422073 TTCAACACATGGTCTTCTCACT 57.578 40.909 0.00 0.00 0.00 3.41
2328 3327 4.422073 TCAACACATGGTCTTCTCACTT 57.578 40.909 0.00 0.00 0.00 3.16
2329 3328 4.780815 TCAACACATGGTCTTCTCACTTT 58.219 39.130 0.00 0.00 0.00 2.66
2330 3329 5.192927 TCAACACATGGTCTTCTCACTTTT 58.807 37.500 0.00 0.00 0.00 2.27
2331 3330 5.652014 TCAACACATGGTCTTCTCACTTTTT 59.348 36.000 0.00 0.00 0.00 1.94
2332 3331 6.826231 TCAACACATGGTCTTCTCACTTTTTA 59.174 34.615 0.00 0.00 0.00 1.52
2333 3332 7.338196 TCAACACATGGTCTTCTCACTTTTTAA 59.662 33.333 0.00 0.00 0.00 1.52
2334 3333 7.639113 ACACATGGTCTTCTCACTTTTTAAA 57.361 32.000 0.00 0.00 0.00 1.52
2335 3334 8.237811 ACACATGGTCTTCTCACTTTTTAAAT 57.762 30.769 0.00 0.00 0.00 1.40
2336 3335 8.137437 ACACATGGTCTTCTCACTTTTTAAATG 58.863 33.333 0.00 0.00 0.00 2.32
2337 3336 7.115378 CACATGGTCTTCTCACTTTTTAAATGC 59.885 37.037 0.00 0.00 0.00 3.56
2338 3337 6.707440 TGGTCTTCTCACTTTTTAAATGCA 57.293 33.333 0.00 0.00 0.00 3.96
2339 3338 6.503524 TGGTCTTCTCACTTTTTAAATGCAC 58.496 36.000 0.00 0.00 0.00 4.57
2340 3339 6.321181 TGGTCTTCTCACTTTTTAAATGCACT 59.679 34.615 0.00 0.00 0.00 4.40
2341 3340 7.147915 TGGTCTTCTCACTTTTTAAATGCACTT 60.148 33.333 0.00 0.00 0.00 3.16
2342 3341 8.349983 GGTCTTCTCACTTTTTAAATGCACTTA 58.650 33.333 0.00 0.00 0.00 2.24
2343 3342 9.730420 GTCTTCTCACTTTTTAAATGCACTTAA 57.270 29.630 0.00 0.00 0.00 1.85
2344 3343 9.730420 TCTTCTCACTTTTTAAATGCACTTAAC 57.270 29.630 0.00 0.00 0.00 2.01
2345 3344 9.736023 CTTCTCACTTTTTAAATGCACTTAACT 57.264 29.630 0.00 0.00 0.00 2.24
2346 3345 9.730420 TTCTCACTTTTTAAATGCACTTAACTC 57.270 29.630 0.00 0.00 0.00 3.01
2347 3346 8.898761 TCTCACTTTTTAAATGCACTTAACTCA 58.101 29.630 0.00 0.00 0.00 3.41
2348 3347 9.683069 CTCACTTTTTAAATGCACTTAACTCAT 57.317 29.630 0.00 0.00 0.00 2.90
2354 3353 9.474920 TTTTAAATGCACTTAACTCATTGAAGG 57.525 29.630 0.00 0.00 31.53 3.46
2355 3354 6.655078 AAATGCACTTAACTCATTGAAGGT 57.345 33.333 0.00 0.00 31.53 3.50
2356 3355 5.633830 ATGCACTTAACTCATTGAAGGTG 57.366 39.130 0.00 0.00 0.00 4.00
2357 3356 3.820467 TGCACTTAACTCATTGAAGGTGG 59.180 43.478 2.49 0.00 0.00 4.61
2358 3357 3.191371 GCACTTAACTCATTGAAGGTGGG 59.809 47.826 2.49 0.00 0.00 4.61
2359 3358 3.191371 CACTTAACTCATTGAAGGTGGGC 59.809 47.826 0.00 0.00 0.00 5.36
2360 3359 3.074538 ACTTAACTCATTGAAGGTGGGCT 59.925 43.478 0.00 0.00 0.00 5.19
2361 3360 4.288626 ACTTAACTCATTGAAGGTGGGCTA 59.711 41.667 0.00 0.00 0.00 3.93
2362 3361 3.806949 AACTCATTGAAGGTGGGCTAA 57.193 42.857 0.00 0.00 0.00 3.09
2363 3362 4.322057 AACTCATTGAAGGTGGGCTAAT 57.678 40.909 0.00 0.00 0.00 1.73
2364 3363 4.322057 ACTCATTGAAGGTGGGCTAATT 57.678 40.909 0.00 0.00 0.00 1.40
2365 3364 5.450818 ACTCATTGAAGGTGGGCTAATTA 57.549 39.130 0.00 0.00 0.00 1.40
2366 3365 5.440610 ACTCATTGAAGGTGGGCTAATTAG 58.559 41.667 8.20 8.20 0.00 1.73
2367 3366 5.191722 ACTCATTGAAGGTGGGCTAATTAGA 59.808 40.000 16.85 0.00 0.00 2.10
2368 3367 5.684704 TCATTGAAGGTGGGCTAATTAGAG 58.315 41.667 16.85 0.00 0.00 2.43
2369 3368 5.428457 TCATTGAAGGTGGGCTAATTAGAGA 59.572 40.000 16.85 0.00 0.00 3.10
2370 3369 5.359194 TTGAAGGTGGGCTAATTAGAGAG 57.641 43.478 16.85 0.00 0.00 3.20
2371 3370 3.134804 TGAAGGTGGGCTAATTAGAGAGC 59.865 47.826 16.85 2.85 38.00 4.09
2372 3371 2.764269 AGGTGGGCTAATTAGAGAGCA 58.236 47.619 16.85 0.00 40.64 4.26
2373 3372 2.703007 AGGTGGGCTAATTAGAGAGCAG 59.297 50.000 16.85 0.00 40.64 4.24
2374 3373 2.700897 GGTGGGCTAATTAGAGAGCAGA 59.299 50.000 16.85 0.00 40.64 4.26
2375 3374 3.244044 GGTGGGCTAATTAGAGAGCAGAG 60.244 52.174 16.85 0.00 40.64 3.35
2376 3375 3.639094 GTGGGCTAATTAGAGAGCAGAGA 59.361 47.826 16.85 0.00 40.64 3.10
2377 3376 3.894427 TGGGCTAATTAGAGAGCAGAGAG 59.106 47.826 16.85 0.00 40.64 3.20
2378 3377 4.148838 GGGCTAATTAGAGAGCAGAGAGA 58.851 47.826 16.85 0.00 40.64 3.10
2379 3378 4.772100 GGGCTAATTAGAGAGCAGAGAGAT 59.228 45.833 16.85 0.00 40.64 2.75
2380 3379 5.336690 GGGCTAATTAGAGAGCAGAGAGATG 60.337 48.000 16.85 0.00 40.64 2.90
2381 3380 5.476599 GGCTAATTAGAGAGCAGAGAGATGA 59.523 44.000 16.85 0.00 40.64 2.92
2382 3381 6.153340 GGCTAATTAGAGAGCAGAGAGATGAT 59.847 42.308 16.85 0.00 40.64 2.45
2383 3382 7.031372 GCTAATTAGAGAGCAGAGAGATGATG 58.969 42.308 16.85 0.00 38.62 3.07
2384 3383 7.094248 GCTAATTAGAGAGCAGAGAGATGATGA 60.094 40.741 16.85 0.00 38.62 2.92
2385 3384 6.579666 ATTAGAGAGCAGAGAGATGATGAC 57.420 41.667 0.00 0.00 0.00 3.06
2386 3385 4.174704 AGAGAGCAGAGAGATGATGACT 57.825 45.455 0.00 0.00 0.00 3.41
2387 3386 4.539726 AGAGAGCAGAGAGATGATGACTT 58.460 43.478 0.00 0.00 0.00 3.01
2388 3387 4.340097 AGAGAGCAGAGAGATGATGACTTG 59.660 45.833 0.00 0.00 0.00 3.16
2389 3388 3.125316 GAGCAGAGAGATGATGACTTGC 58.875 50.000 0.00 0.00 0.00 4.01
2390 3389 2.500504 AGCAGAGAGATGATGACTTGCA 59.499 45.455 0.00 0.00 0.00 4.08
2391 3390 2.608546 GCAGAGAGATGATGACTTGCAC 59.391 50.000 0.00 0.00 0.00 4.57
2392 3391 3.858247 CAGAGAGATGATGACTTGCACA 58.142 45.455 0.00 0.00 0.00 4.57
2393 3392 4.443621 CAGAGAGATGATGACTTGCACAT 58.556 43.478 0.00 0.00 0.00 3.21
2394 3393 4.876679 CAGAGAGATGATGACTTGCACATT 59.123 41.667 0.00 0.00 0.00 2.71
2395 3394 5.354513 CAGAGAGATGATGACTTGCACATTT 59.645 40.000 0.00 0.00 0.00 2.32
2396 3395 5.585445 AGAGAGATGATGACTTGCACATTTC 59.415 40.000 0.00 0.00 0.00 2.17
2397 3396 4.639310 AGAGATGATGACTTGCACATTTCC 59.361 41.667 0.00 0.00 0.00 3.13
2398 3397 4.338012 AGATGATGACTTGCACATTTCCA 58.662 39.130 0.00 0.00 0.00 3.53
2399 3398 4.768448 AGATGATGACTTGCACATTTCCAA 59.232 37.500 0.00 0.00 0.00 3.53
2400 3399 5.421056 AGATGATGACTTGCACATTTCCAAT 59.579 36.000 0.00 0.00 0.00 3.16
2401 3400 4.811908 TGATGACTTGCACATTTCCAATG 58.188 39.130 0.00 0.00 0.00 2.82
2402 3401 4.281435 TGATGACTTGCACATTTCCAATGT 59.719 37.500 0.00 0.00 0.00 2.71
2403 3402 5.476254 TGATGACTTGCACATTTCCAATGTA 59.524 36.000 1.83 0.00 0.00 2.29
2404 3403 5.981088 TGACTTGCACATTTCCAATGTAT 57.019 34.783 1.83 0.00 0.00 2.29
2405 3404 6.343716 TGACTTGCACATTTCCAATGTATT 57.656 33.333 1.83 0.00 0.00 1.89
2406 3405 6.757237 TGACTTGCACATTTCCAATGTATTT 58.243 32.000 1.83 0.00 0.00 1.40
2407 3406 7.215789 TGACTTGCACATTTCCAATGTATTTT 58.784 30.769 1.83 0.00 0.00 1.82
2408 3407 7.714377 TGACTTGCACATTTCCAATGTATTTTT 59.286 29.630 1.83 0.00 0.00 1.94
2409 3408 8.086851 ACTTGCACATTTCCAATGTATTTTTC 57.913 30.769 1.83 0.00 0.00 2.29
2410 3409 7.714377 ACTTGCACATTTCCAATGTATTTTTCA 59.286 29.630 1.83 0.00 0.00 2.69
2411 3410 7.418840 TGCACATTTCCAATGTATTTTTCAC 57.581 32.000 1.83 0.00 0.00 3.18
2412 3411 7.215789 TGCACATTTCCAATGTATTTTTCACT 58.784 30.769 1.83 0.00 0.00 3.41
2413 3412 7.384660 TGCACATTTCCAATGTATTTTTCACTC 59.615 33.333 1.83 0.00 0.00 3.51
2414 3413 7.148590 GCACATTTCCAATGTATTTTTCACTCC 60.149 37.037 1.83 0.00 0.00 3.85
2415 3414 7.871973 CACATTTCCAATGTATTTTTCACTCCA 59.128 33.333 1.83 0.00 0.00 3.86
2416 3415 7.872483 ACATTTCCAATGTATTTTTCACTCCAC 59.128 33.333 0.10 0.00 0.00 4.02
2417 3416 7.595819 TTTCCAATGTATTTTTCACTCCACT 57.404 32.000 0.00 0.00 0.00 4.00
2418 3417 6.573664 TCCAATGTATTTTTCACTCCACTG 57.426 37.500 0.00 0.00 0.00 3.66
2419 3418 5.048083 TCCAATGTATTTTTCACTCCACTGC 60.048 40.000 0.00 0.00 0.00 4.40
2420 3419 5.278907 CCAATGTATTTTTCACTCCACTGCA 60.279 40.000 0.00 0.00 0.00 4.41
2421 3420 6.392354 CAATGTATTTTTCACTCCACTGCAT 58.608 36.000 0.00 0.00 0.00 3.96
2422 3421 7.362834 CCAATGTATTTTTCACTCCACTGCATA 60.363 37.037 0.00 0.00 0.00 3.14
2423 3422 7.701539 ATGTATTTTTCACTCCACTGCATAA 57.298 32.000 0.00 0.00 0.00 1.90
2424 3423 7.701539 TGTATTTTTCACTCCACTGCATAAT 57.298 32.000 0.00 0.00 0.00 1.28
2425 3424 8.800370 TGTATTTTTCACTCCACTGCATAATA 57.200 30.769 0.00 0.00 0.00 0.98
2426 3425 9.407380 TGTATTTTTCACTCCACTGCATAATAT 57.593 29.630 0.00 0.00 0.00 1.28
2427 3426 9.669353 GTATTTTTCACTCCACTGCATAATATG 57.331 33.333 0.00 0.00 0.00 1.78
2428 3427 7.701539 TTTTTCACTCCACTGCATAATATGT 57.298 32.000 1.92 0.00 0.00 2.29
2429 3428 6.925610 TTTCACTCCACTGCATAATATGTC 57.074 37.500 1.92 0.00 0.00 3.06
2430 3429 4.960938 TCACTCCACTGCATAATATGTCC 58.039 43.478 1.92 0.00 0.00 4.02
2431 3430 4.655649 TCACTCCACTGCATAATATGTCCT 59.344 41.667 1.92 0.00 0.00 3.85
2432 3431 5.838521 TCACTCCACTGCATAATATGTCCTA 59.161 40.000 1.92 0.00 0.00 2.94
2433 3432 6.326323 TCACTCCACTGCATAATATGTCCTAA 59.674 38.462 1.92 0.00 0.00 2.69
2434 3433 6.992123 CACTCCACTGCATAATATGTCCTAAA 59.008 38.462 1.92 0.00 0.00 1.85
2435 3434 7.498900 CACTCCACTGCATAATATGTCCTAAAA 59.501 37.037 1.92 0.00 0.00 1.52
2436 3435 8.220559 ACTCCACTGCATAATATGTCCTAAAAT 58.779 33.333 1.92 0.00 0.00 1.82
2437 3436 8.995027 TCCACTGCATAATATGTCCTAAAATT 57.005 30.769 1.92 0.00 0.00 1.82
2438 3437 9.420118 TCCACTGCATAATATGTCCTAAAATTT 57.580 29.630 1.92 0.00 0.00 1.82
2439 3438 9.683069 CCACTGCATAATATGTCCTAAAATTTC 57.317 33.333 1.92 0.00 0.00 2.17
2465 3464 3.648339 GTACACTTACTTGTGGACGGA 57.352 47.619 0.00 0.00 41.26 4.69
2466 3465 2.814280 ACACTTACTTGTGGACGGAG 57.186 50.000 0.00 0.00 41.84 4.63
2467 3466 1.343465 ACACTTACTTGTGGACGGAGG 59.657 52.381 0.00 0.00 41.84 4.30
2468 3467 0.974383 ACTTACTTGTGGACGGAGGG 59.026 55.000 0.00 0.00 0.00 4.30
2469 3468 1.263356 CTTACTTGTGGACGGAGGGA 58.737 55.000 0.00 0.00 0.00 4.20
2470 3469 1.204941 CTTACTTGTGGACGGAGGGAG 59.795 57.143 0.00 0.00 0.00 4.30
2471 3470 0.113776 TACTTGTGGACGGAGGGAGT 59.886 55.000 0.00 0.00 0.00 3.85
2472 3471 0.113776 ACTTGTGGACGGAGGGAGTA 59.886 55.000 0.00 0.00 0.00 2.59
2473 3472 0.818296 CTTGTGGACGGAGGGAGTAG 59.182 60.000 0.00 0.00 0.00 2.57
2474 3473 0.113776 TTGTGGACGGAGGGAGTAGT 59.886 55.000 0.00 0.00 0.00 2.73
2475 3474 0.611062 TGTGGACGGAGGGAGTAGTG 60.611 60.000 0.00 0.00 0.00 2.74
2476 3475 0.611340 GTGGACGGAGGGAGTAGTGT 60.611 60.000 0.00 0.00 0.00 3.55
2477 3476 0.994247 TGGACGGAGGGAGTAGTGTA 59.006 55.000 0.00 0.00 0.00 2.90
2478 3477 1.567649 TGGACGGAGGGAGTAGTGTAT 59.432 52.381 0.00 0.00 0.00 2.29
2479 3478 2.779430 TGGACGGAGGGAGTAGTGTATA 59.221 50.000 0.00 0.00 0.00 1.47
2480 3479 3.396946 TGGACGGAGGGAGTAGTGTATAT 59.603 47.826 0.00 0.00 0.00 0.86
2481 3480 4.598807 TGGACGGAGGGAGTAGTGTATATA 59.401 45.833 0.00 0.00 0.00 0.86
2482 3481 5.252397 TGGACGGAGGGAGTAGTGTATATAT 59.748 44.000 0.00 0.00 0.00 0.86
2483 3482 5.589452 GGACGGAGGGAGTAGTGTATATATG 59.411 48.000 0.00 0.00 0.00 1.78
2484 3483 6.384342 ACGGAGGGAGTAGTGTATATATGA 57.616 41.667 0.00 0.00 0.00 2.15
2485 3484 6.971340 ACGGAGGGAGTAGTGTATATATGAT 58.029 40.000 0.00 0.00 0.00 2.45
2486 3485 8.098963 ACGGAGGGAGTAGTGTATATATGATA 57.901 38.462 0.00 0.00 0.00 2.15
2487 3486 7.992033 ACGGAGGGAGTAGTGTATATATGATAC 59.008 40.741 0.00 0.00 0.00 2.24
2488 3487 7.444792 CGGAGGGAGTAGTGTATATATGATACC 59.555 44.444 0.00 0.00 0.00 2.73
2489 3488 7.724951 GGAGGGAGTAGTGTATATATGATACCC 59.275 44.444 0.00 0.00 0.00 3.69
2490 3489 7.593653 AGGGAGTAGTGTATATATGATACCCC 58.406 42.308 0.00 0.00 32.48 4.95
2491 3490 7.187708 AGGGAGTAGTGTATATATGATACCCCA 59.812 40.741 17.84 0.00 31.44 4.96
2492 3491 7.287235 GGGAGTAGTGTATATATGATACCCCAC 59.713 44.444 0.00 0.00 0.00 4.61
2493 3492 7.837689 GGAGTAGTGTATATATGATACCCCACA 59.162 40.741 0.00 0.00 0.00 4.17
2494 3493 9.251440 GAGTAGTGTATATATGATACCCCACAA 57.749 37.037 0.00 0.00 0.00 3.33
2495 3494 9.610104 AGTAGTGTATATATGATACCCCACAAA 57.390 33.333 0.00 0.00 0.00 2.83
2536 3535 8.198807 TGATAATGATAGCAAGATCTCCTTCA 57.801 34.615 0.00 3.79 31.42 3.02
2537 3536 8.823794 TGATAATGATAGCAAGATCTCCTTCAT 58.176 33.333 0.00 5.69 31.42 2.57
2538 3537 9.100554 GATAATGATAGCAAGATCTCCTTCATG 57.899 37.037 0.00 0.00 31.42 3.07
2539 3538 5.224821 TGATAGCAAGATCTCCTTCATGG 57.775 43.478 0.00 0.00 31.42 3.66
2540 3539 4.657504 TGATAGCAAGATCTCCTTCATGGT 59.342 41.667 0.00 0.00 37.07 3.55
2541 3540 3.557228 AGCAAGATCTCCTTCATGGTC 57.443 47.619 0.00 0.00 37.07 4.02
2542 3541 2.158986 AGCAAGATCTCCTTCATGGTCG 60.159 50.000 0.00 0.00 37.07 4.79
2543 3542 2.831333 CAAGATCTCCTTCATGGTCGG 58.169 52.381 0.00 0.00 37.07 4.79
2544 3543 2.166907 AGATCTCCTTCATGGTCGGT 57.833 50.000 0.00 0.00 37.07 4.69
2545 3544 3.314307 AGATCTCCTTCATGGTCGGTA 57.686 47.619 0.00 0.00 37.07 4.02
2546 3545 3.643237 AGATCTCCTTCATGGTCGGTAA 58.357 45.455 0.00 0.00 37.07 2.85
2547 3546 4.030913 AGATCTCCTTCATGGTCGGTAAA 58.969 43.478 0.00 0.00 37.07 2.01
2548 3547 4.656112 AGATCTCCTTCATGGTCGGTAAAT 59.344 41.667 0.00 0.00 37.07 1.40
2549 3548 4.402056 TCTCCTTCATGGTCGGTAAATC 57.598 45.455 0.00 0.00 37.07 2.17
2550 3549 4.030913 TCTCCTTCATGGTCGGTAAATCT 58.969 43.478 0.00 0.00 37.07 2.40
2551 3550 5.205821 TCTCCTTCATGGTCGGTAAATCTA 58.794 41.667 0.00 0.00 37.07 1.98
2552 3551 5.068723 TCTCCTTCATGGTCGGTAAATCTAC 59.931 44.000 0.00 0.00 37.07 2.59
2553 3552 4.712829 TCCTTCATGGTCGGTAAATCTACA 59.287 41.667 0.00 0.00 37.07 2.74
2554 3553 5.050490 CCTTCATGGTCGGTAAATCTACAG 58.950 45.833 0.00 0.00 0.00 2.74
2555 3554 5.395324 CCTTCATGGTCGGTAAATCTACAGT 60.395 44.000 0.00 0.00 0.00 3.55
2556 3555 5.006153 TCATGGTCGGTAAATCTACAGTG 57.994 43.478 0.00 0.00 0.00 3.66
2557 3556 4.464951 TCATGGTCGGTAAATCTACAGTGT 59.535 41.667 0.00 0.00 0.00 3.55
2558 3557 4.182693 TGGTCGGTAAATCTACAGTGTG 57.817 45.455 5.88 0.00 0.00 3.82
2559 3558 3.575256 TGGTCGGTAAATCTACAGTGTGT 59.425 43.478 5.88 0.00 0.00 3.72
2560 3559 3.924686 GGTCGGTAAATCTACAGTGTGTG 59.075 47.826 5.88 0.00 0.00 3.82
2561 3560 3.367025 GTCGGTAAATCTACAGTGTGTGC 59.633 47.826 5.88 0.00 0.00 4.57
2562 3561 3.257375 TCGGTAAATCTACAGTGTGTGCT 59.743 43.478 5.88 0.00 0.00 4.40
2563 3562 3.994392 CGGTAAATCTACAGTGTGTGCTT 59.006 43.478 5.88 0.00 0.00 3.91
2564 3563 5.047872 TCGGTAAATCTACAGTGTGTGCTTA 60.048 40.000 5.88 0.00 0.00 3.09
2565 3564 5.810587 CGGTAAATCTACAGTGTGTGCTTAT 59.189 40.000 5.88 0.00 0.00 1.73
2566 3565 6.976349 CGGTAAATCTACAGTGTGTGCTTATA 59.024 38.462 5.88 0.00 0.00 0.98
2567 3566 7.490079 CGGTAAATCTACAGTGTGTGCTTATAA 59.510 37.037 5.88 0.00 0.00 0.98
2568 3567 9.158233 GGTAAATCTACAGTGTGTGCTTATAAA 57.842 33.333 5.88 0.00 0.00 1.40
2577 3576 9.840427 ACAGTGTGTGCTTATAAATTAAATGTC 57.160 29.630 0.00 0.00 0.00 3.06
2578 3577 8.998989 CAGTGTGTGCTTATAAATTAAATGTCG 58.001 33.333 0.00 0.00 0.00 4.35
2579 3578 8.941977 AGTGTGTGCTTATAAATTAAATGTCGA 58.058 29.630 0.00 0.00 0.00 4.20
2580 3579 9.716507 GTGTGTGCTTATAAATTAAATGTCGAT 57.283 29.630 0.00 0.00 0.00 3.59
2581 3580 9.715123 TGTGTGCTTATAAATTAAATGTCGATG 57.285 29.630 0.00 0.00 0.00 3.84
2582 3581 9.929722 GTGTGCTTATAAATTAAATGTCGATGA 57.070 29.630 0.00 0.00 0.00 2.92
2601 3600 9.382244 GTCGATGATTTAATTATACAAGGTTGC 57.618 33.333 0.00 0.00 0.00 4.17
2602 3601 8.564574 TCGATGATTTAATTATACAAGGTTGCC 58.435 33.333 0.00 0.00 0.00 4.52
2603 3602 8.567948 CGATGATTTAATTATACAAGGTTGCCT 58.432 33.333 0.00 0.00 33.87 4.75
2612 3611 3.924576 AAGGTTGCCTTGTGTTCCT 57.075 47.368 0.00 0.00 42.96 3.36
2614 3613 3.306472 AAGGTTGCCTTGTGTTCCTAA 57.694 42.857 0.00 0.00 42.96 2.69
2617 3616 4.993028 AGGTTGCCTTGTGTTCCTAATTA 58.007 39.130 0.00 0.00 0.00 1.40
2623 3622 6.162777 TGCCTTGTGTTCCTAATTAATTTGC 58.837 36.000 5.91 0.00 0.00 3.68
2624 3623 5.580691 GCCTTGTGTTCCTAATTAATTTGCC 59.419 40.000 5.91 0.00 0.00 4.52
2627 3626 6.279513 TGTGTTCCTAATTAATTTGCCTGG 57.720 37.500 5.91 2.47 0.00 4.45
2645 3644 4.273318 CCTGGCAAGCTTAATTAGGTTCT 58.727 43.478 0.00 0.00 42.49 3.01
2653 3652 5.440610 AGCTTAATTAGGTTCTCCATGGTG 58.559 41.667 12.58 9.91 35.89 4.17
2656 3655 1.367346 TTAGGTTCTCCATGGTGGCA 58.633 50.000 12.58 0.00 37.47 4.92
2662 3661 1.153208 CTCCATGGTGGCAGAGCTC 60.153 63.158 12.58 5.27 37.47 4.09
2668 3667 1.297689 GGTGGCAGAGCTCATGTCA 59.702 57.895 17.77 15.55 0.00 3.58
2671 3670 0.036671 TGGCAGAGCTCATGTCAGTG 60.037 55.000 17.77 4.40 0.00 3.66
2678 3677 1.919956 GCTCATGTCAGTGTGCTGGC 61.920 60.000 0.00 0.00 46.90 4.85
2680 3679 0.604511 TCATGTCAGTGTGCTGGCTG 60.605 55.000 0.93 0.00 46.84 4.85
2693 3692 2.203181 GGCTGAGCATCTCTGGCC 60.203 66.667 6.82 13.05 44.68 5.36
2694 3693 2.588439 GCTGAGCATCTCTGGCCA 59.412 61.111 4.71 4.71 34.92 5.36
2700 3699 0.180642 AGCATCTCTGGCCACATCAG 59.819 55.000 0.00 0.00 0.00 2.90
2701 3700 1.445716 GCATCTCTGGCCACATCAGC 61.446 60.000 0.00 0.00 32.63 4.26
2703 3702 0.107312 ATCTCTGGCCACATCAGCAC 60.107 55.000 0.00 0.00 32.63 4.40
2706 3705 1.604308 CTGGCCACATCAGCACCAA 60.604 57.895 0.00 0.00 0.00 3.67
2725 3724 3.071206 GAGCTCTCTCCGGGCACA 61.071 66.667 6.43 0.00 33.19 4.57
2755 3754 1.470112 GCCTACCTCGTCTTCAAGCTC 60.470 57.143 0.00 0.00 0.00 4.09
2764 3763 2.055100 GTCTTCAAGCTCACTCACGAC 58.945 52.381 0.00 0.00 0.00 4.34
2791 3790 4.463879 CTCGCCTCCCCACAGCAG 62.464 72.222 0.00 0.00 0.00 4.24
2795 3794 3.790437 CCTCCCCACAGCAGCGAT 61.790 66.667 0.00 0.00 0.00 4.58
2796 3795 2.202987 CTCCCCACAGCAGCGATC 60.203 66.667 0.00 0.00 0.00 3.69
2797 3796 4.147449 TCCCCACAGCAGCGATCG 62.147 66.667 11.69 11.69 0.00 3.69
2799 3798 4.457496 CCCACAGCAGCGATCGGT 62.457 66.667 15.21 15.21 0.00 4.69
2800 3799 2.887568 CCACAGCAGCGATCGGTC 60.888 66.667 18.38 12.26 0.00 4.79
2801 3800 2.887568 CACAGCAGCGATCGGTCC 60.888 66.667 18.38 8.87 0.00 4.46
2802 3801 3.071206 ACAGCAGCGATCGGTCCT 61.071 61.111 18.38 11.64 0.00 3.85
2803 3802 2.279120 CAGCAGCGATCGGTCCTC 60.279 66.667 18.38 9.56 0.00 3.71
2804 3803 2.441164 AGCAGCGATCGGTCCTCT 60.441 61.111 18.38 11.74 0.00 3.69
2805 3804 2.026879 GCAGCGATCGGTCCTCTC 59.973 66.667 18.38 0.00 0.00 3.20
2806 3805 2.725008 CAGCGATCGGTCCTCTCC 59.275 66.667 18.38 0.00 0.00 3.71
2834 3833 4.724602 GGCAGAGCTCGACGCACA 62.725 66.667 21.92 0.00 42.61 4.57
2835 3834 3.474034 GCAGAGCTCGACGCACAC 61.474 66.667 17.52 0.00 42.61 3.82
2837 3836 4.406173 AGAGCTCGACGCACACGG 62.406 66.667 8.37 0.00 46.04 4.94
2848 3847 4.082523 CACACGGCGTCCCTCCAT 62.083 66.667 10.85 0.00 0.00 3.41
2849 3848 3.771160 ACACGGCGTCCCTCCATC 61.771 66.667 10.85 0.00 0.00 3.51
2850 3849 4.530857 CACGGCGTCCCTCCATCC 62.531 72.222 10.85 0.00 0.00 3.51
2851 3850 4.779733 ACGGCGTCCCTCCATCCT 62.780 66.667 6.77 0.00 0.00 3.24
2852 3851 3.470888 CGGCGTCCCTCCATCCTT 61.471 66.667 0.00 0.00 0.00 3.36
2853 3852 2.190578 GGCGTCCCTCCATCCTTG 59.809 66.667 0.00 0.00 0.00 3.61
2854 3853 2.514824 GCGTCCCTCCATCCTTGC 60.515 66.667 0.00 0.00 0.00 4.01
2855 3854 2.989639 CGTCCCTCCATCCTTGCA 59.010 61.111 0.00 0.00 0.00 4.08
2856 3855 1.299648 CGTCCCTCCATCCTTGCAA 59.700 57.895 0.00 0.00 0.00 4.08
2857 3856 1.026718 CGTCCCTCCATCCTTGCAAC 61.027 60.000 0.00 0.00 0.00 4.17
2858 3857 0.681243 GTCCCTCCATCCTTGCAACC 60.681 60.000 0.00 0.00 0.00 3.77
2859 3858 1.750399 CCCTCCATCCTTGCAACCG 60.750 63.158 0.00 0.00 0.00 4.44
2860 3859 1.750399 CCTCCATCCTTGCAACCGG 60.750 63.158 0.00 0.00 0.00 5.28
2861 3860 1.299648 CTCCATCCTTGCAACCGGA 59.700 57.895 9.46 9.66 0.00 5.14
2862 3861 1.002624 TCCATCCTTGCAACCGGAC 60.003 57.895 9.46 0.00 30.90 4.79
2863 3862 2.046285 CCATCCTTGCAACCGGACC 61.046 63.158 9.46 0.00 30.90 4.46
2864 3863 2.046314 ATCCTTGCAACCGGACCG 60.046 61.111 9.46 6.99 30.90 4.79
2865 3864 2.589157 ATCCTTGCAACCGGACCGA 61.589 57.895 17.49 0.00 30.90 4.69
2866 3865 1.910580 ATCCTTGCAACCGGACCGAT 61.911 55.000 17.49 0.00 30.90 4.18
2867 3866 1.674322 CCTTGCAACCGGACCGATT 60.674 57.895 17.49 0.00 0.00 3.34
2868 3867 1.644786 CCTTGCAACCGGACCGATTC 61.645 60.000 17.49 0.00 0.00 2.52
2869 3868 0.673644 CTTGCAACCGGACCGATTCT 60.674 55.000 17.49 0.00 0.00 2.40
2870 3869 0.250553 TTGCAACCGGACCGATTCTT 60.251 50.000 17.49 0.00 0.00 2.52
2871 3870 0.672401 TGCAACCGGACCGATTCTTC 60.672 55.000 17.49 0.00 0.00 2.87
2872 3871 1.366854 GCAACCGGACCGATTCTTCC 61.367 60.000 17.49 0.00 0.00 3.46
2873 3872 0.249398 CAACCGGACCGATTCTTCCT 59.751 55.000 17.49 0.00 0.00 3.36
2874 3873 0.249398 AACCGGACCGATTCTTCCTG 59.751 55.000 17.49 0.00 0.00 3.86
2875 3874 0.903454 ACCGGACCGATTCTTCCTGT 60.903 55.000 17.49 0.00 0.00 4.00
2876 3875 1.108776 CCGGACCGATTCTTCCTGTA 58.891 55.000 17.49 0.00 0.00 2.74
2877 3876 1.202382 CCGGACCGATTCTTCCTGTAC 60.202 57.143 17.49 0.00 0.00 2.90
2878 3877 1.202382 CGGACCGATTCTTCCTGTACC 60.202 57.143 8.64 0.00 0.00 3.34
2879 3878 1.202382 GGACCGATTCTTCCTGTACCG 60.202 57.143 0.00 0.00 0.00 4.02
2880 3879 0.822164 ACCGATTCTTCCTGTACCGG 59.178 55.000 0.00 0.00 41.04 5.28
2881 3880 0.529992 CCGATTCTTCCTGTACCGGC 60.530 60.000 0.00 0.00 0.00 6.13
2882 3881 0.870307 CGATTCTTCCTGTACCGGCG 60.870 60.000 0.00 0.00 0.00 6.46
2883 3882 0.458669 GATTCTTCCTGTACCGGCGA 59.541 55.000 9.30 0.00 0.00 5.54
2884 3883 0.899720 ATTCTTCCTGTACCGGCGAA 59.100 50.000 9.30 4.67 0.00 4.70
2885 3884 0.680618 TTCTTCCTGTACCGGCGAAA 59.319 50.000 9.30 0.00 0.00 3.46
2886 3885 0.899720 TCTTCCTGTACCGGCGAAAT 59.100 50.000 9.30 0.00 0.00 2.17
2887 3886 1.006832 CTTCCTGTACCGGCGAAATG 58.993 55.000 9.30 0.00 0.00 2.32
2888 3887 0.391927 TTCCTGTACCGGCGAAATGG 60.392 55.000 9.30 3.91 0.00 3.16
2889 3888 2.469516 CCTGTACCGGCGAAATGGC 61.470 63.158 9.30 0.00 40.44 4.40
2890 3889 1.449601 CTGTACCGGCGAAATGGCT 60.450 57.895 9.30 0.00 42.02 4.75
2891 3890 1.705337 CTGTACCGGCGAAATGGCTG 61.705 60.000 9.30 0.00 42.02 4.85
2892 3891 1.448893 GTACCGGCGAAATGGCTGA 60.449 57.895 9.30 0.00 41.96 4.26
2893 3892 1.448893 TACCGGCGAAATGGCTGAC 60.449 57.895 9.30 0.00 41.96 3.51
2894 3893 3.864686 CCGGCGAAATGGCTGACG 61.865 66.667 9.30 0.00 41.96 4.35
2895 3894 3.864686 CGGCGAAATGGCTGACGG 61.865 66.667 0.00 0.00 41.96 4.79
2896 3895 3.508840 GGCGAAATGGCTGACGGG 61.509 66.667 0.00 0.00 40.72 5.28
2897 3896 3.508840 GCGAAATGGCTGACGGGG 61.509 66.667 0.00 0.00 0.00 5.73
2898 3897 2.267642 CGAAATGGCTGACGGGGA 59.732 61.111 0.00 0.00 0.00 4.81
2899 3898 1.815421 CGAAATGGCTGACGGGGAG 60.815 63.158 0.00 0.00 0.00 4.30
2900 3899 2.044946 AAATGGCTGACGGGGAGC 60.045 61.111 0.00 0.00 35.57 4.70
2905 3904 4.101448 GCTGACGGGGAGCCACAT 62.101 66.667 0.00 0.00 0.00 3.21
2906 3905 2.124983 CTGACGGGGAGCCACATG 60.125 66.667 0.00 0.00 0.00 3.21
2907 3906 2.606213 TGACGGGGAGCCACATGA 60.606 61.111 0.00 0.00 0.00 3.07
2908 3907 2.125106 GACGGGGAGCCACATGAC 60.125 66.667 0.00 0.00 0.00 3.06
2909 3908 3.682292 GACGGGGAGCCACATGACC 62.682 68.421 0.00 0.00 0.00 4.02
2910 3909 3.716195 CGGGGAGCCACATGACCA 61.716 66.667 0.00 0.00 0.00 4.02
2911 3910 2.044946 GGGGAGCCACATGACCAC 60.045 66.667 0.00 0.00 0.00 4.16
2912 3911 2.436646 GGGAGCCACATGACCACG 60.437 66.667 0.00 0.00 0.00 4.94
2913 3912 2.662596 GGAGCCACATGACCACGA 59.337 61.111 0.00 0.00 0.00 4.35
2914 3913 1.448540 GGAGCCACATGACCACGAG 60.449 63.158 0.00 0.00 0.00 4.18
2915 3914 2.046892 AGCCACATGACCACGAGC 60.047 61.111 0.00 0.00 0.00 5.03
2916 3915 3.490759 GCCACATGACCACGAGCG 61.491 66.667 0.00 0.00 0.00 5.03
2917 3916 2.261361 CCACATGACCACGAGCGA 59.739 61.111 0.00 0.00 0.00 4.93
2918 3917 1.807165 CCACATGACCACGAGCGAG 60.807 63.158 0.00 0.00 0.00 5.03
2919 3918 1.212751 CACATGACCACGAGCGAGA 59.787 57.895 0.00 0.00 0.00 4.04
2920 3919 0.179127 CACATGACCACGAGCGAGAT 60.179 55.000 0.00 0.00 0.00 2.75
2921 3920 0.179127 ACATGACCACGAGCGAGATG 60.179 55.000 0.00 0.00 0.00 2.90
2922 3921 0.101219 CATGACCACGAGCGAGATGA 59.899 55.000 0.00 0.00 0.00 2.92
2923 3922 1.035923 ATGACCACGAGCGAGATGAT 58.964 50.000 0.00 0.00 0.00 2.45
2924 3923 0.101219 TGACCACGAGCGAGATGATG 59.899 55.000 0.00 0.00 0.00 3.07
2925 3924 0.596083 GACCACGAGCGAGATGATGG 60.596 60.000 0.00 0.00 0.00 3.51
2926 3925 1.323271 ACCACGAGCGAGATGATGGT 61.323 55.000 0.00 0.00 35.60 3.55
2927 3926 0.873312 CCACGAGCGAGATGATGGTG 60.873 60.000 0.00 0.00 41.68 4.17
2928 3927 0.179127 CACGAGCGAGATGATGGTGT 60.179 55.000 0.00 0.00 37.84 4.16
2929 3928 0.101399 ACGAGCGAGATGATGGTGTC 59.899 55.000 0.00 0.00 0.00 3.67
2930 3929 0.932123 CGAGCGAGATGATGGTGTCG 60.932 60.000 0.00 0.00 37.87 4.35
2931 3930 0.101399 GAGCGAGATGATGGTGTCGT 59.899 55.000 0.00 0.00 37.24 4.34
2932 3931 0.101399 AGCGAGATGATGGTGTCGTC 59.899 55.000 0.00 0.00 42.18 4.20
2933 3932 1.202973 GCGAGATGATGGTGTCGTCG 61.203 60.000 0.00 0.00 45.67 5.12
2934 3933 0.098905 CGAGATGATGGTGTCGTCGT 59.901 55.000 0.00 0.00 45.67 4.34
2935 3934 1.828832 GAGATGATGGTGTCGTCGTC 58.171 55.000 0.00 0.00 45.67 4.20
2936 3935 1.132453 GAGATGATGGTGTCGTCGTCA 59.868 52.381 9.57 0.00 45.67 4.35
2937 3936 1.133216 AGATGATGGTGTCGTCGTCAG 59.867 52.381 9.57 0.00 45.67 3.51
2938 3937 0.173481 ATGATGGTGTCGTCGTCAGG 59.827 55.000 0.00 0.00 34.18 3.86
2939 3938 1.176619 TGATGGTGTCGTCGTCAGGT 61.177 55.000 0.00 0.00 0.00 4.00
2940 3939 0.806868 GATGGTGTCGTCGTCAGGTA 59.193 55.000 0.00 0.00 0.00 3.08
2941 3940 0.524862 ATGGTGTCGTCGTCAGGTAC 59.475 55.000 0.00 0.00 0.00 3.34
2942 3941 1.211190 GGTGTCGTCGTCAGGTACC 59.789 63.158 2.73 2.73 0.00 3.34
2943 3942 1.211190 GTGTCGTCGTCAGGTACCC 59.789 63.158 8.74 0.00 0.00 3.69
2944 3943 2.327343 TGTCGTCGTCAGGTACCCG 61.327 63.158 8.74 5.40 0.00 5.28
2945 3944 2.747460 TCGTCGTCAGGTACCCGG 60.747 66.667 8.74 0.85 0.00 5.73
2946 3945 3.818787 CGTCGTCAGGTACCCGGG 61.819 72.222 22.25 22.25 0.00 5.73
2947 3946 3.455469 GTCGTCAGGTACCCGGGG 61.455 72.222 27.92 12.73 0.00 5.73
2969 3968 4.653888 GGGTGGACGGGTGGTTGG 62.654 72.222 0.00 0.00 0.00 3.77
2970 3969 3.562232 GGTGGACGGGTGGTTGGA 61.562 66.667 0.00 0.00 0.00 3.53
2971 3970 2.032071 GTGGACGGGTGGTTGGAG 59.968 66.667 0.00 0.00 0.00 3.86
2972 3971 3.948719 TGGACGGGTGGTTGGAGC 61.949 66.667 0.00 0.00 0.00 4.70
2973 3972 3.637273 GGACGGGTGGTTGGAGCT 61.637 66.667 0.00 0.00 0.00 4.09
2974 3973 2.358737 GACGGGTGGTTGGAGCTG 60.359 66.667 0.00 0.00 0.00 4.24
2975 3974 3.901797 GACGGGTGGTTGGAGCTGG 62.902 68.421 0.00 0.00 0.00 4.85
2976 3975 3.636231 CGGGTGGTTGGAGCTGGA 61.636 66.667 0.00 0.00 0.00 3.86
2977 3976 2.352805 GGGTGGTTGGAGCTGGAG 59.647 66.667 0.00 0.00 0.00 3.86
2978 3977 2.224159 GGGTGGTTGGAGCTGGAGA 61.224 63.158 0.00 0.00 0.00 3.71
2979 3978 1.566298 GGGTGGTTGGAGCTGGAGAT 61.566 60.000 0.00 0.00 0.00 2.75
2980 3979 0.393537 GGTGGTTGGAGCTGGAGATG 60.394 60.000 0.00 0.00 0.00 2.90
2981 3980 0.393537 GTGGTTGGAGCTGGAGATGG 60.394 60.000 0.00 0.00 0.00 3.51
2982 3981 1.225704 GGTTGGAGCTGGAGATGGG 59.774 63.158 0.00 0.00 0.00 4.00
2983 3982 1.452833 GTTGGAGCTGGAGATGGGC 60.453 63.158 0.00 0.00 0.00 5.36
2984 3983 3.035173 TTGGAGCTGGAGATGGGCG 62.035 63.158 0.00 0.00 0.00 6.13
2985 3984 3.157252 GGAGCTGGAGATGGGCGA 61.157 66.667 0.00 0.00 0.00 5.54
2986 3985 2.107953 GAGCTGGAGATGGGCGAC 59.892 66.667 0.00 0.00 0.00 5.19
2987 3986 2.364842 AGCTGGAGATGGGCGACT 60.365 61.111 0.00 0.00 0.00 4.18
2988 3987 1.965754 GAGCTGGAGATGGGCGACTT 61.966 60.000 0.00 0.00 0.00 3.01
2989 3988 1.522580 GCTGGAGATGGGCGACTTC 60.523 63.158 0.00 0.00 0.00 3.01
2990 3989 1.144936 CTGGAGATGGGCGACTTCC 59.855 63.158 0.00 0.00 0.00 3.46
2991 3990 1.612146 TGGAGATGGGCGACTTCCA 60.612 57.895 0.00 0.00 38.82 3.53
2992 3991 1.153349 GGAGATGGGCGACTTCCAC 60.153 63.158 0.00 0.00 37.08 4.02
2993 3992 1.596934 GAGATGGGCGACTTCCACA 59.403 57.895 0.00 0.00 37.08 4.17
2994 3993 0.741221 GAGATGGGCGACTTCCACAC 60.741 60.000 0.00 0.00 37.08 3.82
2995 3994 1.003839 GATGGGCGACTTCCACACA 60.004 57.895 0.00 0.00 37.08 3.72
2996 3995 1.003355 ATGGGCGACTTCCACACAG 60.003 57.895 0.00 0.00 37.08 3.66
2997 3996 2.358737 GGGCGACTTCCACACAGG 60.359 66.667 0.00 0.00 39.47 4.00
2998 3997 2.426023 GGCGACTTCCACACAGGT 59.574 61.111 0.00 0.00 39.02 4.00
2999 3998 1.961277 GGCGACTTCCACACAGGTG 60.961 63.158 0.00 0.00 44.85 4.00
3011 4010 3.510388 ACACAGGTGATAGTGATGACG 57.490 47.619 6.40 0.00 39.03 4.35
3012 4011 3.089284 ACACAGGTGATAGTGATGACGA 58.911 45.455 6.40 0.00 39.03 4.20
3013 4012 3.129462 ACACAGGTGATAGTGATGACGAG 59.871 47.826 6.40 0.00 39.03 4.18
3014 4013 2.690497 ACAGGTGATAGTGATGACGAGG 59.310 50.000 0.00 0.00 0.00 4.63
3015 4014 1.683917 AGGTGATAGTGATGACGAGGC 59.316 52.381 0.00 0.00 0.00 4.70
3016 4015 1.683917 GGTGATAGTGATGACGAGGCT 59.316 52.381 0.00 0.00 0.00 4.58
3017 4016 2.885266 GGTGATAGTGATGACGAGGCTA 59.115 50.000 0.00 0.00 0.00 3.93
3018 4017 3.304794 GGTGATAGTGATGACGAGGCTAC 60.305 52.174 0.00 0.00 0.00 3.58
3019 4018 2.548480 TGATAGTGATGACGAGGCTACG 59.452 50.000 0.00 0.00 39.31 3.51
3020 4019 1.306148 TAGTGATGACGAGGCTACGG 58.694 55.000 10.29 0.00 37.61 4.02
3021 4020 1.589196 GTGATGACGAGGCTACGGC 60.589 63.158 10.29 7.99 42.12 5.68
3022 4021 1.753078 TGATGACGAGGCTACGGCT 60.753 57.895 12.25 0.00 42.29 5.52
3023 4022 1.299468 GATGACGAGGCTACGGCTG 60.299 63.158 12.25 0.00 42.29 4.85
3024 4023 3.432051 ATGACGAGGCTACGGCTGC 62.432 63.158 12.25 0.00 42.29 5.25
3025 4024 4.129737 GACGAGGCTACGGCTGCA 62.130 66.667 0.50 0.00 38.98 4.41
3026 4025 4.135153 ACGAGGCTACGGCTGCAG 62.135 66.667 10.11 10.11 38.98 4.41
3027 4026 3.826754 CGAGGCTACGGCTGCAGA 61.827 66.667 20.43 0.00 38.98 4.26
3028 4027 2.579201 GAGGCTACGGCTGCAGAA 59.421 61.111 20.43 0.00 38.98 3.02
3029 4028 1.520342 GAGGCTACGGCTGCAGAAG 60.520 63.158 20.43 12.74 38.98 2.85
3030 4029 1.949847 GAGGCTACGGCTGCAGAAGA 61.950 60.000 20.43 0.00 38.98 2.87
3031 4030 1.144936 GGCTACGGCTGCAGAAGAT 59.855 57.895 20.43 1.29 38.73 2.40
3032 4031 1.156645 GGCTACGGCTGCAGAAGATG 61.157 60.000 20.43 4.98 38.73 2.90
3033 4032 0.460987 GCTACGGCTGCAGAAGATGT 60.461 55.000 20.43 9.76 35.22 3.06
3034 4033 2.009042 GCTACGGCTGCAGAAGATGTT 61.009 52.381 20.43 0.00 35.22 2.71
3035 4034 1.662629 CTACGGCTGCAGAAGATGTTG 59.337 52.381 20.43 4.74 0.00 3.33
3036 4035 0.035317 ACGGCTGCAGAAGATGTTGA 59.965 50.000 20.43 0.00 0.00 3.18
3037 4036 0.445436 CGGCTGCAGAAGATGTTGAC 59.555 55.000 20.43 0.00 0.00 3.18
3038 4037 1.527034 GGCTGCAGAAGATGTTGACA 58.473 50.000 20.43 0.00 0.00 3.58
3039 4038 2.089980 GGCTGCAGAAGATGTTGACAT 58.910 47.619 20.43 0.00 39.70 3.06
3040 4039 2.159421 GGCTGCAGAAGATGTTGACATG 60.159 50.000 20.43 0.00 36.57 3.21
3041 4040 2.745821 GCTGCAGAAGATGTTGACATGA 59.254 45.455 20.43 0.00 36.57 3.07
3042 4041 3.377485 GCTGCAGAAGATGTTGACATGAT 59.623 43.478 20.43 0.00 36.57 2.45
3043 4042 4.573607 GCTGCAGAAGATGTTGACATGATA 59.426 41.667 20.43 0.00 36.57 2.15
3044 4043 5.503683 GCTGCAGAAGATGTTGACATGATAC 60.504 44.000 20.43 0.00 36.57 2.24
3045 4044 5.737860 TGCAGAAGATGTTGACATGATACT 58.262 37.500 0.00 0.00 36.57 2.12
3046 4045 5.814188 TGCAGAAGATGTTGACATGATACTC 59.186 40.000 0.00 0.00 36.57 2.59
3047 4046 5.236047 GCAGAAGATGTTGACATGATACTCC 59.764 44.000 0.00 0.00 36.57 3.85
3048 4047 6.343703 CAGAAGATGTTGACATGATACTCCA 58.656 40.000 0.00 0.00 36.57 3.86
3049 4048 6.990939 CAGAAGATGTTGACATGATACTCCAT 59.009 38.462 0.00 0.00 36.57 3.41
3050 4049 6.990939 AGAAGATGTTGACATGATACTCCATG 59.009 38.462 0.00 0.00 46.90 3.66
3051 4050 6.490241 AGATGTTGACATGATACTCCATGA 57.510 37.500 10.42 0.00 44.98 3.07
3052 4051 6.522946 AGATGTTGACATGATACTCCATGAG 58.477 40.000 10.42 0.00 44.98 2.90
3053 4052 5.682234 TGTTGACATGATACTCCATGAGT 57.318 39.130 10.42 1.94 44.98 3.41
3054 4053 5.422145 TGTTGACATGATACTCCATGAGTG 58.578 41.667 10.42 0.00 44.98 3.51
3055 4054 5.046376 TGTTGACATGATACTCCATGAGTGT 60.046 40.000 10.42 0.00 44.98 3.55
3056 4055 5.014808 TGACATGATACTCCATGAGTGTG 57.985 43.478 10.42 3.87 44.98 3.82
3057 4056 4.711355 TGACATGATACTCCATGAGTGTGA 59.289 41.667 10.42 0.00 44.98 3.58
3058 4057 5.163478 TGACATGATACTCCATGAGTGTGAG 60.163 44.000 10.42 0.00 44.98 3.51
3059 4058 4.100653 ACATGATACTCCATGAGTGTGAGG 59.899 45.833 10.42 0.00 44.98 3.86
3060 4059 3.981212 TGATACTCCATGAGTGTGAGGA 58.019 45.455 7.00 0.00 43.30 3.71
3062 4061 3.756739 CTCCATGAGTGTGAGGAGC 57.243 57.895 0.00 0.00 40.98 4.70
3063 4062 1.193323 CTCCATGAGTGTGAGGAGCT 58.807 55.000 0.00 0.00 40.98 4.09
3064 4063 0.900421 TCCATGAGTGTGAGGAGCTG 59.100 55.000 0.00 0.00 0.00 4.24
3065 4064 0.743701 CCATGAGTGTGAGGAGCTGC 60.744 60.000 0.00 0.00 0.00 5.25
3066 4065 0.036671 CATGAGTGTGAGGAGCTGCA 60.037 55.000 8.35 0.00 0.00 4.41
3067 4066 0.249676 ATGAGTGTGAGGAGCTGCAG 59.750 55.000 10.11 10.11 0.00 4.41
3068 4067 1.117749 TGAGTGTGAGGAGCTGCAGT 61.118 55.000 16.64 1.59 0.00 4.40
3069 4068 0.669932 GAGTGTGAGGAGCTGCAGTG 60.670 60.000 16.64 0.00 0.00 3.66
3070 4069 1.670406 GTGTGAGGAGCTGCAGTGG 60.670 63.158 16.64 0.00 0.00 4.00
3071 4070 1.838396 TGTGAGGAGCTGCAGTGGA 60.838 57.895 16.64 0.00 0.00 4.02
3072 4071 1.372683 GTGAGGAGCTGCAGTGGAA 59.627 57.895 16.64 0.00 0.00 3.53
3073 4072 0.673022 GTGAGGAGCTGCAGTGGAAG 60.673 60.000 16.64 0.00 0.00 3.46
3074 4073 0.833409 TGAGGAGCTGCAGTGGAAGA 60.833 55.000 16.64 0.00 0.00 2.87
3075 4074 0.322975 GAGGAGCTGCAGTGGAAGAA 59.677 55.000 16.64 0.00 0.00 2.52
3076 4075 0.324285 AGGAGCTGCAGTGGAAGAAG 59.676 55.000 16.64 0.00 0.00 2.85
3077 4076 0.676151 GGAGCTGCAGTGGAAGAAGG 60.676 60.000 16.64 0.00 0.00 3.46
3078 4077 0.676151 GAGCTGCAGTGGAAGAAGGG 60.676 60.000 16.64 0.00 0.00 3.95
3079 4078 1.676967 GCTGCAGTGGAAGAAGGGG 60.677 63.158 16.64 0.00 0.00 4.79
3080 4079 1.676967 CTGCAGTGGAAGAAGGGGC 60.677 63.158 5.25 0.00 0.00 5.80
3081 4080 2.134630 CTGCAGTGGAAGAAGGGGCT 62.135 60.000 5.25 0.00 0.00 5.19
3082 4081 0.840288 TGCAGTGGAAGAAGGGGCTA 60.840 55.000 0.00 0.00 0.00 3.93
3083 4082 0.328258 GCAGTGGAAGAAGGGGCTAA 59.672 55.000 0.00 0.00 0.00 3.09
3084 4083 1.064389 GCAGTGGAAGAAGGGGCTAAT 60.064 52.381 0.00 0.00 0.00 1.73
3085 4084 2.924421 CAGTGGAAGAAGGGGCTAATC 58.076 52.381 0.00 0.00 0.00 1.75
3086 4085 2.239654 CAGTGGAAGAAGGGGCTAATCA 59.760 50.000 0.00 0.00 0.00 2.57
3087 4086 3.117738 CAGTGGAAGAAGGGGCTAATCAT 60.118 47.826 0.00 0.00 0.00 2.45
3088 4087 3.137360 AGTGGAAGAAGGGGCTAATCATC 59.863 47.826 0.00 0.00 0.00 2.92
3089 4088 2.104792 TGGAAGAAGGGGCTAATCATCG 59.895 50.000 0.00 0.00 0.00 3.84
3090 4089 2.368875 GGAAGAAGGGGCTAATCATCGA 59.631 50.000 0.00 0.00 0.00 3.59
3091 4090 3.181454 GGAAGAAGGGGCTAATCATCGAA 60.181 47.826 0.00 0.00 0.00 3.71
3092 4091 3.760580 AGAAGGGGCTAATCATCGAAG 57.239 47.619 0.00 0.00 0.00 3.79
3093 4092 2.370189 AGAAGGGGCTAATCATCGAAGG 59.630 50.000 0.00 0.00 0.00 3.46
3094 4093 0.398318 AGGGGCTAATCATCGAAGGC 59.602 55.000 0.00 0.00 35.21 4.35
3095 4094 0.108585 GGGGCTAATCATCGAAGGCA 59.891 55.000 9.50 0.00 37.53 4.75
3096 4095 1.271597 GGGGCTAATCATCGAAGGCAT 60.272 52.381 9.50 0.00 37.53 4.40
3097 4096 2.079925 GGGCTAATCATCGAAGGCATC 58.920 52.381 9.50 0.00 37.53 3.91
3107 4106 2.911594 GAAGGCATCGAGATCAGGC 58.088 57.895 0.00 0.00 0.00 4.85
3108 4107 0.602372 GAAGGCATCGAGATCAGGCC 60.602 60.000 0.00 0.00 44.92 5.19
3109 4108 2.031768 GGCATCGAGATCAGGCCC 59.968 66.667 0.00 0.00 38.70 5.80
3110 4109 2.811514 GGCATCGAGATCAGGCCCA 61.812 63.158 0.00 0.00 38.70 5.36
3111 4110 1.146930 GCATCGAGATCAGGCCCAA 59.853 57.895 0.00 0.00 0.00 4.12
3112 4111 0.883814 GCATCGAGATCAGGCCCAAG 60.884 60.000 0.00 0.00 0.00 3.61
3113 4112 0.755079 CATCGAGATCAGGCCCAAGA 59.245 55.000 0.00 0.00 0.00 3.02
3114 4113 1.139654 CATCGAGATCAGGCCCAAGAA 59.860 52.381 0.00 0.00 0.00 2.52
3115 4114 1.275666 TCGAGATCAGGCCCAAGAAA 58.724 50.000 0.00 0.00 0.00 2.52
3116 4115 1.628340 TCGAGATCAGGCCCAAGAAAA 59.372 47.619 0.00 0.00 0.00 2.29
3117 4116 2.239654 TCGAGATCAGGCCCAAGAAAAT 59.760 45.455 0.00 0.00 0.00 1.82
3118 4117 3.019564 CGAGATCAGGCCCAAGAAAATT 58.980 45.455 0.00 0.00 0.00 1.82
3119 4118 4.080582 TCGAGATCAGGCCCAAGAAAATTA 60.081 41.667 0.00 0.00 0.00 1.40
3120 4119 4.640201 CGAGATCAGGCCCAAGAAAATTAA 59.360 41.667 0.00 0.00 0.00 1.40
3121 4120 5.300286 CGAGATCAGGCCCAAGAAAATTAAT 59.700 40.000 0.00 0.00 0.00 1.40
3122 4121 6.183360 CGAGATCAGGCCCAAGAAAATTAATT 60.183 38.462 0.00 0.00 0.00 1.40
3123 4122 6.881570 AGATCAGGCCCAAGAAAATTAATTG 58.118 36.000 0.00 0.00 0.00 2.32
3124 4123 6.669154 AGATCAGGCCCAAGAAAATTAATTGA 59.331 34.615 0.00 0.00 0.00 2.57
3125 4124 6.872585 TCAGGCCCAAGAAAATTAATTGAT 57.127 33.333 0.00 0.00 0.00 2.57
3126 4125 7.256494 TCAGGCCCAAGAAAATTAATTGATT 57.744 32.000 0.00 0.00 0.00 2.57
3127 4126 7.104939 TCAGGCCCAAGAAAATTAATTGATTG 58.895 34.615 0.00 7.26 0.00 2.67
3128 4127 7.038445 TCAGGCCCAAGAAAATTAATTGATTGA 60.038 33.333 16.20 0.00 0.00 2.57
3129 4128 7.771826 CAGGCCCAAGAAAATTAATTGATTGAT 59.228 33.333 16.20 0.00 0.00 2.57
3130 4129 8.330993 AGGCCCAAGAAAATTAATTGATTGATT 58.669 29.630 16.20 2.27 0.00 2.57
3131 4130 8.959548 GGCCCAAGAAAATTAATTGATTGATTT 58.040 29.630 16.20 1.86 37.51 2.17
3132 4131 9.777575 GCCCAAGAAAATTAATTGATTGATTTG 57.222 29.630 16.20 2.50 36.49 2.32
3133 4132 9.777575 CCCAAGAAAATTAATTGATTGATTTGC 57.222 29.630 16.20 5.80 36.49 3.68
3134 4133 9.777575 CCAAGAAAATTAATTGATTGATTTGCC 57.222 29.630 16.20 4.09 36.49 4.52
3135 4134 9.480538 CAAGAAAATTAATTGATTGATTTGCCG 57.519 29.630 0.39 0.00 36.49 5.69
3136 4135 8.776376 AGAAAATTAATTGATTGATTTGCCGT 57.224 26.923 0.39 0.00 36.49 5.68
3137 4136 8.872845 AGAAAATTAATTGATTGATTTGCCGTC 58.127 29.630 0.39 2.88 36.49 4.79
3138 4137 8.545229 AAAATTAATTGATTGATTTGCCGTCA 57.455 26.923 0.39 0.00 36.49 4.35
3139 4138 7.760131 AATTAATTGATTGATTTGCCGTCAG 57.240 32.000 0.00 0.00 0.00 3.51
3140 4139 2.634982 TTGATTGATTTGCCGTCAGC 57.365 45.000 0.00 0.00 44.14 4.26
3166 4165 7.477144 TGTATGCTCAAATATAAGGTGAACG 57.523 36.000 0.00 0.00 0.00 3.95
3167 4166 7.269316 TGTATGCTCAAATATAAGGTGAACGA 58.731 34.615 0.00 0.00 0.00 3.85
3168 4167 7.766738 TGTATGCTCAAATATAAGGTGAACGAA 59.233 33.333 0.00 0.00 0.00 3.85
3169 4168 7.624360 ATGCTCAAATATAAGGTGAACGAAA 57.376 32.000 0.00 0.00 0.00 3.46
3170 4169 7.624360 TGCTCAAATATAAGGTGAACGAAAT 57.376 32.000 0.00 0.00 0.00 2.17
3171 4170 8.725405 TGCTCAAATATAAGGTGAACGAAATA 57.275 30.769 0.00 0.00 0.00 1.40
3172 4171 9.168451 TGCTCAAATATAAGGTGAACGAAATAA 57.832 29.630 0.00 0.00 0.00 1.40
3173 4172 9.997482 GCTCAAATATAAGGTGAACGAAATAAA 57.003 29.630 0.00 0.00 0.00 1.40
3181 4180 9.974980 ATAAGGTGAACGAAATAAACATTGTTT 57.025 25.926 18.13 18.13 0.00 2.83
3182 4181 7.692908 AGGTGAACGAAATAAACATTGTTTG 57.307 32.000 22.04 9.42 0.00 2.93
3183 4182 6.699642 AGGTGAACGAAATAAACATTGTTTGG 59.300 34.615 22.04 10.06 0.00 3.28
3184 4183 6.351749 GTGAACGAAATAAACATTGTTTGGC 58.648 36.000 22.04 9.32 0.00 4.52
3185 4184 6.019479 GTGAACGAAATAAACATTGTTTGGCA 60.019 34.615 22.04 5.49 0.00 4.92
3186 4185 6.535150 TGAACGAAATAAACATTGTTTGGCAA 59.465 30.769 22.04 0.00 41.89 4.52
3188 4187 7.116061 ACGAAATAAACATTGTTTGGCAATC 57.884 32.000 22.04 12.62 45.33 2.67
3189 4188 6.147000 ACGAAATAAACATTGTTTGGCAATCC 59.853 34.615 22.04 0.00 45.33 3.01
3190 4189 6.402011 CGAAATAAACATTGTTTGGCAATCCC 60.402 38.462 22.04 5.20 45.33 3.85
3191 4190 2.857186 AACATTGTTTGGCAATCCCC 57.143 45.000 0.00 0.00 45.33 4.81
3192 4191 1.727062 ACATTGTTTGGCAATCCCCA 58.273 45.000 0.00 0.00 45.33 4.96
3193 4192 2.268107 ACATTGTTTGGCAATCCCCAT 58.732 42.857 0.00 0.00 45.33 4.00
3194 4193 2.236893 ACATTGTTTGGCAATCCCCATC 59.763 45.455 0.00 0.00 45.33 3.51
3195 4194 2.323999 TTGTTTGGCAATCCCCATCT 57.676 45.000 0.00 0.00 34.21 2.90
3196 4195 2.323999 TGTTTGGCAATCCCCATCTT 57.676 45.000 0.00 0.00 34.21 2.40
3197 4196 1.901159 TGTTTGGCAATCCCCATCTTG 59.099 47.619 0.00 0.00 34.21 3.02
3198 4197 1.207811 GTTTGGCAATCCCCATCTTGG 59.792 52.381 0.00 0.00 37.25 3.61
3199 4198 0.977108 TTGGCAATCCCCATCTTGGC 60.977 55.000 0.00 2.29 45.30 4.52
3200 4199 2.492773 GGCAATCCCCATCTTGGCG 61.493 63.158 0.00 0.00 38.03 5.69
3201 4200 1.754234 GCAATCCCCATCTTGGCGT 60.754 57.895 0.00 0.00 35.79 5.68
3202 4201 0.465460 GCAATCCCCATCTTGGCGTA 60.465 55.000 0.00 0.00 35.79 4.42
3203 4202 1.819305 GCAATCCCCATCTTGGCGTAT 60.819 52.381 0.00 0.00 35.79 3.06
3204 4203 2.586425 CAATCCCCATCTTGGCGTATT 58.414 47.619 0.00 0.00 35.79 1.89
3205 4204 2.554032 CAATCCCCATCTTGGCGTATTC 59.446 50.000 0.00 0.00 35.79 1.75
3206 4205 1.208706 TCCCCATCTTGGCGTATTCA 58.791 50.000 0.00 0.00 35.79 2.57
3207 4206 1.134220 TCCCCATCTTGGCGTATTCAC 60.134 52.381 0.00 0.00 35.79 3.18
3208 4207 1.134098 CCCCATCTTGGCGTATTCACT 60.134 52.381 0.00 0.00 35.79 3.41
3209 4208 1.942657 CCCATCTTGGCGTATTCACTG 59.057 52.381 0.00 0.00 35.79 3.66
3210 4209 1.331756 CCATCTTGGCGTATTCACTGC 59.668 52.381 0.00 0.00 0.00 4.40
3211 4210 1.331756 CATCTTGGCGTATTCACTGCC 59.668 52.381 0.00 0.00 41.66 4.85
3212 4211 0.323302 TCTTGGCGTATTCACTGCCA 59.677 50.000 0.17 0.17 45.88 4.92
3213 4212 1.065491 TCTTGGCGTATTCACTGCCAT 60.065 47.619 5.93 0.00 46.37 4.40
3214 4213 1.064505 CTTGGCGTATTCACTGCCATG 59.935 52.381 5.93 5.03 46.37 3.66
3215 4214 1.356624 GGCGTATTCACTGCCATGC 59.643 57.895 0.00 0.00 41.24 4.06
3216 4215 1.097547 GGCGTATTCACTGCCATGCT 61.098 55.000 0.00 0.00 41.24 3.79
3217 4216 1.581934 GCGTATTCACTGCCATGCTA 58.418 50.000 0.00 0.00 0.00 3.49
3218 4217 2.146342 GCGTATTCACTGCCATGCTAT 58.854 47.619 0.00 0.00 0.00 2.97
3219 4218 3.325870 GCGTATTCACTGCCATGCTATA 58.674 45.455 0.00 0.00 0.00 1.31
3220 4219 3.745975 GCGTATTCACTGCCATGCTATAA 59.254 43.478 0.00 0.00 0.00 0.98
3221 4220 4.213270 GCGTATTCACTGCCATGCTATAAA 59.787 41.667 0.00 0.00 0.00 1.40
3222 4221 5.277779 GCGTATTCACTGCCATGCTATAAAA 60.278 40.000 0.00 0.00 0.00 1.52
3223 4222 6.365839 CGTATTCACTGCCATGCTATAAAAG 58.634 40.000 0.00 0.00 0.00 2.27
3224 4223 5.779529 ATTCACTGCCATGCTATAAAAGG 57.220 39.130 0.00 0.00 0.00 3.11
3225 4224 4.235079 TCACTGCCATGCTATAAAAGGT 57.765 40.909 0.00 0.00 0.00 3.50
3226 4225 5.366482 TCACTGCCATGCTATAAAAGGTA 57.634 39.130 0.00 0.00 0.00 3.08
3227 4226 5.123227 TCACTGCCATGCTATAAAAGGTAC 58.877 41.667 0.00 0.00 0.00 3.34
3228 4227 4.024893 CACTGCCATGCTATAAAAGGTACG 60.025 45.833 0.00 0.00 0.00 3.67
3229 4228 4.127171 CTGCCATGCTATAAAAGGTACGT 58.873 43.478 0.00 0.00 0.00 3.57
3230 4229 5.163385 ACTGCCATGCTATAAAAGGTACGTA 60.163 40.000 0.00 0.00 0.00 3.57
3231 4230 5.294356 TGCCATGCTATAAAAGGTACGTAG 58.706 41.667 0.00 0.00 0.00 3.51
3232 4231 5.069383 TGCCATGCTATAAAAGGTACGTAGA 59.931 40.000 0.00 0.00 0.00 2.59
3233 4232 6.164176 GCCATGCTATAAAAGGTACGTAGAT 58.836 40.000 0.00 0.00 0.00 1.98
3234 4233 7.039574 TGCCATGCTATAAAAGGTACGTAGATA 60.040 37.037 0.00 0.00 0.00 1.98
3235 4234 7.488471 GCCATGCTATAAAAGGTACGTAGATAG 59.512 40.741 0.00 0.00 0.00 2.08
3236 4235 8.737175 CCATGCTATAAAAGGTACGTAGATAGA 58.263 37.037 0.00 0.00 0.00 1.98
3240 4239 9.127006 GCTATAAAAGGTACGTAGATAGAAAGC 57.873 37.037 0.00 0.00 0.00 3.51
3241 4240 9.327529 CTATAAAAGGTACGTAGATAGAAAGCG 57.672 37.037 0.00 0.00 0.00 4.68
3242 4241 5.573337 AAAGGTACGTAGATAGAAAGCGT 57.427 39.130 0.00 0.00 39.23 5.07
3243 4242 5.573337 AAGGTACGTAGATAGAAAGCGTT 57.427 39.130 0.00 0.00 37.05 4.84
3244 4243 6.683974 AAGGTACGTAGATAGAAAGCGTTA 57.316 37.500 0.00 0.00 37.05 3.18
3245 4244 6.297694 AGGTACGTAGATAGAAAGCGTTAG 57.702 41.667 0.00 0.00 37.05 2.34
3246 4245 5.819901 AGGTACGTAGATAGAAAGCGTTAGT 59.180 40.000 0.00 0.00 37.05 2.24
3247 4246 6.317391 AGGTACGTAGATAGAAAGCGTTAGTT 59.683 38.462 0.00 0.00 37.05 2.24
3248 4247 6.969473 GGTACGTAGATAGAAAGCGTTAGTTT 59.031 38.462 0.00 0.00 37.05 2.66
3249 4248 8.122952 GGTACGTAGATAGAAAGCGTTAGTTTA 58.877 37.037 0.00 0.00 37.05 2.01
3250 4249 9.490663 GTACGTAGATAGAAAGCGTTAGTTTAA 57.509 33.333 0.00 0.00 37.05 1.52
3251 4250 8.387053 ACGTAGATAGAAAGCGTTAGTTTAAC 57.613 34.615 0.00 0.00 35.37 2.01
3252 4251 7.486232 ACGTAGATAGAAAGCGTTAGTTTAACC 59.514 37.037 0.00 0.00 35.27 2.85
3253 4252 7.699812 CGTAGATAGAAAGCGTTAGTTTAACCT 59.300 37.037 0.00 0.00 35.27 3.50
3254 4253 9.018716 GTAGATAGAAAGCGTTAGTTTAACCTC 57.981 37.037 0.00 0.00 35.27 3.85
3255 4254 7.838884 AGATAGAAAGCGTTAGTTTAACCTCT 58.161 34.615 0.00 0.00 35.27 3.69
3256 4255 8.964772 AGATAGAAAGCGTTAGTTTAACCTCTA 58.035 33.333 0.00 0.00 35.27 2.43
3257 4256 9.578439 GATAGAAAGCGTTAGTTTAACCTCTAA 57.422 33.333 0.00 0.00 35.27 2.10
3258 4257 7.886405 AGAAAGCGTTAGTTTAACCTCTAAG 57.114 36.000 0.00 0.00 35.27 2.18
3259 4258 7.440198 AGAAAGCGTTAGTTTAACCTCTAAGT 58.560 34.615 0.00 0.00 35.27 2.24
3260 4259 7.598118 AGAAAGCGTTAGTTTAACCTCTAAGTC 59.402 37.037 0.00 0.00 35.27 3.01
3261 4260 6.336842 AGCGTTAGTTTAACCTCTAAGTCA 57.663 37.500 0.00 0.00 35.27 3.41
3262 4261 6.932947 AGCGTTAGTTTAACCTCTAAGTCAT 58.067 36.000 0.00 0.00 35.27 3.06
3263 4262 6.812160 AGCGTTAGTTTAACCTCTAAGTCATG 59.188 38.462 0.00 0.00 35.27 3.07
3264 4263 6.589139 GCGTTAGTTTAACCTCTAAGTCATGT 59.411 38.462 0.00 0.00 35.27 3.21
3265 4264 7.117379 GCGTTAGTTTAACCTCTAAGTCATGTT 59.883 37.037 0.00 0.00 35.27 2.71
3266 4265 9.630098 CGTTAGTTTAACCTCTAAGTCATGTTA 57.370 33.333 0.00 0.00 35.27 2.41
3269 4268 8.494016 AGTTTAACCTCTAAGTCATGTTATGC 57.506 34.615 0.00 0.00 0.00 3.14
3270 4269 7.553044 AGTTTAACCTCTAAGTCATGTTATGCC 59.447 37.037 0.00 0.00 0.00 4.40
3271 4270 4.423625 ACCTCTAAGTCATGTTATGCCC 57.576 45.455 0.00 0.00 0.00 5.36
3272 4271 3.136626 ACCTCTAAGTCATGTTATGCCCC 59.863 47.826 0.00 0.00 0.00 5.80
3273 4272 3.496870 CCTCTAAGTCATGTTATGCCCCC 60.497 52.174 0.00 0.00 0.00 5.40
3295 4294 3.618690 CCCCCAAACAAAACAAACTGA 57.381 42.857 0.00 0.00 0.00 3.41
3296 4295 3.266636 CCCCCAAACAAAACAAACTGAC 58.733 45.455 0.00 0.00 0.00 3.51
3297 4296 3.266636 CCCCAAACAAAACAAACTGACC 58.733 45.455 0.00 0.00 0.00 4.02
3298 4297 3.266636 CCCAAACAAAACAAACTGACCC 58.733 45.455 0.00 0.00 0.00 4.46
3299 4298 3.055458 CCCAAACAAAACAAACTGACCCT 60.055 43.478 0.00 0.00 0.00 4.34
3300 4299 4.564613 CCCAAACAAAACAAACTGACCCTT 60.565 41.667 0.00 0.00 0.00 3.95
3301 4300 5.000591 CCAAACAAAACAAACTGACCCTTT 58.999 37.500 0.00 0.00 0.00 3.11
3302 4301 6.166982 CCAAACAAAACAAACTGACCCTTTA 58.833 36.000 0.00 0.00 0.00 1.85
3303 4302 6.091577 CCAAACAAAACAAACTGACCCTTTAC 59.908 38.462 0.00 0.00 0.00 2.01
3304 4303 5.333299 ACAAAACAAACTGACCCTTTACC 57.667 39.130 0.00 0.00 0.00 2.85
3305 4304 5.020795 ACAAAACAAACTGACCCTTTACCT 58.979 37.500 0.00 0.00 0.00 3.08
3306 4305 5.482526 ACAAAACAAACTGACCCTTTACCTT 59.517 36.000 0.00 0.00 0.00 3.50
3307 4306 6.664384 ACAAAACAAACTGACCCTTTACCTTA 59.336 34.615 0.00 0.00 0.00 2.69
3308 4307 7.178805 ACAAAACAAACTGACCCTTTACCTTAA 59.821 33.333 0.00 0.00 0.00 1.85
3309 4308 6.704289 AACAAACTGACCCTTTACCTTAAC 57.296 37.500 0.00 0.00 0.00 2.01
3310 4309 6.009908 ACAAACTGACCCTTTACCTTAACT 57.990 37.500 0.00 0.00 0.00 2.24
3311 4310 7.140522 ACAAACTGACCCTTTACCTTAACTA 57.859 36.000 0.00 0.00 0.00 2.24
3312 4311 7.222161 ACAAACTGACCCTTTACCTTAACTAG 58.778 38.462 0.00 0.00 0.00 2.57
3313 4312 7.147426 ACAAACTGACCCTTTACCTTAACTAGT 60.147 37.037 0.00 0.00 0.00 2.57
3314 4313 7.384524 AACTGACCCTTTACCTTAACTAGTT 57.615 36.000 13.68 13.68 0.00 2.24
3315 4314 8.496534 AACTGACCCTTTACCTTAACTAGTTA 57.503 34.615 11.38 11.38 0.00 2.24
3316 4315 8.496534 ACTGACCCTTTACCTTAACTAGTTAA 57.503 34.615 23.31 23.31 34.28 2.01
3317 4316 8.370940 ACTGACCCTTTACCTTAACTAGTTAAC 58.629 37.037 21.52 10.15 32.26 2.01
3318 4317 8.496534 TGACCCTTTACCTTAACTAGTTAACT 57.503 34.615 21.52 13.68 32.26 2.24
3319 4318 9.600432 TGACCCTTTACCTTAACTAGTTAACTA 57.400 33.333 21.52 14.52 32.26 2.24
3354 4353 2.997980 TGAGAAACCACAGTTGAAGCA 58.002 42.857 0.00 0.00 35.97 3.91
3357 4356 4.219507 TGAGAAACCACAGTTGAAGCAAAA 59.780 37.500 0.00 0.00 35.97 2.44
3358 4357 5.105392 TGAGAAACCACAGTTGAAGCAAAAT 60.105 36.000 0.00 0.00 35.97 1.82
3359 4358 6.096141 TGAGAAACCACAGTTGAAGCAAAATA 59.904 34.615 0.00 0.00 35.97 1.40
3360 4359 6.507023 AGAAACCACAGTTGAAGCAAAATAG 58.493 36.000 0.00 0.00 35.97 1.73
3371 4382 7.658575 AGTTGAAGCAAAATAGCATGTTTTGAT 59.341 29.630 18.93 12.55 45.02 2.57
3380 4391 8.922058 AAATAGCATGTTTTGATGACAATCTC 57.078 30.769 0.00 0.00 35.85 2.75
3388 4399 9.683069 ATGTTTTGATGACAATCTCTAACAAAC 57.317 29.630 0.00 0.00 34.67 2.93
3399 4410 7.169308 ACAATCTCTAACAAACTAGTTGACACG 59.831 37.037 9.34 0.00 39.87 4.49
3406 4417 6.913873 ACAAACTAGTTGACACGTTGTTAT 57.086 33.333 9.34 0.00 39.87 1.89
3445 4456 8.707938 TGTGATGAGAGAAATATGTGTACTTG 57.292 34.615 0.00 0.00 0.00 3.16
3464 4475 8.646900 TGTACTTGTACATATGATAAGATGGCA 58.353 33.333 10.38 0.00 0.00 4.92
3539 4554 9.702494 AGGTATACGCTATTGTAATACCTTTTC 57.298 33.333 6.53 0.00 36.50 2.29
3543 4558 7.535489 ACGCTATTGTAATACCTTTTCTCAC 57.465 36.000 0.00 0.00 0.00 3.51
3573 4596 7.390027 AGAAATTAGTCTTGATGCAGTAGTGT 58.610 34.615 0.00 0.00 0.00 3.55
3585 4608 0.736325 AGTAGTGTGGATTGCGCGAC 60.736 55.000 12.10 0.88 0.00 5.19
3586 4609 1.447140 TAGTGTGGATTGCGCGACC 60.447 57.895 12.10 7.76 0.00 4.79
3587 4610 4.147322 GTGTGGATTGCGCGACCG 62.147 66.667 12.10 0.00 37.57 4.79
3588 4611 4.673298 TGTGGATTGCGCGACCGT 62.673 61.111 12.10 0.00 36.67 4.83
3595 4619 0.385473 ATTGCGCGACCGTGAAAAAG 60.385 50.000 12.10 0.00 36.67 2.27
3597 4621 2.554272 CGCGACCGTGAAAAAGGG 59.446 61.111 0.00 0.00 39.88 3.95
3605 4629 2.360801 ACCGTGAAAAAGGGACATGTTG 59.639 45.455 0.00 0.00 37.26 3.33
3610 4634 5.175127 GTGAAAAAGGGACATGTTGTTTGT 58.825 37.500 0.00 0.00 0.00 2.83
3621 4645 6.879458 GGACATGTTGTTTGTATACTTCTCCT 59.121 38.462 0.00 0.00 0.00 3.69
3650 4674 8.770010 TCTTCTATATCTAAATAGCTAGCCCC 57.230 38.462 12.13 0.00 30.79 5.80
3651 4675 7.785506 TCTTCTATATCTAAATAGCTAGCCCCC 59.214 40.741 12.13 0.00 30.79 5.40
3652 4676 6.993408 TCTATATCTAAATAGCTAGCCCCCA 58.007 40.000 12.13 0.00 30.79 4.96
3653 4677 5.959583 ATATCTAAATAGCTAGCCCCCAC 57.040 43.478 12.13 0.00 0.00 4.61
3654 4678 3.346146 TCTAAATAGCTAGCCCCCACT 57.654 47.619 12.13 0.00 0.00 4.00
3655 4679 4.480777 TCTAAATAGCTAGCCCCCACTA 57.519 45.455 12.13 0.00 0.00 2.74
3656 4680 4.823107 TCTAAATAGCTAGCCCCCACTAA 58.177 43.478 12.13 0.00 0.00 2.24
3657 4681 5.412384 TCTAAATAGCTAGCCCCCACTAAT 58.588 41.667 12.13 0.00 0.00 1.73
3658 4682 6.567854 TCTAAATAGCTAGCCCCCACTAATA 58.432 40.000 12.13 0.00 0.00 0.98
3659 4683 7.196901 TCTAAATAGCTAGCCCCCACTAATAT 58.803 38.462 12.13 0.00 0.00 1.28
3660 4684 8.349118 TCTAAATAGCTAGCCCCCACTAATATA 58.651 37.037 12.13 0.00 0.00 0.86
3661 4685 9.160412 CTAAATAGCTAGCCCCCACTAATATAT 57.840 37.037 12.13 0.00 0.00 0.86
3662 4686 8.407313 AAATAGCTAGCCCCCACTAATATATT 57.593 34.615 12.13 2.97 0.00 1.28
3663 4687 8.407313 AATAGCTAGCCCCCACTAATATATTT 57.593 34.615 12.13 0.00 0.00 1.40
3664 4688 6.314899 AGCTAGCCCCCACTAATATATTTC 57.685 41.667 12.13 0.00 0.00 2.17
3665 4689 6.032693 AGCTAGCCCCCACTAATATATTTCT 58.967 40.000 12.13 0.00 0.00 2.52
3666 4690 6.157123 AGCTAGCCCCCACTAATATATTTCTC 59.843 42.308 12.13 0.00 0.00 2.87
3667 4691 6.157123 GCTAGCCCCCACTAATATATTTCTCT 59.843 42.308 2.29 0.00 0.00 3.10
3668 4692 6.628644 AGCCCCCACTAATATATTTCTCTC 57.371 41.667 2.68 0.00 0.00 3.20
3669 4693 6.091555 AGCCCCCACTAATATATTTCTCTCA 58.908 40.000 2.68 0.00 0.00 3.27
3670 4694 6.562608 AGCCCCCACTAATATATTTCTCTCAA 59.437 38.462 2.68 0.00 0.00 3.02
3671 4695 6.655425 GCCCCCACTAATATATTTCTCTCAAC 59.345 42.308 2.68 0.00 0.00 3.18
3672 4696 7.691791 GCCCCCACTAATATATTTCTCTCAACA 60.692 40.741 2.68 0.00 0.00 3.33
3673 4697 8.386264 CCCCCACTAATATATTTCTCTCAACAT 58.614 37.037 2.68 0.00 0.00 2.71
3683 4707 4.952262 TTCTCTCAACATACAAGCATGC 57.048 40.909 10.51 10.51 0.00 4.06
3684 4708 3.273434 TCTCTCAACATACAAGCATGCC 58.727 45.455 15.66 0.00 0.00 4.40
3685 4709 3.011818 CTCTCAACATACAAGCATGCCA 58.988 45.455 15.66 0.00 0.00 4.92
3686 4710 2.749076 TCTCAACATACAAGCATGCCAC 59.251 45.455 15.66 0.00 0.00 5.01
3687 4711 1.818060 TCAACATACAAGCATGCCACC 59.182 47.619 15.66 0.00 0.00 4.61
3688 4712 1.820519 CAACATACAAGCATGCCACCT 59.179 47.619 15.66 0.00 0.00 4.00
3689 4713 1.755179 ACATACAAGCATGCCACCTC 58.245 50.000 15.66 0.00 0.00 3.85
3690 4714 1.004628 ACATACAAGCATGCCACCTCA 59.995 47.619 15.66 0.00 0.00 3.86
3691 4715 2.304092 CATACAAGCATGCCACCTCAT 58.696 47.619 15.66 0.00 0.00 2.90
3692 4716 2.042686 TACAAGCATGCCACCTCATC 57.957 50.000 15.66 0.00 0.00 2.92
3693 4717 0.038599 ACAAGCATGCCACCTCATCA 59.961 50.000 15.66 0.00 0.00 3.07
3694 4718 1.341679 ACAAGCATGCCACCTCATCAT 60.342 47.619 15.66 0.00 0.00 2.45
3695 4719 1.754803 CAAGCATGCCACCTCATCATT 59.245 47.619 15.66 0.00 0.00 2.57
3696 4720 1.688772 AGCATGCCACCTCATCATTC 58.311 50.000 15.66 0.00 0.00 2.67
3697 4721 1.064240 AGCATGCCACCTCATCATTCA 60.064 47.619 15.66 0.00 0.00 2.57
3698 4722 1.752498 GCATGCCACCTCATCATTCAA 59.248 47.619 6.36 0.00 0.00 2.69
3699 4723 2.480759 GCATGCCACCTCATCATTCAAC 60.481 50.000 6.36 0.00 0.00 3.18
3700 4724 2.583024 TGCCACCTCATCATTCAACA 57.417 45.000 0.00 0.00 0.00 3.33
3701 4725 3.090210 TGCCACCTCATCATTCAACAT 57.910 42.857 0.00 0.00 0.00 2.71
3702 4726 2.756207 TGCCACCTCATCATTCAACATG 59.244 45.455 0.00 0.00 0.00 3.21
3703 4727 2.480759 GCCACCTCATCATTCAACATGC 60.481 50.000 0.00 0.00 0.00 4.06
3704 4728 2.756207 CCACCTCATCATTCAACATGCA 59.244 45.455 0.00 0.00 0.00 3.96
3705 4729 3.383505 CCACCTCATCATTCAACATGCAT 59.616 43.478 0.00 0.00 0.00 3.96
3706 4730 4.581409 CCACCTCATCATTCAACATGCATA 59.419 41.667 0.00 0.00 0.00 3.14
3707 4731 5.278315 CCACCTCATCATTCAACATGCATAG 60.278 44.000 0.00 0.00 0.00 2.23
3708 4732 4.825634 ACCTCATCATTCAACATGCATAGG 59.174 41.667 0.00 0.00 0.00 2.57
3709 4733 5.067954 CCTCATCATTCAACATGCATAGGA 58.932 41.667 0.00 0.00 0.00 2.94
3710 4734 5.533528 CCTCATCATTCAACATGCATAGGAA 59.466 40.000 0.00 4.05 0.00 3.36
3711 4735 6.040054 CCTCATCATTCAACATGCATAGGAAA 59.960 38.462 0.00 0.00 0.00 3.13
3712 4736 7.407393 TCATCATTCAACATGCATAGGAAAA 57.593 32.000 0.00 0.00 0.00 2.29
3713 4737 7.485810 TCATCATTCAACATGCATAGGAAAAG 58.514 34.615 0.00 1.96 0.00 2.27
3714 4738 6.211587 TCATTCAACATGCATAGGAAAAGG 57.788 37.500 0.00 0.00 0.00 3.11
3715 4739 4.454728 TTCAACATGCATAGGAAAAGGC 57.545 40.909 0.00 0.00 0.00 4.35
3716 4740 2.760092 TCAACATGCATAGGAAAAGGCC 59.240 45.455 0.00 0.00 0.00 5.19
3717 4741 2.496871 CAACATGCATAGGAAAAGGCCA 59.503 45.455 5.01 0.00 0.00 5.36
3718 4742 2.818921 ACATGCATAGGAAAAGGCCAA 58.181 42.857 5.01 0.00 0.00 4.52
3719 4743 2.497273 ACATGCATAGGAAAAGGCCAAC 59.503 45.455 5.01 0.00 0.00 3.77
3720 4744 1.555967 TGCATAGGAAAAGGCCAACC 58.444 50.000 5.01 2.06 0.00 3.77
3729 4753 4.102113 AGGCCAACCTCAACATGC 57.898 55.556 5.01 0.00 46.34 4.06
3730 4754 1.153524 AGGCCAACCTCAACATGCA 59.846 52.632 5.01 0.00 46.34 3.96
3731 4755 0.469705 AGGCCAACCTCAACATGCAA 60.470 50.000 5.01 0.00 46.34 4.08
3732 4756 0.319813 GGCCAACCTCAACATGCAAC 60.320 55.000 0.00 0.00 0.00 4.17
3733 4757 0.675633 GCCAACCTCAACATGCAACT 59.324 50.000 0.00 0.00 0.00 3.16
3734 4758 1.885887 GCCAACCTCAACATGCAACTA 59.114 47.619 0.00 0.00 0.00 2.24
3735 4759 2.493278 GCCAACCTCAACATGCAACTAT 59.507 45.455 0.00 0.00 0.00 2.12
3736 4760 3.674138 GCCAACCTCAACATGCAACTATG 60.674 47.826 0.00 0.00 0.00 2.23
3759 4783 8.633075 ATGCATATTAAAAATCCACTTCAACG 57.367 30.769 0.00 0.00 0.00 4.10
3760 4784 7.598278 TGCATATTAAAAATCCACTTCAACGT 58.402 30.769 0.00 0.00 0.00 3.99
3761 4785 7.540400 TGCATATTAAAAATCCACTTCAACGTG 59.460 33.333 0.00 0.00 34.71 4.49
3762 4786 7.462724 GCATATTAAAAATCCACTTCAACGTGC 60.463 37.037 0.00 0.00 33.60 5.34
3763 4787 3.791973 AAAAATCCACTTCAACGTGCA 57.208 38.095 0.00 0.00 33.60 4.57
3764 4788 3.791973 AAAATCCACTTCAACGTGCAA 57.208 38.095 0.00 0.00 33.60 4.08
3765 4789 3.791973 AAATCCACTTCAACGTGCAAA 57.208 38.095 0.00 0.00 33.60 3.68
3766 4790 2.774439 ATCCACTTCAACGTGCAAAC 57.226 45.000 0.00 0.00 33.60 2.93
3767 4791 1.454201 TCCACTTCAACGTGCAAACA 58.546 45.000 0.00 0.00 33.60 2.83
3768 4792 2.020720 TCCACTTCAACGTGCAAACAT 58.979 42.857 0.00 0.00 33.60 2.71
3769 4793 2.118683 CCACTTCAACGTGCAAACATG 58.881 47.619 0.00 0.00 38.85 3.21
3770 4794 1.518102 CACTTCAACGTGCAAACATGC 59.482 47.619 0.00 0.00 36.15 4.06
3771 4795 1.133982 ACTTCAACGTGCAAACATGCA 59.866 42.857 0.00 0.00 43.22 3.96
3789 4813 6.612247 CATGCATGCATGTAAAATTCCATT 57.388 33.333 40.30 13.05 46.20 3.16
3790 4814 6.655062 CATGCATGCATGTAAAATTCCATTC 58.345 36.000 40.30 6.83 46.20 2.67
3791 4815 5.979993 TGCATGCATGTAAAATTCCATTCT 58.020 33.333 26.79 0.00 0.00 2.40
3792 4816 7.110043 TGCATGCATGTAAAATTCCATTCTA 57.890 32.000 26.79 0.00 0.00 2.10
3793 4817 7.728148 TGCATGCATGTAAAATTCCATTCTAT 58.272 30.769 26.79 0.00 0.00 1.98
3794 4818 8.205512 TGCATGCATGTAAAATTCCATTCTATT 58.794 29.630 26.79 0.00 0.00 1.73
3795 4819 9.695526 GCATGCATGTAAAATTCCATTCTATTA 57.304 29.630 26.79 0.00 0.00 0.98
3872 4896 9.825109 TTCACGTATCATATAACCAAAATCTCA 57.175 29.630 0.00 0.00 0.00 3.27
3873 4897 9.996554 TCACGTATCATATAACCAAAATCTCAT 57.003 29.630 0.00 0.00 0.00 2.90
3900 4924 9.092876 TGAAATAATTCAAAATATTCCCGCAAC 57.907 29.630 0.00 0.00 42.47 4.17
3901 4925 9.092876 GAAATAATTCAAAATATTCCCGCAACA 57.907 29.630 0.00 0.00 35.54 3.33
3902 4926 9.442047 AAATAATTCAAAATATTCCCGCAACAA 57.558 25.926 0.00 0.00 0.00 2.83
3903 4927 6.720012 AATTCAAAATATTCCCGCAACAAC 57.280 33.333 0.00 0.00 0.00 3.32
3904 4928 3.827625 TCAAAATATTCCCGCAACAACG 58.172 40.909 0.00 0.00 0.00 4.10
3905 4929 3.253677 TCAAAATATTCCCGCAACAACGT 59.746 39.130 0.00 0.00 0.00 3.99
3906 4930 2.911819 AATATTCCCGCAACAACGTG 57.088 45.000 0.00 0.00 0.00 4.49
3907 4931 0.450184 ATATTCCCGCAACAACGTGC 59.550 50.000 0.00 0.00 41.32 5.34
3914 4938 3.669344 CAACAACGTGCGGGCCAT 61.669 61.111 4.39 0.00 0.00 4.40
3915 4939 3.361977 AACAACGTGCGGGCCATC 61.362 61.111 4.39 0.00 0.00 3.51
3916 4940 4.634703 ACAACGTGCGGGCCATCA 62.635 61.111 4.39 0.00 0.00 3.07
3917 4941 3.133464 CAACGTGCGGGCCATCAT 61.133 61.111 4.39 0.00 0.00 2.45
3918 4942 2.824041 AACGTGCGGGCCATCATC 60.824 61.111 4.39 0.00 0.00 2.92
3919 4943 3.329542 AACGTGCGGGCCATCATCT 62.330 57.895 4.39 0.00 0.00 2.90
3920 4944 1.966901 AACGTGCGGGCCATCATCTA 61.967 55.000 4.39 0.00 0.00 1.98
3921 4945 1.227527 CGTGCGGGCCATCATCTAA 60.228 57.895 4.39 0.00 0.00 2.10
3922 4946 0.603707 CGTGCGGGCCATCATCTAAT 60.604 55.000 4.39 0.00 0.00 1.73
3923 4947 1.337728 CGTGCGGGCCATCATCTAATA 60.338 52.381 4.39 0.00 0.00 0.98
3924 4948 2.778299 GTGCGGGCCATCATCTAATAA 58.222 47.619 4.39 0.00 0.00 1.40
3925 4949 2.484264 GTGCGGGCCATCATCTAATAAC 59.516 50.000 4.39 0.00 0.00 1.89
3926 4950 2.371841 TGCGGGCCATCATCTAATAACT 59.628 45.455 4.39 0.00 0.00 2.24
3927 4951 3.580895 TGCGGGCCATCATCTAATAACTA 59.419 43.478 4.39 0.00 0.00 2.24
3935 4959 7.041098 GGCCATCATCTAATAACTACAAAGTGG 60.041 40.741 0.00 0.00 35.62 4.00
4008 5032 1.632965 AACCTCGGATTACCTGGCCC 61.633 60.000 0.00 0.00 33.14 5.80
4012 5036 2.135581 CGGATTACCTGGCCCGGTA 61.136 63.158 21.22 21.22 38.49 4.02
4019 5043 1.078426 CCTGGCCCGGTAACTTGAG 60.078 63.158 4.74 0.00 0.00 3.02
4063 5087 3.772572 TGGTGAGCAGCCACTTAGTATAA 59.227 43.478 12.17 0.00 37.24 0.98
4075 5099 9.953565 AGCCACTTAGTATAAACAATCTTACAA 57.046 29.630 0.00 0.00 0.00 2.41
4092 5116 7.136289 TCTTACAACGGACAAATTAATGACC 57.864 36.000 0.00 0.00 32.71 4.02
4100 5124 4.814771 GGACAAATTAATGACCCTAGACGG 59.185 45.833 0.00 0.00 0.00 4.79
4107 5131 3.543680 ATGACCCTAGACGGTTGAATG 57.456 47.619 0.00 0.00 35.79 2.67
4112 5136 2.643551 CCTAGACGGTTGAATGCCAAT 58.356 47.619 0.00 0.00 37.08 3.16
4113 5137 3.433031 CCCTAGACGGTTGAATGCCAATA 60.433 47.826 0.00 0.00 37.08 1.90
4114 5138 4.389374 CCTAGACGGTTGAATGCCAATAT 58.611 43.478 0.00 0.00 37.08 1.28
4115 5139 4.821805 CCTAGACGGTTGAATGCCAATATT 59.178 41.667 0.00 0.00 37.08 1.28
4116 5140 5.299279 CCTAGACGGTTGAATGCCAATATTT 59.701 40.000 0.00 0.00 37.08 1.40
4117 5141 6.485313 CCTAGACGGTTGAATGCCAATATTTA 59.515 38.462 0.00 0.00 37.08 1.40
4118 5142 6.767524 AGACGGTTGAATGCCAATATTTAA 57.232 33.333 0.00 0.00 37.08 1.52
4119 5143 7.346751 AGACGGTTGAATGCCAATATTTAAT 57.653 32.000 0.00 0.00 37.08 1.40
4120 5144 7.781056 AGACGGTTGAATGCCAATATTTAATT 58.219 30.769 0.00 0.00 37.08 1.40
4121 5145 8.257306 AGACGGTTGAATGCCAATATTTAATTT 58.743 29.630 0.00 0.00 37.08 1.82
4122 5146 8.785329 ACGGTTGAATGCCAATATTTAATTTT 57.215 26.923 0.00 0.00 37.08 1.82
4123 5147 8.878769 ACGGTTGAATGCCAATATTTAATTTTC 58.121 29.630 0.00 0.00 37.08 2.29
4124 5148 9.097257 CGGTTGAATGCCAATATTTAATTTTCT 57.903 29.630 0.00 0.00 37.08 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
14 15 0.042581 TCAGATCCTAGCCACCACCA 59.957 55.000 0.00 0.00 0.00 4.17
16 17 0.466124 GGTCAGATCCTAGCCACCAC 59.534 60.000 0.00 0.00 0.00 4.16
25 26 2.024825 GCAGTACCGAGGTCAGATCCT 61.025 57.143 0.00 0.00 40.97 3.24
47 48 2.358247 GACCCACAATGCCGTCGT 60.358 61.111 0.00 0.00 0.00 4.34
50 51 2.034066 CCAGACCCACAATGCCGT 59.966 61.111 0.00 0.00 0.00 5.68
185 196 0.759959 TGGGAACGTGCCAAGAGTAA 59.240 50.000 16.38 0.00 33.84 2.24
217 228 2.629763 GACGCAGAAAAACGCCGT 59.370 55.556 0.00 0.00 34.22 5.68
267 279 3.398629 AGGTAGTGGATAGGGGTCTAGAC 59.601 52.174 14.87 14.87 0.00 2.59
295 307 7.937942 CAGATGATTGATTGATCTAGGGTTTCT 59.062 37.037 0.00 0.00 0.00 2.52
317 329 1.627329 ACATGAGTGCCACTGTCAGAT 59.373 47.619 0.00 0.00 0.00 2.90
318 330 1.051008 ACATGAGTGCCACTGTCAGA 58.949 50.000 0.00 0.00 0.00 3.27
330 343 2.515854 AGTGGAGTACGACACATGAGT 58.484 47.619 20.13 0.00 39.99 3.41
345 358 0.036388 GAATGACGCCCTCAAGTGGA 60.036 55.000 0.00 0.00 30.60 4.02
348 361 1.611673 CCAAGAATGACGCCCTCAAGT 60.612 52.381 0.00 0.00 30.60 3.16
378 391 1.002868 CACTGGTCCCTTGAGCCTG 60.003 63.158 0.00 0.00 38.24 4.85
398 411 1.589196 GCTCCACCGTAGATGTCGC 60.589 63.158 0.00 0.00 0.00 5.19
417 430 0.320771 GATGCGTCACAGGGAACACT 60.321 55.000 0.00 0.00 0.00 3.55
496 509 2.202570 CCTCCCTACGCACGTTCG 60.203 66.667 5.94 5.94 0.00 3.95
549 564 2.484062 GCATCGACCTTGCCATGGG 61.484 63.158 15.13 0.00 33.95 4.00
550 565 2.827051 CGCATCGACCTTGCCATGG 61.827 63.158 7.63 7.63 36.75 3.66
552 567 3.204827 GCGCATCGACCTTGCCAT 61.205 61.111 0.30 0.00 36.75 4.40
578 593 5.427806 TCTTCCATCAATCCATCTTCAGAGT 59.572 40.000 0.00 0.00 0.00 3.24
615 630 1.945394 GGTCCGACGCACTCTTATAGA 59.055 52.381 0.00 0.00 0.00 1.98
620 636 4.052229 CCGGTCCGACGCACTCTT 62.052 66.667 14.39 0.00 0.00 2.85
648 664 1.679944 CCAAGCCACATACCAGGTCTG 60.680 57.143 0.00 0.00 0.00 3.51
720 741 1.131638 AGGGTGCAGAAAGTGTGAGA 58.868 50.000 0.00 0.00 0.00 3.27
774 797 0.398696 TCTTTGAAGCCGCCACCTTA 59.601 50.000 0.00 0.00 0.00 2.69
778 801 2.682856 TCAATATCTTTGAAGCCGCCAC 59.317 45.455 0.00 0.00 0.00 5.01
855 878 2.364186 TCCGGGCTCTGCATCTGA 60.364 61.111 0.00 0.00 0.00 3.27
904 933 1.342672 TAATCTCCGGCCCCCAGTTC 61.343 60.000 0.00 0.00 0.00 3.01
905 934 0.917333 TTAATCTCCGGCCCCCAGTT 60.917 55.000 0.00 0.00 0.00 3.16
906 935 0.697854 ATTAATCTCCGGCCCCCAGT 60.698 55.000 0.00 0.00 0.00 4.00
907 936 0.478507 AATTAATCTCCGGCCCCCAG 59.521 55.000 0.00 0.00 0.00 4.45
908 937 0.476771 GAATTAATCTCCGGCCCCCA 59.523 55.000 0.00 0.00 0.00 4.96
909 938 0.251209 GGAATTAATCTCCGGCCCCC 60.251 60.000 0.00 0.00 0.00 5.40
910 939 0.476771 TGGAATTAATCTCCGGCCCC 59.523 55.000 0.00 0.00 35.55 5.80
911 940 2.162681 CATGGAATTAATCTCCGGCCC 58.837 52.381 0.00 0.00 35.55 5.80
912 941 2.814336 GTCATGGAATTAATCTCCGGCC 59.186 50.000 0.00 0.00 35.55 6.13
913 942 3.744660 AGTCATGGAATTAATCTCCGGC 58.255 45.455 0.00 2.32 35.55 6.13
914 943 4.023707 GCAAGTCATGGAATTAATCTCCGG 60.024 45.833 0.00 0.00 35.55 5.14
915 944 4.023707 GGCAAGTCATGGAATTAATCTCCG 60.024 45.833 0.00 0.00 35.55 4.63
916 945 4.279420 GGGCAAGTCATGGAATTAATCTCC 59.721 45.833 8.79 8.79 0.00 3.71
917 946 4.889409 TGGGCAAGTCATGGAATTAATCTC 59.111 41.667 0.00 0.00 0.00 2.75
918 947 4.870636 TGGGCAAGTCATGGAATTAATCT 58.129 39.130 0.00 0.00 0.00 2.40
919 948 5.796424 ATGGGCAAGTCATGGAATTAATC 57.204 39.130 0.00 0.00 0.00 1.75
920 949 8.974238 CATATATGGGCAAGTCATGGAATTAAT 58.026 33.333 4.68 0.00 0.00 1.40
921 950 7.093814 GCATATATGGGCAAGTCATGGAATTAA 60.094 37.037 14.51 0.00 0.00 1.40
922 951 6.377996 GCATATATGGGCAAGTCATGGAATTA 59.622 38.462 14.51 0.00 0.00 1.40
923 952 5.186409 GCATATATGGGCAAGTCATGGAATT 59.814 40.000 14.51 0.00 0.00 2.17
924 953 4.708421 GCATATATGGGCAAGTCATGGAAT 59.292 41.667 14.51 0.00 0.00 3.01
925 954 4.081406 GCATATATGGGCAAGTCATGGAA 58.919 43.478 14.51 0.00 0.00 3.53
926 955 3.074242 TGCATATATGGGCAAGTCATGGA 59.926 43.478 14.51 0.00 37.03 3.41
927 956 3.423749 TGCATATATGGGCAAGTCATGG 58.576 45.455 14.51 0.00 37.03 3.66
934 963 2.886523 GCTCACTTGCATATATGGGCAA 59.113 45.455 14.51 11.67 46.84 4.52
935 964 2.507484 GCTCACTTGCATATATGGGCA 58.493 47.619 14.51 4.30 38.48 5.36
936 965 1.466167 CGCTCACTTGCATATATGGGC 59.534 52.381 14.51 1.55 35.10 5.36
937 966 1.466167 GCGCTCACTTGCATATATGGG 59.534 52.381 14.51 0.00 0.00 4.00
938 967 1.127397 CGCGCTCACTTGCATATATGG 59.873 52.381 14.51 0.70 0.00 2.74
939 968 1.794701 ACGCGCTCACTTGCATATATG 59.205 47.619 5.73 8.45 0.00 1.78
940 969 1.794701 CACGCGCTCACTTGCATATAT 59.205 47.619 5.73 0.00 0.00 0.86
941 970 1.208259 CACGCGCTCACTTGCATATA 58.792 50.000 5.73 0.00 0.00 0.86
942 971 0.740868 ACACGCGCTCACTTGCATAT 60.741 50.000 5.73 0.00 0.00 1.78
943 972 1.374125 ACACGCGCTCACTTGCATA 60.374 52.632 5.73 0.00 0.00 3.14
944 973 2.666190 ACACGCGCTCACTTGCAT 60.666 55.556 5.73 0.00 0.00 3.96
945 974 3.639008 CACACGCGCTCACTTGCA 61.639 61.111 5.73 0.00 0.00 4.08
968 997 2.480555 GGTCAGCGAATGCAACCG 59.519 61.111 6.72 6.72 46.23 4.44
969 998 2.877691 GGGTCAGCGAATGCAACC 59.122 61.111 0.00 0.00 46.23 3.77
970 999 1.573829 TTCGGGTCAGCGAATGCAAC 61.574 55.000 0.00 0.00 46.23 4.17
971 1000 0.886938 TTTCGGGTCAGCGAATGCAA 60.887 50.000 0.00 0.00 46.23 4.08
972 1001 1.298157 CTTTCGGGTCAGCGAATGCA 61.298 55.000 0.00 0.00 46.23 3.96
973 1002 1.019278 TCTTTCGGGTCAGCGAATGC 61.019 55.000 0.00 0.00 43.24 3.56
974 1003 1.656652 ATCTTTCGGGTCAGCGAATG 58.343 50.000 0.00 0.00 0.00 2.67
975 1004 3.132289 TCTTATCTTTCGGGTCAGCGAAT 59.868 43.478 0.00 0.00 0.00 3.34
976 1005 2.494471 TCTTATCTTTCGGGTCAGCGAA 59.506 45.455 0.00 0.00 0.00 4.70
977 1006 2.097036 TCTTATCTTTCGGGTCAGCGA 58.903 47.619 0.00 0.00 0.00 4.93
978 1007 2.464865 CTCTTATCTTTCGGGTCAGCG 58.535 52.381 0.00 0.00 0.00 5.18
979 1008 2.205911 GCTCTTATCTTTCGGGTCAGC 58.794 52.381 0.00 0.00 0.00 4.26
980 1009 3.526931 TGCTCTTATCTTTCGGGTCAG 57.473 47.619 0.00 0.00 0.00 3.51
981 1010 3.432186 CCATGCTCTTATCTTTCGGGTCA 60.432 47.826 0.00 0.00 0.00 4.02
982 1011 3.134458 CCATGCTCTTATCTTTCGGGTC 58.866 50.000 0.00 0.00 0.00 4.46
983 1012 2.771943 TCCATGCTCTTATCTTTCGGGT 59.228 45.455 0.00 0.00 0.00 5.28
984 1013 3.397482 CTCCATGCTCTTATCTTTCGGG 58.603 50.000 0.00 0.00 0.00 5.14
985 1014 2.805099 GCTCCATGCTCTTATCTTTCGG 59.195 50.000 0.00 0.00 38.95 4.30
986 1015 3.461061 TGCTCCATGCTCTTATCTTTCG 58.539 45.455 0.00 0.00 43.37 3.46
987 1016 4.450053 ACTGCTCCATGCTCTTATCTTTC 58.550 43.478 0.00 0.00 43.37 2.62
988 1017 4.080695 TGACTGCTCCATGCTCTTATCTTT 60.081 41.667 0.00 0.00 43.37 2.52
989 1018 3.453717 TGACTGCTCCATGCTCTTATCTT 59.546 43.478 0.00 0.00 43.37 2.40
990 1019 3.036819 TGACTGCTCCATGCTCTTATCT 58.963 45.455 0.00 0.00 43.37 1.98
991 1020 3.465742 TGACTGCTCCATGCTCTTATC 57.534 47.619 0.00 0.00 43.37 1.75
992 1021 3.806380 CTTGACTGCTCCATGCTCTTAT 58.194 45.455 0.00 0.00 43.37 1.73
993 1022 2.679059 GCTTGACTGCTCCATGCTCTTA 60.679 50.000 0.00 0.00 43.37 2.10
994 1023 1.949547 GCTTGACTGCTCCATGCTCTT 60.950 52.381 0.00 0.00 43.37 2.85
995 1024 0.392729 GCTTGACTGCTCCATGCTCT 60.393 55.000 0.00 0.00 43.37 4.09
996 1025 0.675837 TGCTTGACTGCTCCATGCTC 60.676 55.000 0.00 0.00 43.37 4.26
997 1026 0.251033 TTGCTTGACTGCTCCATGCT 60.251 50.000 0.00 0.00 43.37 3.79
998 1027 0.170561 CTTGCTTGACTGCTCCATGC 59.829 55.000 0.00 0.00 43.25 4.06
999 1028 0.809385 CCTTGCTTGACTGCTCCATG 59.191 55.000 0.00 0.00 0.00 3.66
1000 1029 0.694771 TCCTTGCTTGACTGCTCCAT 59.305 50.000 0.00 0.00 0.00 3.41
1001 1030 0.473755 TTCCTTGCTTGACTGCTCCA 59.526 50.000 0.00 0.00 0.00 3.86
1002 1031 1.609208 TTTCCTTGCTTGACTGCTCC 58.391 50.000 0.00 0.00 0.00 4.70
1003 1032 2.603173 CGTTTTCCTTGCTTGACTGCTC 60.603 50.000 0.00 0.00 0.00 4.26
1004 1033 1.334869 CGTTTTCCTTGCTTGACTGCT 59.665 47.619 0.00 0.00 0.00 4.24
1005 1034 1.600413 CCGTTTTCCTTGCTTGACTGC 60.600 52.381 0.00 0.00 0.00 4.40
1006 1035 1.946768 TCCGTTTTCCTTGCTTGACTG 59.053 47.619 0.00 0.00 0.00 3.51
1007 1036 2.341846 TCCGTTTTCCTTGCTTGACT 57.658 45.000 0.00 0.00 0.00 3.41
1008 1037 3.643159 AATCCGTTTTCCTTGCTTGAC 57.357 42.857 0.00 0.00 0.00 3.18
1009 1038 5.105917 GGATTAATCCGTTTTCCTTGCTTGA 60.106 40.000 18.61 0.00 37.19 3.02
1010 1039 5.102313 GGATTAATCCGTTTTCCTTGCTTG 58.898 41.667 18.61 0.00 37.19 4.01
1011 1040 5.324784 GGATTAATCCGTTTTCCTTGCTT 57.675 39.130 18.61 0.00 37.19 3.91
1012 1041 4.983671 GGATTAATCCGTTTTCCTTGCT 57.016 40.909 18.61 0.00 37.19 3.91
1024 1053 4.805581 CCGGGACTCGCTGGATTAATCC 62.806 59.091 25.17 25.17 41.57 3.01
1025 1054 1.605712 CCGGGACTCGCTGGATTAATC 60.606 57.143 6.93 6.93 37.59 1.75
1026 1055 0.393077 CCGGGACTCGCTGGATTAAT 59.607 55.000 0.00 0.00 37.59 1.40
1027 1056 0.685131 TCCGGGACTCGCTGGATTAA 60.685 55.000 0.00 0.00 37.59 1.40
1028 1057 1.076559 TCCGGGACTCGCTGGATTA 60.077 57.895 0.00 0.00 37.59 1.75
1038 1067 3.999285 AGGCACTCCTCCGGGACT 61.999 66.667 0.00 0.00 38.72 3.85
1039 1068 3.775654 CAGGCACTCCTCCGGGAC 61.776 72.222 0.00 0.00 41.93 4.46
1057 1086 1.913262 TCAGGCCGATGACTGTGGT 60.913 57.895 0.00 0.00 36.17 4.16
1059 1088 4.192000 GTCAGGCCGATGACTGTG 57.808 61.111 16.01 0.00 45.03 3.66
1064 1093 3.838271 GCGAGGTCAGGCCGATGA 61.838 66.667 0.00 0.00 43.70 2.92
1157 1186 1.298014 CAGTCCAGAGGCAGGAACC 59.702 63.158 0.00 0.00 36.80 3.62
1204 1233 1.195115 CTGGAGGAGGAATCCACGAA 58.805 55.000 0.61 0.00 41.96 3.85
1223 1252 5.723181 TGAGATCCATGAAGAGCTCCTTCC 61.723 50.000 10.93 0.00 46.43 3.46
1230 1259 1.068281 TCGCTGAGATCCATGAAGAGC 59.932 52.381 0.00 0.00 0.00 4.09
1263 1292 2.380410 CCTTTTGCCGTCGTCGAGG 61.380 63.158 7.96 7.96 39.71 4.63
1278 1307 4.082125 CAGGAAAATTAGCACTCACCCTT 58.918 43.478 0.00 0.00 0.00 3.95
1293 1322 4.265904 TGTCGTCTTAGCATCAGGAAAA 57.734 40.909 0.00 0.00 0.00 2.29
1304 1333 7.043986 CGATGATCTACCTTTTTGTCGTCTTAG 60.044 40.741 0.00 0.00 0.00 2.18
1305 1334 6.750501 CGATGATCTACCTTTTTGTCGTCTTA 59.249 38.462 0.00 0.00 0.00 2.10
1306 1335 5.577164 CGATGATCTACCTTTTTGTCGTCTT 59.423 40.000 0.00 0.00 0.00 3.01
1307 1336 5.103000 CGATGATCTACCTTTTTGTCGTCT 58.897 41.667 0.00 0.00 0.00 4.18
1308 1337 5.100259 TCGATGATCTACCTTTTTGTCGTC 58.900 41.667 0.00 0.00 0.00 4.20
1309 1338 5.068234 TCGATGATCTACCTTTTTGTCGT 57.932 39.130 0.00 0.00 0.00 4.34
1310 1339 6.589830 AATCGATGATCTACCTTTTTGTCG 57.410 37.500 0.00 0.00 0.00 4.35
1311 1340 7.752695 ACAAATCGATGATCTACCTTTTTGTC 58.247 34.615 0.00 0.00 31.23 3.18
1330 1359 5.324739 TCAGAGAAAACGACGAACAAATC 57.675 39.130 0.00 0.00 0.00 2.17
1331 1360 4.318831 GCTCAGAGAAAACGACGAACAAAT 60.319 41.667 0.00 0.00 0.00 2.32
1332 1361 3.000925 GCTCAGAGAAAACGACGAACAAA 59.999 43.478 0.00 0.00 0.00 2.83
1333 1362 2.538449 GCTCAGAGAAAACGACGAACAA 59.462 45.455 0.00 0.00 0.00 2.83
1335 1364 2.395654 AGCTCAGAGAAAACGACGAAC 58.604 47.619 0.00 0.00 0.00 3.95
1339 1368 5.090083 CACTACTAGCTCAGAGAAAACGAC 58.910 45.833 0.00 0.00 0.00 4.34
1342 1371 9.810545 ATTAATCACTACTAGCTCAGAGAAAAC 57.189 33.333 0.00 0.00 0.00 2.43
1348 1377 7.987750 ATCGATTAATCACTACTAGCTCAGA 57.012 36.000 15.57 0.52 0.00 3.27
1353 2346 9.291664 GTATCCAATCGATTAATCACTACTAGC 57.708 37.037 10.97 0.00 31.92 3.42
1362 2355 8.338259 GCCATGTATGTATCCAATCGATTAATC 58.662 37.037 10.97 5.30 31.92 1.75
1364 2357 7.394016 AGCCATGTATGTATCCAATCGATTAA 58.606 34.615 10.97 2.45 31.92 1.40
1365 2358 6.946340 AGCCATGTATGTATCCAATCGATTA 58.054 36.000 10.97 0.00 31.92 1.75
1366 2359 5.809001 AGCCATGTATGTATCCAATCGATT 58.191 37.500 4.39 4.39 31.92 3.34
1367 2360 5.426689 AGCCATGTATGTATCCAATCGAT 57.573 39.130 0.00 0.00 34.73 3.59
1368 2361 4.890158 AGCCATGTATGTATCCAATCGA 57.110 40.909 0.00 0.00 0.00 3.59
1369 2362 5.240891 AGAAGCCATGTATGTATCCAATCG 58.759 41.667 0.00 0.00 0.00 3.34
1370 2363 7.148573 CGTTAGAAGCCATGTATGTATCCAATC 60.149 40.741 0.00 0.00 0.00 2.67
1371 2364 6.650807 CGTTAGAAGCCATGTATGTATCCAAT 59.349 38.462 0.00 0.00 0.00 3.16
1372 2365 5.989168 CGTTAGAAGCCATGTATGTATCCAA 59.011 40.000 0.00 0.00 0.00 3.53
1373 2366 5.303333 TCGTTAGAAGCCATGTATGTATCCA 59.697 40.000 0.00 0.00 0.00 3.41
1374 2367 5.779922 TCGTTAGAAGCCATGTATGTATCC 58.220 41.667 0.00 0.00 0.00 2.59
1375 2368 7.274468 CAGATCGTTAGAAGCCATGTATGTATC 59.726 40.741 0.00 0.00 0.00 2.24
1376 2369 7.093354 CAGATCGTTAGAAGCCATGTATGTAT 58.907 38.462 0.00 0.00 0.00 2.29
1377 2370 6.447162 CAGATCGTTAGAAGCCATGTATGTA 58.553 40.000 0.00 0.00 0.00 2.29
1378 2371 5.292765 CAGATCGTTAGAAGCCATGTATGT 58.707 41.667 0.00 0.00 0.00 2.29
1379 2372 4.687948 CCAGATCGTTAGAAGCCATGTATG 59.312 45.833 0.00 0.00 0.00 2.39
1380 2373 4.345257 ACCAGATCGTTAGAAGCCATGTAT 59.655 41.667 0.00 0.00 0.00 2.29
1381 2374 3.704566 ACCAGATCGTTAGAAGCCATGTA 59.295 43.478 0.00 0.00 0.00 2.29
1382 2375 2.501723 ACCAGATCGTTAGAAGCCATGT 59.498 45.455 0.00 0.00 0.00 3.21
1383 2376 3.185246 ACCAGATCGTTAGAAGCCATG 57.815 47.619 0.00 0.00 0.00 3.66
1384 2377 3.914426 AACCAGATCGTTAGAAGCCAT 57.086 42.857 0.00 0.00 0.00 4.40
1385 2378 4.811969 TTAACCAGATCGTTAGAAGCCA 57.188 40.909 0.00 0.00 30.20 4.75
1386 2379 5.116882 ACATTAACCAGATCGTTAGAAGCC 58.883 41.667 0.00 0.00 30.20 4.35
1387 2380 6.755141 TGTACATTAACCAGATCGTTAGAAGC 59.245 38.462 0.00 0.00 30.20 3.86
1388 2381 8.873215 ATGTACATTAACCAGATCGTTAGAAG 57.127 34.615 1.41 0.00 30.20 2.85
1411 2404 9.574458 CCCGAAACTCTAACACATAGATATATG 57.426 37.037 5.80 5.80 39.88 1.78
1412 2405 8.251721 GCCCGAAACTCTAACACATAGATATAT 58.748 37.037 0.00 0.00 39.88 0.86
1414 2407 6.267928 AGCCCGAAACTCTAACACATAGATAT 59.732 38.462 0.00 0.00 39.88 1.63
1415 2408 5.597182 AGCCCGAAACTCTAACACATAGATA 59.403 40.000 0.00 0.00 39.88 1.98
1418 2411 4.113354 GAGCCCGAAACTCTAACACATAG 58.887 47.826 0.00 0.00 0.00 2.23
1419 2412 3.118884 GGAGCCCGAAACTCTAACACATA 60.119 47.826 0.00 0.00 34.46 2.29
1420 2413 2.354805 GGAGCCCGAAACTCTAACACAT 60.355 50.000 0.00 0.00 34.46 3.21
1422 2415 1.001633 TGGAGCCCGAAACTCTAACAC 59.998 52.381 0.00 0.00 34.46 3.32
1423 2416 1.275291 CTGGAGCCCGAAACTCTAACA 59.725 52.381 0.00 0.00 34.46 2.41
1424 2417 2.007547 GCTGGAGCCCGAAACTCTAAC 61.008 57.143 0.00 0.00 34.46 2.34
1434 2433 4.637489 CTCGATCGCTGGAGCCCG 62.637 72.222 11.09 0.00 37.91 6.13
1471 2470 2.763039 TGCCATCTCCCTCACAGATAA 58.237 47.619 0.00 0.00 0.00 1.75
1473 2472 1.588239 TTGCCATCTCCCTCACAGAT 58.412 50.000 0.00 0.00 0.00 2.90
1476 2475 0.178767 CGATTGCCATCTCCCTCACA 59.821 55.000 0.00 0.00 0.00 3.58
1478 2477 1.146930 GCGATTGCCATCTCCCTCA 59.853 57.895 0.00 0.00 33.98 3.86
1479 2478 0.179034 AAGCGATTGCCATCTCCCTC 60.179 55.000 0.00 0.00 44.31 4.30
1482 2481 1.450531 CCCAAGCGATTGCCATCTCC 61.451 60.000 8.15 0.00 44.31 3.71
1486 2485 1.846007 TTAACCCAAGCGATTGCCAT 58.154 45.000 8.15 0.00 44.31 4.40
1509 2508 5.445964 GACCTCTCTCTCCAGTAAAGATCT 58.554 45.833 0.00 0.00 0.00 2.75
1532 2531 1.108776 TTACCTCGAATCTGGGTCCG 58.891 55.000 0.00 0.00 34.86 4.79
1539 2538 5.630415 TGGGAATGAATTACCTCGAATCT 57.370 39.130 5.88 0.00 41.57 2.40
1545 2544 7.963532 TCTAGTACATGGGAATGAATTACCTC 58.036 38.462 5.88 0.00 41.57 3.85
1555 2554 7.698163 AGGAATTCTTCTAGTACATGGGAAT 57.302 36.000 5.23 0.00 0.00 3.01
1556 2555 7.510675 AAGGAATTCTTCTAGTACATGGGAA 57.489 36.000 5.23 0.00 0.00 3.97
1558 2557 8.581253 AAAAAGGAATTCTTCTAGTACATGGG 57.419 34.615 5.23 0.00 33.94 4.00
1588 2587 8.908903 CAGTAGAATTCCTGTACATAGACTTCT 58.091 37.037 21.75 21.75 0.00 2.85
1589 2588 7.650104 GCAGTAGAATTCCTGTACATAGACTTC 59.350 40.741 13.78 13.78 0.00 3.01
1590 2589 7.124298 TGCAGTAGAATTCCTGTACATAGACTT 59.876 37.037 11.77 0.00 0.00 3.01
1591 2590 6.607600 TGCAGTAGAATTCCTGTACATAGACT 59.392 38.462 11.77 0.00 0.00 3.24
1592 2591 6.697892 GTGCAGTAGAATTCCTGTACATAGAC 59.302 42.308 20.19 4.64 41.93 2.59
1593 2592 6.183360 GGTGCAGTAGAATTCCTGTACATAGA 60.183 42.308 23.75 0.00 43.45 1.98
1594 2593 5.986135 GGTGCAGTAGAATTCCTGTACATAG 59.014 44.000 23.75 9.19 43.45 2.23
1595 2594 5.423931 TGGTGCAGTAGAATTCCTGTACATA 59.576 40.000 23.75 14.76 43.45 2.29
1596 2595 4.225042 TGGTGCAGTAGAATTCCTGTACAT 59.775 41.667 23.75 1.94 43.45 2.29
1597 2596 3.580895 TGGTGCAGTAGAATTCCTGTACA 59.419 43.478 23.75 13.63 43.45 2.90
1598 2597 3.933332 GTGGTGCAGTAGAATTCCTGTAC 59.067 47.826 18.21 18.21 41.70 2.90
1599 2598 3.580895 TGTGGTGCAGTAGAATTCCTGTA 59.419 43.478 11.77 6.12 0.00 2.74
1600 2599 2.371841 TGTGGTGCAGTAGAATTCCTGT 59.628 45.455 11.77 0.00 0.00 4.00
1601 2600 3.057969 TGTGGTGCAGTAGAATTCCTG 57.942 47.619 0.65 4.63 0.00 3.86
1602 2601 5.435686 TTATGTGGTGCAGTAGAATTCCT 57.564 39.130 0.65 0.00 0.00 3.36
1603 2602 5.414454 TGTTTATGTGGTGCAGTAGAATTCC 59.586 40.000 0.65 0.00 0.00 3.01
1604 2603 6.494893 TGTTTATGTGGTGCAGTAGAATTC 57.505 37.500 0.00 0.00 0.00 2.17
1605 2604 6.071952 CCTTGTTTATGTGGTGCAGTAGAATT 60.072 38.462 0.00 0.00 0.00 2.17
1606 2605 5.415701 CCTTGTTTATGTGGTGCAGTAGAAT 59.584 40.000 0.00 0.00 0.00 2.40
1607 2606 4.759693 CCTTGTTTATGTGGTGCAGTAGAA 59.240 41.667 0.00 0.00 0.00 2.10
1608 2607 4.323417 CCTTGTTTATGTGGTGCAGTAGA 58.677 43.478 0.00 0.00 0.00 2.59
1609 2608 3.119849 GCCTTGTTTATGTGGTGCAGTAG 60.120 47.826 0.00 0.00 0.00 2.57
1610 2609 2.817258 GCCTTGTTTATGTGGTGCAGTA 59.183 45.455 0.00 0.00 0.00 2.74
1611 2610 1.613437 GCCTTGTTTATGTGGTGCAGT 59.387 47.619 0.00 0.00 0.00 4.40
1612 2611 1.888512 AGCCTTGTTTATGTGGTGCAG 59.111 47.619 0.00 0.00 0.00 4.41
1613 2612 1.993956 AGCCTTGTTTATGTGGTGCA 58.006 45.000 0.00 0.00 0.00 4.57
1614 2613 7.687941 ATATATAGCCTTGTTTATGTGGTGC 57.312 36.000 0.00 0.00 0.00 5.01
1641 2640 9.865321 ACGCAATAACAAAAATCTAGAGTAGTA 57.135 29.630 0.00 0.00 0.00 1.82
1642 2641 8.773404 ACGCAATAACAAAAATCTAGAGTAGT 57.227 30.769 0.00 0.00 0.00 2.73
1643 2642 8.869897 TGACGCAATAACAAAAATCTAGAGTAG 58.130 33.333 0.00 0.00 0.00 2.57
1644 2643 8.766000 TGACGCAATAACAAAAATCTAGAGTA 57.234 30.769 0.00 0.00 0.00 2.59
1645 2644 7.387948 ACTGACGCAATAACAAAAATCTAGAGT 59.612 33.333 0.00 0.00 0.00 3.24
1646 2645 7.743104 ACTGACGCAATAACAAAAATCTAGAG 58.257 34.615 0.00 0.00 0.00 2.43
1647 2646 7.386573 TGACTGACGCAATAACAAAAATCTAGA 59.613 33.333 0.00 0.00 0.00 2.43
1648 2647 7.478667 GTGACTGACGCAATAACAAAAATCTAG 59.521 37.037 0.00 0.00 0.00 2.43
1649 2648 7.172532 AGTGACTGACGCAATAACAAAAATCTA 59.827 33.333 0.00 0.00 0.00 1.98
1650 2649 6.017109 AGTGACTGACGCAATAACAAAAATCT 60.017 34.615 0.00 0.00 0.00 2.40
1651 2650 6.142817 AGTGACTGACGCAATAACAAAAATC 58.857 36.000 0.00 0.00 0.00 2.17
1652 2651 6.072112 AGTGACTGACGCAATAACAAAAAT 57.928 33.333 0.00 0.00 0.00 1.82
1653 2652 5.493133 AGTGACTGACGCAATAACAAAAA 57.507 34.783 0.00 0.00 0.00 1.94
1654 2653 5.493133 AAGTGACTGACGCAATAACAAAA 57.507 34.783 0.00 0.00 0.00 2.44
1655 2654 4.024387 GGAAGTGACTGACGCAATAACAAA 60.024 41.667 0.00 0.00 0.00 2.83
1656 2655 3.496884 GGAAGTGACTGACGCAATAACAA 59.503 43.478 0.00 0.00 0.00 2.83
1657 2656 3.064207 GGAAGTGACTGACGCAATAACA 58.936 45.455 0.00 0.00 0.00 2.41
1658 2657 3.326747 AGGAAGTGACTGACGCAATAAC 58.673 45.455 0.00 0.00 0.00 1.89
1659 2658 3.678056 AGGAAGTGACTGACGCAATAA 57.322 42.857 0.00 0.00 0.00 1.40
1660 2659 3.585862 GAAGGAAGTGACTGACGCAATA 58.414 45.455 0.00 0.00 0.00 1.90
1661 2660 2.417719 GAAGGAAGTGACTGACGCAAT 58.582 47.619 0.00 0.00 0.00 3.56
1662 2661 1.540363 GGAAGGAAGTGACTGACGCAA 60.540 52.381 0.00 0.00 0.00 4.85
1663 2662 0.033504 GGAAGGAAGTGACTGACGCA 59.966 55.000 0.00 0.00 0.00 5.24
1664 2663 0.318762 AGGAAGGAAGTGACTGACGC 59.681 55.000 0.00 0.00 0.00 5.19
1665 2664 2.297597 AGAAGGAAGGAAGTGACTGACG 59.702 50.000 0.00 0.00 0.00 4.35
1666 2665 4.311606 GAAGAAGGAAGGAAGTGACTGAC 58.688 47.826 0.00 0.00 0.00 3.51
1667 2666 3.325135 GGAAGAAGGAAGGAAGTGACTGA 59.675 47.826 0.00 0.00 0.00 3.41
1668 2667 3.558109 GGGAAGAAGGAAGGAAGTGACTG 60.558 52.174 0.00 0.00 0.00 3.51
1669 2668 2.640332 GGGAAGAAGGAAGGAAGTGACT 59.360 50.000 0.00 0.00 0.00 3.41
1670 2669 2.372172 TGGGAAGAAGGAAGGAAGTGAC 59.628 50.000 0.00 0.00 0.00 3.67
1671 2670 2.701551 TGGGAAGAAGGAAGGAAGTGA 58.298 47.619 0.00 0.00 0.00 3.41
1672 2671 3.149981 GTTGGGAAGAAGGAAGGAAGTG 58.850 50.000 0.00 0.00 0.00 3.16
1673 2672 2.108425 GGTTGGGAAGAAGGAAGGAAGT 59.892 50.000 0.00 0.00 0.00 3.01
1674 2673 2.376855 AGGTTGGGAAGAAGGAAGGAAG 59.623 50.000 0.00 0.00 0.00 3.46
1675 2674 2.428901 AGGTTGGGAAGAAGGAAGGAA 58.571 47.619 0.00 0.00 0.00 3.36
1676 2675 2.108250 CAAGGTTGGGAAGAAGGAAGGA 59.892 50.000 0.00 0.00 0.00 3.36
1677 2676 2.519013 CAAGGTTGGGAAGAAGGAAGG 58.481 52.381 0.00 0.00 0.00 3.46
1678 2677 1.889170 GCAAGGTTGGGAAGAAGGAAG 59.111 52.381 0.00 0.00 0.00 3.46
1679 2678 1.499007 AGCAAGGTTGGGAAGAAGGAA 59.501 47.619 0.00 0.00 0.00 3.36
1680 2679 1.149101 AGCAAGGTTGGGAAGAAGGA 58.851 50.000 0.00 0.00 0.00 3.36
1681 2680 1.251251 CAGCAAGGTTGGGAAGAAGG 58.749 55.000 0.00 0.00 0.00 3.46
1682 2681 1.202927 TCCAGCAAGGTTGGGAAGAAG 60.203 52.381 0.00 0.00 39.02 2.85
1683 2682 0.850100 TCCAGCAAGGTTGGGAAGAA 59.150 50.000 0.00 0.00 39.02 2.52
1684 2683 0.401738 CTCCAGCAAGGTTGGGAAGA 59.598 55.000 0.00 0.00 39.02 2.87
1685 2684 0.401738 TCTCCAGCAAGGTTGGGAAG 59.598 55.000 0.00 0.00 39.02 3.46
1686 2685 0.850100 TTCTCCAGCAAGGTTGGGAA 59.150 50.000 0.00 0.33 39.02 3.97
1687 2686 0.401738 CTTCTCCAGCAAGGTTGGGA 59.598 55.000 0.00 0.00 39.02 4.37
1688 2687 0.401738 TCTTCTCCAGCAAGGTTGGG 59.598 55.000 0.00 0.00 39.02 4.12
1689 2688 2.276732 TTCTTCTCCAGCAAGGTTGG 57.723 50.000 0.00 0.00 39.02 3.77
1690 2689 3.415212 TGATTCTTCTCCAGCAAGGTTG 58.585 45.455 0.00 0.00 39.02 3.77
1691 2690 3.683802 CTGATTCTTCTCCAGCAAGGTT 58.316 45.455 0.00 0.00 39.02 3.50
1692 2691 3.347077 CTGATTCTTCTCCAGCAAGGT 57.653 47.619 0.00 0.00 39.02 3.50
1698 2697 0.914644 TGGGGCTGATTCTTCTCCAG 59.085 55.000 0.00 0.00 0.00 3.86
1699 2698 0.620556 GTGGGGCTGATTCTTCTCCA 59.379 55.000 0.00 0.00 0.00 3.86
1700 2699 0.915364 AGTGGGGCTGATTCTTCTCC 59.085 55.000 0.00 0.00 0.00 3.71
1701 2700 3.645687 AGATAGTGGGGCTGATTCTTCTC 59.354 47.826 0.00 0.00 0.00 2.87
1702 2701 3.663198 AGATAGTGGGGCTGATTCTTCT 58.337 45.455 0.00 0.00 0.00 2.85
1703 2702 5.486526 CATAGATAGTGGGGCTGATTCTTC 58.513 45.833 0.00 0.00 0.00 2.87
1704 2703 4.263243 GCATAGATAGTGGGGCTGATTCTT 60.263 45.833 0.00 0.00 0.00 2.52
1705 2704 3.262915 GCATAGATAGTGGGGCTGATTCT 59.737 47.826 0.00 0.00 0.00 2.40
1706 2705 3.262915 AGCATAGATAGTGGGGCTGATTC 59.737 47.826 0.00 0.00 0.00 2.52
1707 2706 3.254960 AGCATAGATAGTGGGGCTGATT 58.745 45.455 0.00 0.00 0.00 2.57
1708 2707 2.913203 AGCATAGATAGTGGGGCTGAT 58.087 47.619 0.00 0.00 0.00 2.90
1709 2708 2.405618 AGCATAGATAGTGGGGCTGA 57.594 50.000 0.00 0.00 0.00 4.26
1710 2709 2.499289 CCTAGCATAGATAGTGGGGCTG 59.501 54.545 0.00 0.00 42.77 4.85
1711 2710 2.560841 CCCTAGCATAGATAGTGGGGCT 60.561 54.545 0.00 0.00 42.77 5.19
1712 2711 1.834263 CCCTAGCATAGATAGTGGGGC 59.166 57.143 0.00 0.00 42.77 5.80
1713 2712 3.474798 TCCCTAGCATAGATAGTGGGG 57.525 52.381 0.00 0.00 42.77 4.96
1714 2713 5.308237 ACTTTTCCCTAGCATAGATAGTGGG 59.692 44.000 0.00 0.00 42.77 4.61
1715 2714 6.042093 TGACTTTTCCCTAGCATAGATAGTGG 59.958 42.308 0.00 0.00 42.77 4.00
1716 2715 7.055667 TGACTTTTCCCTAGCATAGATAGTG 57.944 40.000 0.00 0.00 42.77 2.74
1717 2716 7.863901 ATGACTTTTCCCTAGCATAGATAGT 57.136 36.000 0.00 0.00 42.77 2.12
1718 2717 9.030452 ACTATGACTTTTCCCTAGCATAGATAG 57.970 37.037 0.00 0.00 42.77 2.08
1719 2718 8.958060 ACTATGACTTTTCCCTAGCATAGATA 57.042 34.615 0.00 0.00 42.77 1.98
1720 2719 7.732593 AGACTATGACTTTTCCCTAGCATAGAT 59.267 37.037 0.00 0.00 42.77 1.98
1721 2720 7.069986 AGACTATGACTTTTCCCTAGCATAGA 58.930 38.462 0.00 0.00 42.77 1.98
1722 2721 7.014711 TGAGACTATGACTTTTCCCTAGCATAG 59.985 40.741 0.00 0.00 40.40 2.23
1723 2722 6.839134 TGAGACTATGACTTTTCCCTAGCATA 59.161 38.462 0.00 0.00 0.00 3.14
1724 2723 5.663106 TGAGACTATGACTTTTCCCTAGCAT 59.337 40.000 0.00 0.00 0.00 3.79
1725 2724 5.023452 TGAGACTATGACTTTTCCCTAGCA 58.977 41.667 0.00 0.00 0.00 3.49
1726 2725 5.599999 TGAGACTATGACTTTTCCCTAGC 57.400 43.478 0.00 0.00 0.00 3.42
1727 2726 7.353414 TGATGAGACTATGACTTTTCCCTAG 57.647 40.000 0.00 0.00 0.00 3.02
1728 2727 7.786943 AGATGATGAGACTATGACTTTTCCCTA 59.213 37.037 0.00 0.00 0.00 3.53
1729 2728 6.614906 AGATGATGAGACTATGACTTTTCCCT 59.385 38.462 0.00 0.00 0.00 4.20
1730 2729 6.825610 AGATGATGAGACTATGACTTTTCCC 58.174 40.000 0.00 0.00 0.00 3.97
1731 2730 9.638239 GATAGATGATGAGACTATGACTTTTCC 57.362 37.037 0.00 0.00 0.00 3.13
1742 2741 8.281531 CCCCTAAGATAGATAGATGATGAGACT 58.718 40.741 0.00 0.00 0.00 3.24
1743 2742 8.278639 TCCCCTAAGATAGATAGATGATGAGAC 58.721 40.741 0.00 0.00 0.00 3.36
1744 2743 8.412693 TCCCCTAAGATAGATAGATGATGAGA 57.587 38.462 0.00 0.00 0.00 3.27
1745 2744 9.486123 TTTCCCCTAAGATAGATAGATGATGAG 57.514 37.037 0.00 0.00 0.00 2.90
1746 2745 9.486123 CTTTCCCCTAAGATAGATAGATGATGA 57.514 37.037 0.00 0.00 0.00 2.92
1747 2746 8.203485 GCTTTCCCCTAAGATAGATAGATGATG 58.797 40.741 0.00 0.00 0.00 3.07
1748 2747 8.128346 AGCTTTCCCCTAAGATAGATAGATGAT 58.872 37.037 0.00 0.00 0.00 2.45
1749 2748 7.483018 AGCTTTCCCCTAAGATAGATAGATGA 58.517 38.462 0.00 0.00 0.00 2.92
1750 2749 7.732222 AGCTTTCCCCTAAGATAGATAGATG 57.268 40.000 0.00 0.00 0.00 2.90
1751 2750 9.487442 CTTAGCTTTCCCCTAAGATAGATAGAT 57.513 37.037 0.00 0.00 42.68 1.98
1752 2751 8.457757 ACTTAGCTTTCCCCTAAGATAGATAGA 58.542 37.037 13.36 0.00 42.68 1.98
1753 2752 8.658840 ACTTAGCTTTCCCCTAAGATAGATAG 57.341 38.462 13.36 0.00 42.68 2.08
1754 2753 8.232412 TGACTTAGCTTTCCCCTAAGATAGATA 58.768 37.037 13.36 0.00 42.68 1.98
1755 2754 7.015779 GTGACTTAGCTTTCCCCTAAGATAGAT 59.984 40.741 13.36 0.00 42.68 1.98
1756 2755 6.324254 GTGACTTAGCTTTCCCCTAAGATAGA 59.676 42.308 13.36 0.00 42.68 1.98
1757 2756 6.098409 TGTGACTTAGCTTTCCCCTAAGATAG 59.902 42.308 13.36 0.00 42.68 2.08
1758 2757 5.962031 TGTGACTTAGCTTTCCCCTAAGATA 59.038 40.000 13.36 1.76 42.68 1.98
1759 2758 4.783227 TGTGACTTAGCTTTCCCCTAAGAT 59.217 41.667 13.36 0.00 42.68 2.40
1760 2759 4.164981 TGTGACTTAGCTTTCCCCTAAGA 58.835 43.478 13.36 0.00 42.68 2.10
1761 2760 4.553330 TGTGACTTAGCTTTCCCCTAAG 57.447 45.455 0.00 6.62 44.55 2.18
1762 2761 4.506095 GGTTGTGACTTAGCTTTCCCCTAA 60.506 45.833 0.00 0.00 0.00 2.69
1763 2762 3.008704 GGTTGTGACTTAGCTTTCCCCTA 59.991 47.826 0.00 0.00 0.00 3.53
1764 2763 2.224793 GGTTGTGACTTAGCTTTCCCCT 60.225 50.000 0.00 0.00 0.00 4.79
1765 2764 2.160205 GGTTGTGACTTAGCTTTCCCC 58.840 52.381 0.00 0.00 0.00 4.81
1766 2765 2.160205 GGGTTGTGACTTAGCTTTCCC 58.840 52.381 0.00 0.00 0.00 3.97
1767 2766 2.160205 GGGGTTGTGACTTAGCTTTCC 58.840 52.381 0.00 0.00 0.00 3.13
1768 2767 2.858745 TGGGGTTGTGACTTAGCTTTC 58.141 47.619 0.00 0.00 0.00 2.62
1769 2768 3.525800 ATGGGGTTGTGACTTAGCTTT 57.474 42.857 0.00 0.00 0.00 3.51
1770 2769 3.525800 AATGGGGTTGTGACTTAGCTT 57.474 42.857 0.00 0.00 0.00 3.74
1771 2770 4.385310 GGATAATGGGGTTGTGACTTAGCT 60.385 45.833 0.00 0.00 0.00 3.32
1772 2771 3.883489 GGATAATGGGGTTGTGACTTAGC 59.117 47.826 0.00 0.00 0.00 3.09
1773 2772 5.110814 TGGATAATGGGGTTGTGACTTAG 57.889 43.478 0.00 0.00 0.00 2.18
1774 2773 5.431731 AGATGGATAATGGGGTTGTGACTTA 59.568 40.000 0.00 0.00 0.00 2.24
1775 2774 4.230502 AGATGGATAATGGGGTTGTGACTT 59.769 41.667 0.00 0.00 0.00 3.01
1776 2775 3.788142 AGATGGATAATGGGGTTGTGACT 59.212 43.478 0.00 0.00 0.00 3.41
1777 2776 4.170468 AGATGGATAATGGGGTTGTGAC 57.830 45.455 0.00 0.00 0.00 3.67
1778 2777 4.879295 AAGATGGATAATGGGGTTGTGA 57.121 40.909 0.00 0.00 0.00 3.58
1779 2778 5.072741 CCTAAGATGGATAATGGGGTTGTG 58.927 45.833 0.00 0.00 0.00 3.33
1780 2779 4.106341 CCCTAAGATGGATAATGGGGTTGT 59.894 45.833 0.00 0.00 0.00 3.32
1781 2780 4.509122 CCCCTAAGATGGATAATGGGGTTG 60.509 50.000 6.05 0.00 45.71 3.77
1782 2781 3.662642 CCCCTAAGATGGATAATGGGGTT 59.337 47.826 6.05 0.00 45.71 4.11
1783 2782 3.269034 CCCCTAAGATGGATAATGGGGT 58.731 50.000 6.05 0.00 45.71 4.95
1785 2784 4.106341 ACAACCCCTAAGATGGATAATGGG 59.894 45.833 0.00 0.00 37.80 4.00
1786 2785 5.072741 CACAACCCCTAAGATGGATAATGG 58.927 45.833 0.00 0.00 0.00 3.16
1787 2786 5.072741 CCACAACCCCTAAGATGGATAATG 58.927 45.833 0.00 0.00 0.00 1.90
1788 2787 4.106341 CCCACAACCCCTAAGATGGATAAT 59.894 45.833 0.00 0.00 0.00 1.28
1789 2788 3.461831 CCCACAACCCCTAAGATGGATAA 59.538 47.826 0.00 0.00 0.00 1.75
1790 2789 3.053077 CCCACAACCCCTAAGATGGATA 58.947 50.000 0.00 0.00 0.00 2.59
1791 2790 1.852965 CCCACAACCCCTAAGATGGAT 59.147 52.381 0.00 0.00 0.00 3.41
1792 2791 1.295020 CCCACAACCCCTAAGATGGA 58.705 55.000 0.00 0.00 0.00 3.41
1793 2792 0.258774 CCCCACAACCCCTAAGATGG 59.741 60.000 0.00 0.00 0.00 3.51
1794 2793 0.999712 ACCCCACAACCCCTAAGATG 59.000 55.000 0.00 0.00 0.00 2.90
1795 2794 0.999712 CACCCCACAACCCCTAAGAT 59.000 55.000 0.00 0.00 0.00 2.40
1796 2795 1.137594 CCACCCCACAACCCCTAAGA 61.138 60.000 0.00 0.00 0.00 2.10
1797 2796 1.382629 CCACCCCACAACCCCTAAG 59.617 63.158 0.00 0.00 0.00 2.18
1798 2797 2.164279 CCCACCCCACAACCCCTAA 61.164 63.158 0.00 0.00 0.00 2.69
1799 2798 2.533232 CCCACCCCACAACCCCTA 60.533 66.667 0.00 0.00 0.00 3.53
1815 2814 3.958860 CGATCCCCTGCATCCCCC 61.959 72.222 0.00 0.00 0.00 5.40
1816 2815 4.650377 GCGATCCCCTGCATCCCC 62.650 72.222 0.00 0.00 0.00 4.81
1817 2816 4.650377 GGCGATCCCCTGCATCCC 62.650 72.222 0.00 0.00 0.00 3.85
1818 2817 4.996434 CGGCGATCCCCTGCATCC 62.996 72.222 0.00 0.00 0.00 3.51
1819 2818 4.996434 CCGGCGATCCCCTGCATC 62.996 72.222 9.30 0.00 0.00 3.91
1823 2822 2.441822 GAATCTCCGGCGATCCCCTG 62.442 65.000 9.30 0.00 0.00 4.45
1824 2823 2.122813 AATCTCCGGCGATCCCCT 60.123 61.111 9.30 0.00 0.00 4.79
1825 2824 2.161078 GAGAATCTCCGGCGATCCCC 62.161 65.000 9.30 0.62 0.00 4.81
1826 2825 1.290639 GAGAATCTCCGGCGATCCC 59.709 63.158 9.30 3.15 0.00 3.85
1827 2826 0.319125 GTGAGAATCTCCGGCGATCC 60.319 60.000 9.30 0.00 34.92 3.36
1828 2827 0.319125 GGTGAGAATCTCCGGCGATC 60.319 60.000 9.30 1.81 39.19 3.69
1829 2828 1.742768 GGTGAGAATCTCCGGCGAT 59.257 57.895 9.30 0.00 39.19 4.58
1830 2829 3.207354 GGTGAGAATCTCCGGCGA 58.793 61.111 9.30 0.00 39.19 5.54
1835 2834 2.287829 ACCACCGGTGAGAATCTCC 58.712 57.895 36.07 0.00 45.04 3.71
1845 2844 2.752807 AAAGTCCTGCACCACCGGT 61.753 57.895 0.00 0.00 35.62 5.28
1846 2845 2.113139 AAAGTCCTGCACCACCGG 59.887 61.111 0.00 0.00 0.00 5.28
1847 2846 1.227823 TCAAAGTCCTGCACCACCG 60.228 57.895 0.00 0.00 0.00 4.94
1848 2847 0.890996 CCTCAAAGTCCTGCACCACC 60.891 60.000 0.00 0.00 0.00 4.61
1849 2848 0.890996 CCCTCAAAGTCCTGCACCAC 60.891 60.000 0.00 0.00 0.00 4.16
1850 2849 1.059584 TCCCTCAAAGTCCTGCACCA 61.060 55.000 0.00 0.00 0.00 4.17
1851 2850 0.329596 ATCCCTCAAAGTCCTGCACC 59.670 55.000 0.00 0.00 0.00 5.01
1852 2851 1.457346 CATCCCTCAAAGTCCTGCAC 58.543 55.000 0.00 0.00 0.00 4.57
1853 2852 0.329261 CCATCCCTCAAAGTCCTGCA 59.671 55.000 0.00 0.00 0.00 4.41
1854 2853 1.034292 GCCATCCCTCAAAGTCCTGC 61.034 60.000 0.00 0.00 0.00 4.85
1855 2854 0.622665 AGCCATCCCTCAAAGTCCTG 59.377 55.000 0.00 0.00 0.00 3.86
1856 2855 0.622665 CAGCCATCCCTCAAAGTCCT 59.377 55.000 0.00 0.00 0.00 3.85
1857 2856 0.394899 CCAGCCATCCCTCAAAGTCC 60.395 60.000 0.00 0.00 0.00 3.85
1858 2857 0.394899 CCCAGCCATCCCTCAAAGTC 60.395 60.000 0.00 0.00 0.00 3.01
1859 2858 1.693640 CCCAGCCATCCCTCAAAGT 59.306 57.895 0.00 0.00 0.00 2.66
1860 2859 1.076485 CCCCAGCCATCCCTCAAAG 60.076 63.158 0.00 0.00 0.00 2.77
1861 2860 3.099171 CCCCAGCCATCCCTCAAA 58.901 61.111 0.00 0.00 0.00 2.69
1862 2861 3.743017 GCCCCAGCCATCCCTCAA 61.743 66.667 0.00 0.00 0.00 3.02
1889 2888 3.361977 CTTTCCCCACCGCCGTTG 61.362 66.667 0.00 0.00 0.00 4.10
1890 2889 4.653888 CCTTTCCCCACCGCCGTT 62.654 66.667 0.00 0.00 0.00 4.44
1892 2891 4.653888 AACCTTTCCCCACCGCCG 62.654 66.667 0.00 0.00 0.00 6.46
1893 2892 2.989253 CAACCTTTCCCCACCGCC 60.989 66.667 0.00 0.00 0.00 6.13
1894 2893 1.971695 CTCAACCTTTCCCCACCGC 60.972 63.158 0.00 0.00 0.00 5.68
1895 2894 1.303317 CCTCAACCTTTCCCCACCG 60.303 63.158 0.00 0.00 0.00 4.94
1896 2895 1.076727 CCCTCAACCTTTCCCCACC 59.923 63.158 0.00 0.00 0.00 4.61
1897 2896 0.481128 TTCCCTCAACCTTTCCCCAC 59.519 55.000 0.00 0.00 0.00 4.61
1898 2897 1.146982 CTTTCCCTCAACCTTTCCCCA 59.853 52.381 0.00 0.00 0.00 4.96
1899 2898 1.550179 CCTTTCCCTCAACCTTTCCCC 60.550 57.143 0.00 0.00 0.00 4.81
1900 2899 1.924731 CCTTTCCCTCAACCTTTCCC 58.075 55.000 0.00 0.00 0.00 3.97
1901 2900 1.257743 GCCTTTCCCTCAACCTTTCC 58.742 55.000 0.00 0.00 0.00 3.13
1902 2901 0.881796 CGCCTTTCCCTCAACCTTTC 59.118 55.000 0.00 0.00 0.00 2.62
1903 2902 0.539669 CCGCCTTTCCCTCAACCTTT 60.540 55.000 0.00 0.00 0.00 3.11
1904 2903 1.074951 CCGCCTTTCCCTCAACCTT 59.925 57.895 0.00 0.00 0.00 3.50
1905 2904 2.757077 CCGCCTTTCCCTCAACCT 59.243 61.111 0.00 0.00 0.00 3.50
1906 2905 2.361230 CCCGCCTTTCCCTCAACC 60.361 66.667 0.00 0.00 0.00 3.77
1907 2906 2.361230 CCCCGCCTTTCCCTCAAC 60.361 66.667 0.00 0.00 0.00 3.18
1908 2907 4.360405 GCCCCGCCTTTCCCTCAA 62.360 66.667 0.00 0.00 0.00 3.02
1910 2909 4.803908 CTGCCCCGCCTTTCCCTC 62.804 72.222 0.00 0.00 0.00 4.30
1962 2961 2.687566 ATCCGTCTGTCCCCACCC 60.688 66.667 0.00 0.00 0.00 4.61
1963 2962 2.584608 CATCCGTCTGTCCCCACC 59.415 66.667 0.00 0.00 0.00 4.61
1964 2963 2.584608 CCATCCGTCTGTCCCCAC 59.415 66.667 0.00 0.00 0.00 4.61
1965 2964 2.687200 CCCATCCGTCTGTCCCCA 60.687 66.667 0.00 0.00 0.00 4.96
1966 2965 3.480133 CCCCATCCGTCTGTCCCC 61.480 72.222 0.00 0.00 0.00 4.81
1967 2966 4.176752 GCCCCATCCGTCTGTCCC 62.177 72.222 0.00 0.00 0.00 4.46
1968 2967 4.530857 CGCCCCATCCGTCTGTCC 62.531 72.222 0.00 0.00 0.00 4.02
1969 2968 4.530857 CCGCCCCATCCGTCTGTC 62.531 72.222 0.00 0.00 0.00 3.51
1992 2991 3.492311 TTTTTCTGCAACCGCCGGC 62.492 57.895 19.07 19.07 37.32 6.13
1993 2992 1.371635 CTTTTTCTGCAACCGCCGG 60.372 57.895 0.00 0.00 37.32 6.13
1994 2993 1.371635 CCTTTTTCTGCAACCGCCG 60.372 57.895 0.00 0.00 37.32 6.46
1995 2994 0.603065 ATCCTTTTTCTGCAACCGCC 59.397 50.000 0.00 0.00 37.32 6.13
1996 2995 1.669795 CCATCCTTTTTCTGCAACCGC 60.670 52.381 0.00 0.00 39.24 5.68
1997 2996 1.885887 TCCATCCTTTTTCTGCAACCG 59.114 47.619 0.00 0.00 0.00 4.44
1998 2997 3.428045 CGATCCATCCTTTTTCTGCAACC 60.428 47.826 0.00 0.00 0.00 3.77
1999 2998 3.428045 CCGATCCATCCTTTTTCTGCAAC 60.428 47.826 0.00 0.00 0.00 4.17
2000 2999 2.754552 CCGATCCATCCTTTTTCTGCAA 59.245 45.455 0.00 0.00 0.00 4.08
2001 3000 2.026356 TCCGATCCATCCTTTTTCTGCA 60.026 45.455 0.00 0.00 0.00 4.41
2002 3001 2.643551 TCCGATCCATCCTTTTTCTGC 58.356 47.619 0.00 0.00 0.00 4.26
2003 3002 3.496130 CGATCCGATCCATCCTTTTTCTG 59.504 47.826 2.69 0.00 0.00 3.02
2004 3003 3.134804 ACGATCCGATCCATCCTTTTTCT 59.865 43.478 2.69 0.00 0.00 2.52
2005 3004 3.248602 CACGATCCGATCCATCCTTTTTC 59.751 47.826 2.69 0.00 0.00 2.29
2006 3005 3.206150 CACGATCCGATCCATCCTTTTT 58.794 45.455 2.69 0.00 0.00 1.94
2007 3006 2.485479 CCACGATCCGATCCATCCTTTT 60.485 50.000 2.69 0.00 0.00 2.27
2008 3007 1.070758 CCACGATCCGATCCATCCTTT 59.929 52.381 2.69 0.00 0.00 3.11
2009 3008 0.681733 CCACGATCCGATCCATCCTT 59.318 55.000 2.69 0.00 0.00 3.36
2010 3009 1.821061 GCCACGATCCGATCCATCCT 61.821 60.000 2.69 0.00 0.00 3.24
2011 3010 1.374758 GCCACGATCCGATCCATCC 60.375 63.158 2.69 0.00 0.00 3.51
2012 3011 0.034059 AAGCCACGATCCGATCCATC 59.966 55.000 2.69 0.00 0.00 3.51
2013 3012 0.250038 CAAGCCACGATCCGATCCAT 60.250 55.000 2.69 0.00 0.00 3.41
2014 3013 1.143838 CAAGCCACGATCCGATCCA 59.856 57.895 2.69 0.00 0.00 3.41
2015 3014 0.598680 CTCAAGCCACGATCCGATCC 60.599 60.000 2.69 0.00 0.00 3.36
2016 3015 0.598680 CCTCAAGCCACGATCCGATC 60.599 60.000 0.00 0.00 0.00 3.69
2017 3016 1.043116 TCCTCAAGCCACGATCCGAT 61.043 55.000 0.00 0.00 0.00 4.18
2018 3017 1.667154 CTCCTCAAGCCACGATCCGA 61.667 60.000 0.00 0.00 0.00 4.55
2019 3018 1.227089 CTCCTCAAGCCACGATCCG 60.227 63.158 0.00 0.00 0.00 4.18
2020 3019 1.144936 CCTCCTCAAGCCACGATCC 59.855 63.158 0.00 0.00 0.00 3.36
2021 3020 0.537188 TTCCTCCTCAAGCCACGATC 59.463 55.000 0.00 0.00 0.00 3.69
2022 3021 0.539051 CTTCCTCCTCAAGCCACGAT 59.461 55.000 0.00 0.00 0.00 3.73
2023 3022 0.541998 TCTTCCTCCTCAAGCCACGA 60.542 55.000 0.00 0.00 0.00 4.35
2024 3023 0.390472 GTCTTCCTCCTCAAGCCACG 60.390 60.000 0.00 0.00 0.00 4.94
2025 3024 0.390472 CGTCTTCCTCCTCAAGCCAC 60.390 60.000 0.00 0.00 0.00 5.01
2026 3025 1.544825 CCGTCTTCCTCCTCAAGCCA 61.545 60.000 0.00 0.00 0.00 4.75
2027 3026 1.219393 CCGTCTTCCTCCTCAAGCC 59.781 63.158 0.00 0.00 0.00 4.35
2028 3027 0.321996 AACCGTCTTCCTCCTCAAGC 59.678 55.000 0.00 0.00 0.00 4.01
2029 3028 1.338200 CCAACCGTCTTCCTCCTCAAG 60.338 57.143 0.00 0.00 0.00 3.02
2030 3029 0.685097 CCAACCGTCTTCCTCCTCAA 59.315 55.000 0.00 0.00 0.00 3.02
2031 3030 1.192146 CCCAACCGTCTTCCTCCTCA 61.192 60.000 0.00 0.00 0.00 3.86
2032 3031 0.903454 TCCCAACCGTCTTCCTCCTC 60.903 60.000 0.00 0.00 0.00 3.71
2033 3032 0.905337 CTCCCAACCGTCTTCCTCCT 60.905 60.000 0.00 0.00 0.00 3.69
2034 3033 1.597461 CTCCCAACCGTCTTCCTCC 59.403 63.158 0.00 0.00 0.00 4.30
2035 3034 0.903454 TCCTCCCAACCGTCTTCCTC 60.903 60.000 0.00 0.00 0.00 3.71
2036 3035 0.473117 TTCCTCCCAACCGTCTTCCT 60.473 55.000 0.00 0.00 0.00 3.36
2037 3036 0.036294 CTTCCTCCCAACCGTCTTCC 60.036 60.000 0.00 0.00 0.00 3.46
2038 3037 0.974383 TCTTCCTCCCAACCGTCTTC 59.026 55.000 0.00 0.00 0.00 2.87
2039 3038 1.071857 GTTCTTCCTCCCAACCGTCTT 59.928 52.381 0.00 0.00 0.00 3.01
2040 3039 0.685660 GTTCTTCCTCCCAACCGTCT 59.314 55.000 0.00 0.00 0.00 4.18
2041 3040 0.669625 CGTTCTTCCTCCCAACCGTC 60.670 60.000 0.00 0.00 0.00 4.79
2042 3041 1.370064 CGTTCTTCCTCCCAACCGT 59.630 57.895 0.00 0.00 0.00 4.83
2043 3042 0.949105 CACGTTCTTCCTCCCAACCG 60.949 60.000 0.00 0.00 0.00 4.44
2044 3043 0.605589 CCACGTTCTTCCTCCCAACC 60.606 60.000 0.00 0.00 0.00 3.77
2045 3044 1.235281 GCCACGTTCTTCCTCCCAAC 61.235 60.000 0.00 0.00 0.00 3.77
2046 3045 1.072505 GCCACGTTCTTCCTCCCAA 59.927 57.895 0.00 0.00 0.00 4.12
2047 3046 1.488705 ATGCCACGTTCTTCCTCCCA 61.489 55.000 0.00 0.00 0.00 4.37
2048 3047 1.026718 CATGCCACGTTCTTCCTCCC 61.027 60.000 0.00 0.00 0.00 4.30
2049 3048 0.321653 ACATGCCACGTTCTTCCTCC 60.322 55.000 0.00 0.00 0.00 4.30
2050 3049 0.798776 CACATGCCACGTTCTTCCTC 59.201 55.000 0.00 0.00 0.00 3.71
2051 3050 0.396435 TCACATGCCACGTTCTTCCT 59.604 50.000 0.00 0.00 0.00 3.36
2052 3051 0.798776 CTCACATGCCACGTTCTTCC 59.201 55.000 0.00 0.00 0.00 3.46
2053 3052 1.195448 CACTCACATGCCACGTTCTTC 59.805 52.381 0.00 0.00 0.00 2.87
2054 3053 1.229428 CACTCACATGCCACGTTCTT 58.771 50.000 0.00 0.00 0.00 2.52
2055 3054 0.603707 CCACTCACATGCCACGTTCT 60.604 55.000 0.00 0.00 0.00 3.01
2056 3055 0.884704 ACCACTCACATGCCACGTTC 60.885 55.000 0.00 0.00 0.00 3.95
2057 3056 0.465460 AACCACTCACATGCCACGTT 60.465 50.000 0.00 0.00 0.00 3.99
2058 3057 0.394938 TAACCACTCACATGCCACGT 59.605 50.000 0.00 0.00 0.00 4.49
2059 3058 1.078709 CTAACCACTCACATGCCACG 58.921 55.000 0.00 0.00 0.00 4.94
2060 3059 2.472695 TCTAACCACTCACATGCCAC 57.527 50.000 0.00 0.00 0.00 5.01
2061 3060 2.940971 GCATCTAACCACTCACATGCCA 60.941 50.000 0.00 0.00 32.20 4.92
2062 3061 1.672881 GCATCTAACCACTCACATGCC 59.327 52.381 0.00 0.00 32.20 4.40
2063 3062 2.358957 TGCATCTAACCACTCACATGC 58.641 47.619 0.00 0.00 37.69 4.06
2064 3063 5.993441 TGATATGCATCTAACCACTCACATG 59.007 40.000 0.19 0.00 31.93 3.21
2065 3064 6.042437 TCTGATATGCATCTAACCACTCACAT 59.958 38.462 0.19 0.00 31.93 3.21
2066 3065 5.363580 TCTGATATGCATCTAACCACTCACA 59.636 40.000 0.19 0.00 31.93 3.58
2067 3066 5.847304 TCTGATATGCATCTAACCACTCAC 58.153 41.667 0.19 0.00 31.93 3.51
2068 3067 6.676990 ATCTGATATGCATCTAACCACTCA 57.323 37.500 0.19 0.00 31.93 3.41
2069 3068 7.973388 GTCTATCTGATATGCATCTAACCACTC 59.027 40.741 0.19 0.00 31.93 3.51
2070 3069 7.452813 TGTCTATCTGATATGCATCTAACCACT 59.547 37.037 0.19 0.00 31.93 4.00
2071 3070 7.606349 TGTCTATCTGATATGCATCTAACCAC 58.394 38.462 0.19 0.00 31.93 4.16
2072 3071 7.781324 TGTCTATCTGATATGCATCTAACCA 57.219 36.000 0.19 0.00 31.93 3.67
2073 3072 9.494271 TTTTGTCTATCTGATATGCATCTAACC 57.506 33.333 0.19 0.00 31.93 2.85
2104 3103 8.624776 CCAGAAGAAAAGTTTCATCAGTAACTT 58.375 33.333 10.61 0.00 44.15 2.66
2105 3104 7.255277 GCCAGAAGAAAAGTTTCATCAGTAACT 60.255 37.037 10.61 0.00 37.36 2.24
2106 3105 6.858478 GCCAGAAGAAAAGTTTCATCAGTAAC 59.142 38.462 10.61 0.00 37.36 2.50
2107 3106 6.545666 TGCCAGAAGAAAAGTTTCATCAGTAA 59.454 34.615 10.61 0.00 37.36 2.24
2108 3107 6.017109 GTGCCAGAAGAAAAGTTTCATCAGTA 60.017 38.462 10.61 0.74 37.36 2.74
2109 3108 4.889409 TGCCAGAAGAAAAGTTTCATCAGT 59.111 37.500 10.61 0.00 37.36 3.41
2110 3109 5.218139 GTGCCAGAAGAAAAGTTTCATCAG 58.782 41.667 10.61 3.86 37.36 2.90
2111 3110 4.037923 GGTGCCAGAAGAAAAGTTTCATCA 59.962 41.667 10.61 0.00 37.36 3.07
2112 3111 4.279420 AGGTGCCAGAAGAAAAGTTTCATC 59.721 41.667 6.56 4.02 39.61 2.92
2113 3112 4.038402 CAGGTGCCAGAAGAAAAGTTTCAT 59.962 41.667 6.56 0.00 39.61 2.57
2114 3113 3.381272 CAGGTGCCAGAAGAAAAGTTTCA 59.619 43.478 6.56 0.00 39.61 2.69
2115 3114 3.381590 ACAGGTGCCAGAAGAAAAGTTTC 59.618 43.478 0.00 0.00 37.45 2.78
2116 3115 3.365472 ACAGGTGCCAGAAGAAAAGTTT 58.635 40.909 0.00 0.00 0.00 2.66
2117 3116 2.952310 GACAGGTGCCAGAAGAAAAGTT 59.048 45.455 0.00 0.00 0.00 2.66
2118 3117 2.173569 AGACAGGTGCCAGAAGAAAAGT 59.826 45.455 0.00 0.00 0.00 2.66
2119 3118 2.810852 GAGACAGGTGCCAGAAGAAAAG 59.189 50.000 0.00 0.00 0.00 2.27
2120 3119 2.487265 GGAGACAGGTGCCAGAAGAAAA 60.487 50.000 0.00 0.00 0.00 2.29
2121 3120 1.072331 GGAGACAGGTGCCAGAAGAAA 59.928 52.381 0.00 0.00 0.00 2.52
2122 3121 0.687354 GGAGACAGGTGCCAGAAGAA 59.313 55.000 0.00 0.00 0.00 2.52
2123 3122 0.178921 AGGAGACAGGTGCCAGAAGA 60.179 55.000 0.00 0.00 0.00 2.87
2124 3123 0.689623 AAGGAGACAGGTGCCAGAAG 59.310 55.000 0.00 0.00 0.00 2.85
2125 3124 1.140312 AAAGGAGACAGGTGCCAGAA 58.860 50.000 0.00 0.00 0.00 3.02
2126 3125 2.024176 TAAAGGAGACAGGTGCCAGA 57.976 50.000 0.00 0.00 0.00 3.86
2127 3126 3.742640 GCTATAAAGGAGACAGGTGCCAG 60.743 52.174 0.00 0.00 0.00 4.85
2128 3127 2.170607 GCTATAAAGGAGACAGGTGCCA 59.829 50.000 0.00 0.00 0.00 4.92
2129 3128 2.436173 AGCTATAAAGGAGACAGGTGCC 59.564 50.000 0.00 0.00 0.00 5.01
2130 3129 3.828875 AGCTATAAAGGAGACAGGTGC 57.171 47.619 0.00 0.00 0.00 5.01
2131 3130 6.773685 AGTACTAGCTATAAAGGAGACAGGTG 59.226 42.308 0.00 0.00 0.00 4.00
2132 3131 6.913545 AGTACTAGCTATAAAGGAGACAGGT 58.086 40.000 0.00 0.00 0.00 4.00
2133 3132 9.523168 AATAGTACTAGCTATAAAGGAGACAGG 57.477 37.037 8.85 0.00 31.94 4.00
2154 3153 8.100164 GGACGGAGGAAGTACTAGTATAATAGT 58.900 40.741 16.40 16.40 39.35 2.12
2155 3154 8.099537 TGGACGGAGGAAGTACTAGTATAATAG 58.900 40.741 5.75 5.68 0.00 1.73
2156 3155 7.977818 TGGACGGAGGAAGTACTAGTATAATA 58.022 38.462 5.75 0.00 0.00 0.98
2157 3156 6.845908 TGGACGGAGGAAGTACTAGTATAAT 58.154 40.000 5.75 0.00 0.00 1.28
2158 3157 6.100279 TCTGGACGGAGGAAGTACTAGTATAA 59.900 42.308 5.75 0.00 0.00 0.98
2159 3158 5.604231 TCTGGACGGAGGAAGTACTAGTATA 59.396 44.000 5.75 0.00 0.00 1.47
2160 3159 4.411540 TCTGGACGGAGGAAGTACTAGTAT 59.588 45.833 5.75 0.00 0.00 2.12
2161 3160 3.776969 TCTGGACGGAGGAAGTACTAGTA 59.223 47.826 0.00 0.00 0.00 1.82
2162 3161 2.575279 TCTGGACGGAGGAAGTACTAGT 59.425 50.000 0.00 0.00 0.00 2.57
2163 3162 3.278668 TCTGGACGGAGGAAGTACTAG 57.721 52.381 0.00 0.00 0.00 2.57
2164 3163 3.726557 TTCTGGACGGAGGAAGTACTA 57.273 47.619 0.00 0.00 0.00 1.82
2165 3164 2.599408 TTCTGGACGGAGGAAGTACT 57.401 50.000 0.00 0.00 0.00 2.73
2166 3165 3.889520 ATTTCTGGACGGAGGAAGTAC 57.110 47.619 0.00 0.00 0.00 2.73
2167 3166 5.021458 ACTTATTTCTGGACGGAGGAAGTA 58.979 41.667 0.00 0.00 0.00 2.24
2168 3167 3.838903 ACTTATTTCTGGACGGAGGAAGT 59.161 43.478 0.00 0.00 0.00 3.01
2169 3168 4.160626 AGACTTATTTCTGGACGGAGGAAG 59.839 45.833 0.00 0.00 0.00 3.46
2170 3169 4.094476 AGACTTATTTCTGGACGGAGGAA 58.906 43.478 0.00 0.00 0.00 3.36
2171 3170 3.709587 AGACTTATTTCTGGACGGAGGA 58.290 45.455 0.00 0.00 0.00 3.71
2172 3171 4.401519 TGTAGACTTATTTCTGGACGGAGG 59.598 45.833 0.00 0.00 0.00 4.30
2173 3172 5.578005 TGTAGACTTATTTCTGGACGGAG 57.422 43.478 0.00 0.00 0.00 4.63
2174 3173 6.540438 AATGTAGACTTATTTCTGGACGGA 57.460 37.500 0.00 0.00 0.00 4.69
2175 3174 6.037172 CCAAATGTAGACTTATTTCTGGACGG 59.963 42.308 0.00 0.00 0.00 4.79
2176 3175 6.456988 GCCAAATGTAGACTTATTTCTGGACG 60.457 42.308 0.00 0.00 0.00 4.79
2177 3176 6.374333 TGCCAAATGTAGACTTATTTCTGGAC 59.626 38.462 0.00 0.00 0.00 4.02
2178 3177 6.480763 TGCCAAATGTAGACTTATTTCTGGA 58.519 36.000 0.00 0.00 0.00 3.86
2179 3178 6.757897 TGCCAAATGTAGACTTATTTCTGG 57.242 37.500 0.00 0.00 0.00 3.86
2193 3192 9.512588 TGTGGATAAATTTTAAATGCCAAATGT 57.487 25.926 0.00 0.00 0.00 2.71
2224 3223 7.880195 AGTGCATTGAGAAGATAAAACTACACT 59.120 33.333 0.00 0.00 0.00 3.55
2225 3224 8.034058 AGTGCATTGAGAAGATAAAACTACAC 57.966 34.615 0.00 0.00 0.00 2.90
2262 3261 6.884295 TCGTGTGATGAGAGGGAAATATTTTT 59.116 34.615 1.43 0.00 0.00 1.94
2266 3265 5.815233 ATCGTGTGATGAGAGGGAAATAT 57.185 39.130 0.00 0.00 32.21 1.28
2268 3267 5.614324 TTATCGTGTGATGAGAGGGAAAT 57.386 39.130 0.00 0.00 35.99 2.17
2271 3270 4.215109 TGATTATCGTGTGATGAGAGGGA 58.785 43.478 0.00 0.00 35.99 4.20
2272 3271 4.590850 TGATTATCGTGTGATGAGAGGG 57.409 45.455 0.00 0.00 35.99 4.30
2273 3272 5.689514 GTCTTGATTATCGTGTGATGAGAGG 59.310 44.000 0.00 0.00 35.99 3.69
2274 3273 5.689514 GGTCTTGATTATCGTGTGATGAGAG 59.310 44.000 0.00 0.00 35.99 3.20
2275 3274 5.127031 TGGTCTTGATTATCGTGTGATGAGA 59.873 40.000 0.00 0.00 35.99 3.27
2276 3275 5.351458 TGGTCTTGATTATCGTGTGATGAG 58.649 41.667 0.00 0.00 35.99 2.90
2277 3276 5.337578 TGGTCTTGATTATCGTGTGATGA 57.662 39.130 0.00 0.00 35.99 2.92
2278 3277 6.609237 ATTGGTCTTGATTATCGTGTGATG 57.391 37.500 0.00 0.00 35.99 3.07
2279 3278 7.768582 TGTTATTGGTCTTGATTATCGTGTGAT 59.231 33.333 0.00 0.00 38.67 3.06
2280 3279 7.100409 TGTTATTGGTCTTGATTATCGTGTGA 58.900 34.615 0.00 0.00 0.00 3.58
2281 3280 7.302350 TGTTATTGGTCTTGATTATCGTGTG 57.698 36.000 0.00 0.00 0.00 3.82
2282 3281 8.506168 AATGTTATTGGTCTTGATTATCGTGT 57.494 30.769 0.00 0.00 0.00 4.49
2283 3282 8.611757 TGAATGTTATTGGTCTTGATTATCGTG 58.388 33.333 0.00 0.00 0.00 4.35
2284 3283 8.731275 TGAATGTTATTGGTCTTGATTATCGT 57.269 30.769 0.00 0.00 0.00 3.73
2285 3284 9.438291 GTTGAATGTTATTGGTCTTGATTATCG 57.562 33.333 0.00 0.00 0.00 2.92
2288 3287 9.072375 TGTGTTGAATGTTATTGGTCTTGATTA 57.928 29.630 0.00 0.00 0.00 1.75
2289 3288 7.950512 TGTGTTGAATGTTATTGGTCTTGATT 58.049 30.769 0.00 0.00 0.00 2.57
2290 3289 7.523293 TGTGTTGAATGTTATTGGTCTTGAT 57.477 32.000 0.00 0.00 0.00 2.57
2291 3290 6.951062 TGTGTTGAATGTTATTGGTCTTGA 57.049 33.333 0.00 0.00 0.00 3.02
2292 3291 6.587226 CCATGTGTTGAATGTTATTGGTCTTG 59.413 38.462 0.00 0.00 0.00 3.02
2293 3292 6.267471 ACCATGTGTTGAATGTTATTGGTCTT 59.733 34.615 0.00 0.00 0.00 3.01
2294 3293 5.774690 ACCATGTGTTGAATGTTATTGGTCT 59.225 36.000 0.00 0.00 0.00 3.85
2295 3294 6.024552 ACCATGTGTTGAATGTTATTGGTC 57.975 37.500 0.00 0.00 0.00 4.02
2296 3295 5.774690 AGACCATGTGTTGAATGTTATTGGT 59.225 36.000 0.00 0.00 0.00 3.67
2297 3296 6.271488 AGACCATGTGTTGAATGTTATTGG 57.729 37.500 0.00 0.00 0.00 3.16
2298 3297 7.596494 AGAAGACCATGTGTTGAATGTTATTG 58.404 34.615 0.00 0.00 0.00 1.90
2299 3298 7.448161 TGAGAAGACCATGTGTTGAATGTTATT 59.552 33.333 0.00 0.00 0.00 1.40
2300 3299 6.942005 TGAGAAGACCATGTGTTGAATGTTAT 59.058 34.615 0.00 0.00 0.00 1.89
2301 3300 6.204688 GTGAGAAGACCATGTGTTGAATGTTA 59.795 38.462 0.00 0.00 0.00 2.41
2302 3301 5.009010 GTGAGAAGACCATGTGTTGAATGTT 59.991 40.000 0.00 0.00 0.00 2.71
2303 3302 4.516698 GTGAGAAGACCATGTGTTGAATGT 59.483 41.667 0.00 0.00 0.00 2.71
2304 3303 4.758674 AGTGAGAAGACCATGTGTTGAATG 59.241 41.667 0.00 0.00 0.00 2.67
2305 3304 4.978099 AGTGAGAAGACCATGTGTTGAAT 58.022 39.130 0.00 0.00 0.00 2.57
2306 3305 4.422073 AGTGAGAAGACCATGTGTTGAA 57.578 40.909 0.00 0.00 0.00 2.69
2307 3306 4.422073 AAGTGAGAAGACCATGTGTTGA 57.578 40.909 0.00 0.00 0.00 3.18
2308 3307 5.505173 AAAAGTGAGAAGACCATGTGTTG 57.495 39.130 0.00 0.00 0.00 3.33
2309 3308 7.639113 TTAAAAAGTGAGAAGACCATGTGTT 57.361 32.000 0.00 0.00 0.00 3.32
2310 3309 7.639113 TTTAAAAAGTGAGAAGACCATGTGT 57.361 32.000 0.00 0.00 0.00 3.72
2311 3310 7.115378 GCATTTAAAAAGTGAGAAGACCATGTG 59.885 37.037 0.00 0.00 0.00 3.21
2312 3311 7.147976 GCATTTAAAAAGTGAGAAGACCATGT 58.852 34.615 0.00 0.00 0.00 3.21
2313 3312 7.115378 GTGCATTTAAAAAGTGAGAAGACCATG 59.885 37.037 0.00 0.00 0.00 3.66
2314 3313 7.014615 AGTGCATTTAAAAAGTGAGAAGACCAT 59.985 33.333 0.00 0.00 0.00 3.55
2315 3314 6.321181 AGTGCATTTAAAAAGTGAGAAGACCA 59.679 34.615 0.00 0.00 0.00 4.02
2316 3315 6.739112 AGTGCATTTAAAAAGTGAGAAGACC 58.261 36.000 0.00 0.00 0.00 3.85
2317 3316 9.730420 TTAAGTGCATTTAAAAAGTGAGAAGAC 57.270 29.630 11.57 0.00 0.00 3.01
2318 3317 9.730420 GTTAAGTGCATTTAAAAAGTGAGAAGA 57.270 29.630 15.11 0.00 0.00 2.87
2319 3318 9.736023 AGTTAAGTGCATTTAAAAAGTGAGAAG 57.264 29.630 15.11 0.00 0.00 2.85
2320 3319 9.730420 GAGTTAAGTGCATTTAAAAAGTGAGAA 57.270 29.630 15.11 0.00 0.00 2.87
2321 3320 8.898761 TGAGTTAAGTGCATTTAAAAAGTGAGA 58.101 29.630 15.11 0.00 0.00 3.27
2322 3321 9.683069 ATGAGTTAAGTGCATTTAAAAAGTGAG 57.317 29.630 15.11 0.00 0.00 3.51
2328 3327 9.474920 CCTTCAATGAGTTAAGTGCATTTAAAA 57.525 29.630 15.11 5.88 30.37 1.52
2329 3328 8.637986 ACCTTCAATGAGTTAAGTGCATTTAAA 58.362 29.630 15.11 1.98 30.37 1.52
2330 3329 8.081633 CACCTTCAATGAGTTAAGTGCATTTAA 58.918 33.333 10.08 10.08 30.37 1.52
2331 3330 7.309133 CCACCTTCAATGAGTTAAGTGCATTTA 60.309 37.037 0.00 0.00 30.37 1.40
2332 3331 6.449698 CACCTTCAATGAGTTAAGTGCATTT 58.550 36.000 0.00 0.00 30.37 2.32
2333 3332 5.047802 CCACCTTCAATGAGTTAAGTGCATT 60.048 40.000 0.00 0.00 32.83 3.56
2334 3333 4.460382 CCACCTTCAATGAGTTAAGTGCAT 59.540 41.667 0.00 0.00 0.00 3.96
2335 3334 3.820467 CCACCTTCAATGAGTTAAGTGCA 59.180 43.478 0.00 0.00 0.00 4.57
2336 3335 3.191371 CCCACCTTCAATGAGTTAAGTGC 59.809 47.826 0.00 0.00 0.00 4.40
2337 3336 3.191371 GCCCACCTTCAATGAGTTAAGTG 59.809 47.826 0.00 0.00 0.00 3.16
2338 3337 3.074538 AGCCCACCTTCAATGAGTTAAGT 59.925 43.478 0.00 0.00 0.00 2.24
2339 3338 3.690460 AGCCCACCTTCAATGAGTTAAG 58.310 45.455 0.00 0.00 0.00 1.85
2340 3339 3.806949 AGCCCACCTTCAATGAGTTAA 57.193 42.857 0.00 0.00 0.00 2.01
2341 3340 4.919774 TTAGCCCACCTTCAATGAGTTA 57.080 40.909 0.00 0.00 0.00 2.24
2342 3341 3.806949 TTAGCCCACCTTCAATGAGTT 57.193 42.857 0.00 0.00 0.00 3.01
2343 3342 4.322057 AATTAGCCCACCTTCAATGAGT 57.678 40.909 0.00 0.00 0.00 3.41
2344 3343 5.684704 TCTAATTAGCCCACCTTCAATGAG 58.315 41.667 7.67 0.00 0.00 2.90
2345 3344 5.428457 TCTCTAATTAGCCCACCTTCAATGA 59.572 40.000 7.67 0.00 0.00 2.57
2346 3345 5.684704 TCTCTAATTAGCCCACCTTCAATG 58.315 41.667 7.67 0.00 0.00 2.82
2347 3346 5.688766 GCTCTCTAATTAGCCCACCTTCAAT 60.689 44.000 7.67 0.00 32.40 2.57
2348 3347 4.384208 GCTCTCTAATTAGCCCACCTTCAA 60.384 45.833 7.67 0.00 32.40 2.69
2349 3348 3.134804 GCTCTCTAATTAGCCCACCTTCA 59.865 47.826 7.67 0.00 32.40 3.02
2350 3349 3.134804 TGCTCTCTAATTAGCCCACCTTC 59.865 47.826 7.67 0.00 37.97 3.46
2351 3350 3.115390 TGCTCTCTAATTAGCCCACCTT 58.885 45.455 7.67 0.00 37.97 3.50
2352 3351 2.703007 CTGCTCTCTAATTAGCCCACCT 59.297 50.000 7.67 0.00 37.97 4.00
2353 3352 2.700897 TCTGCTCTCTAATTAGCCCACC 59.299 50.000 7.67 0.00 37.97 4.61
2354 3353 3.639094 TCTCTGCTCTCTAATTAGCCCAC 59.361 47.826 7.67 0.00 37.97 4.61
2355 3354 3.894427 CTCTCTGCTCTCTAATTAGCCCA 59.106 47.826 7.67 1.72 37.97 5.36
2356 3355 4.148838 TCTCTCTGCTCTCTAATTAGCCC 58.851 47.826 7.67 0.00 37.97 5.19
2357 3356 5.476599 TCATCTCTCTGCTCTCTAATTAGCC 59.523 44.000 7.67 0.00 37.97 3.93
2358 3357 6.573664 TCATCTCTCTGCTCTCTAATTAGC 57.426 41.667 7.67 0.00 39.25 3.09
2359 3358 8.239314 GTCATCATCTCTCTGCTCTCTAATTAG 58.761 40.741 6.11 6.11 0.00 1.73
2360 3359 7.944000 AGTCATCATCTCTCTGCTCTCTAATTA 59.056 37.037 0.00 0.00 0.00 1.40
2361 3360 6.779049 AGTCATCATCTCTCTGCTCTCTAATT 59.221 38.462 0.00 0.00 0.00 1.40
2362 3361 6.309357 AGTCATCATCTCTCTGCTCTCTAAT 58.691 40.000 0.00 0.00 0.00 1.73
2363 3362 5.693961 AGTCATCATCTCTCTGCTCTCTAA 58.306 41.667 0.00 0.00 0.00 2.10
2364 3363 5.308976 AGTCATCATCTCTCTGCTCTCTA 57.691 43.478 0.00 0.00 0.00 2.43
2365 3364 4.174704 AGTCATCATCTCTCTGCTCTCT 57.825 45.455 0.00 0.00 0.00 3.10
2366 3365 4.613944 CAAGTCATCATCTCTCTGCTCTC 58.386 47.826 0.00 0.00 0.00 3.20
2367 3366 3.181473 GCAAGTCATCATCTCTCTGCTCT 60.181 47.826 0.00 0.00 0.00 4.09
2368 3367 3.125316 GCAAGTCATCATCTCTCTGCTC 58.875 50.000 0.00 0.00 0.00 4.26
2369 3368 2.500504 TGCAAGTCATCATCTCTCTGCT 59.499 45.455 0.00 0.00 0.00 4.24
2370 3369 2.608546 GTGCAAGTCATCATCTCTCTGC 59.391 50.000 0.00 0.00 0.00 4.26
2371 3370 3.858247 TGTGCAAGTCATCATCTCTCTG 58.142 45.455 0.00 0.00 0.00 3.35
2372 3371 4.757019 ATGTGCAAGTCATCATCTCTCT 57.243 40.909 0.00 0.00 0.00 3.10
2373 3372 5.220815 GGAAATGTGCAAGTCATCATCTCTC 60.221 44.000 0.00 0.00 0.00 3.20
2374 3373 4.639310 GGAAATGTGCAAGTCATCATCTCT 59.361 41.667 0.00 0.00 0.00 3.10
2375 3374 4.397103 TGGAAATGTGCAAGTCATCATCTC 59.603 41.667 0.00 0.00 0.00 2.75
2376 3375 4.338012 TGGAAATGTGCAAGTCATCATCT 58.662 39.130 0.00 0.00 0.00 2.90
2377 3376 4.707030 TGGAAATGTGCAAGTCATCATC 57.293 40.909 0.00 0.00 0.00 2.92
2378 3377 5.046878 ACATTGGAAATGTGCAAGTCATCAT 60.047 36.000 4.86 0.00 38.60 2.45
2379 3378 4.281435 ACATTGGAAATGTGCAAGTCATCA 59.719 37.500 4.86 0.00 38.60 3.07
2380 3379 4.813027 ACATTGGAAATGTGCAAGTCATC 58.187 39.130 4.86 0.00 38.60 2.92
2381 3380 4.877378 ACATTGGAAATGTGCAAGTCAT 57.123 36.364 4.86 0.00 38.60 3.06
2382 3381 5.981088 ATACATTGGAAATGTGCAAGTCA 57.019 34.783 14.35 0.00 38.60 3.41
2383 3382 7.656707 AAAATACATTGGAAATGTGCAAGTC 57.343 32.000 14.35 0.00 38.60 3.01
2384 3383 7.714377 TGAAAAATACATTGGAAATGTGCAAGT 59.286 29.630 14.35 0.00 38.60 3.16
2385 3384 8.011106 GTGAAAAATACATTGGAAATGTGCAAG 58.989 33.333 14.35 0.00 38.60 4.01
2386 3385 7.714377 AGTGAAAAATACATTGGAAATGTGCAA 59.286 29.630 14.35 0.00 39.64 4.08
2387 3386 7.215789 AGTGAAAAATACATTGGAAATGTGCA 58.784 30.769 14.35 0.00 33.76 4.57
2388 3387 7.148590 GGAGTGAAAAATACATTGGAAATGTGC 60.149 37.037 14.35 0.60 33.76 4.57
2389 3388 7.871973 TGGAGTGAAAAATACATTGGAAATGTG 59.128 33.333 14.35 0.00 33.76 3.21
2390 3389 7.872483 GTGGAGTGAAAAATACATTGGAAATGT 59.128 33.333 10.25 10.25 36.13 2.71
2391 3390 8.090214 AGTGGAGTGAAAAATACATTGGAAATG 58.910 33.333 0.00 0.00 0.00 2.32
2392 3391 8.090214 CAGTGGAGTGAAAAATACATTGGAAAT 58.910 33.333 0.00 0.00 0.00 2.17
2393 3392 7.432869 CAGTGGAGTGAAAAATACATTGGAAA 58.567 34.615 0.00 0.00 0.00 3.13
2394 3393 6.516527 GCAGTGGAGTGAAAAATACATTGGAA 60.517 38.462 0.00 0.00 0.00 3.53
2395 3394 5.048083 GCAGTGGAGTGAAAAATACATTGGA 60.048 40.000 0.00 0.00 0.00 3.53
2396 3395 5.163513 GCAGTGGAGTGAAAAATACATTGG 58.836 41.667 0.00 0.00 0.00 3.16
2397 3396 5.771469 TGCAGTGGAGTGAAAAATACATTG 58.229 37.500 0.00 0.00 0.00 2.82
2398 3397 6.594788 ATGCAGTGGAGTGAAAAATACATT 57.405 33.333 0.00 0.00 0.00 2.71
2399 3398 7.701539 TTATGCAGTGGAGTGAAAAATACAT 57.298 32.000 0.00 0.00 0.00 2.29
2400 3399 7.701539 ATTATGCAGTGGAGTGAAAAATACA 57.298 32.000 0.00 0.00 0.00 2.29
2401 3400 9.669353 CATATTATGCAGTGGAGTGAAAAATAC 57.331 33.333 0.00 0.00 0.00 1.89
2402 3401 9.407380 ACATATTATGCAGTGGAGTGAAAAATA 57.593 29.630 3.52 0.00 0.00 1.40
2403 3402 8.297470 ACATATTATGCAGTGGAGTGAAAAAT 57.703 30.769 3.52 0.00 0.00 1.82
2404 3403 7.148086 GGACATATTATGCAGTGGAGTGAAAAA 60.148 37.037 3.52 0.00 0.00 1.94
2405 3404 6.318648 GGACATATTATGCAGTGGAGTGAAAA 59.681 38.462 3.52 0.00 0.00 2.29
2406 3405 5.822519 GGACATATTATGCAGTGGAGTGAAA 59.177 40.000 3.52 0.00 0.00 2.69
2407 3406 5.130975 AGGACATATTATGCAGTGGAGTGAA 59.869 40.000 3.52 0.00 0.00 3.18
2408 3407 4.655649 AGGACATATTATGCAGTGGAGTGA 59.344 41.667 3.52 0.00 0.00 3.41
2409 3408 4.965814 AGGACATATTATGCAGTGGAGTG 58.034 43.478 3.52 0.00 0.00 3.51
2410 3409 6.747414 TTAGGACATATTATGCAGTGGAGT 57.253 37.500 3.52 0.00 0.00 3.85
2411 3410 8.627208 ATTTTAGGACATATTATGCAGTGGAG 57.373 34.615 3.52 0.00 0.00 3.86
2412 3411 8.995027 AATTTTAGGACATATTATGCAGTGGA 57.005 30.769 3.52 0.00 0.00 4.02
2413 3412 9.683069 GAAATTTTAGGACATATTATGCAGTGG 57.317 33.333 3.52 0.00 0.00 4.00
2436 3435 9.865321 GTCCACAAGTAAGTGTACATATAGAAA 57.135 33.333 0.00 0.00 37.82 2.52
2437 3436 8.186163 CGTCCACAAGTAAGTGTACATATAGAA 58.814 37.037 0.00 0.00 37.82 2.10
2438 3437 7.201758 CCGTCCACAAGTAAGTGTACATATAGA 60.202 40.741 0.00 0.00 37.82 1.98
2439 3438 6.916387 CCGTCCACAAGTAAGTGTACATATAG 59.084 42.308 0.00 0.00 37.82 1.31
2440 3439 6.602803 TCCGTCCACAAGTAAGTGTACATATA 59.397 38.462 0.00 0.00 37.82 0.86
2441 3440 5.419788 TCCGTCCACAAGTAAGTGTACATAT 59.580 40.000 0.00 0.00 37.82 1.78
2442 3441 4.766373 TCCGTCCACAAGTAAGTGTACATA 59.234 41.667 0.00 0.00 37.82 2.29
2443 3442 3.575256 TCCGTCCACAAGTAAGTGTACAT 59.425 43.478 0.00 0.00 37.82 2.29
2444 3443 2.957680 TCCGTCCACAAGTAAGTGTACA 59.042 45.455 0.00 0.00 37.82 2.90
2445 3444 3.572584 CTCCGTCCACAAGTAAGTGTAC 58.427 50.000 0.00 0.00 37.82 2.90
2446 3445 2.559668 CCTCCGTCCACAAGTAAGTGTA 59.440 50.000 0.00 0.00 37.82 2.90
2447 3446 1.343465 CCTCCGTCCACAAGTAAGTGT 59.657 52.381 0.00 0.00 37.82 3.55
2448 3447 1.337823 CCCTCCGTCCACAAGTAAGTG 60.338 57.143 0.00 0.00 39.21 3.16
2449 3448 0.974383 CCCTCCGTCCACAAGTAAGT 59.026 55.000 0.00 0.00 0.00 2.24
2450 3449 1.204941 CTCCCTCCGTCCACAAGTAAG 59.795 57.143 0.00 0.00 0.00 2.34
2451 3450 1.263356 CTCCCTCCGTCCACAAGTAA 58.737 55.000 0.00 0.00 0.00 2.24
2452 3451 0.113776 ACTCCCTCCGTCCACAAGTA 59.886 55.000 0.00 0.00 0.00 2.24
2453 3452 0.113776 TACTCCCTCCGTCCACAAGT 59.886 55.000 0.00 0.00 0.00 3.16
2454 3453 0.818296 CTACTCCCTCCGTCCACAAG 59.182 60.000 0.00 0.00 0.00 3.16
2455 3454 0.113776 ACTACTCCCTCCGTCCACAA 59.886 55.000 0.00 0.00 0.00 3.33
2456 3455 0.611062 CACTACTCCCTCCGTCCACA 60.611 60.000 0.00 0.00 0.00 4.17
2457 3456 0.611340 ACACTACTCCCTCCGTCCAC 60.611 60.000 0.00 0.00 0.00 4.02
2458 3457 0.994247 TACACTACTCCCTCCGTCCA 59.006 55.000 0.00 0.00 0.00 4.02
2459 3458 2.361643 ATACACTACTCCCTCCGTCC 57.638 55.000 0.00 0.00 0.00 4.79
2460 3459 6.413052 TCATATATACACTACTCCCTCCGTC 58.587 44.000 0.00 0.00 0.00 4.79
2461 3460 6.384342 TCATATATACACTACTCCCTCCGT 57.616 41.667 0.00 0.00 0.00 4.69
2462 3461 7.444792 GGTATCATATATACACTACTCCCTCCG 59.555 44.444 0.00 0.00 0.00 4.63
2463 3462 7.724951 GGGTATCATATATACACTACTCCCTCC 59.275 44.444 0.00 0.00 0.00 4.30
2464 3463 7.724951 GGGGTATCATATATACACTACTCCCTC 59.275 44.444 0.00 0.00 0.00 4.30
2465 3464 7.187708 TGGGGTATCATATATACACTACTCCCT 59.812 40.741 11.25 0.00 30.19 4.20
2466 3465 7.287235 GTGGGGTATCATATATACACTACTCCC 59.713 44.444 6.64 11.60 36.73 4.30
2467 3466 7.837689 TGTGGGGTATCATATATACACTACTCC 59.162 40.741 13.00 8.46 39.28 3.85
2468 3467 8.818622 TGTGGGGTATCATATATACACTACTC 57.181 38.462 13.00 0.00 39.28 2.59
2469 3468 9.610104 TTTGTGGGGTATCATATATACACTACT 57.390 33.333 13.00 0.00 39.28 2.57
2510 3509 8.823794 TGAAGGAGATCTTGCTATCATTATCAT 58.176 33.333 0.00 0.00 35.50 2.45
2511 3510 8.198807 TGAAGGAGATCTTGCTATCATTATCA 57.801 34.615 0.00 0.00 35.50 2.15
2512 3511 9.100554 CATGAAGGAGATCTTGCTATCATTATC 57.899 37.037 0.00 0.00 35.50 1.75
2513 3512 8.047911 CCATGAAGGAGATCTTGCTATCATTAT 58.952 37.037 0.00 0.00 41.22 1.28
2514 3513 7.016957 ACCATGAAGGAGATCTTGCTATCATTA 59.983 37.037 0.00 0.00 41.22 1.90
2515 3514 6.183361 ACCATGAAGGAGATCTTGCTATCATT 60.183 38.462 0.00 0.00 41.22 2.57
2516 3515 5.310068 ACCATGAAGGAGATCTTGCTATCAT 59.690 40.000 0.00 1.00 41.22 2.45
2517 3516 4.657504 ACCATGAAGGAGATCTTGCTATCA 59.342 41.667 0.00 0.00 41.22 2.15
2518 3517 5.226194 ACCATGAAGGAGATCTTGCTATC 57.774 43.478 0.00 0.00 41.22 2.08
2519 3518 4.262377 CGACCATGAAGGAGATCTTGCTAT 60.262 45.833 0.00 0.00 41.22 2.97
2520 3519 3.068732 CGACCATGAAGGAGATCTTGCTA 59.931 47.826 0.00 0.00 41.22 3.49
2521 3520 2.158986 CGACCATGAAGGAGATCTTGCT 60.159 50.000 0.00 0.00 41.22 3.91
2522 3521 2.208431 CGACCATGAAGGAGATCTTGC 58.792 52.381 0.00 0.00 41.22 4.01
2523 3522 2.169352 ACCGACCATGAAGGAGATCTTG 59.831 50.000 0.00 0.00 41.22 3.02
2524 3523 2.472029 ACCGACCATGAAGGAGATCTT 58.528 47.619 0.00 0.00 41.22 2.40
2525 3524 2.166907 ACCGACCATGAAGGAGATCT 57.833 50.000 0.00 0.00 41.22 2.75
2526 3525 4.402056 TTTACCGACCATGAAGGAGATC 57.598 45.455 0.00 0.00 41.22 2.75
2527 3526 4.656112 AGATTTACCGACCATGAAGGAGAT 59.344 41.667 0.00 0.00 41.22 2.75
2528 3527 4.030913 AGATTTACCGACCATGAAGGAGA 58.969 43.478 0.00 0.00 41.22 3.71
2529 3528 4.408182 AGATTTACCGACCATGAAGGAG 57.592 45.455 0.00 0.00 41.22 3.69
2530 3529 4.712829 TGTAGATTTACCGACCATGAAGGA 59.287 41.667 0.00 0.00 41.22 3.36
2531 3530 5.018539 TGTAGATTTACCGACCATGAAGG 57.981 43.478 0.00 0.00 45.67 3.46
2532 3531 5.520288 CACTGTAGATTTACCGACCATGAAG 59.480 44.000 0.00 0.00 0.00 3.02
2533 3532 5.046878 ACACTGTAGATTTACCGACCATGAA 60.047 40.000 0.00 0.00 0.00 2.57
2534 3533 4.464951 ACACTGTAGATTTACCGACCATGA 59.535 41.667 0.00 0.00 0.00 3.07
2535 3534 4.566759 CACACTGTAGATTTACCGACCATG 59.433 45.833 0.00 0.00 0.00 3.66
2536 3535 4.222145 ACACACTGTAGATTTACCGACCAT 59.778 41.667 0.00 0.00 0.00 3.55
2537 3536 3.575256 ACACACTGTAGATTTACCGACCA 59.425 43.478 0.00 0.00 0.00 4.02
2538 3537 3.924686 CACACACTGTAGATTTACCGACC 59.075 47.826 0.00 0.00 0.00 4.79
2539 3538 3.367025 GCACACACTGTAGATTTACCGAC 59.633 47.826 0.00 0.00 0.00 4.79
2540 3539 3.257375 AGCACACACTGTAGATTTACCGA 59.743 43.478 0.00 0.00 0.00 4.69
2541 3540 3.585862 AGCACACACTGTAGATTTACCG 58.414 45.455 0.00 0.00 0.00 4.02
2542 3541 8.712285 TTATAAGCACACACTGTAGATTTACC 57.288 34.615 0.00 0.00 0.00 2.85
2551 3550 9.840427 GACATTTAATTTATAAGCACACACTGT 57.160 29.630 0.00 0.00 0.00 3.55
2552 3551 8.998989 CGACATTTAATTTATAAGCACACACTG 58.001 33.333 0.00 0.00 0.00 3.66
2553 3552 8.941977 TCGACATTTAATTTATAAGCACACACT 58.058 29.630 0.00 0.00 0.00 3.55
2554 3553 9.716507 ATCGACATTTAATTTATAAGCACACAC 57.283 29.630 0.00 0.00 0.00 3.82
2555 3554 9.715123 CATCGACATTTAATTTATAAGCACACA 57.285 29.630 0.00 0.00 0.00 3.72
2556 3555 9.929722 TCATCGACATTTAATTTATAAGCACAC 57.070 29.630 0.00 0.00 0.00 3.82
2575 3574 9.382244 GCAACCTTGTATAATTAAATCATCGAC 57.618 33.333 0.00 0.00 0.00 4.20
2576 3575 8.564574 GGCAACCTTGTATAATTAAATCATCGA 58.435 33.333 0.00 0.00 0.00 3.59
2577 3576 8.567948 AGGCAACCTTGTATAATTAAATCATCG 58.432 33.333 0.00 0.00 37.17 3.84
2594 3593 3.306472 TTAGGAACACAAGGCAACCTT 57.694 42.857 0.00 0.00 45.88 3.50
2595 3594 3.525800 ATTAGGAACACAAGGCAACCT 57.474 42.857 0.00 0.00 33.87 3.50
2596 3595 5.715434 TTAATTAGGAACACAAGGCAACC 57.285 39.130 0.00 0.00 37.17 3.77
2597 3596 7.360017 GCAAATTAATTAGGAACACAAGGCAAC 60.360 37.037 0.01 0.00 0.00 4.17
2598 3597 6.648725 GCAAATTAATTAGGAACACAAGGCAA 59.351 34.615 0.01 0.00 0.00 4.52
2599 3598 6.162777 GCAAATTAATTAGGAACACAAGGCA 58.837 36.000 0.01 0.00 0.00 4.75
2600 3599 5.580691 GGCAAATTAATTAGGAACACAAGGC 59.419 40.000 0.01 0.00 0.00 4.35
2601 3600 6.813152 CAGGCAAATTAATTAGGAACACAAGG 59.187 38.462 0.01 0.00 0.00 3.61
2602 3601 6.813152 CCAGGCAAATTAATTAGGAACACAAG 59.187 38.462 0.01 0.00 0.00 3.16
2603 3602 6.696411 CCAGGCAAATTAATTAGGAACACAA 58.304 36.000 0.01 0.00 0.00 3.33
2604 3603 5.337169 GCCAGGCAAATTAATTAGGAACACA 60.337 40.000 6.55 0.00 0.00 3.72
2605 3604 5.109210 GCCAGGCAAATTAATTAGGAACAC 58.891 41.667 6.55 0.00 0.00 3.32
2606 3605 4.774726 TGCCAGGCAAATTAATTAGGAACA 59.225 37.500 13.33 0.00 34.76 3.18
2607 3606 5.337578 TGCCAGGCAAATTAATTAGGAAC 57.662 39.130 13.33 0.00 34.76 3.62
2623 3622 4.273318 AGAACCTAATTAAGCTTGCCAGG 58.727 43.478 9.86 12.26 0.00 4.45
2624 3623 4.336713 GGAGAACCTAATTAAGCTTGCCAG 59.663 45.833 9.86 0.81 0.00 4.85
2627 3626 5.221126 CCATGGAGAACCTAATTAAGCTTGC 60.221 44.000 5.56 0.00 37.04 4.01
2632 3631 4.580580 GCCACCATGGAGAACCTAATTAAG 59.419 45.833 21.47 0.00 40.96 1.85
2633 3632 4.017958 TGCCACCATGGAGAACCTAATTAA 60.018 41.667 21.47 0.00 40.96 1.40
2634 3633 3.525609 TGCCACCATGGAGAACCTAATTA 59.474 43.478 21.47 0.00 40.96 1.40
2635 3634 2.311542 TGCCACCATGGAGAACCTAATT 59.688 45.455 21.47 0.00 40.96 1.40
2636 3635 1.922447 TGCCACCATGGAGAACCTAAT 59.078 47.619 21.47 0.00 40.96 1.73
2637 3636 1.281867 CTGCCACCATGGAGAACCTAA 59.718 52.381 21.47 0.00 40.96 2.69
2645 3644 1.276859 ATGAGCTCTGCCACCATGGA 61.277 55.000 21.47 0.00 40.96 3.41
2653 3652 0.036577 ACACTGACATGAGCTCTGCC 60.037 55.000 16.19 4.02 0.00 4.85
2656 3655 0.975135 AGCACACTGACATGAGCTCT 59.025 50.000 16.19 0.00 41.97 4.09
2678 3677 0.180642 ATGTGGCCAGAGATGCTCAG 59.819 55.000 5.11 0.00 32.06 3.35
2680 3679 0.179702 TGATGTGGCCAGAGATGCTC 59.820 55.000 5.11 0.00 0.00 4.26
2688 3687 1.592400 CTTGGTGCTGATGTGGCCAG 61.592 60.000 5.11 0.00 34.88 4.85
2693 3692 0.322277 AGCTCCTTGGTGCTGATGTG 60.322 55.000 14.44 0.00 38.21 3.21
2694 3693 0.035630 GAGCTCCTTGGTGCTGATGT 60.036 55.000 19.20 0.00 39.91 3.06
2700 3699 4.930592 GAGAGAGCTCCTTGGTGC 57.069 61.111 10.93 5.65 35.01 5.01
2725 3724 2.362120 AGGTAGGCCGCGTAGTGT 60.362 61.111 4.92 0.00 40.50 3.55
2755 3754 4.778415 CCGGAGGCGTCGTGAGTG 62.778 72.222 0.00 0.00 46.14 3.51
2778 3777 3.746949 GATCGCTGCTGTGGGGAGG 62.747 68.421 4.20 0.00 33.77 4.30
2784 3783 2.887568 GGACCGATCGCTGCTGTG 60.888 66.667 10.32 0.00 0.00 3.66
2785 3784 3.069980 GAGGACCGATCGCTGCTGT 62.070 63.158 9.33 1.10 0.00 4.40
2786 3785 2.279120 GAGGACCGATCGCTGCTG 60.279 66.667 9.33 0.00 0.00 4.41
2787 3786 2.441164 AGAGGACCGATCGCTGCT 60.441 61.111 10.32 6.92 0.00 4.24
2788 3787 2.026879 GAGAGGACCGATCGCTGC 59.973 66.667 10.32 0.71 0.00 5.25
2789 3788 2.725008 GGAGAGGACCGATCGCTG 59.275 66.667 10.32 0.00 0.00 5.18
2837 3836 2.514824 GCAAGGATGGAGGGACGC 60.515 66.667 0.00 0.00 0.00 5.19
2838 3837 1.026718 GTTGCAAGGATGGAGGGACG 61.027 60.000 0.00 0.00 0.00 4.79
2839 3838 0.681243 GGTTGCAAGGATGGAGGGAC 60.681 60.000 0.00 0.00 0.00 4.46
2840 3839 1.691219 GGTTGCAAGGATGGAGGGA 59.309 57.895 0.00 0.00 0.00 4.20
2841 3840 1.750399 CGGTTGCAAGGATGGAGGG 60.750 63.158 0.00 0.00 0.00 4.30
2842 3841 1.750399 CCGGTTGCAAGGATGGAGG 60.750 63.158 0.00 0.00 0.00 4.30
2843 3842 1.026718 GTCCGGTTGCAAGGATGGAG 61.027 60.000 10.36 0.00 38.97 3.86
2844 3843 1.002624 GTCCGGTTGCAAGGATGGA 60.003 57.895 10.36 7.59 38.97 3.41
2845 3844 2.046285 GGTCCGGTTGCAAGGATGG 61.046 63.158 10.36 5.43 38.97 3.51
2846 3845 2.398554 CGGTCCGGTTGCAAGGATG 61.399 63.158 10.36 3.73 38.97 3.51
2847 3846 1.910580 ATCGGTCCGGTTGCAAGGAT 61.911 55.000 12.29 0.00