Multiple sequence alignment - TraesCS5B01G558700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G558700 chr5B 100.000 4610 0 0 1 4610 705985528 705980919 0.000000e+00 8514.0
1 TraesCS5B01G558700 chr5B 86.949 3632 460 11 945 4571 706453376 706456998 0.000000e+00 4069.0
2 TraesCS5B01G558700 chr5B 86.964 3590 437 26 969 4541 706389074 706385499 0.000000e+00 4008.0
3 TraesCS5B01G558700 chr5B 85.439 3482 483 19 1025 4501 706710225 706713687 0.000000e+00 3600.0
4 TraesCS5B01G558700 chr5B 100.000 1731 0 0 4836 6566 705980693 705978963 0.000000e+00 3197.0
5 TraesCS5B01G558700 chr5B 100.000 475 0 0 6966 7440 705978563 705978089 0.000000e+00 878.0
6 TraesCS5B01G558700 chr5B 84.877 324 20 13 7110 7430 705946857 705946560 4.360000e-77 300.0
7 TraesCS5B01G558700 chr5B 86.029 272 14 11 7110 7374 706155553 706155299 3.420000e-68 270.0
8 TraesCS5B01G558700 chr5B 85.567 97 9 4 89 181 706390686 706390591 6.140000e-16 97.1
9 TraesCS5B01G558700 chr5B 82.727 110 15 2 5826 5935 443271401 443271506 2.210000e-15 95.3
10 TraesCS5B01G558700 chr5D 87.302 3662 438 26 840 4487 563979898 563976250 0.000000e+00 4161.0
11 TraesCS5B01G558700 chr5D 84.682 3708 520 36 859 4541 564226621 564230305 0.000000e+00 3657.0
12 TraesCS5B01G558700 chr5D 89.976 409 32 5 187 593 13171348 13170947 3.080000e-143 520.0
13 TraesCS5B01G558700 chr5D 89.100 422 36 8 179 600 443821823 443821412 3.980000e-142 516.0
14 TraesCS5B01G558700 chr5D 89.970 329 16 5 7110 7438 563725980 563725669 6.950000e-110 409.0
15 TraesCS5B01G558700 chr5D 90.000 220 15 3 7110 7328 563638674 563638461 2.040000e-70 278.0
16 TraesCS5B01G558700 chr5D 82.727 110 15 2 5826 5935 373206164 373206269 2.210000e-15 95.3
17 TraesCS5B01G558700 chr5D 90.411 73 4 2 7366 7438 563638449 563638380 7.950000e-15 93.5
18 TraesCS5B01G558700 chr4A 85.218 3687 497 30 904 4572 608481647 608477991 0.000000e+00 3746.0
19 TraesCS5B01G558700 chr4A 84.816 3609 503 31 954 4541 608271172 608267588 0.000000e+00 3587.0
20 TraesCS5B01G558700 chr4A 83.992 3467 541 13 1029 4487 608234683 608231223 0.000000e+00 3315.0
21 TraesCS5B01G558700 chr4A 85.542 83 2 4 7365 7438 608868267 608868348 2.230000e-10 78.7
22 TraesCS5B01G558700 chr3B 84.897 3529 508 22 1025 4541 8039908 8043423 0.000000e+00 3541.0
23 TraesCS5B01G558700 chr4B 95.519 424 15 4 182 601 520838978 520839401 0.000000e+00 675.0
24 TraesCS5B01G558700 chr2A 92.892 408 21 6 187 592 174751870 174751469 2.990000e-163 586.0
25 TraesCS5B01G558700 chr2A 91.892 407 25 8 189 592 33688699 33689100 5.040000e-156 562.0
26 TraesCS5B01G558700 chr7A 92.365 406 24 6 189 592 596327459 596327859 8.370000e-159 571.0
27 TraesCS5B01G558700 chr7A 90.709 409 22 8 184 592 687904306 687904698 1.420000e-146 531.0
28 TraesCS5B01G558700 chr5A 91.709 398 25 5 189 585 494869377 494868987 5.080000e-151 545.0
29 TraesCS5B01G558700 chr5A 90.244 410 32 6 188 593 573054872 573054467 5.110000e-146 529.0
30 TraesCS5B01G558700 chr5A 92.708 96 4 2 5836 5931 538322966 538322874 1.300000e-27 135.0
31 TraesCS5B01G558700 chr6B 83.019 106 14 4 5826 5931 23039507 23039406 7.950000e-15 93.5
32 TraesCS5B01G558700 chr7D 83.505 97 13 2 5835 5931 79547314 79547221 3.700000e-13 87.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G558700 chr5B 705978089 705985528 7439 True 4196.333333 8514 100.0000 1 7440 3 chr5B.!!$R3 7439
1 TraesCS5B01G558700 chr5B 706453376 706456998 3622 False 4069.000000 4069 86.9490 945 4571 1 chr5B.!!$F2 3626
2 TraesCS5B01G558700 chr5B 706710225 706713687 3462 False 3600.000000 3600 85.4390 1025 4501 1 chr5B.!!$F3 3476
3 TraesCS5B01G558700 chr5B 706385499 706390686 5187 True 2052.550000 4008 86.2655 89 4541 2 chr5B.!!$R4 4452
4 TraesCS5B01G558700 chr5D 563976250 563979898 3648 True 4161.000000 4161 87.3020 840 4487 1 chr5D.!!$R4 3647
5 TraesCS5B01G558700 chr5D 564226621 564230305 3684 False 3657.000000 3657 84.6820 859 4541 1 chr5D.!!$F2 3682
6 TraesCS5B01G558700 chr4A 608477991 608481647 3656 True 3746.000000 3746 85.2180 904 4572 1 chr4A.!!$R3 3668
7 TraesCS5B01G558700 chr4A 608267588 608271172 3584 True 3587.000000 3587 84.8160 954 4541 1 chr4A.!!$R2 3587
8 TraesCS5B01G558700 chr4A 608231223 608234683 3460 True 3315.000000 3315 83.9920 1029 4487 1 chr4A.!!$R1 3458
9 TraesCS5B01G558700 chr3B 8039908 8043423 3515 False 3541.000000 3541 84.8970 1025 4541 1 chr3B.!!$F1 3516


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
206 208 0.108585 TGGGAAAGGTGTGACAGCTC 59.891 55.0 18.37 6.62 41.59 4.09 F
825 834 0.109342 ACACTCTTCCTGTGGCAAGG 59.891 55.0 8.80 8.80 39.52 3.61 F
826 835 0.109342 CACTCTTCCTGTGGCAAGGT 59.891 55.0 13.15 0.00 38.58 3.50 F
962 2171 0.321671 CAGAGACCTCCTTGCCGAAA 59.678 55.0 0.00 0.00 0.00 3.46 F
1675 2900 0.694771 TGAACCAGAATCCAGCAGCT 59.305 50.0 0.00 0.00 0.00 4.24 F
3552 4792 0.463654 ACTTGCCGTCAGTGAAGCAA 60.464 50.0 23.34 23.34 42.60 3.91 F
5085 6342 0.178967 TGGAAAGCATGCTTGGGACA 60.179 50.0 32.54 23.63 36.26 4.02 F
5174 6431 0.034337 AAATTTGCTGGCTGGTGCAG 59.966 50.0 0.00 0.00 40.46 4.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1225 2447 0.108520 TCGGTTATGGCCTTCACGAC 60.109 55.000 3.32 0.00 0.00 4.34 R
2409 3644 0.396974 AGCTCTGCCTCTGTCTAGGG 60.397 60.000 0.00 0.00 37.11 3.53 R
2694 3932 1.002888 ACAGTTGGTGATGCTCTCTGG 59.997 52.381 0.00 0.00 0.00 3.86 R
2849 4087 3.742882 CACTCGAATGCTTCTTGAGTTGA 59.257 43.478 0.00 0.00 37.79 3.18 R
3660 4900 0.461339 ACCTTGTGACGCGTTGAAGT 60.461 50.000 15.53 3.82 0.00 3.01 R
5155 6412 0.034337 CTGCACCAGCCAGCAAATTT 59.966 50.000 0.00 0.00 40.73 1.82 R
6280 7537 0.105453 ATACAGGCTCAGGATCCCGT 60.105 55.000 8.55 0.00 0.00 5.28 R
7138 8395 0.032217 CTCCCTCCTTCCTCAGCTCT 60.032 60.000 0.00 0.00 0.00 4.09 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
21 22 4.928661 CAAGTTATACCGATATGCAGGC 57.071 45.455 0.00 0.00 0.00 4.85
22 23 4.569943 CAAGTTATACCGATATGCAGGCT 58.430 43.478 0.00 0.00 0.00 4.58
23 24 4.891992 AGTTATACCGATATGCAGGCTT 57.108 40.909 0.00 0.00 0.00 4.35
24 25 4.569943 AGTTATACCGATATGCAGGCTTG 58.430 43.478 0.00 0.00 0.00 4.01
25 26 4.040461 AGTTATACCGATATGCAGGCTTGT 59.960 41.667 0.00 0.00 0.00 3.16
26 27 2.238942 TACCGATATGCAGGCTTGTG 57.761 50.000 0.00 0.00 0.00 3.33
27 28 1.097547 ACCGATATGCAGGCTTGTGC 61.098 55.000 0.00 0.00 44.27 4.57
37 38 3.731136 GCTTGTGCCTGTGACGAA 58.269 55.556 0.00 0.00 0.00 3.85
38 39 2.247790 GCTTGTGCCTGTGACGAAT 58.752 52.632 0.00 0.00 0.00 3.34
39 40 0.593128 GCTTGTGCCTGTGACGAATT 59.407 50.000 0.00 0.00 0.00 2.17
40 41 1.001378 GCTTGTGCCTGTGACGAATTT 60.001 47.619 0.00 0.00 0.00 1.82
41 42 2.653890 CTTGTGCCTGTGACGAATTTG 58.346 47.619 0.00 0.00 0.00 2.32
42 43 0.310543 TGTGCCTGTGACGAATTTGC 59.689 50.000 0.00 0.00 0.00 3.68
43 44 0.593128 GTGCCTGTGACGAATTTGCT 59.407 50.000 0.00 0.00 0.00 3.91
44 45 1.804151 GTGCCTGTGACGAATTTGCTA 59.196 47.619 0.00 0.00 0.00 3.49
45 46 2.076100 TGCCTGTGACGAATTTGCTAG 58.924 47.619 0.00 0.00 0.00 3.42
46 47 2.289382 TGCCTGTGACGAATTTGCTAGA 60.289 45.455 0.00 0.00 0.00 2.43
47 48 2.939103 GCCTGTGACGAATTTGCTAGAT 59.061 45.455 0.00 0.00 0.00 1.98
48 49 3.375299 GCCTGTGACGAATTTGCTAGATT 59.625 43.478 0.00 0.00 0.00 2.40
49 50 4.142600 GCCTGTGACGAATTTGCTAGATTT 60.143 41.667 0.00 0.00 0.00 2.17
50 51 5.327091 CCTGTGACGAATTTGCTAGATTTG 58.673 41.667 0.00 0.00 0.00 2.32
51 52 5.122239 CCTGTGACGAATTTGCTAGATTTGA 59.878 40.000 0.00 0.00 0.00 2.69
52 53 6.183360 CCTGTGACGAATTTGCTAGATTTGAT 60.183 38.462 0.00 0.00 0.00 2.57
53 54 6.775088 TGTGACGAATTTGCTAGATTTGATC 58.225 36.000 0.00 0.00 0.00 2.92
54 55 6.371271 TGTGACGAATTTGCTAGATTTGATCA 59.629 34.615 0.00 0.00 0.00 2.92
55 56 7.066163 TGTGACGAATTTGCTAGATTTGATCAT 59.934 33.333 0.00 0.00 0.00 2.45
56 57 7.912250 GTGACGAATTTGCTAGATTTGATCATT 59.088 33.333 0.00 0.00 0.00 2.57
57 58 8.461222 TGACGAATTTGCTAGATTTGATCATTT 58.539 29.630 0.00 0.00 0.00 2.32
58 59 9.935682 GACGAATTTGCTAGATTTGATCATTTA 57.064 29.630 0.00 0.00 0.00 1.40
59 60 9.722056 ACGAATTTGCTAGATTTGATCATTTAC 57.278 29.630 0.00 0.00 0.00 2.01
60 61 9.720667 CGAATTTGCTAGATTTGATCATTTACA 57.279 29.630 0.00 0.00 0.00 2.41
64 65 9.624697 TTTGCTAGATTTGATCATTTACAACAC 57.375 29.630 0.00 0.00 0.00 3.32
65 66 8.565896 TGCTAGATTTGATCATTTACAACACT 57.434 30.769 0.00 0.00 0.00 3.55
66 67 9.665719 TGCTAGATTTGATCATTTACAACACTA 57.334 29.630 0.00 0.00 0.00 2.74
67 68 9.922305 GCTAGATTTGATCATTTACAACACTAC 57.078 33.333 0.00 0.00 0.00 2.73
73 74 9.653287 TTTGATCATTTACAACACTACCTAGAG 57.347 33.333 0.00 0.00 0.00 2.43
74 75 8.589701 TGATCATTTACAACACTACCTAGAGA 57.410 34.615 0.00 0.00 0.00 3.10
75 76 9.031537 TGATCATTTACAACACTACCTAGAGAA 57.968 33.333 0.00 0.00 0.00 2.87
76 77 9.522804 GATCATTTACAACACTACCTAGAGAAG 57.477 37.037 0.00 0.00 0.00 2.85
77 78 7.321153 TCATTTACAACACTACCTAGAGAAGC 58.679 38.462 0.00 0.00 0.00 3.86
78 79 5.656213 TTACAACACTACCTAGAGAAGCC 57.344 43.478 0.00 0.00 0.00 4.35
79 80 2.492484 ACAACACTACCTAGAGAAGCCG 59.508 50.000 0.00 0.00 0.00 5.52
80 81 2.492484 CAACACTACCTAGAGAAGCCGT 59.508 50.000 0.00 0.00 0.00 5.68
81 82 2.805194 ACACTACCTAGAGAAGCCGTT 58.195 47.619 0.00 0.00 0.00 4.44
82 83 3.163467 ACACTACCTAGAGAAGCCGTTT 58.837 45.455 0.00 0.00 0.00 3.60
83 84 3.577415 ACACTACCTAGAGAAGCCGTTTT 59.423 43.478 0.00 0.00 0.00 2.43
84 85 3.927142 CACTACCTAGAGAAGCCGTTTTG 59.073 47.826 0.00 0.00 0.00 2.44
85 86 1.809684 ACCTAGAGAAGCCGTTTTGC 58.190 50.000 0.00 0.00 0.00 3.68
86 87 1.071699 ACCTAGAGAAGCCGTTTTGCA 59.928 47.619 0.00 0.00 0.00 4.08
87 88 1.734465 CCTAGAGAAGCCGTTTTGCAG 59.266 52.381 0.00 0.00 0.00 4.41
88 89 2.612972 CCTAGAGAAGCCGTTTTGCAGA 60.613 50.000 0.00 0.00 0.00 4.26
89 90 1.967319 AGAGAAGCCGTTTTGCAGAA 58.033 45.000 0.00 0.00 0.00 3.02
90 91 2.508526 AGAGAAGCCGTTTTGCAGAAT 58.491 42.857 0.00 0.00 0.00 2.40
91 92 2.887152 AGAGAAGCCGTTTTGCAGAATT 59.113 40.909 0.00 0.00 0.00 2.17
92 93 3.319122 AGAGAAGCCGTTTTGCAGAATTT 59.681 39.130 0.00 0.00 0.00 1.82
93 94 3.642705 AGAAGCCGTTTTGCAGAATTTC 58.357 40.909 0.00 0.00 0.00 2.17
100 101 4.484236 CGTTTTGCAGAATTTCATAGGCA 58.516 39.130 0.00 0.68 0.00 4.75
105 106 3.198068 GCAGAATTTCATAGGCACTCGA 58.802 45.455 0.00 0.00 41.75 4.04
107 108 3.806521 CAGAATTTCATAGGCACTCGAGG 59.193 47.826 18.41 6.97 41.75 4.63
109 110 4.162320 AGAATTTCATAGGCACTCGAGGAA 59.838 41.667 18.41 5.67 41.75 3.36
111 112 3.459232 TTCATAGGCACTCGAGGAATG 57.541 47.619 18.41 11.93 41.75 2.67
118 119 2.266554 GCACTCGAGGAATGAAGTCTG 58.733 52.381 18.41 2.61 0.00 3.51
119 120 2.266554 CACTCGAGGAATGAAGTCTGC 58.733 52.381 18.41 0.00 0.00 4.26
122 123 3.007398 ACTCGAGGAATGAAGTCTGCTTT 59.993 43.478 18.41 0.00 34.61 3.51
123 124 3.589988 TCGAGGAATGAAGTCTGCTTTC 58.410 45.455 0.00 0.00 34.61 2.62
124 125 3.006859 TCGAGGAATGAAGTCTGCTTTCA 59.993 43.478 8.37 0.00 34.61 2.69
132 133 5.679734 TGAAGTCTGCTTTCACAAGATTC 57.320 39.130 0.00 0.00 34.61 2.52
133 134 4.212004 TGAAGTCTGCTTTCACAAGATTCG 59.788 41.667 0.00 0.00 34.61 3.34
134 135 3.995199 AGTCTGCTTTCACAAGATTCGA 58.005 40.909 0.00 0.00 30.57 3.71
135 136 3.993081 AGTCTGCTTTCACAAGATTCGAG 59.007 43.478 0.00 0.00 30.57 4.04
136 137 3.743396 GTCTGCTTTCACAAGATTCGAGT 59.257 43.478 0.00 0.00 30.57 4.18
167 169 6.256686 CAACTCAAGAGCTAATTTCTGATGC 58.743 40.000 0.00 0.00 0.00 3.91
170 172 5.660460 TCAAGAGCTAATTTCTGATGCGTA 58.340 37.500 0.00 0.00 0.00 4.42
203 205 4.670896 AAAAATGGGAAAGGTGTGACAG 57.329 40.909 0.00 0.00 0.00 3.51
204 206 1.620822 AATGGGAAAGGTGTGACAGC 58.379 50.000 6.68 6.68 0.00 4.40
205 207 0.773644 ATGGGAAAGGTGTGACAGCT 59.226 50.000 12.08 12.08 44.48 4.24
206 208 0.108585 TGGGAAAGGTGTGACAGCTC 59.891 55.000 18.37 6.62 41.59 4.09
207 209 0.606673 GGGAAAGGTGTGACAGCTCC 60.607 60.000 18.37 15.28 41.59 4.70
208 210 0.606673 GGAAAGGTGTGACAGCTCCC 60.607 60.000 18.37 17.25 41.59 4.30
209 211 0.951040 GAAAGGTGTGACAGCTCCCG 60.951 60.000 18.37 0.00 41.59 5.14
210 212 2.397413 AAAGGTGTGACAGCTCCCGG 62.397 60.000 18.37 0.00 41.59 5.73
211 213 4.394712 GGTGTGACAGCTCCCGGG 62.395 72.222 16.85 16.85 0.00 5.73
212 214 3.626924 GTGTGACAGCTCCCGGGT 61.627 66.667 22.86 0.00 0.00 5.28
216 218 4.767255 GACAGCTCCCGGGTGCAG 62.767 72.222 40.44 35.86 46.30 4.41
237 239 2.489938 GGCACCCTCATGAACAGTAA 57.510 50.000 0.00 0.00 0.00 2.24
238 240 2.084546 GGCACCCTCATGAACAGTAAC 58.915 52.381 0.00 0.00 0.00 2.50
239 241 2.290323 GGCACCCTCATGAACAGTAACT 60.290 50.000 0.00 0.00 0.00 2.24
240 242 3.412386 GCACCCTCATGAACAGTAACTT 58.588 45.455 0.00 0.00 0.00 2.66
241 243 3.189287 GCACCCTCATGAACAGTAACTTG 59.811 47.826 0.00 0.00 0.00 3.16
242 244 4.641396 CACCCTCATGAACAGTAACTTGA 58.359 43.478 0.00 0.00 0.00 3.02
243 245 5.063204 CACCCTCATGAACAGTAACTTGAA 58.937 41.667 0.00 0.00 0.00 2.69
244 246 5.530915 CACCCTCATGAACAGTAACTTGAAA 59.469 40.000 0.00 0.00 0.00 2.69
245 247 6.039270 CACCCTCATGAACAGTAACTTGAAAA 59.961 38.462 0.00 0.00 0.00 2.29
246 248 6.039382 ACCCTCATGAACAGTAACTTGAAAAC 59.961 38.462 0.00 0.00 0.00 2.43
247 249 6.039270 CCCTCATGAACAGTAACTTGAAAACA 59.961 38.462 0.00 0.00 0.00 2.83
248 250 7.416213 CCCTCATGAACAGTAACTTGAAAACAA 60.416 37.037 0.00 0.00 0.00 2.83
249 251 7.645340 CCTCATGAACAGTAACTTGAAAACAAG 59.355 37.037 8.18 8.18 38.11 3.16
250 252 8.275015 TCATGAACAGTAACTTGAAAACAAGA 57.725 30.769 15.32 0.00 36.16 3.02
251 253 8.902806 TCATGAACAGTAACTTGAAAACAAGAT 58.097 29.630 15.32 7.33 36.16 2.40
252 254 8.961092 CATGAACAGTAACTTGAAAACAAGATG 58.039 33.333 15.32 10.52 36.16 2.90
253 255 8.275015 TGAACAGTAACTTGAAAACAAGATGA 57.725 30.769 15.32 0.00 36.16 2.92
254 256 8.735315 TGAACAGTAACTTGAAAACAAGATGAA 58.265 29.630 15.32 0.00 36.16 2.57
255 257 9.567848 GAACAGTAACTTGAAAACAAGATGAAA 57.432 29.630 15.32 0.00 36.16 2.69
256 258 9.921637 AACAGTAACTTGAAAACAAGATGAAAA 57.078 25.926 15.32 0.00 36.16 2.29
257 259 9.921637 ACAGTAACTTGAAAACAAGATGAAAAA 57.078 25.926 15.32 0.00 36.16 1.94
284 286 7.748691 ATTGAAAAATTCTGAAATGTTGGGG 57.251 32.000 0.00 0.00 0.00 4.96
285 287 5.619220 TGAAAAATTCTGAAATGTTGGGGG 58.381 37.500 0.00 0.00 0.00 5.40
286 288 5.367937 TGAAAAATTCTGAAATGTTGGGGGA 59.632 36.000 0.00 0.00 0.00 4.81
287 289 6.044171 TGAAAAATTCTGAAATGTTGGGGGAT 59.956 34.615 0.00 0.00 0.00 3.85
288 290 5.682234 AAATTCTGAAATGTTGGGGGATC 57.318 39.130 0.00 0.00 0.00 3.36
289 291 3.824001 TTCTGAAATGTTGGGGGATCA 57.176 42.857 0.00 0.00 0.00 2.92
290 292 3.824001 TCTGAAATGTTGGGGGATCAA 57.176 42.857 0.00 0.00 0.00 2.57
291 293 4.125124 TCTGAAATGTTGGGGGATCAAA 57.875 40.909 0.00 0.00 0.00 2.69
292 294 4.686891 TCTGAAATGTTGGGGGATCAAAT 58.313 39.130 0.00 0.00 0.00 2.32
293 295 5.836705 TCTGAAATGTTGGGGGATCAAATA 58.163 37.500 0.00 0.00 0.00 1.40
294 296 6.442961 TCTGAAATGTTGGGGGATCAAATAT 58.557 36.000 0.00 0.00 0.00 1.28
295 297 6.324512 TCTGAAATGTTGGGGGATCAAATATG 59.675 38.462 0.00 0.00 0.00 1.78
296 298 6.200852 TGAAATGTTGGGGGATCAAATATGA 58.799 36.000 0.00 0.00 40.57 2.15
318 320 4.891627 TCAAACTTTTGATGTTCTCGCA 57.108 36.364 0.07 0.00 41.88 5.10
319 321 5.242069 TCAAACTTTTGATGTTCTCGCAA 57.758 34.783 0.07 0.00 41.88 4.85
320 322 5.645624 TCAAACTTTTGATGTTCTCGCAAA 58.354 33.333 0.07 0.00 41.88 3.68
321 323 6.272318 TCAAACTTTTGATGTTCTCGCAAAT 58.728 32.000 0.07 0.00 41.88 2.32
322 324 6.756074 TCAAACTTTTGATGTTCTCGCAAATT 59.244 30.769 0.07 0.00 41.88 1.82
323 325 7.277539 TCAAACTTTTGATGTTCTCGCAAATTT 59.722 29.630 0.07 0.00 41.88 1.82
324 326 7.538303 AACTTTTGATGTTCTCGCAAATTTT 57.462 28.000 0.00 0.00 32.27 1.82
325 327 7.165427 ACTTTTGATGTTCTCGCAAATTTTC 57.835 32.000 0.00 0.00 32.27 2.29
326 328 6.756074 ACTTTTGATGTTCTCGCAAATTTTCA 59.244 30.769 0.00 0.00 32.27 2.69
327 329 6.752335 TTTGATGTTCTCGCAAATTTTCAG 57.248 33.333 0.00 0.00 0.00 3.02
328 330 4.229096 TGATGTTCTCGCAAATTTTCAGC 58.771 39.130 0.00 0.00 0.00 4.26
329 331 3.011949 TGTTCTCGCAAATTTTCAGCC 57.988 42.857 0.00 0.00 0.00 4.85
330 332 2.360483 TGTTCTCGCAAATTTTCAGCCA 59.640 40.909 0.00 0.00 0.00 4.75
331 333 2.982470 GTTCTCGCAAATTTTCAGCCAG 59.018 45.455 0.00 0.00 0.00 4.85
332 334 2.503331 TCTCGCAAATTTTCAGCCAGA 58.497 42.857 0.00 0.00 0.00 3.86
333 335 2.884012 TCTCGCAAATTTTCAGCCAGAA 59.116 40.909 0.00 0.00 0.00 3.02
334 336 3.317711 TCTCGCAAATTTTCAGCCAGAAA 59.682 39.130 0.00 0.00 44.21 2.52
342 344 3.715628 TTTCAGCCAGAAAAAGCACTC 57.284 42.857 0.00 0.00 43.00 3.51
343 345 1.229428 TCAGCCAGAAAAAGCACTCG 58.771 50.000 0.00 0.00 0.00 4.18
344 346 1.202639 TCAGCCAGAAAAAGCACTCGA 60.203 47.619 0.00 0.00 0.00 4.04
345 347 1.196354 CAGCCAGAAAAAGCACTCGAG 59.804 52.381 11.84 11.84 0.00 4.04
346 348 0.519077 GCCAGAAAAAGCACTCGAGG 59.481 55.000 18.41 6.97 0.00 4.63
347 349 1.878102 GCCAGAAAAAGCACTCGAGGA 60.878 52.381 18.41 0.00 0.00 3.71
348 350 2.072298 CCAGAAAAAGCACTCGAGGAG 58.928 52.381 18.41 10.09 35.52 3.69
349 351 1.462670 CAGAAAAAGCACTCGAGGAGC 59.537 52.381 18.41 19.59 32.04 4.70
350 352 0.799393 GAAAAAGCACTCGAGGAGCC 59.201 55.000 23.19 8.49 32.04 4.70
351 353 0.606673 AAAAAGCACTCGAGGAGCCC 60.607 55.000 23.19 5.47 32.04 5.19
352 354 1.484444 AAAAGCACTCGAGGAGCCCT 61.484 55.000 23.19 11.87 36.03 5.19
353 355 1.893919 AAAGCACTCGAGGAGCCCTC 61.894 60.000 23.19 10.35 46.44 4.30
387 389 7.801716 AAACAGATTACTGCTCAAAAGTACA 57.198 32.000 0.00 0.00 46.95 2.90
388 390 6.787085 ACAGATTACTGCTCAAAAGTACAC 57.213 37.500 0.00 0.00 46.95 2.90
389 391 6.288294 ACAGATTACTGCTCAAAAGTACACA 58.712 36.000 0.00 0.00 46.95 3.72
390 392 6.936900 ACAGATTACTGCTCAAAAGTACACAT 59.063 34.615 0.00 0.00 46.95 3.21
391 393 8.094548 ACAGATTACTGCTCAAAAGTACACATA 58.905 33.333 0.00 0.00 46.95 2.29
392 394 8.935844 CAGATTACTGCTCAAAAGTACACATAA 58.064 33.333 0.00 0.00 37.33 1.90
393 395 8.936864 AGATTACTGCTCAAAAGTACACATAAC 58.063 33.333 0.00 0.00 29.93 1.89
394 396 8.848474 ATTACTGCTCAAAAGTACACATAACT 57.152 30.769 0.00 0.00 29.93 2.24
395 397 8.671384 TTACTGCTCAAAAGTACACATAACTT 57.329 30.769 0.00 0.00 38.82 2.66
396 398 7.568199 ACTGCTCAAAAGTACACATAACTTT 57.432 32.000 0.00 0.00 46.45 2.66
397 399 7.417612 ACTGCTCAAAAGTACACATAACTTTG 58.582 34.615 2.26 0.00 44.35 2.77
398 400 7.282224 ACTGCTCAAAAGTACACATAACTTTGA 59.718 33.333 2.26 0.00 44.35 2.69
399 401 7.990917 TGCTCAAAAGTACACATAACTTTGAA 58.009 30.769 2.26 0.00 44.35 2.69
400 402 7.913297 TGCTCAAAAGTACACATAACTTTGAAC 59.087 33.333 2.26 0.00 44.35 3.18
401 403 7.913297 GCTCAAAAGTACACATAACTTTGAACA 59.087 33.333 2.26 0.00 44.35 3.18
402 404 9.221775 CTCAAAAGTACACATAACTTTGAACAC 57.778 33.333 2.26 0.00 44.35 3.32
403 405 8.952278 TCAAAAGTACACATAACTTTGAACACT 58.048 29.630 2.26 0.00 44.35 3.55
404 406 9.009327 CAAAAGTACACATAACTTTGAACACTG 57.991 33.333 2.26 0.00 44.35 3.66
405 407 8.500753 AAAGTACACATAACTTTGAACACTGA 57.499 30.769 0.00 0.00 43.66 3.41
406 408 8.677148 AAGTACACATAACTTTGAACACTGAT 57.323 30.769 0.00 0.00 33.39 2.90
407 409 8.677148 AGTACACATAACTTTGAACACTGATT 57.323 30.769 0.00 0.00 0.00 2.57
408 410 9.120538 AGTACACATAACTTTGAACACTGATTT 57.879 29.630 0.00 0.00 0.00 2.17
409 411 9.730420 GTACACATAACTTTGAACACTGATTTT 57.270 29.630 0.00 0.00 0.00 1.82
410 412 8.633075 ACACATAACTTTGAACACTGATTTTG 57.367 30.769 0.00 0.00 0.00 2.44
411 413 8.250332 ACACATAACTTTGAACACTGATTTTGT 58.750 29.630 0.00 0.00 0.00 2.83
412 414 9.086336 CACATAACTTTGAACACTGATTTTGTT 57.914 29.630 0.00 0.00 39.94 2.83
413 415 9.651913 ACATAACTTTGAACACTGATTTTGTTT 57.348 25.926 0.00 0.00 37.31 2.83
433 435 2.359478 TTTTTCGGCGAGGGCTCC 60.359 61.111 10.46 0.00 39.81 4.70
434 436 3.185299 TTTTTCGGCGAGGGCTCCA 62.185 57.895 10.46 0.00 39.81 3.86
435 437 2.478335 TTTTTCGGCGAGGGCTCCAT 62.478 55.000 10.46 0.00 39.81 3.41
436 438 3.680620 TTTCGGCGAGGGCTCCATG 62.681 63.158 10.46 0.00 39.81 3.66
438 440 4.161295 CGGCGAGGGCTCCATGAA 62.161 66.667 0.00 0.00 39.81 2.57
439 441 2.512896 GGCGAGGGCTCCATGAAT 59.487 61.111 0.00 0.00 39.81 2.57
440 442 1.895707 GGCGAGGGCTCCATGAATG 60.896 63.158 0.00 0.00 39.81 2.67
441 443 1.153086 GCGAGGGCTCCATGAATGT 60.153 57.895 0.00 0.00 35.83 2.71
442 444 0.749454 GCGAGGGCTCCATGAATGTT 60.749 55.000 0.00 0.00 35.83 2.71
443 445 1.755179 CGAGGGCTCCATGAATGTTT 58.245 50.000 0.00 0.00 0.00 2.83
444 446 2.094675 CGAGGGCTCCATGAATGTTTT 58.905 47.619 0.00 0.00 0.00 2.43
445 447 2.493278 CGAGGGCTCCATGAATGTTTTT 59.507 45.455 0.00 0.00 0.00 1.94
466 468 7.783090 TTTTTGATGCTAAAACTTTGCATGA 57.217 28.000 11.99 2.54 45.90 3.07
467 469 7.783090 TTTTGATGCTAAAACTTTGCATGAA 57.217 28.000 11.99 7.99 45.90 2.57
468 470 6.768029 TTGATGCTAAAACTTTGCATGAAC 57.232 33.333 11.99 1.07 45.90 3.18
469 471 4.916831 TGATGCTAAAACTTTGCATGAACG 59.083 37.500 11.99 0.00 45.90 3.95
470 472 4.300189 TGCTAAAACTTTGCATGAACGT 57.700 36.364 0.00 0.00 0.00 3.99
471 473 4.677584 TGCTAAAACTTTGCATGAACGTT 58.322 34.783 0.00 0.00 0.00 3.99
472 474 4.502282 TGCTAAAACTTTGCATGAACGTTG 59.498 37.500 5.00 0.00 0.00 4.10
473 475 4.737765 GCTAAAACTTTGCATGAACGTTGA 59.262 37.500 5.00 0.00 0.00 3.18
474 476 5.231147 GCTAAAACTTTGCATGAACGTTGAA 59.769 36.000 5.00 0.00 0.00 2.69
475 477 6.074356 GCTAAAACTTTGCATGAACGTTGAAT 60.074 34.615 5.00 0.00 0.00 2.57
476 478 5.640218 AAACTTTGCATGAACGTTGAATG 57.360 34.783 5.00 10.81 0.00 2.67
477 479 4.305989 ACTTTGCATGAACGTTGAATGT 57.694 36.364 5.00 0.00 0.00 2.71
478 480 4.681744 ACTTTGCATGAACGTTGAATGTT 58.318 34.783 5.00 1.83 0.00 2.71
479 481 5.108517 ACTTTGCATGAACGTTGAATGTTT 58.891 33.333 5.00 0.00 0.00 2.83
480 482 5.005586 ACTTTGCATGAACGTTGAATGTTTG 59.994 36.000 5.00 1.24 0.00 2.93
481 483 4.298744 TGCATGAACGTTGAATGTTTGA 57.701 36.364 5.00 0.00 0.00 2.69
482 484 4.869215 TGCATGAACGTTGAATGTTTGAT 58.131 34.783 5.00 0.00 0.00 2.57
483 485 4.916831 TGCATGAACGTTGAATGTTTGATC 59.083 37.500 5.00 0.00 0.00 2.92
484 486 4.916831 GCATGAACGTTGAATGTTTGATCA 59.083 37.500 5.00 0.00 0.00 2.92
485 487 5.574055 GCATGAACGTTGAATGTTTGATCAT 59.426 36.000 5.00 0.81 0.00 2.45
486 488 6.746822 GCATGAACGTTGAATGTTTGATCATA 59.253 34.615 5.00 0.00 0.00 2.15
487 489 7.433131 GCATGAACGTTGAATGTTTGATCATAT 59.567 33.333 5.00 0.00 0.00 1.78
488 490 9.292846 CATGAACGTTGAATGTTTGATCATATT 57.707 29.630 5.00 0.00 0.00 1.28
489 491 9.859427 ATGAACGTTGAATGTTTGATCATATTT 57.141 25.926 5.00 0.00 0.00 1.40
490 492 9.127006 TGAACGTTGAATGTTTGATCATATTTG 57.873 29.630 5.00 0.00 0.00 2.32
491 493 9.128107 GAACGTTGAATGTTTGATCATATTTGT 57.872 29.630 5.00 0.00 0.00 2.83
492 494 9.474920 AACGTTGAATGTTTGATCATATTTGTT 57.525 25.926 0.00 1.15 0.00 2.83
493 495 9.128107 ACGTTGAATGTTTGATCATATTTGTTC 57.872 29.630 0.00 0.00 0.00 3.18
494 496 8.586273 CGTTGAATGTTTGATCATATTTGTTCC 58.414 33.333 0.00 0.00 0.00 3.62
495 497 8.872845 GTTGAATGTTTGATCATATTTGTTCCC 58.127 33.333 0.00 0.00 0.00 3.97
496 498 7.555087 TGAATGTTTGATCATATTTGTTCCCC 58.445 34.615 0.00 0.00 0.00 4.81
497 499 5.930837 TGTTTGATCATATTTGTTCCCCC 57.069 39.130 0.00 0.00 0.00 5.40
498 500 5.336945 TGTTTGATCATATTTGTTCCCCCA 58.663 37.500 0.00 0.00 0.00 4.96
499 501 5.782331 TGTTTGATCATATTTGTTCCCCCAA 59.218 36.000 0.00 0.00 0.00 4.12
500 502 6.270927 TGTTTGATCATATTTGTTCCCCCAAA 59.729 34.615 0.00 0.00 38.58 3.28
501 503 6.543430 TTGATCATATTTGTTCCCCCAAAG 57.457 37.500 0.00 0.00 37.71 2.77
502 504 5.588845 TGATCATATTTGTTCCCCCAAAGT 58.411 37.500 0.00 0.00 37.71 2.66
503 505 6.022315 TGATCATATTTGTTCCCCCAAAGTT 58.978 36.000 0.00 0.00 37.71 2.66
504 506 6.500049 TGATCATATTTGTTCCCCCAAAGTTT 59.500 34.615 0.00 0.00 37.71 2.66
505 507 6.353404 TCATATTTGTTCCCCCAAAGTTTC 57.647 37.500 0.00 0.00 37.71 2.78
506 508 5.841237 TCATATTTGTTCCCCCAAAGTTTCA 59.159 36.000 0.00 0.00 37.71 2.69
507 509 4.687901 ATTTGTTCCCCCAAAGTTTCAG 57.312 40.909 0.00 0.00 37.71 3.02
508 510 3.390175 TTGTTCCCCCAAAGTTTCAGA 57.610 42.857 0.00 0.00 0.00 3.27
509 511 3.611025 TGTTCCCCCAAAGTTTCAGAT 57.389 42.857 0.00 0.00 0.00 2.90
510 512 3.922375 TGTTCCCCCAAAGTTTCAGATT 58.078 40.909 0.00 0.00 0.00 2.40
511 513 4.294347 TGTTCCCCCAAAGTTTCAGATTT 58.706 39.130 0.00 0.00 0.00 2.17
512 514 4.719273 TGTTCCCCCAAAGTTTCAGATTTT 59.281 37.500 0.00 0.00 0.00 1.82
513 515 5.190726 TGTTCCCCCAAAGTTTCAGATTTTT 59.809 36.000 0.00 0.00 0.00 1.94
556 558 8.870160 TTGTTTTGAATTTACTGTTCATGAGG 57.130 30.769 0.00 0.00 35.68 3.86
557 559 7.432869 TGTTTTGAATTTACTGTTCATGAGGG 58.567 34.615 0.00 0.00 35.68 4.30
558 560 7.069331 TGTTTTGAATTTACTGTTCATGAGGGT 59.931 33.333 0.00 0.00 35.68 4.34
559 561 6.573664 TTGAATTTACTGTTCATGAGGGTG 57.426 37.500 0.00 0.00 35.68 4.61
560 562 4.458989 TGAATTTACTGTTCATGAGGGTGC 59.541 41.667 0.00 0.00 31.07 5.01
561 563 2.489938 TTACTGTTCATGAGGGTGCC 57.510 50.000 0.00 0.00 0.00 5.01
562 564 0.618458 TACTGTTCATGAGGGTGCCC 59.382 55.000 0.00 0.00 0.00 5.36
563 565 1.379044 CTGTTCATGAGGGTGCCCC 60.379 63.158 3.17 2.16 45.90 5.80
580 582 4.020617 CTGCACCCGGGAGCTGAA 62.021 66.667 37.52 20.81 33.96 3.02
581 583 3.551496 CTGCACCCGGGAGCTGAAA 62.551 63.158 37.52 20.46 33.96 2.69
582 584 2.747855 GCACCCGGGAGCTGAAAG 60.748 66.667 32.83 10.45 0.00 2.62
583 585 2.750350 CACCCGGGAGCTGAAAGT 59.250 61.111 32.02 0.00 35.30 2.66
584 586 1.376037 CACCCGGGAGCTGAAAGTC 60.376 63.158 32.02 0.00 35.30 3.01
585 587 2.269241 CCCGGGAGCTGAAAGTCC 59.731 66.667 18.48 0.00 35.30 3.85
586 588 2.592993 CCCGGGAGCTGAAAGTCCA 61.593 63.158 18.48 0.00 36.33 4.02
587 589 1.078848 CCGGGAGCTGAAAGTCCAG 60.079 63.158 0.00 0.00 36.33 3.86
588 590 1.674057 CGGGAGCTGAAAGTCCAGT 59.326 57.895 0.00 0.00 36.33 4.00
589 591 0.390472 CGGGAGCTGAAAGTCCAGTC 60.390 60.000 0.00 0.00 36.33 3.51
590 592 0.980423 GGGAGCTGAAAGTCCAGTCT 59.020 55.000 0.00 0.00 36.33 3.24
591 593 1.066502 GGGAGCTGAAAGTCCAGTCTC 60.067 57.143 0.00 0.00 36.33 3.36
592 594 1.620819 GGAGCTGAAAGTCCAGTCTCA 59.379 52.381 0.00 0.00 38.19 3.27
593 595 2.037772 GGAGCTGAAAGTCCAGTCTCAA 59.962 50.000 0.00 0.00 38.19 3.02
594 596 3.495100 GGAGCTGAAAGTCCAGTCTCAAA 60.495 47.826 0.00 0.00 38.19 2.69
595 597 4.130118 GAGCTGAAAGTCCAGTCTCAAAA 58.870 43.478 0.00 0.00 37.32 2.44
596 598 4.526970 AGCTGAAAGTCCAGTCTCAAAAA 58.473 39.130 0.00 0.00 36.57 1.94
623 625 6.687081 TTAACTTCCTTTGTAGGTGTTGTG 57.313 37.500 12.11 0.00 42.60 3.33
627 629 3.537580 TCCTTTGTAGGTGTTGTGTGTC 58.462 45.455 0.00 0.00 42.60 3.67
668 677 9.585099 TGAAATGTCACCAATAAAATCTAATGC 57.415 29.630 0.00 0.00 0.00 3.56
669 678 8.947055 AAATGTCACCAATAAAATCTAATGCC 57.053 30.769 0.00 0.00 0.00 4.40
670 679 7.658525 ATGTCACCAATAAAATCTAATGCCA 57.341 32.000 0.00 0.00 0.00 4.92
672 681 7.490840 TGTCACCAATAAAATCTAATGCCATG 58.509 34.615 0.00 0.00 0.00 3.66
673 682 7.123997 TGTCACCAATAAAATCTAATGCCATGT 59.876 33.333 0.00 0.00 0.00 3.21
677 686 9.365906 ACCAATAAAATCTAATGCCATGTCATA 57.634 29.630 0.00 0.00 0.00 2.15
690 699 4.686554 GCCATGTCATATTCTTCGGAGTAC 59.313 45.833 0.00 0.00 0.00 2.73
691 700 5.739070 GCCATGTCATATTCTTCGGAGTACA 60.739 44.000 0.00 0.00 0.00 2.90
694 703 8.088365 CCATGTCATATTCTTCGGAGTACATAA 58.912 37.037 0.00 0.00 0.00 1.90
703 712 5.878116 TCTTCGGAGTACATAATTTGTTGGG 59.122 40.000 0.00 0.00 39.87 4.12
706 715 4.938832 CGGAGTACATAATTTGTTGGGTGA 59.061 41.667 0.00 0.00 39.87 4.02
708 717 6.458206 CGGAGTACATAATTTGTTGGGTGATG 60.458 42.308 0.00 0.00 39.87 3.07
709 718 6.601613 GGAGTACATAATTTGTTGGGTGATGA 59.398 38.462 0.00 0.00 39.87 2.92
710 719 7.285401 GGAGTACATAATTTGTTGGGTGATGAT 59.715 37.037 0.00 0.00 39.87 2.45
711 720 8.225603 AGTACATAATTTGTTGGGTGATGATC 57.774 34.615 0.00 0.00 39.87 2.92
712 721 8.055181 AGTACATAATTTGTTGGGTGATGATCT 58.945 33.333 0.00 0.00 39.87 2.75
716 725 6.862469 AATTTGTTGGGTGATGATCTTGAT 57.138 33.333 0.00 0.00 0.00 2.57
717 726 5.902613 TTTGTTGGGTGATGATCTTGATC 57.097 39.130 3.82 3.82 0.00 2.92
719 728 4.920999 TGTTGGGTGATGATCTTGATCAA 58.079 39.130 15.98 8.12 33.83 2.57
721 730 5.416639 TGTTGGGTGATGATCTTGATCAAAG 59.583 40.000 15.98 4.26 37.22 2.77
747 756 9.915629 GAACTGATACATAAGTAAGTATCCAGG 57.084 37.037 9.90 4.99 43.66 4.45
748 757 9.435570 AACTGATACATAAGTAAGTATCCAGGT 57.564 33.333 9.90 5.28 43.66 4.00
749 758 9.080097 ACTGATACATAAGTAAGTATCCAGGTC 57.920 37.037 9.90 0.00 43.66 3.85
750 759 9.078990 CTGATACATAAGTAAGTATCCAGGTCA 57.921 37.037 9.90 0.00 43.66 4.02
751 760 9.429109 TGATACATAAGTAAGTATCCAGGTCAA 57.571 33.333 9.90 0.00 43.66 3.18
754 763 8.319057 ACATAAGTAAGTATCCAGGTCAATCA 57.681 34.615 0.00 0.00 0.00 2.57
755 764 8.768397 ACATAAGTAAGTATCCAGGTCAATCAA 58.232 33.333 0.00 0.00 0.00 2.57
756 765 9.046296 CATAAGTAAGTATCCAGGTCAATCAAC 57.954 37.037 0.00 0.00 0.00 3.18
757 766 5.661458 AGTAAGTATCCAGGTCAATCAACG 58.339 41.667 0.00 0.00 0.00 4.10
758 767 3.543680 AGTATCCAGGTCAATCAACGG 57.456 47.619 0.00 0.00 0.00 4.44
759 768 3.104512 AGTATCCAGGTCAATCAACGGA 58.895 45.455 0.00 0.00 0.00 4.69
760 769 3.711704 AGTATCCAGGTCAATCAACGGAT 59.288 43.478 0.00 0.00 37.10 4.18
761 770 4.899457 AGTATCCAGGTCAATCAACGGATA 59.101 41.667 0.00 0.00 35.03 2.59
762 771 3.819564 TCCAGGTCAATCAACGGATAG 57.180 47.619 0.00 0.00 32.09 2.08
763 772 3.371034 TCCAGGTCAATCAACGGATAGA 58.629 45.455 0.00 0.00 32.09 1.98
764 773 3.967326 TCCAGGTCAATCAACGGATAGAT 59.033 43.478 0.00 0.00 32.09 1.98
765 774 4.408921 TCCAGGTCAATCAACGGATAGATT 59.591 41.667 0.00 0.00 34.96 2.40
771 780 7.393234 AGGTCAATCAACGGATAGATTTTTGAA 59.607 33.333 0.00 0.00 32.43 2.69
780 789 5.643777 CGGATAGATTTTTGAACAGGTGACT 59.356 40.000 0.00 0.00 46.44 3.41
788 797 7.639113 TTTTTGAACAGGTGACTAACTCAAT 57.361 32.000 0.00 0.00 40.21 2.57
789 798 6.618287 TTTGAACAGGTGACTAACTCAATG 57.382 37.500 0.00 0.00 40.21 2.82
790 799 5.545063 TGAACAGGTGACTAACTCAATGA 57.455 39.130 0.00 0.00 40.21 2.57
796 805 5.934043 CAGGTGACTAACTCAATGATTGACA 59.066 40.000 3.29 0.00 40.21 3.58
807 816 8.411318 ACTCAATGATTGACAAACTGAAAAAC 57.589 30.769 3.29 0.00 35.46 2.43
808 817 8.034215 ACTCAATGATTGACAAACTGAAAAACA 58.966 29.630 3.29 0.00 35.46 2.83
809 818 8.183830 TCAATGATTGACAAACTGAAAAACAC 57.816 30.769 3.29 0.00 34.08 3.32
810 819 8.034215 TCAATGATTGACAAACTGAAAAACACT 58.966 29.630 3.29 0.00 34.08 3.55
811 820 7.992180 ATGATTGACAAACTGAAAAACACTC 57.008 32.000 0.00 0.00 0.00 3.51
814 823 7.754924 TGATTGACAAACTGAAAAACACTCTTC 59.245 33.333 0.00 0.00 0.00 2.87
815 824 5.949735 TGACAAACTGAAAAACACTCTTCC 58.050 37.500 0.00 0.00 0.00 3.46
816 825 5.710099 TGACAAACTGAAAAACACTCTTCCT 59.290 36.000 0.00 0.00 0.00 3.36
817 826 5.954335 ACAAACTGAAAAACACTCTTCCTG 58.046 37.500 0.00 0.00 0.00 3.86
818 827 5.476945 ACAAACTGAAAAACACTCTTCCTGT 59.523 36.000 0.00 0.00 0.00 4.00
819 828 5.567138 AACTGAAAAACACTCTTCCTGTG 57.433 39.130 0.00 0.00 40.87 3.66
820 829 3.947834 ACTGAAAAACACTCTTCCTGTGG 59.052 43.478 0.00 0.00 39.52 4.17
821 830 2.687935 TGAAAAACACTCTTCCTGTGGC 59.312 45.455 0.00 0.00 39.52 5.01
822 831 2.435372 AAAACACTCTTCCTGTGGCA 57.565 45.000 0.00 0.00 39.52 4.92
824 833 1.972872 AACACTCTTCCTGTGGCAAG 58.027 50.000 0.00 0.00 39.52 4.01
825 834 0.109342 ACACTCTTCCTGTGGCAAGG 59.891 55.000 8.80 8.80 39.52 3.61
826 835 0.109342 CACTCTTCCTGTGGCAAGGT 59.891 55.000 13.15 0.00 38.58 3.50
827 836 0.398318 ACTCTTCCTGTGGCAAGGTC 59.602 55.000 13.15 0.00 38.58 3.85
829 838 1.902508 CTCTTCCTGTGGCAAGGTCTA 59.097 52.381 13.15 3.30 38.58 2.59
831 840 2.708861 TCTTCCTGTGGCAAGGTCTAAA 59.291 45.455 13.15 3.00 38.58 1.85
832 841 3.137544 TCTTCCTGTGGCAAGGTCTAAAA 59.862 43.478 13.15 2.73 38.58 1.52
833 842 3.140325 TCCTGTGGCAAGGTCTAAAAG 57.860 47.619 13.15 0.00 38.58 2.27
835 844 1.541588 CTGTGGCAAGGTCTAAAAGGC 59.458 52.381 0.00 0.00 0.00 4.35
836 845 0.521735 GTGGCAAGGTCTAAAAGGCG 59.478 55.000 0.00 0.00 0.00 5.52
837 846 1.241315 TGGCAAGGTCTAAAAGGCGC 61.241 55.000 0.00 0.00 0.00 6.53
838 847 0.960861 GGCAAGGTCTAAAAGGCGCT 60.961 55.000 7.64 0.00 0.00 5.92
850 873 7.309316 GGTCTAAAAGGCGCTTATCTCTAGTAT 60.309 40.741 7.64 0.00 0.00 2.12
861 884 7.577807 CGCTTATCTCTAGTATTGCCTACCAAT 60.578 40.741 0.00 0.00 45.75 3.16
869 892 8.367911 TCTAGTATTGCCTACCAATTCATACAG 58.632 37.037 0.00 0.00 41.29 2.74
882 905 8.028938 ACCAATTCATACAGGAAGAAAAATTCG 58.971 33.333 0.00 0.00 34.02 3.34
890 2013 6.059484 ACAGGAAGAAAAATTCGTCAGGTTA 58.941 36.000 8.01 0.00 39.49 2.85
892 2015 5.472478 AGGAAGAAAAATTCGTCAGGTTACC 59.528 40.000 8.01 0.00 39.49 2.85
905 2028 5.596845 GTCAGGTTACCAAATGCTTGAAAA 58.403 37.500 3.51 0.00 34.14 2.29
929 2134 5.460748 AGTTTGTTTTTACGCATTTAGTGGC 59.539 36.000 0.00 0.00 0.00 5.01
932 2137 3.840890 TTTTACGCATTTAGTGGCCTG 57.159 42.857 3.32 0.00 0.00 4.85
939 2144 4.127171 CGCATTTAGTGGCCTGTATAGTT 58.873 43.478 3.32 0.00 0.00 2.24
941 2146 5.405571 CGCATTTAGTGGCCTGTATAGTTAG 59.594 44.000 3.32 0.00 0.00 2.34
961 2170 1.975327 CAGAGACCTCCTTGCCGAA 59.025 57.895 0.00 0.00 0.00 4.30
962 2171 0.321671 CAGAGACCTCCTTGCCGAAA 59.678 55.000 0.00 0.00 0.00 3.46
989 2200 9.170734 TGAAGCTCATTATTAATATGCTCATCC 57.829 33.333 12.63 6.63 31.33 3.51
1021 2234 4.158394 ACATGAGACAACTTTGCACAACTT 59.842 37.500 0.00 0.00 0.00 2.66
1116 2338 4.036518 AGATAGCTGGTGGTTTCTCATCT 58.963 43.478 0.00 0.00 28.49 2.90
1125 2347 4.702131 GGTGGTTTCTCATCTGCAGTTATT 59.298 41.667 14.67 0.00 0.00 1.40
1174 2396 3.510388 TCCTCGAGAGCAACTACAATG 57.490 47.619 15.71 0.00 0.00 2.82
1225 2447 4.680237 TCCGCACAAGCCTCACCG 62.680 66.667 0.00 0.00 37.52 4.94
1287 2509 3.057736 TCGTCAGCACTAGTCTTACCAAC 60.058 47.826 0.00 0.00 0.00 3.77
1401 2623 4.449131 TGAGTGAGCTCATTTCATCATCC 58.551 43.478 21.47 2.37 45.94 3.51
1413 2635 2.143419 ATCATCCGTCAGGGCCCTC 61.143 63.158 25.77 11.59 38.33 4.30
1558 2783 2.546899 TGAAGGAGGAAGGAATTCGGA 58.453 47.619 0.00 0.00 0.00 4.55
1675 2900 0.694771 TGAACCAGAATCCAGCAGCT 59.305 50.000 0.00 0.00 0.00 4.24
1705 2930 2.033448 TTGGGGCAAGGTACTGCG 59.967 61.111 1.44 0.00 40.86 5.18
1710 2935 2.561373 GCAAGGTACTGCGTTGGC 59.439 61.111 0.00 0.00 40.86 4.52
1723 2948 1.206578 GTTGGCGGTGTTGATGTCG 59.793 57.895 0.00 0.00 0.00 4.35
1771 2996 2.306847 GGAAGACAACCCTTGCTCAAA 58.693 47.619 0.00 0.00 32.64 2.69
1801 3026 9.545105 TTTACAATCATGAAAATGTGAAGCTTT 57.455 25.926 17.54 0.00 0.00 3.51
1896 3121 7.083858 TGTGCTCTTTTAAAGGAAATGATTCG 58.916 34.615 4.77 0.00 36.36 3.34
1909 3134 6.934645 AGGAAATGATTCGTCTTTTGACTACA 59.065 34.615 0.00 0.00 46.76 2.74
1956 3181 8.915654 GTCAACAATATTCAAAATGTCTTCCAC 58.084 33.333 0.00 0.00 0.00 4.02
1958 3186 6.935167 ACAATATTCAAAATGTCTTCCACCC 58.065 36.000 0.00 0.00 0.00 4.61
2065 3296 2.550830 AGTGCCAGGAAGTGTAGTTG 57.449 50.000 0.00 0.00 0.00 3.16
2094 3325 1.298602 CACAAAGCAAAAGGGTTGCC 58.701 50.000 7.41 0.00 45.98 4.52
2097 3328 1.047801 AAAGCAAAAGGGTTGCCGAT 58.952 45.000 7.41 0.00 45.98 4.18
2112 3343 1.537348 GCCGATACAGTGGCGACAATA 60.537 52.381 0.00 0.00 46.06 1.90
2160 3392 0.961753 GGGAGAGTTTTTGGCCAGTG 59.038 55.000 5.11 0.00 0.00 3.66
2210 3445 4.853924 ATGTTGTGGTTGAGAACAATCC 57.146 40.909 0.00 0.00 40.94 3.01
2223 3458 5.588648 TGAGAACAATCCGACTCTTTTGTTT 59.411 36.000 0.00 0.00 41.10 2.83
2233 3468 5.468746 CCGACTCTTTTGTTTATTGGTGAGA 59.531 40.000 0.00 0.00 0.00 3.27
2243 3478 9.474920 TTTGTTTATTGGTGAGAAAATAGCAAG 57.525 29.630 0.00 0.00 37.66 4.01
2253 3488 8.447053 GGTGAGAAAATAGCAAGAAAACTAGAG 58.553 37.037 0.00 0.00 0.00 2.43
2358 3593 1.838073 ATTGGTGGGACCGGAGTGAC 61.838 60.000 9.46 0.00 42.58 3.67
2454 3689 4.377841 GCTTTCTGTTCGATCTTTCCACAG 60.378 45.833 5.05 5.05 36.91 3.66
2486 3721 8.737168 TTGTTTGATAAGGATAGATTGGTCAG 57.263 34.615 0.00 0.00 0.00 3.51
2522 3757 4.460034 TCATGATTTCATCCAACACAGTGG 59.540 41.667 5.31 0.00 40.33 4.00
2557 3792 8.974060 AACTAGATTAGAGGATATCGGAGATC 57.026 38.462 4.04 4.04 45.12 2.75
2559 3794 8.210946 ACTAGATTAGAGGATATCGGAGATCAG 58.789 40.741 14.01 2.88 45.12 2.90
2560 3795 6.364701 AGATTAGAGGATATCGGAGATCAGG 58.635 44.000 14.01 0.00 45.12 3.86
2562 3797 4.396357 AGAGGATATCGGAGATCAGGTT 57.604 45.455 14.01 0.00 45.12 3.50
2646 3884 2.362717 GCACGATCTAGTAAGGGCTCTT 59.637 50.000 3.26 3.26 37.03 2.85
2694 3932 3.669536 CTTCTTCCACAAAGAGACCTCC 58.330 50.000 0.00 0.00 44.69 4.30
2739 3977 1.288127 CTTGGCTCTGCAAGTTGGC 59.712 57.895 4.75 0.00 35.52 4.52
2746 3984 2.546373 GCTCTGCAAGTTGGCAATCAAA 60.546 45.455 1.92 0.00 44.40 2.69
2802 4040 3.179048 GCGGACAATCTTATTGTTTGGC 58.821 45.455 6.72 7.14 33.68 4.52
2849 4087 5.048083 GTGATGTTGTGGACAATATGTTGGT 60.048 40.000 7.15 0.00 42.62 3.67
2913 4151 2.487934 GTGATGACGAATATGCTGCCT 58.512 47.619 0.00 0.00 0.00 4.75
2915 4153 3.677121 GTGATGACGAATATGCTGCCTAG 59.323 47.826 0.00 0.00 0.00 3.02
2934 4172 4.583489 CCTAGCATTGCATCCTTGAGAAAT 59.417 41.667 11.91 0.00 0.00 2.17
2965 4203 9.225436 GGTTCTTAGATCTTTCTTTCACAAGAT 57.775 33.333 0.00 0.00 41.54 2.40
3044 4282 4.570772 TGCTCGCAATACTATTCCTCAAAC 59.429 41.667 0.00 0.00 0.00 2.93
3051 4289 7.196331 GCAATACTATTCCTCAAACCATCAAC 58.804 38.462 0.00 0.00 0.00 3.18
3053 4291 8.906867 CAATACTATTCCTCAAACCATCAACAT 58.093 33.333 0.00 0.00 0.00 2.71
3193 4433 7.397221 TGGATTCATGATAAGTGAGTTGAAGT 58.603 34.615 0.00 0.00 0.00 3.01
3243 4483 4.818005 TGCATCAGTAACATCCACATCATC 59.182 41.667 0.00 0.00 0.00 2.92
3360 4600 2.036256 GGATTGCAGCCACACCCT 59.964 61.111 3.04 0.00 0.00 4.34
3421 4661 2.093447 AGTTTCCCGAGCTGGATGTTAG 60.093 50.000 0.00 0.00 42.00 2.34
3430 4670 2.093235 AGCTGGATGTTAGAAGCTCACC 60.093 50.000 0.00 0.00 42.20 4.02
3444 4684 6.827727 AGAAGCTCACCTCTTTACAAAACTA 58.172 36.000 0.00 0.00 0.00 2.24
3445 4685 7.280356 AGAAGCTCACCTCTTTACAAAACTAA 58.720 34.615 0.00 0.00 0.00 2.24
3454 4694 7.837689 ACCTCTTTACAAAACTAAAGTCCCTTT 59.162 33.333 0.00 0.00 35.84 3.11
3465 4705 8.721133 AACTAAAGTCCCTTTATGTTGGAAAT 57.279 30.769 0.00 0.00 35.72 2.17
3529 4769 5.244851 ACTTCACTCAAGCATCTCACTCTAA 59.755 40.000 0.00 0.00 35.17 2.10
3552 4792 0.463654 ACTTGCCGTCAGTGAAGCAA 60.464 50.000 23.34 23.34 42.60 3.91
3643 4883 3.023119 ACAAACTGGTCACATGCAGAAA 58.977 40.909 5.23 0.00 0.00 2.52
3644 4884 3.067180 ACAAACTGGTCACATGCAGAAAG 59.933 43.478 5.23 2.68 0.00 2.62
3660 4900 3.135348 CAGAAAGTGATCATGGCCCTCTA 59.865 47.826 0.00 0.00 0.00 2.43
3668 4908 1.207089 TCATGGCCCTCTACTTCAACG 59.793 52.381 0.00 0.00 0.00 4.10
3690 4930 3.243068 GCGTCACAAGGTTTGAACTTCAT 60.243 43.478 0.00 0.00 0.00 2.57
3691 4931 4.282068 CGTCACAAGGTTTGAACTTCATG 58.718 43.478 0.00 0.00 0.00 3.07
3702 4942 4.524316 TGAACTTCATGATTGCCCTTTG 57.476 40.909 0.00 0.00 0.00 2.77
3717 4957 1.959282 CCTTTGCTGAAAGAAGTGCCT 59.041 47.619 0.00 0.00 41.12 4.75
3768 5008 2.104111 ACTTGACATCTCGGTTTGTGGA 59.896 45.455 0.00 0.00 0.00 4.02
3811 5051 6.620733 GCCACAATATGTACAACTCTTGACAC 60.621 42.308 0.00 0.00 0.00 3.67
3812 5052 6.426633 CCACAATATGTACAACTCTTGACACA 59.573 38.462 0.00 0.00 35.08 3.72
3847 5087 1.733912 GCATGTCTTTCTGCGATCACA 59.266 47.619 0.00 0.00 0.00 3.58
3867 5107 1.203187 ACACTCCTACTCTCTGGGCAA 60.203 52.381 0.00 0.00 0.00 4.52
3915 5155 3.955471 TCTTAGAAAATGTGGAGGGCTG 58.045 45.455 0.00 0.00 0.00 4.85
3942 5182 5.957842 TGATTGATGGGTTACACTGTTTC 57.042 39.130 0.00 0.00 0.00 2.78
3975 5215 7.375053 TCAGGAAAGTTAATGTTTATGGTTGC 58.625 34.615 0.00 0.00 0.00 4.17
4013 5253 5.989477 TGAATTCTCCGACCAATCAACTAT 58.011 37.500 7.05 0.00 0.00 2.12
4027 5267 6.988580 CCAATCAACTATACAAGATGAGCAGA 59.011 38.462 0.00 0.00 40.02 4.26
4031 5271 5.528043 ACTATACAAGATGAGCAGAGTGG 57.472 43.478 0.00 0.00 0.00 4.00
4038 5278 1.474478 GATGAGCAGAGTGGACTTCGA 59.526 52.381 0.00 0.00 0.00 3.71
4041 5281 0.600557 AGCAGAGTGGACTTCGACTG 59.399 55.000 0.00 0.00 35.02 3.51
4071 5311 6.743575 ATGGTTACAGATTACAGCTTGTTC 57.256 37.500 0.00 0.00 0.00 3.18
4225 5468 1.354101 TTTTCTGGAACGGCTCCCTA 58.646 50.000 3.58 0.00 44.69 3.53
4236 5479 1.749635 CGGCTCCCTACTACACTAGCA 60.750 57.143 0.00 0.00 0.00 3.49
4248 5491 5.322754 ACTACACTAGCAAGACTTACCTCA 58.677 41.667 0.00 0.00 0.00 3.86
4253 5496 7.097834 ACACTAGCAAGACTTACCTCATTAAC 58.902 38.462 0.00 0.00 0.00 2.01
4277 5520 8.048534 ACAATACTTCATCTCAAATGGACAAG 57.951 34.615 0.00 0.00 0.00 3.16
4284 5527 4.437682 TCTCAAATGGACAAGACCAGTT 57.562 40.909 0.00 0.00 46.77 3.16
4286 5529 5.200483 TCTCAAATGGACAAGACCAGTTTT 58.800 37.500 1.79 0.00 44.09 2.43
4287 5530 5.299279 TCTCAAATGGACAAGACCAGTTTTC 59.701 40.000 1.79 0.00 44.09 2.29
4341 5584 3.574284 TTGGTCATGAATGGCTTTTCG 57.426 42.857 0.00 0.00 31.84 3.46
4395 5638 5.893824 AGGATCAGAATGGGTAAACATTTCC 59.106 40.000 0.00 0.00 40.92 3.13
4422 5665 7.667043 TGTTCCATATATTCGGCTTAATGAC 57.333 36.000 0.00 0.00 0.00 3.06
4464 5710 3.252701 CAGTTAATGCTGCCTCATCATCC 59.747 47.826 0.00 0.00 0.00 3.51
4478 5724 4.081406 TCATCATCCTCAAACCACCAAAG 58.919 43.478 0.00 0.00 0.00 2.77
4481 5727 5.055265 TCATCCTCAAACCACCAAAGTTA 57.945 39.130 0.00 0.00 0.00 2.24
4487 5733 5.453198 CCTCAAACCACCAAAGTTAAGCAAT 60.453 40.000 0.00 0.00 0.00 3.56
4488 5734 5.355596 TCAAACCACCAAAGTTAAGCAATG 58.644 37.500 0.00 0.00 0.00 2.82
4507 5764 6.320672 AGCAATGATTTATCTGTTCTCCTTGG 59.679 38.462 0.00 0.00 0.00 3.61
4515 5772 1.377856 GTTCTCCTTGGCTGCCTCC 60.378 63.158 21.03 0.00 0.00 4.30
4519 5776 4.335647 CCTTGGCTGCCTCCGTGT 62.336 66.667 21.03 0.00 0.00 4.49
4522 5779 0.605319 CTTGGCTGCCTCCGTGTTAA 60.605 55.000 21.03 1.81 0.00 2.01
4555 5812 7.962964 TCTCTGTAAGTAACCACATTTTCTG 57.037 36.000 0.00 0.00 33.76 3.02
4560 5817 5.695851 AAGTAACCACATTTTCTGCTCTG 57.304 39.130 0.00 0.00 0.00 3.35
4577 5834 9.453572 TTCTGCTCTGTAAATTCTTATGATTGT 57.546 29.630 0.00 0.00 0.00 2.71
4578 5835 9.453572 TCTGCTCTGTAAATTCTTATGATTGTT 57.546 29.630 0.00 0.00 0.00 2.83
4579 5836 9.713740 CTGCTCTGTAAATTCTTATGATTGTTC 57.286 33.333 0.00 0.00 0.00 3.18
4580 5837 9.230122 TGCTCTGTAAATTCTTATGATTGTTCA 57.770 29.630 0.00 0.00 36.00 3.18
4588 5845 9.865321 AAATTCTTATGATTGTTCATGTCAAGG 57.135 29.630 10.53 0.00 42.60 3.61
4589 5846 8.585471 ATTCTTATGATTGTTCATGTCAAGGT 57.415 30.769 10.53 4.11 42.60 3.50
4590 5847 8.408043 TTCTTATGATTGTTCATGTCAAGGTT 57.592 30.769 10.53 0.00 42.60 3.50
4591 5848 8.408043 TCTTATGATTGTTCATGTCAAGGTTT 57.592 30.769 10.53 0.00 42.60 3.27
4592 5849 8.514594 TCTTATGATTGTTCATGTCAAGGTTTC 58.485 33.333 10.53 5.55 42.60 2.78
4593 5850 6.906157 ATGATTGTTCATGTCAAGGTTTCT 57.094 33.333 10.53 0.00 41.12 2.52
4594 5851 9.513906 TTATGATTGTTCATGTCAAGGTTTCTA 57.486 29.630 10.53 0.00 42.60 2.10
4595 5852 7.439157 TGATTGTTCATGTCAAGGTTTCTAG 57.561 36.000 10.53 0.00 0.00 2.43
4596 5853 6.430925 TGATTGTTCATGTCAAGGTTTCTAGG 59.569 38.462 10.53 0.00 0.00 3.02
4597 5854 4.651778 TGTTCATGTCAAGGTTTCTAGGG 58.348 43.478 0.00 0.00 0.00 3.53
4598 5855 4.104102 TGTTCATGTCAAGGTTTCTAGGGT 59.896 41.667 0.00 0.00 0.00 4.34
4599 5856 5.308497 TGTTCATGTCAAGGTTTCTAGGGTA 59.692 40.000 0.00 0.00 0.00 3.69
4600 5857 5.416271 TCATGTCAAGGTTTCTAGGGTAC 57.584 43.478 0.00 0.00 0.00 3.34
4601 5858 5.091552 TCATGTCAAGGTTTCTAGGGTACT 58.908 41.667 0.00 0.00 0.00 2.73
4602 5859 6.258354 TCATGTCAAGGTTTCTAGGGTACTA 58.742 40.000 0.00 0.00 0.00 1.82
4603 5860 5.990120 TGTCAAGGTTTCTAGGGTACTAC 57.010 43.478 0.00 0.00 0.00 2.73
4604 5861 4.460382 TGTCAAGGTTTCTAGGGTACTACG 59.540 45.833 0.00 0.00 0.00 3.51
4605 5862 3.445096 TCAAGGTTTCTAGGGTACTACGC 59.555 47.826 0.00 0.00 0.00 4.42
4606 5863 2.382882 AGGTTTCTAGGGTACTACGCC 58.617 52.381 0.00 0.00 0.00 5.68
4607 5864 1.410517 GGTTTCTAGGGTACTACGCCC 59.589 57.143 0.00 0.00 46.43 6.13
4857 6114 4.486125 TGACAGAATAATGGCACTAGCA 57.514 40.909 0.00 0.00 44.61 3.49
4858 6115 5.039920 TGACAGAATAATGGCACTAGCAT 57.960 39.130 0.00 0.00 44.61 3.79
4859 6116 5.439721 TGACAGAATAATGGCACTAGCATT 58.560 37.500 0.00 0.00 44.61 3.56
4860 6117 5.297527 TGACAGAATAATGGCACTAGCATTG 59.702 40.000 0.00 0.00 44.61 2.82
4861 6118 5.439721 ACAGAATAATGGCACTAGCATTGA 58.560 37.500 0.00 0.00 44.61 2.57
4862 6119 5.530171 ACAGAATAATGGCACTAGCATTGAG 59.470 40.000 0.00 0.00 44.61 3.02
4863 6120 4.518211 AGAATAATGGCACTAGCATTGAGC 59.482 41.667 0.00 0.00 44.61 4.26
4886 6143 6.399204 CTAAGAAGCAACATGAAAAATGCC 57.601 37.500 0.00 0.00 39.59 4.40
4887 6144 4.339872 AGAAGCAACATGAAAAATGCCA 57.660 36.364 0.00 0.00 39.59 4.92
4888 6145 4.901868 AGAAGCAACATGAAAAATGCCAT 58.098 34.783 0.00 0.00 39.59 4.40
4889 6146 6.040209 AGAAGCAACATGAAAAATGCCATA 57.960 33.333 0.00 0.00 39.59 2.74
4890 6147 5.870978 AGAAGCAACATGAAAAATGCCATAC 59.129 36.000 0.00 0.00 39.59 2.39
4891 6148 4.506758 AGCAACATGAAAAATGCCATACC 58.493 39.130 0.00 0.00 39.59 2.73
4892 6149 4.020396 AGCAACATGAAAAATGCCATACCA 60.020 37.500 0.00 0.00 39.59 3.25
4893 6150 4.877251 GCAACATGAAAAATGCCATACCAT 59.123 37.500 0.00 0.00 32.73 3.55
4894 6151 6.047870 GCAACATGAAAAATGCCATACCATA 58.952 36.000 0.00 0.00 32.73 2.74
4895 6152 6.707161 GCAACATGAAAAATGCCATACCATAT 59.293 34.615 0.00 0.00 32.73 1.78
4896 6153 7.307514 GCAACATGAAAAATGCCATACCATATG 60.308 37.037 0.00 0.00 32.73 1.78
4897 6154 7.364149 ACATGAAAAATGCCATACCATATGT 57.636 32.000 0.00 0.00 0.00 2.29
4898 6155 7.211573 ACATGAAAAATGCCATACCATATGTG 58.788 34.615 0.00 0.00 0.00 3.21
4899 6156 7.069702 ACATGAAAAATGCCATACCATATGTGA 59.930 33.333 0.00 0.00 0.00 3.58
4900 6157 7.600231 TGAAAAATGCCATACCATATGTGAT 57.400 32.000 1.24 0.00 0.00 3.06
4901 6158 8.020777 TGAAAAATGCCATACCATATGTGATT 57.979 30.769 1.24 0.00 0.00 2.57
4902 6159 8.484575 TGAAAAATGCCATACCATATGTGATTT 58.515 29.630 1.24 0.00 0.00 2.17
4903 6160 8.891671 AAAAATGCCATACCATATGTGATTTC 57.108 30.769 1.24 0.00 0.00 2.17
4904 6161 6.594788 AATGCCATACCATATGTGATTTCC 57.405 37.500 1.24 0.00 0.00 3.13
4905 6162 5.323382 TGCCATACCATATGTGATTTCCT 57.677 39.130 1.24 0.00 0.00 3.36
4906 6163 5.704354 TGCCATACCATATGTGATTTCCTT 58.296 37.500 1.24 0.00 0.00 3.36
4907 6164 5.535783 TGCCATACCATATGTGATTTCCTTG 59.464 40.000 1.24 0.00 0.00 3.61
4908 6165 5.565439 GCCATACCATATGTGATTTCCTTGC 60.565 44.000 1.24 0.00 0.00 4.01
4909 6166 5.771666 CCATACCATATGTGATTTCCTTGCT 59.228 40.000 1.24 0.00 0.00 3.91
4910 6167 6.942005 CCATACCATATGTGATTTCCTTGCTA 59.058 38.462 1.24 0.00 0.00 3.49
4911 6168 7.613022 CCATACCATATGTGATTTCCTTGCTAT 59.387 37.037 1.24 0.00 0.00 2.97
4912 6169 9.671279 CATACCATATGTGATTTCCTTGCTATA 57.329 33.333 1.24 0.00 0.00 1.31
4913 6170 9.896645 ATACCATATGTGATTTCCTTGCTATAG 57.103 33.333 1.24 0.00 0.00 1.31
4914 6171 7.749666 ACCATATGTGATTTCCTTGCTATAGT 58.250 34.615 1.24 0.00 0.00 2.12
4915 6172 8.220559 ACCATATGTGATTTCCTTGCTATAGTT 58.779 33.333 1.24 0.00 0.00 2.24
4916 6173 9.725019 CCATATGTGATTTCCTTGCTATAGTTA 57.275 33.333 1.24 0.00 0.00 2.24
4919 6176 8.668510 ATGTGATTTCCTTGCTATAGTTACAG 57.331 34.615 0.84 0.00 0.00 2.74
4920 6177 7.847096 TGTGATTTCCTTGCTATAGTTACAGA 58.153 34.615 0.84 0.00 0.00 3.41
4921 6178 8.318412 TGTGATTTCCTTGCTATAGTTACAGAA 58.682 33.333 0.84 0.00 0.00 3.02
4922 6179 8.604890 GTGATTTCCTTGCTATAGTTACAGAAC 58.395 37.037 0.84 0.00 35.64 3.01
4923 6180 8.318412 TGATTTCCTTGCTATAGTTACAGAACA 58.682 33.333 0.84 0.00 38.10 3.18
4924 6181 9.331282 GATTTCCTTGCTATAGTTACAGAACAT 57.669 33.333 0.84 0.00 38.10 2.71
4925 6182 8.718102 TTTCCTTGCTATAGTTACAGAACATC 57.282 34.615 0.84 0.00 38.10 3.06
4926 6183 7.418337 TCCTTGCTATAGTTACAGAACATCA 57.582 36.000 0.84 0.00 38.10 3.07
4927 6184 7.265673 TCCTTGCTATAGTTACAGAACATCAC 58.734 38.462 0.84 0.00 38.10 3.06
4928 6185 7.041721 CCTTGCTATAGTTACAGAACATCACA 58.958 38.462 0.84 0.00 38.10 3.58
4929 6186 7.712639 CCTTGCTATAGTTACAGAACATCACAT 59.287 37.037 0.84 0.00 38.10 3.21
4930 6187 8.648557 TTGCTATAGTTACAGAACATCACATC 57.351 34.615 0.84 0.00 38.10 3.06
4931 6188 8.011844 TGCTATAGTTACAGAACATCACATCT 57.988 34.615 0.84 0.00 38.10 2.90
4932 6189 8.138074 TGCTATAGTTACAGAACATCACATCTC 58.862 37.037 0.84 0.00 38.10 2.75
4933 6190 8.356657 GCTATAGTTACAGAACATCACATCTCT 58.643 37.037 0.84 0.00 38.10 3.10
4934 6191 9.891828 CTATAGTTACAGAACATCACATCTCTC 57.108 37.037 0.00 0.00 38.10 3.20
4935 6192 5.971763 AGTTACAGAACATCACATCTCTCC 58.028 41.667 0.00 0.00 38.10 3.71
4936 6193 5.719085 AGTTACAGAACATCACATCTCTCCT 59.281 40.000 0.00 0.00 38.10 3.69
4937 6194 6.212388 AGTTACAGAACATCACATCTCTCCTT 59.788 38.462 0.00 0.00 38.10 3.36
4938 6195 5.495926 ACAGAACATCACATCTCTCCTTT 57.504 39.130 0.00 0.00 0.00 3.11
4939 6196 5.486526 ACAGAACATCACATCTCTCCTTTC 58.513 41.667 0.00 0.00 0.00 2.62
4940 6197 4.874966 CAGAACATCACATCTCTCCTTTCC 59.125 45.833 0.00 0.00 0.00 3.13
4941 6198 4.533707 AGAACATCACATCTCTCCTTTCCA 59.466 41.667 0.00 0.00 0.00 3.53
4942 6199 4.916041 ACATCACATCTCTCCTTTCCAA 57.084 40.909 0.00 0.00 0.00 3.53
4943 6200 5.447778 ACATCACATCTCTCCTTTCCAAT 57.552 39.130 0.00 0.00 0.00 3.16
4944 6201 5.824421 ACATCACATCTCTCCTTTCCAATT 58.176 37.500 0.00 0.00 0.00 2.32
4945 6202 5.884792 ACATCACATCTCTCCTTTCCAATTC 59.115 40.000 0.00 0.00 0.00 2.17
4946 6203 4.848357 TCACATCTCTCCTTTCCAATTCC 58.152 43.478 0.00 0.00 0.00 3.01
4947 6204 4.537688 TCACATCTCTCCTTTCCAATTCCT 59.462 41.667 0.00 0.00 0.00 3.36
4948 6205 4.880696 CACATCTCTCCTTTCCAATTCCTC 59.119 45.833 0.00 0.00 0.00 3.71
4949 6206 4.080072 ACATCTCTCCTTTCCAATTCCTCC 60.080 45.833 0.00 0.00 0.00 4.30
4950 6207 3.808189 TCTCTCCTTTCCAATTCCTCCT 58.192 45.455 0.00 0.00 0.00 3.69
4951 6208 4.179133 TCTCTCCTTTCCAATTCCTCCTT 58.821 43.478 0.00 0.00 0.00 3.36
4952 6209 4.226168 TCTCTCCTTTCCAATTCCTCCTTC 59.774 45.833 0.00 0.00 0.00 3.46
4953 6210 3.055094 TCTCCTTTCCAATTCCTCCTTCG 60.055 47.826 0.00 0.00 0.00 3.79
4954 6211 2.642807 TCCTTTCCAATTCCTCCTTCGT 59.357 45.455 0.00 0.00 0.00 3.85
4955 6212 3.073946 TCCTTTCCAATTCCTCCTTCGTT 59.926 43.478 0.00 0.00 0.00 3.85
4956 6213 3.440522 CCTTTCCAATTCCTCCTTCGTTC 59.559 47.826 0.00 0.00 0.00 3.95
4957 6214 4.327680 CTTTCCAATTCCTCCTTCGTTCT 58.672 43.478 0.00 0.00 0.00 3.01
4958 6215 4.367039 TTCCAATTCCTCCTTCGTTCTT 57.633 40.909 0.00 0.00 0.00 2.52
4959 6216 4.367039 TCCAATTCCTCCTTCGTTCTTT 57.633 40.909 0.00 0.00 0.00 2.52
4960 6217 4.725490 TCCAATTCCTCCTTCGTTCTTTT 58.275 39.130 0.00 0.00 0.00 2.27
4961 6218 5.871834 TCCAATTCCTCCTTCGTTCTTTTA 58.128 37.500 0.00 0.00 0.00 1.52
4962 6219 5.704053 TCCAATTCCTCCTTCGTTCTTTTAC 59.296 40.000 0.00 0.00 0.00 2.01
4963 6220 5.705905 CCAATTCCTCCTTCGTTCTTTTACT 59.294 40.000 0.00 0.00 0.00 2.24
4964 6221 6.206829 CCAATTCCTCCTTCGTTCTTTTACTT 59.793 38.462 0.00 0.00 0.00 2.24
4965 6222 7.255486 CCAATTCCTCCTTCGTTCTTTTACTTT 60.255 37.037 0.00 0.00 0.00 2.66
4966 6223 8.780249 CAATTCCTCCTTCGTTCTTTTACTTTA 58.220 33.333 0.00 0.00 0.00 1.85
4967 6224 7.719778 TTCCTCCTTCGTTCTTTTACTTTAC 57.280 36.000 0.00 0.00 0.00 2.01
4968 6225 6.819284 TCCTCCTTCGTTCTTTTACTTTACA 58.181 36.000 0.00 0.00 0.00 2.41
4969 6226 6.927381 TCCTCCTTCGTTCTTTTACTTTACAG 59.073 38.462 0.00 0.00 0.00 2.74
4970 6227 6.927381 CCTCCTTCGTTCTTTTACTTTACAGA 59.073 38.462 0.00 0.00 0.00 3.41
4971 6228 7.603024 CCTCCTTCGTTCTTTTACTTTACAGAT 59.397 37.037 0.00 0.00 0.00 2.90
4972 6229 8.897872 TCCTTCGTTCTTTTACTTTACAGATT 57.102 30.769 0.00 0.00 0.00 2.40
4973 6230 9.333724 TCCTTCGTTCTTTTACTTTACAGATTT 57.666 29.630 0.00 0.00 0.00 2.17
4974 6231 9.382244 CCTTCGTTCTTTTACTTTACAGATTTG 57.618 33.333 0.00 0.00 0.00 2.32
4975 6232 9.931210 CTTCGTTCTTTTACTTTACAGATTTGT 57.069 29.630 0.00 0.00 41.39 2.83
4987 6244 9.877178 ACTTTACAGATTTGTATTAGTGAGAGG 57.123 33.333 9.52 0.00 39.43 3.69
4988 6245 9.877178 CTTTACAGATTTGTATTAGTGAGAGGT 57.123 33.333 0.00 0.00 39.43 3.85
4992 6249 9.574516 ACAGATTTGTATTAGTGAGAGGTTTTT 57.425 29.630 0.00 0.00 35.25 1.94
5017 6274 6.683974 TTTTTGGCTAGCAGTGAGAATATC 57.316 37.500 18.24 0.00 0.00 1.63
5018 6275 5.620738 TTTGGCTAGCAGTGAGAATATCT 57.379 39.130 18.24 0.00 0.00 1.98
5019 6276 6.731292 TTTGGCTAGCAGTGAGAATATCTA 57.269 37.500 18.24 0.00 0.00 1.98
5020 6277 5.713792 TGGCTAGCAGTGAGAATATCTAC 57.286 43.478 18.24 0.00 0.00 2.59
5021 6278 4.216472 TGGCTAGCAGTGAGAATATCTACG 59.784 45.833 18.24 0.00 0.00 3.51
5022 6279 4.456222 GGCTAGCAGTGAGAATATCTACGA 59.544 45.833 18.24 0.00 0.00 3.43
5023 6280 5.387279 GCTAGCAGTGAGAATATCTACGAC 58.613 45.833 10.63 0.00 0.00 4.34
5024 6281 5.180492 GCTAGCAGTGAGAATATCTACGACT 59.820 44.000 10.63 0.00 0.00 4.18
5025 6282 6.369340 GCTAGCAGTGAGAATATCTACGACTA 59.631 42.308 10.63 0.00 0.00 2.59
5026 6283 6.795098 AGCAGTGAGAATATCTACGACTAG 57.205 41.667 0.00 0.00 0.00 2.57
5027 6284 6.292923 AGCAGTGAGAATATCTACGACTAGT 58.707 40.000 0.00 0.00 0.00 2.57
5028 6285 6.768861 AGCAGTGAGAATATCTACGACTAGTT 59.231 38.462 0.00 0.00 0.00 2.24
5029 6286 7.283580 AGCAGTGAGAATATCTACGACTAGTTT 59.716 37.037 0.00 0.00 0.00 2.66
5030 6287 7.588488 GCAGTGAGAATATCTACGACTAGTTTC 59.412 40.741 0.00 0.00 0.00 2.78
5031 6288 8.832521 CAGTGAGAATATCTACGACTAGTTTCT 58.167 37.037 0.00 0.00 0.00 2.52
5032 6289 9.048446 AGTGAGAATATCTACGACTAGTTTCTC 57.952 37.037 17.17 17.17 35.26 2.87
5033 6290 8.828644 GTGAGAATATCTACGACTAGTTTCTCA 58.171 37.037 20.60 20.60 38.10 3.27
5034 6291 9.562408 TGAGAATATCTACGACTAGTTTCTCAT 57.438 33.333 20.60 5.83 37.08 2.90
5041 6298 8.332996 TCTACGACTAGTTTCTCATACTTTGT 57.667 34.615 0.00 0.00 0.00 2.83
5042 6299 8.235226 TCTACGACTAGTTTCTCATACTTTGTG 58.765 37.037 0.00 0.00 0.00 3.33
5043 6300 6.978338 ACGACTAGTTTCTCATACTTTGTGA 58.022 36.000 0.00 0.00 0.00 3.58
5044 6301 7.603651 ACGACTAGTTTCTCATACTTTGTGAT 58.396 34.615 0.00 0.00 0.00 3.06
5045 6302 8.088981 ACGACTAGTTTCTCATACTTTGTGATT 58.911 33.333 0.00 0.00 0.00 2.57
5046 6303 8.926710 CGACTAGTTTCTCATACTTTGTGATTT 58.073 33.333 0.00 0.00 0.00 2.17
5048 6305 9.003658 ACTAGTTTCTCATACTTTGTGATTTGG 57.996 33.333 0.00 0.00 0.00 3.28
5049 6306 9.219603 CTAGTTTCTCATACTTTGTGATTTGGA 57.780 33.333 0.00 0.00 0.00 3.53
5050 6307 8.463930 AGTTTCTCATACTTTGTGATTTGGAA 57.536 30.769 0.00 0.00 0.00 3.53
5051 6308 9.082313 AGTTTCTCATACTTTGTGATTTGGAAT 57.918 29.630 0.00 0.00 0.00 3.01
5052 6309 9.346725 GTTTCTCATACTTTGTGATTTGGAATC 57.653 33.333 0.00 0.00 0.00 2.52
5053 6310 7.630242 TCTCATACTTTGTGATTTGGAATCC 57.370 36.000 0.00 0.00 0.00 3.01
5054 6311 7.405292 TCTCATACTTTGTGATTTGGAATCCT 58.595 34.615 0.00 0.00 0.00 3.24
5055 6312 7.890127 TCTCATACTTTGTGATTTGGAATCCTT 59.110 33.333 0.00 0.00 0.00 3.36
5056 6313 7.829725 TCATACTTTGTGATTTGGAATCCTTG 58.170 34.615 0.00 0.00 0.00 3.61
5057 6314 7.451255 TCATACTTTGTGATTTGGAATCCTTGT 59.549 33.333 0.00 0.00 0.00 3.16
5058 6315 6.089249 ACTTTGTGATTTGGAATCCTTGTC 57.911 37.500 0.00 0.00 0.00 3.18
5059 6316 5.598005 ACTTTGTGATTTGGAATCCTTGTCA 59.402 36.000 0.00 0.00 0.00 3.58
5060 6317 5.710513 TTGTGATTTGGAATCCTTGTCAG 57.289 39.130 0.00 0.00 0.00 3.51
5061 6318 4.728772 TGTGATTTGGAATCCTTGTCAGT 58.271 39.130 0.00 0.00 0.00 3.41
5062 6319 4.520111 TGTGATTTGGAATCCTTGTCAGTG 59.480 41.667 0.00 0.00 0.00 3.66
5063 6320 4.520492 GTGATTTGGAATCCTTGTCAGTGT 59.480 41.667 0.00 0.00 0.00 3.55
5064 6321 5.010012 GTGATTTGGAATCCTTGTCAGTGTT 59.990 40.000 0.00 0.00 0.00 3.32
5065 6322 5.598005 TGATTTGGAATCCTTGTCAGTGTTT 59.402 36.000 0.00 0.00 0.00 2.83
5066 6323 5.930837 TTTGGAATCCTTGTCAGTGTTTT 57.069 34.783 0.00 0.00 0.00 2.43
5067 6324 4.916983 TGGAATCCTTGTCAGTGTTTTG 57.083 40.909 0.00 0.00 0.00 2.44
5068 6325 3.636300 TGGAATCCTTGTCAGTGTTTTGG 59.364 43.478 0.00 0.00 0.00 3.28
5069 6326 3.888930 GGAATCCTTGTCAGTGTTTTGGA 59.111 43.478 0.00 0.00 0.00 3.53
5070 6327 4.340950 GGAATCCTTGTCAGTGTTTTGGAA 59.659 41.667 0.00 0.00 0.00 3.53
5071 6328 5.163457 GGAATCCTTGTCAGTGTTTTGGAAA 60.163 40.000 0.00 0.00 0.00 3.13
5072 6329 4.981806 TCCTTGTCAGTGTTTTGGAAAG 57.018 40.909 0.00 0.00 0.00 2.62
5073 6330 3.130340 TCCTTGTCAGTGTTTTGGAAAGC 59.870 43.478 0.00 0.00 0.00 3.51
5074 6331 3.119173 CCTTGTCAGTGTTTTGGAAAGCA 60.119 43.478 0.00 0.00 0.00 3.91
5075 6332 4.441913 CCTTGTCAGTGTTTTGGAAAGCAT 60.442 41.667 0.00 0.00 31.84 3.79
5076 6333 4.044336 TGTCAGTGTTTTGGAAAGCATG 57.956 40.909 0.00 0.00 31.84 4.06
5077 6334 2.796593 GTCAGTGTTTTGGAAAGCATGC 59.203 45.455 10.51 10.51 31.84 4.06
5078 6335 2.694628 TCAGTGTTTTGGAAAGCATGCT 59.305 40.909 16.30 16.30 31.84 3.79
5079 6336 3.132646 TCAGTGTTTTGGAAAGCATGCTT 59.867 39.130 27.21 27.21 37.98 3.91
5080 6337 3.246699 CAGTGTTTTGGAAAGCATGCTTG 59.753 43.478 32.54 13.09 36.26 4.01
5081 6338 2.545106 GTGTTTTGGAAAGCATGCTTGG 59.455 45.455 32.54 0.00 36.26 3.61
5082 6339 2.145536 GTTTTGGAAAGCATGCTTGGG 58.854 47.619 32.54 0.00 36.26 4.12
5083 6340 1.714541 TTTGGAAAGCATGCTTGGGA 58.285 45.000 32.54 16.40 36.26 4.37
5084 6341 0.968405 TTGGAAAGCATGCTTGGGAC 59.032 50.000 32.54 21.57 36.26 4.46
5085 6342 0.178967 TGGAAAGCATGCTTGGGACA 60.179 50.000 32.54 23.63 36.26 4.02
5086 6343 1.188863 GGAAAGCATGCTTGGGACAT 58.811 50.000 32.54 16.54 39.30 3.06
5087 6344 1.134907 GGAAAGCATGCTTGGGACATG 60.135 52.381 32.54 0.00 46.19 3.21
5088 6345 0.899720 AAAGCATGCTTGGGACATGG 59.100 50.000 32.54 0.00 44.12 3.66
5089 6346 4.023137 GCATGCTTGGGACATGGT 57.977 55.556 11.37 0.00 44.12 3.55
5090 6347 1.514087 GCATGCTTGGGACATGGTG 59.486 57.895 11.37 0.00 44.12 4.17
5091 6348 0.966875 GCATGCTTGGGACATGGTGA 60.967 55.000 11.37 0.00 44.12 4.02
5092 6349 1.100510 CATGCTTGGGACATGGTGAG 58.899 55.000 0.00 0.00 40.99 3.51
5093 6350 0.700564 ATGCTTGGGACATGGTGAGT 59.299 50.000 0.00 0.00 39.30 3.41
5094 6351 0.478072 TGCTTGGGACATGGTGAGTT 59.522 50.000 0.00 0.00 39.30 3.01
5095 6352 1.702401 TGCTTGGGACATGGTGAGTTA 59.298 47.619 0.00 0.00 39.30 2.24
5096 6353 2.107378 TGCTTGGGACATGGTGAGTTAA 59.893 45.455 0.00 0.00 39.30 2.01
5097 6354 3.153919 GCTTGGGACATGGTGAGTTAAA 58.846 45.455 0.00 0.00 39.30 1.52
5098 6355 3.191371 GCTTGGGACATGGTGAGTTAAAG 59.809 47.826 0.00 0.00 39.30 1.85
5099 6356 4.651778 CTTGGGACATGGTGAGTTAAAGA 58.348 43.478 0.00 0.00 39.30 2.52
5100 6357 4.927267 TGGGACATGGTGAGTTAAAGAT 57.073 40.909 0.00 0.00 0.00 2.40
5101 6358 4.588899 TGGGACATGGTGAGTTAAAGATG 58.411 43.478 0.00 0.00 0.00 2.90
5102 6359 3.947834 GGGACATGGTGAGTTAAAGATGG 59.052 47.826 0.00 0.00 0.00 3.51
5103 6360 4.567747 GGGACATGGTGAGTTAAAGATGGT 60.568 45.833 0.00 0.00 0.00 3.55
5104 6361 5.338871 GGGACATGGTGAGTTAAAGATGGTA 60.339 44.000 0.00 0.00 0.00 3.25
5105 6362 6.177610 GGACATGGTGAGTTAAAGATGGTAA 58.822 40.000 0.00 0.00 0.00 2.85
5106 6363 6.657541 GGACATGGTGAGTTAAAGATGGTAAA 59.342 38.462 0.00 0.00 0.00 2.01
5107 6364 7.361799 GGACATGGTGAGTTAAAGATGGTAAAC 60.362 40.741 0.00 0.00 0.00 2.01
5108 6365 7.231467 ACATGGTGAGTTAAAGATGGTAAACT 58.769 34.615 0.00 0.00 34.96 2.66
5109 6366 7.390718 ACATGGTGAGTTAAAGATGGTAAACTC 59.609 37.037 0.00 7.03 45.15 3.01
5110 6367 6.235664 TGGTGAGTTAAAGATGGTAAACTCC 58.764 40.000 10.57 3.81 44.60 3.85
5111 6368 6.183361 TGGTGAGTTAAAGATGGTAAACTCCA 60.183 38.462 10.57 2.10 44.60 3.86
5113 6370 7.148239 GGTGAGTTAAAGATGGTAAACTCCATG 60.148 40.741 10.57 0.00 46.72 3.66
5114 6371 6.374333 TGAGTTAAAGATGGTAAACTCCATGC 59.626 38.462 10.57 0.00 46.72 4.06
5115 6372 6.245408 AGTTAAAGATGGTAAACTCCATGCA 58.755 36.000 2.82 0.00 46.72 3.96
5116 6373 6.891908 AGTTAAAGATGGTAAACTCCATGCAT 59.108 34.615 2.82 0.00 46.72 3.96
5117 6374 5.587388 AAAGATGGTAAACTCCATGCATG 57.413 39.130 20.19 20.19 46.72 4.06
5118 6375 2.954318 AGATGGTAAACTCCATGCATGC 59.046 45.455 21.69 11.82 46.72 4.06
5119 6376 2.512692 TGGTAAACTCCATGCATGCT 57.487 45.000 21.69 2.51 31.96 3.79
5120 6377 2.368439 TGGTAAACTCCATGCATGCTC 58.632 47.619 21.69 5.49 31.96 4.26
5121 6378 2.290832 TGGTAAACTCCATGCATGCTCA 60.291 45.455 21.69 6.13 31.96 4.26
5122 6379 2.098117 GGTAAACTCCATGCATGCTCAC 59.902 50.000 21.69 11.37 0.00 3.51
5123 6380 2.211250 AAACTCCATGCATGCTCACT 57.789 45.000 21.69 2.15 0.00 3.41
5124 6381 1.460504 AACTCCATGCATGCTCACTG 58.539 50.000 21.69 10.71 0.00 3.66
5125 6382 0.327259 ACTCCATGCATGCTCACTGT 59.673 50.000 21.69 9.58 0.00 3.55
5126 6383 1.015109 CTCCATGCATGCTCACTGTC 58.985 55.000 21.69 0.00 0.00 3.51
5127 6384 0.325602 TCCATGCATGCTCACTGTCA 59.674 50.000 21.69 0.00 0.00 3.58
5128 6385 0.450583 CCATGCATGCTCACTGTCAC 59.549 55.000 21.69 0.00 0.00 3.67
5129 6386 1.450025 CATGCATGCTCACTGTCACT 58.550 50.000 20.33 0.00 0.00 3.41
5130 6387 1.810755 CATGCATGCTCACTGTCACTT 59.189 47.619 20.33 0.00 0.00 3.16
5131 6388 1.232119 TGCATGCTCACTGTCACTTG 58.768 50.000 20.33 0.00 0.00 3.16
5132 6389 0.520404 GCATGCTCACTGTCACTTGG 59.480 55.000 11.37 0.00 0.00 3.61
5133 6390 0.520404 CATGCTCACTGTCACTTGGC 59.480 55.000 0.00 0.00 0.00 4.52
5134 6391 0.607489 ATGCTCACTGTCACTTGGCC 60.607 55.000 0.00 0.00 0.00 5.36
5135 6392 1.227943 GCTCACTGTCACTTGGCCA 60.228 57.895 0.00 0.00 0.00 5.36
5136 6393 1.233285 GCTCACTGTCACTTGGCCAG 61.233 60.000 5.11 2.72 0.00 4.85
5137 6394 1.227943 TCACTGTCACTTGGCCAGC 60.228 57.895 5.11 0.00 0.00 4.85
5138 6395 1.526686 CACTGTCACTTGGCCAGCA 60.527 57.895 5.11 0.66 0.00 4.41
5139 6396 1.526917 ACTGTCACTTGGCCAGCAC 60.527 57.895 5.11 1.79 0.00 4.40
5140 6397 1.526686 CTGTCACTTGGCCAGCACA 60.527 57.895 5.11 6.75 0.00 4.57
5141 6398 1.512996 CTGTCACTTGGCCAGCACAG 61.513 60.000 5.11 12.77 32.75 3.66
5142 6399 1.227943 GTCACTTGGCCAGCACAGA 60.228 57.895 5.11 0.00 0.00 3.41
5143 6400 0.607489 GTCACTTGGCCAGCACAGAT 60.607 55.000 5.11 0.00 0.00 2.90
5144 6401 0.607217 TCACTTGGCCAGCACAGATG 60.607 55.000 5.11 2.24 0.00 2.90
5145 6402 1.303888 ACTTGGCCAGCACAGATGG 60.304 57.895 5.11 0.00 42.66 3.51
5150 6407 2.359107 CCAGCACAGATGGCGTGT 60.359 61.111 0.00 0.00 36.71 4.49
5151 6408 2.683859 CCAGCACAGATGGCGTGTG 61.684 63.158 1.76 1.76 46.78 3.82
5152 6409 1.668793 CAGCACAGATGGCGTGTGA 60.669 57.895 11.22 0.00 46.99 3.58
5153 6410 1.071299 AGCACAGATGGCGTGTGAA 59.929 52.632 11.22 0.00 46.99 3.18
5154 6411 0.321919 AGCACAGATGGCGTGTGAAT 60.322 50.000 11.22 0.00 46.99 2.57
5155 6412 1.066215 AGCACAGATGGCGTGTGAATA 60.066 47.619 11.22 0.00 46.99 1.75
5156 6413 1.737236 GCACAGATGGCGTGTGAATAA 59.263 47.619 11.22 0.00 46.99 1.40
5157 6414 2.161410 GCACAGATGGCGTGTGAATAAA 59.839 45.455 11.22 0.00 46.99 1.40
5158 6415 3.181497 GCACAGATGGCGTGTGAATAAAT 60.181 43.478 11.22 0.00 46.99 1.40
5159 6416 4.675146 GCACAGATGGCGTGTGAATAAATT 60.675 41.667 11.22 0.00 46.99 1.82
5160 6417 5.401550 CACAGATGGCGTGTGAATAAATTT 58.598 37.500 11.22 0.00 46.99 1.82
5161 6418 5.286797 CACAGATGGCGTGTGAATAAATTTG 59.713 40.000 11.22 0.00 46.99 2.32
5162 6419 4.266029 CAGATGGCGTGTGAATAAATTTGC 59.734 41.667 0.00 0.00 0.00 3.68
5163 6420 3.932545 TGGCGTGTGAATAAATTTGCT 57.067 38.095 0.00 0.00 0.00 3.91
5164 6421 3.573598 TGGCGTGTGAATAAATTTGCTG 58.426 40.909 0.00 0.00 0.00 4.41
5165 6422 2.923020 GGCGTGTGAATAAATTTGCTGG 59.077 45.455 0.00 0.00 0.00 4.85
5166 6423 2.345341 GCGTGTGAATAAATTTGCTGGC 59.655 45.455 0.00 0.00 0.00 4.85
5167 6424 3.836949 CGTGTGAATAAATTTGCTGGCT 58.163 40.909 0.00 0.00 0.00 4.75
5168 6425 3.609373 CGTGTGAATAAATTTGCTGGCTG 59.391 43.478 0.00 0.00 0.00 4.85
5169 6426 3.928375 GTGTGAATAAATTTGCTGGCTGG 59.072 43.478 0.00 0.00 0.00 4.85
5170 6427 3.577848 TGTGAATAAATTTGCTGGCTGGT 59.422 39.130 0.00 0.00 0.00 4.00
5171 6428 3.928375 GTGAATAAATTTGCTGGCTGGTG 59.072 43.478 0.00 0.00 0.00 4.17
5172 6429 2.678471 ATAAATTTGCTGGCTGGTGC 57.322 45.000 0.00 0.00 38.76 5.01
5173 6430 1.336131 TAAATTTGCTGGCTGGTGCA 58.664 45.000 0.00 0.00 41.91 4.57
5174 6431 0.034337 AAATTTGCTGGCTGGTGCAG 59.966 50.000 0.00 0.00 40.46 4.41
5175 6432 0.828762 AATTTGCTGGCTGGTGCAGA 60.829 50.000 0.00 0.00 40.46 4.26
5176 6433 1.248785 ATTTGCTGGCTGGTGCAGAG 61.249 55.000 0.00 0.00 40.46 3.35
5177 6434 2.629424 TTTGCTGGCTGGTGCAGAGT 62.629 55.000 0.00 0.00 40.46 3.24
5178 6435 3.054503 GCTGGCTGGTGCAGAGTG 61.055 66.667 0.00 0.00 41.91 3.51
5179 6436 3.054503 CTGGCTGGTGCAGAGTGC 61.055 66.667 0.00 0.00 45.29 4.40
5189 6446 3.254629 GCAGAGTGCATCCAGGAAA 57.745 52.632 0.00 0.00 44.26 3.13
5190 6447 1.093159 GCAGAGTGCATCCAGGAAAG 58.907 55.000 0.00 0.00 44.26 2.62
5191 6448 1.612726 GCAGAGTGCATCCAGGAAAGT 60.613 52.381 0.00 0.00 44.26 2.66
5192 6449 2.354259 CAGAGTGCATCCAGGAAAGTC 58.646 52.381 0.00 0.00 0.00 3.01
5193 6450 1.980765 AGAGTGCATCCAGGAAAGTCA 59.019 47.619 0.00 0.00 0.00 3.41
5194 6451 2.027377 AGAGTGCATCCAGGAAAGTCAG 60.027 50.000 0.00 0.00 0.00 3.51
5195 6452 1.701847 AGTGCATCCAGGAAAGTCAGT 59.298 47.619 0.00 0.00 0.00 3.41
5196 6453 2.906389 AGTGCATCCAGGAAAGTCAGTA 59.094 45.455 0.00 0.00 0.00 2.74
5197 6454 3.055530 AGTGCATCCAGGAAAGTCAGTAG 60.056 47.826 0.00 0.00 0.00 2.57
5198 6455 2.906389 TGCATCCAGGAAAGTCAGTAGT 59.094 45.455 0.00 0.00 0.00 2.73
5199 6456 3.327757 TGCATCCAGGAAAGTCAGTAGTT 59.672 43.478 0.00 0.00 0.00 2.24
5200 6457 3.935828 GCATCCAGGAAAGTCAGTAGTTC 59.064 47.826 0.00 0.00 0.00 3.01
5201 6458 4.323104 GCATCCAGGAAAGTCAGTAGTTCT 60.323 45.833 0.00 0.00 0.00 3.01
5202 6459 5.799213 CATCCAGGAAAGTCAGTAGTTCTT 58.201 41.667 0.00 0.00 0.00 2.52
5203 6460 5.215252 TCCAGGAAAGTCAGTAGTTCTTG 57.785 43.478 0.00 0.00 0.00 3.02
5204 6461 4.899457 TCCAGGAAAGTCAGTAGTTCTTGA 59.101 41.667 0.00 0.00 31.88 3.02
5205 6462 5.011125 TCCAGGAAAGTCAGTAGTTCTTGAG 59.989 44.000 0.00 0.00 31.88 3.02
5206 6463 5.233988 CAGGAAAGTCAGTAGTTCTTGAGG 58.766 45.833 0.00 0.00 31.88 3.86
5207 6464 5.011125 CAGGAAAGTCAGTAGTTCTTGAGGA 59.989 44.000 0.00 0.00 31.88 3.71
5208 6465 5.602978 AGGAAAGTCAGTAGTTCTTGAGGAA 59.397 40.000 0.00 0.00 0.00 3.36
5209 6466 5.929415 GGAAAGTCAGTAGTTCTTGAGGAAG 59.071 44.000 0.00 0.00 34.23 3.46
5210 6467 4.529109 AGTCAGTAGTTCTTGAGGAAGC 57.471 45.455 0.00 0.00 34.23 3.86
5211 6468 4.156477 AGTCAGTAGTTCTTGAGGAAGCT 58.844 43.478 0.00 0.00 34.23 3.74
5212 6469 4.021544 AGTCAGTAGTTCTTGAGGAAGCTG 60.022 45.833 0.00 0.00 34.23 4.24
5213 6470 3.898123 TCAGTAGTTCTTGAGGAAGCTGT 59.102 43.478 0.00 0.00 34.27 4.40
5214 6471 3.993081 CAGTAGTTCTTGAGGAAGCTGTG 59.007 47.826 0.00 0.00 34.23 3.66
5215 6472 2.557920 AGTTCTTGAGGAAGCTGTGG 57.442 50.000 0.00 0.00 34.23 4.17
5216 6473 2.050144 AGTTCTTGAGGAAGCTGTGGA 58.950 47.619 0.00 0.00 34.23 4.02
5217 6474 2.439507 AGTTCTTGAGGAAGCTGTGGAA 59.560 45.455 0.00 0.00 34.23 3.53
5218 6475 2.810852 GTTCTTGAGGAAGCTGTGGAAG 59.189 50.000 0.00 0.00 34.23 3.46
5219 6476 2.329267 TCTTGAGGAAGCTGTGGAAGA 58.671 47.619 0.00 0.00 0.00 2.87
5220 6477 2.705658 TCTTGAGGAAGCTGTGGAAGAA 59.294 45.455 0.00 0.00 0.00 2.52
5221 6478 3.136443 TCTTGAGGAAGCTGTGGAAGAAA 59.864 43.478 0.00 0.00 0.00 2.52
5222 6479 3.576078 TGAGGAAGCTGTGGAAGAAAA 57.424 42.857 0.00 0.00 0.00 2.29
5223 6480 3.897239 TGAGGAAGCTGTGGAAGAAAAA 58.103 40.909 0.00 0.00 0.00 1.94
5224 6481 3.885297 TGAGGAAGCTGTGGAAGAAAAAG 59.115 43.478 0.00 0.00 0.00 2.27
5225 6482 3.225940 AGGAAGCTGTGGAAGAAAAAGG 58.774 45.455 0.00 0.00 0.00 3.11
5226 6483 3.117512 AGGAAGCTGTGGAAGAAAAAGGA 60.118 43.478 0.00 0.00 0.00 3.36
5227 6484 3.254411 GGAAGCTGTGGAAGAAAAAGGAG 59.746 47.826 0.00 0.00 0.00 3.69
5228 6485 2.868899 AGCTGTGGAAGAAAAAGGAGG 58.131 47.619 0.00 0.00 0.00 4.30
5229 6486 2.443255 AGCTGTGGAAGAAAAAGGAGGA 59.557 45.455 0.00 0.00 0.00 3.71
5230 6487 2.816672 GCTGTGGAAGAAAAAGGAGGAG 59.183 50.000 0.00 0.00 0.00 3.69
5231 6488 3.496870 GCTGTGGAAGAAAAAGGAGGAGA 60.497 47.826 0.00 0.00 0.00 3.71
5232 6489 4.718961 CTGTGGAAGAAAAAGGAGGAGAA 58.281 43.478 0.00 0.00 0.00 2.87
5233 6490 5.320277 CTGTGGAAGAAAAAGGAGGAGAAT 58.680 41.667 0.00 0.00 0.00 2.40
5234 6491 5.072741 TGTGGAAGAAAAAGGAGGAGAATG 58.927 41.667 0.00 0.00 0.00 2.67
5235 6492 5.163099 TGTGGAAGAAAAAGGAGGAGAATGA 60.163 40.000 0.00 0.00 0.00 2.57
5236 6493 5.182190 GTGGAAGAAAAAGGAGGAGAATGAC 59.818 44.000 0.00 0.00 0.00 3.06
5237 6494 5.163099 TGGAAGAAAAAGGAGGAGAATGACA 60.163 40.000 0.00 0.00 0.00 3.58
5238 6495 5.414144 GGAAGAAAAAGGAGGAGAATGACAG 59.586 44.000 0.00 0.00 0.00 3.51
5239 6496 4.331108 AGAAAAAGGAGGAGAATGACAGC 58.669 43.478 0.00 0.00 0.00 4.40
5240 6497 3.795688 AAAAGGAGGAGAATGACAGCA 57.204 42.857 0.00 0.00 0.00 4.41
5241 6498 4.313020 AAAAGGAGGAGAATGACAGCAT 57.687 40.909 0.00 0.00 35.92 3.79
5242 6499 3.278668 AAGGAGGAGAATGACAGCATG 57.721 47.619 0.00 0.00 46.00 4.06
5243 6500 1.134159 AGGAGGAGAATGACAGCATGC 60.134 52.381 10.51 10.51 42.53 4.06
5244 6501 0.935898 GAGGAGAATGACAGCATGCG 59.064 55.000 13.01 9.99 42.53 4.73
5245 6502 0.463295 AGGAGAATGACAGCATGCGG 60.463 55.000 16.70 16.70 42.53 5.69
5246 6503 0.745845 GGAGAATGACAGCATGCGGT 60.746 55.000 23.79 23.79 42.53 5.68
5247 6504 1.089920 GAGAATGACAGCATGCGGTT 58.910 50.000 24.33 9.18 42.53 4.44
5248 6505 1.063174 GAGAATGACAGCATGCGGTTC 59.937 52.381 24.33 17.39 42.53 3.62
5249 6506 0.804364 GAATGACAGCATGCGGTTCA 59.196 50.000 24.33 21.23 42.53 3.18
5250 6507 1.402968 GAATGACAGCATGCGGTTCAT 59.597 47.619 24.33 22.30 42.53 2.57
5257 6514 3.924507 ATGCGGTTCATGAAGGGC 58.075 55.556 18.96 18.96 33.26 5.19
5258 6515 1.001020 ATGCGGTTCATGAAGGGCA 60.001 52.632 26.46 26.46 35.23 5.36
5259 6516 1.315257 ATGCGGTTCATGAAGGGCAC 61.315 55.000 26.69 10.08 34.11 5.01
5273 6530 4.767255 GCACCGAGGAGTGGCAGG 62.767 72.222 0.00 0.00 38.24 4.85
5274 6531 2.997315 CACCGAGGAGTGGCAGGA 60.997 66.667 0.00 0.00 33.95 3.86
5275 6532 2.039624 ACCGAGGAGTGGCAGGAT 59.960 61.111 0.00 0.00 0.00 3.24
5276 6533 1.613630 ACCGAGGAGTGGCAGGATT 60.614 57.895 0.00 0.00 0.00 3.01
5277 6534 1.144936 CCGAGGAGTGGCAGGATTC 59.855 63.158 0.00 0.00 0.00 2.52
5278 6535 1.333636 CCGAGGAGTGGCAGGATTCT 61.334 60.000 0.00 0.00 0.00 2.40
5279 6536 0.179089 CGAGGAGTGGCAGGATTCTG 60.179 60.000 0.00 0.00 43.64 3.02
5280 6537 0.908198 GAGGAGTGGCAGGATTCTGT 59.092 55.000 2.16 0.00 42.78 3.41
5281 6538 1.280421 GAGGAGTGGCAGGATTCTGTT 59.720 52.381 2.16 0.00 42.78 3.16
5282 6539 1.280421 AGGAGTGGCAGGATTCTGTTC 59.720 52.381 2.16 0.00 42.78 3.18
5283 6540 1.680249 GGAGTGGCAGGATTCTGTTCC 60.680 57.143 2.16 1.95 42.78 3.62
5284 6541 0.036010 AGTGGCAGGATTCTGTTCCG 60.036 55.000 2.16 0.00 42.78 4.30
5285 6542 1.026718 GTGGCAGGATTCTGTTCCGG 61.027 60.000 2.16 0.00 42.78 5.14
5286 6543 1.452108 GGCAGGATTCTGTTCCGGG 60.452 63.158 0.00 0.00 42.78 5.73
5287 6544 2.115291 GCAGGATTCTGTTCCGGGC 61.115 63.158 0.00 0.00 42.78 6.13
5288 6545 1.452108 CAGGATTCTGTTCCGGGCC 60.452 63.158 0.00 0.00 40.94 5.80
5289 6546 1.616628 AGGATTCTGTTCCGGGCCT 60.617 57.895 0.84 0.00 40.94 5.19
5290 6547 1.208165 AGGATTCTGTTCCGGGCCTT 61.208 55.000 0.84 0.00 40.94 4.35
5291 6548 0.748367 GGATTCTGTTCCGGGCCTTC 60.748 60.000 0.84 0.00 0.00 3.46
5292 6549 0.253327 GATTCTGTTCCGGGCCTTCT 59.747 55.000 0.84 0.00 0.00 2.85
5293 6550 0.253327 ATTCTGTTCCGGGCCTTCTC 59.747 55.000 0.84 0.00 0.00 2.87
5294 6551 0.836400 TTCTGTTCCGGGCCTTCTCT 60.836 55.000 0.84 0.00 0.00 3.10
5295 6552 1.078848 CTGTTCCGGGCCTTCTCTG 60.079 63.158 0.84 0.00 0.00 3.35
5296 6553 2.436824 GTTCCGGGCCTTCTCTGC 60.437 66.667 0.84 0.00 0.00 4.26
5297 6554 2.607750 TTCCGGGCCTTCTCTGCT 60.608 61.111 0.84 0.00 0.00 4.24
5298 6555 2.959484 TTCCGGGCCTTCTCTGCTG 61.959 63.158 0.84 0.00 0.00 4.41
5300 6557 4.093291 CGGGCCTTCTCTGCTGCT 62.093 66.667 0.84 0.00 0.00 4.24
5301 6558 2.438075 GGGCCTTCTCTGCTGCTG 60.438 66.667 0.84 0.00 0.00 4.41
5302 6559 2.350514 GGCCTTCTCTGCTGCTGT 59.649 61.111 0.00 0.00 0.00 4.40
5303 6560 2.039405 GGCCTTCTCTGCTGCTGTG 61.039 63.158 0.00 1.40 0.00 3.66
5304 6561 1.302351 GCCTTCTCTGCTGCTGTGT 60.302 57.895 0.00 0.00 0.00 3.72
5305 6562 1.575576 GCCTTCTCTGCTGCTGTGTG 61.576 60.000 0.00 0.28 0.00 3.82
5306 6563 1.575576 CCTTCTCTGCTGCTGTGTGC 61.576 60.000 0.00 0.00 43.25 4.57
5307 6564 0.603172 CTTCTCTGCTGCTGTGTGCT 60.603 55.000 0.00 0.00 43.37 4.40
5308 6565 0.602106 TTCTCTGCTGCTGTGTGCTC 60.602 55.000 0.00 0.00 43.37 4.26
5309 6566 1.004799 CTCTGCTGCTGTGTGCTCT 60.005 57.895 0.00 0.00 43.37 4.09
5310 6567 1.005275 TCTGCTGCTGTGTGCTCTC 60.005 57.895 0.00 0.00 43.37 3.20
5311 6568 1.004799 CTGCTGCTGTGTGCTCTCT 60.005 57.895 0.00 0.00 43.37 3.10
5312 6569 1.292571 CTGCTGCTGTGTGCTCTCTG 61.293 60.000 0.00 0.00 43.37 3.35
5313 6570 1.005275 GCTGCTGTGTGCTCTCTGA 60.005 57.895 0.00 0.00 43.37 3.27
5314 6571 1.290491 GCTGCTGTGTGCTCTCTGAC 61.290 60.000 0.00 0.00 43.37 3.51
5315 6572 0.317799 CTGCTGTGTGCTCTCTGACT 59.682 55.000 0.00 0.00 43.37 3.41
5316 6573 0.316522 TGCTGTGTGCTCTCTGACTC 59.683 55.000 0.00 0.00 43.37 3.36
5317 6574 0.389687 GCTGTGTGCTCTCTGACTCC 60.390 60.000 0.00 0.00 38.95 3.85
5318 6575 0.109365 CTGTGTGCTCTCTGACTCCG 60.109 60.000 0.00 0.00 0.00 4.63
5319 6576 0.537371 TGTGTGCTCTCTGACTCCGA 60.537 55.000 0.00 0.00 0.00 4.55
5320 6577 0.814457 GTGTGCTCTCTGACTCCGAT 59.186 55.000 0.00 0.00 0.00 4.18
5321 6578 0.813821 TGTGCTCTCTGACTCCGATG 59.186 55.000 0.00 0.00 0.00 3.84
5322 6579 0.814457 GTGCTCTCTGACTCCGATGT 59.186 55.000 0.00 0.00 0.00 3.06
5323 6580 1.203523 GTGCTCTCTGACTCCGATGTT 59.796 52.381 0.00 0.00 0.00 2.71
5324 6581 1.203287 TGCTCTCTGACTCCGATGTTG 59.797 52.381 0.00 0.00 0.00 3.33
5325 6582 1.474478 GCTCTCTGACTCCGATGTTGA 59.526 52.381 0.00 0.00 0.00 3.18
5326 6583 2.479389 GCTCTCTGACTCCGATGTTGAG 60.479 54.545 0.00 0.00 35.92 3.02
5327 6584 2.095461 TCTCTGACTCCGATGTTGAGG 58.905 52.381 0.00 0.00 34.06 3.86
5328 6585 2.095461 CTCTGACTCCGATGTTGAGGA 58.905 52.381 0.00 0.00 34.06 3.71
5333 6590 2.202866 TCCGATGTTGAGGAGGAGC 58.797 57.895 0.00 0.00 31.95 4.70
5334 6591 0.324738 TCCGATGTTGAGGAGGAGCT 60.325 55.000 0.00 0.00 31.95 4.09
5335 6592 0.179089 CCGATGTTGAGGAGGAGCTG 60.179 60.000 0.00 0.00 0.00 4.24
5336 6593 0.179089 CGATGTTGAGGAGGAGCTGG 60.179 60.000 0.00 0.00 0.00 4.85
5337 6594 0.908198 GATGTTGAGGAGGAGCTGGT 59.092 55.000 0.00 0.00 0.00 4.00
5338 6595 1.280421 GATGTTGAGGAGGAGCTGGTT 59.720 52.381 0.00 0.00 0.00 3.67
5339 6596 0.397941 TGTTGAGGAGGAGCTGGTTG 59.602 55.000 0.00 0.00 0.00 3.77
5340 6597 0.687354 GTTGAGGAGGAGCTGGTTGA 59.313 55.000 0.00 0.00 0.00 3.18
5341 6598 0.979665 TTGAGGAGGAGCTGGTTGAG 59.020 55.000 0.00 0.00 0.00 3.02
5342 6599 0.906756 TGAGGAGGAGCTGGTTGAGG 60.907 60.000 0.00 0.00 0.00 3.86
5343 6600 2.250741 GAGGAGGAGCTGGTTGAGGC 62.251 65.000 0.00 0.00 0.00 4.70
5344 6601 2.297129 GGAGGAGCTGGTTGAGGCT 61.297 63.158 0.00 0.00 41.88 4.58
5345 6602 0.978146 GGAGGAGCTGGTTGAGGCTA 60.978 60.000 0.00 0.00 39.05 3.93
5346 6603 1.127343 GAGGAGCTGGTTGAGGCTAT 58.873 55.000 0.00 0.00 39.05 2.97
5347 6604 1.069978 GAGGAGCTGGTTGAGGCTATC 59.930 57.143 0.00 0.00 39.05 2.08
5348 6605 0.249657 GGAGCTGGTTGAGGCTATCG 60.250 60.000 0.00 0.00 39.05 2.92
5349 6606 0.249657 GAGCTGGTTGAGGCTATCGG 60.250 60.000 0.00 0.00 39.05 4.18
5350 6607 1.889573 GCTGGTTGAGGCTATCGGC 60.890 63.158 0.00 0.00 40.90 5.54
5351 6608 1.592669 CTGGTTGAGGCTATCGGCG 60.593 63.158 0.00 0.00 42.94 6.46
5352 6609 2.967615 GGTTGAGGCTATCGGCGC 60.968 66.667 0.00 0.00 42.94 6.53
5363 6620 4.331622 TCGGCGCCGAGGATATAT 57.668 55.556 45.37 0.00 44.01 0.86
5364 6621 1.807226 TCGGCGCCGAGGATATATG 59.193 57.895 45.37 16.10 44.01 1.78
5365 6622 1.226974 CGGCGCCGAGGATATATGG 60.227 63.158 44.86 9.41 42.83 2.74
5366 6623 1.144057 GGCGCCGAGGATATATGGG 59.856 63.158 12.58 0.00 0.00 4.00
5367 6624 1.144057 GCGCCGAGGATATATGGGG 59.856 63.158 0.00 0.00 37.48 4.96
5368 6625 1.823295 CGCCGAGGATATATGGGGG 59.177 63.158 0.00 0.00 0.00 5.40
5369 6626 0.686441 CGCCGAGGATATATGGGGGA 60.686 60.000 0.00 0.00 32.94 4.81
5370 6627 1.123928 GCCGAGGATATATGGGGGAG 58.876 60.000 0.00 0.00 0.00 4.30
5371 6628 1.343075 GCCGAGGATATATGGGGGAGA 60.343 57.143 0.00 0.00 0.00 3.71
5372 6629 2.389715 CCGAGGATATATGGGGGAGAC 58.610 57.143 0.00 0.00 0.00 3.36
5386 6643 2.044123 GGAGACCATGCTTACCAAGG 57.956 55.000 0.00 0.00 38.28 3.61
5388 6645 2.504175 GGAGACCATGCTTACCAAGGTA 59.496 50.000 0.00 0.00 45.07 3.08
5389 6646 3.054655 GGAGACCATGCTTACCAAGGTAA 60.055 47.826 11.00 11.00 45.07 2.85
5390 6647 4.385310 GGAGACCATGCTTACCAAGGTAAT 60.385 45.833 11.82 0.00 45.07 1.89
5391 6648 4.526970 AGACCATGCTTACCAAGGTAATG 58.473 43.478 11.82 7.87 45.07 1.90
5392 6649 4.227300 AGACCATGCTTACCAAGGTAATGA 59.773 41.667 11.82 2.95 45.07 2.57
5393 6650 4.526970 ACCATGCTTACCAAGGTAATGAG 58.473 43.478 11.82 2.56 43.37 2.90
5394 6651 4.018415 ACCATGCTTACCAAGGTAATGAGT 60.018 41.667 11.82 6.00 43.37 3.41
5395 6652 4.576463 CCATGCTTACCAAGGTAATGAGTC 59.424 45.833 11.82 1.70 39.49 3.36
5396 6653 5.431765 CATGCTTACCAAGGTAATGAGTCT 58.568 41.667 11.82 0.00 39.49 3.24
5397 6654 5.086104 TGCTTACCAAGGTAATGAGTCTC 57.914 43.478 11.82 0.00 39.49 3.36
5398 6655 4.777896 TGCTTACCAAGGTAATGAGTCTCT 59.222 41.667 11.82 0.00 39.49 3.10
5399 6656 5.248477 TGCTTACCAAGGTAATGAGTCTCTT 59.752 40.000 11.82 0.00 39.49 2.85
5400 6657 5.582665 GCTTACCAAGGTAATGAGTCTCTTG 59.417 44.000 11.82 0.00 39.49 3.02
5401 6658 3.944087 ACCAAGGTAATGAGTCTCTTGC 58.056 45.455 0.65 0.00 35.00 4.01
5402 6659 2.932614 CCAAGGTAATGAGTCTCTTGCG 59.067 50.000 0.65 0.00 35.00 4.85
5403 6660 2.932614 CAAGGTAATGAGTCTCTTGCGG 59.067 50.000 0.65 0.00 0.00 5.69
5404 6661 2.457598 AGGTAATGAGTCTCTTGCGGA 58.542 47.619 0.65 0.00 0.00 5.54
5405 6662 2.832129 AGGTAATGAGTCTCTTGCGGAA 59.168 45.455 0.65 0.00 0.00 4.30
5406 6663 3.452627 AGGTAATGAGTCTCTTGCGGAAT 59.547 43.478 0.65 0.00 0.00 3.01
5407 6664 3.804873 GGTAATGAGTCTCTTGCGGAATC 59.195 47.826 0.65 0.00 0.00 2.52
5408 6665 3.902881 AATGAGTCTCTTGCGGAATCT 57.097 42.857 0.65 0.00 0.00 2.40
5409 6666 3.902881 ATGAGTCTCTTGCGGAATCTT 57.097 42.857 0.65 0.00 0.00 2.40
5410 6667 3.685139 TGAGTCTCTTGCGGAATCTTT 57.315 42.857 0.65 0.00 0.00 2.52
5411 6668 3.329386 TGAGTCTCTTGCGGAATCTTTG 58.671 45.455 0.65 0.00 0.00 2.77
5412 6669 3.006859 TGAGTCTCTTGCGGAATCTTTGA 59.993 43.478 0.65 0.00 0.00 2.69
5413 6670 3.330267 AGTCTCTTGCGGAATCTTTGAC 58.670 45.455 0.00 0.00 0.00 3.18
5414 6671 3.067106 GTCTCTTGCGGAATCTTTGACA 58.933 45.455 0.00 0.00 0.00 3.58
5415 6672 3.686726 GTCTCTTGCGGAATCTTTGACAT 59.313 43.478 0.00 0.00 0.00 3.06
5416 6673 4.870426 GTCTCTTGCGGAATCTTTGACATA 59.130 41.667 0.00 0.00 0.00 2.29
5417 6674 5.351465 GTCTCTTGCGGAATCTTTGACATAA 59.649 40.000 0.00 0.00 0.00 1.90
5418 6675 5.937540 TCTCTTGCGGAATCTTTGACATAAA 59.062 36.000 0.00 0.00 0.00 1.40
5419 6676 5.938322 TCTTGCGGAATCTTTGACATAAAC 58.062 37.500 0.00 0.00 0.00 2.01
5420 6677 5.705441 TCTTGCGGAATCTTTGACATAAACT 59.295 36.000 0.00 0.00 0.00 2.66
5421 6678 5.295431 TGCGGAATCTTTGACATAAACTG 57.705 39.130 0.00 0.00 0.00 3.16
5422 6679 5.000591 TGCGGAATCTTTGACATAAACTGA 58.999 37.500 0.00 0.00 0.00 3.41
5423 6680 5.647658 TGCGGAATCTTTGACATAAACTGAT 59.352 36.000 0.00 0.00 0.00 2.90
5424 6681 6.150976 TGCGGAATCTTTGACATAAACTGATT 59.849 34.615 0.00 0.00 0.00 2.57
5425 6682 6.470235 GCGGAATCTTTGACATAAACTGATTG 59.530 38.462 0.00 0.00 0.00 2.67
5426 6683 6.968904 CGGAATCTTTGACATAAACTGATTGG 59.031 38.462 0.00 0.00 0.00 3.16
5427 6684 7.362056 CGGAATCTTTGACATAAACTGATTGGT 60.362 37.037 0.00 0.00 0.00 3.67
5428 6685 8.306761 GGAATCTTTGACATAAACTGATTGGTT 58.693 33.333 0.00 0.00 0.00 3.67
5429 6686 9.132521 GAATCTTTGACATAAACTGATTGGTTG 57.867 33.333 0.00 0.00 0.00 3.77
5430 6687 7.581213 TCTTTGACATAAACTGATTGGTTGT 57.419 32.000 0.00 0.00 0.00 3.32
5431 6688 8.006298 TCTTTGACATAAACTGATTGGTTGTT 57.994 30.769 0.00 0.00 0.00 2.83
5432 6689 7.920151 TCTTTGACATAAACTGATTGGTTGTTG 59.080 33.333 0.00 0.00 0.00 3.33
5433 6690 6.083098 TGACATAAACTGATTGGTTGTTGG 57.917 37.500 0.00 0.00 0.00 3.77
5434 6691 5.010516 TGACATAAACTGATTGGTTGTTGGG 59.989 40.000 0.00 0.00 0.00 4.12
5435 6692 4.898861 ACATAAACTGATTGGTTGTTGGGT 59.101 37.500 0.00 0.00 0.00 4.51
5436 6693 3.817709 AAACTGATTGGTTGTTGGGTG 57.182 42.857 0.00 0.00 0.00 4.61
5437 6694 2.452600 ACTGATTGGTTGTTGGGTGT 57.547 45.000 0.00 0.00 0.00 4.16
5438 6695 3.586470 ACTGATTGGTTGTTGGGTGTA 57.414 42.857 0.00 0.00 0.00 2.90
5439 6696 3.486383 ACTGATTGGTTGTTGGGTGTAG 58.514 45.455 0.00 0.00 0.00 2.74
5440 6697 3.137544 ACTGATTGGTTGTTGGGTGTAGA 59.862 43.478 0.00 0.00 0.00 2.59
5441 6698 4.141287 CTGATTGGTTGTTGGGTGTAGAA 58.859 43.478 0.00 0.00 0.00 2.10
5442 6699 4.537751 TGATTGGTTGTTGGGTGTAGAAA 58.462 39.130 0.00 0.00 0.00 2.52
5443 6700 4.956700 TGATTGGTTGTTGGGTGTAGAAAA 59.043 37.500 0.00 0.00 0.00 2.29
5444 6701 4.993029 TTGGTTGTTGGGTGTAGAAAAG 57.007 40.909 0.00 0.00 0.00 2.27
5445 6702 3.292460 TGGTTGTTGGGTGTAGAAAAGG 58.708 45.455 0.00 0.00 0.00 3.11
5446 6703 2.626266 GGTTGTTGGGTGTAGAAAAGGG 59.374 50.000 0.00 0.00 0.00 3.95
5447 6704 3.558033 GTTGTTGGGTGTAGAAAAGGGA 58.442 45.455 0.00 0.00 0.00 4.20
5448 6705 3.955524 TGTTGGGTGTAGAAAAGGGAA 57.044 42.857 0.00 0.00 0.00 3.97
5449 6706 3.558033 TGTTGGGTGTAGAAAAGGGAAC 58.442 45.455 0.00 0.00 0.00 3.62
5450 6707 3.053544 TGTTGGGTGTAGAAAAGGGAACA 60.054 43.478 0.00 0.00 0.00 3.18
5451 6708 3.217681 TGGGTGTAGAAAAGGGAACAC 57.782 47.619 0.00 0.00 41.14 3.32
5476 6733 5.751243 TTTTTGAGAGCTACACACCTTTC 57.249 39.130 0.00 0.00 0.00 2.62
5477 6734 4.689612 TTTGAGAGCTACACACCTTTCT 57.310 40.909 0.00 0.00 0.00 2.52
5478 6735 4.689612 TTGAGAGCTACACACCTTTCTT 57.310 40.909 0.00 0.00 0.00 2.52
5479 6736 4.689612 TGAGAGCTACACACCTTTCTTT 57.310 40.909 0.00 0.00 0.00 2.52
5480 6737 5.036117 TGAGAGCTACACACCTTTCTTTT 57.964 39.130 0.00 0.00 0.00 2.27
5481 6738 4.816385 TGAGAGCTACACACCTTTCTTTTG 59.184 41.667 0.00 0.00 0.00 2.44
5482 6739 5.036117 AGAGCTACACACCTTTCTTTTGA 57.964 39.130 0.00 0.00 0.00 2.69
5483 6740 5.437060 AGAGCTACACACCTTTCTTTTGAA 58.563 37.500 0.00 0.00 36.52 2.69
5484 6741 6.064717 AGAGCTACACACCTTTCTTTTGAAT 58.935 36.000 0.00 0.00 38.37 2.57
5485 6742 6.547510 AGAGCTACACACCTTTCTTTTGAATT 59.452 34.615 0.00 0.00 38.37 2.17
5486 6743 6.739112 AGCTACACACCTTTCTTTTGAATTC 58.261 36.000 0.00 0.00 38.37 2.17
5487 6744 6.321181 AGCTACACACCTTTCTTTTGAATTCA 59.679 34.615 3.38 3.38 38.37 2.57
5488 6745 6.978080 GCTACACACCTTTCTTTTGAATTCAA 59.022 34.615 16.91 16.91 38.37 2.69
5489 6746 7.168135 GCTACACACCTTTCTTTTGAATTCAAG 59.832 37.037 19.64 10.51 38.37 3.02
5490 6747 7.169158 ACACACCTTTCTTTTGAATTCAAGA 57.831 32.000 19.64 15.08 38.37 3.02
5491 6748 7.785033 ACACACCTTTCTTTTGAATTCAAGAT 58.215 30.769 19.64 0.00 38.37 2.40
5492 6749 8.260114 ACACACCTTTCTTTTGAATTCAAGATT 58.740 29.630 19.64 0.00 38.37 2.40
5493 6750 9.101655 CACACCTTTCTTTTGAATTCAAGATTT 57.898 29.630 19.64 0.00 38.37 2.17
5520 6777 9.965824 ATTCTTTACAGTTTTGTACCAAGAATG 57.034 29.630 17.81 0.00 45.09 2.67
5521 6778 8.740123 TCTTTACAGTTTTGTACCAAGAATGA 57.260 30.769 2.60 0.00 39.44 2.57
5522 6779 9.179909 TCTTTACAGTTTTGTACCAAGAATGAA 57.820 29.630 2.60 0.00 39.44 2.57
5523 6780 9.450807 CTTTACAGTTTTGTACCAAGAATGAAG 57.549 33.333 2.60 0.00 39.44 3.02
5524 6781 8.514330 TTACAGTTTTGTACCAAGAATGAAGT 57.486 30.769 2.60 0.00 39.44 3.01
5525 6782 7.404671 ACAGTTTTGTACCAAGAATGAAGTT 57.595 32.000 2.60 0.00 35.25 2.66
5526 6783 8.514330 ACAGTTTTGTACCAAGAATGAAGTTA 57.486 30.769 2.60 0.00 35.25 2.24
5527 6784 8.403236 ACAGTTTTGTACCAAGAATGAAGTTAC 58.597 33.333 2.60 0.00 35.25 2.50
5528 6785 8.621286 CAGTTTTGTACCAAGAATGAAGTTACT 58.379 33.333 0.00 0.00 0.00 2.24
5529 6786 8.621286 AGTTTTGTACCAAGAATGAAGTTACTG 58.379 33.333 0.00 0.00 0.00 2.74
5530 6787 8.403236 GTTTTGTACCAAGAATGAAGTTACTGT 58.597 33.333 0.00 0.00 0.00 3.55
5531 6788 8.514330 TTTGTACCAAGAATGAAGTTACTGTT 57.486 30.769 0.00 0.00 0.00 3.16
5532 6789 7.724305 TGTACCAAGAATGAAGTTACTGTTC 57.276 36.000 0.00 0.00 0.00 3.18
5533 6790 7.506114 TGTACCAAGAATGAAGTTACTGTTCT 58.494 34.615 0.00 3.23 0.00 3.01
5534 6791 7.656137 TGTACCAAGAATGAAGTTACTGTTCTC 59.344 37.037 7.88 0.00 0.00 2.87
5535 6792 5.998363 ACCAAGAATGAAGTTACTGTTCTCC 59.002 40.000 7.88 0.00 0.00 3.71
5536 6793 5.120830 CCAAGAATGAAGTTACTGTTCTCCG 59.879 44.000 7.88 4.35 0.00 4.63
5537 6794 5.723672 AGAATGAAGTTACTGTTCTCCGA 57.276 39.130 3.23 0.00 0.00 4.55
5538 6795 6.097915 AGAATGAAGTTACTGTTCTCCGAA 57.902 37.500 3.23 0.00 0.00 4.30
5539 6796 6.159988 AGAATGAAGTTACTGTTCTCCGAAG 58.840 40.000 3.23 0.00 0.00 3.79
5540 6797 5.723672 ATGAAGTTACTGTTCTCCGAAGA 57.276 39.130 0.00 0.00 0.00 2.87
5541 6798 4.868067 TGAAGTTACTGTTCTCCGAAGAC 58.132 43.478 0.00 0.00 0.00 3.01
5542 6799 4.340097 TGAAGTTACTGTTCTCCGAAGACA 59.660 41.667 0.00 0.00 0.00 3.41
5543 6800 4.506886 AGTTACTGTTCTCCGAAGACAG 57.493 45.455 8.54 8.54 37.02 3.51
5544 6801 3.890147 AGTTACTGTTCTCCGAAGACAGT 59.110 43.478 16.41 16.41 41.97 3.55
5545 6802 4.341520 AGTTACTGTTCTCCGAAGACAGTT 59.658 41.667 17.06 2.80 40.80 3.16
5546 6803 5.533903 AGTTACTGTTCTCCGAAGACAGTTA 59.466 40.000 17.06 9.10 40.80 2.24
5547 6804 4.240175 ACTGTTCTCCGAAGACAGTTAC 57.760 45.455 9.55 0.00 39.09 2.50
5548 6805 3.005578 ACTGTTCTCCGAAGACAGTTACC 59.994 47.826 9.55 0.00 39.09 2.85
5549 6806 2.030540 TGTTCTCCGAAGACAGTTACCG 60.031 50.000 0.00 0.00 0.00 4.02
5550 6807 0.524862 TCTCCGAAGACAGTTACCGC 59.475 55.000 0.00 0.00 0.00 5.68
5551 6808 0.242825 CTCCGAAGACAGTTACCGCA 59.757 55.000 0.00 0.00 0.00 5.69
5552 6809 0.892755 TCCGAAGACAGTTACCGCAT 59.107 50.000 0.00 0.00 0.00 4.73
5553 6810 2.093890 TCCGAAGACAGTTACCGCATA 58.906 47.619 0.00 0.00 0.00 3.14
5554 6811 2.098607 TCCGAAGACAGTTACCGCATAG 59.901 50.000 0.00 0.00 0.00 2.23
5555 6812 1.852895 CGAAGACAGTTACCGCATAGC 59.147 52.381 0.00 0.00 0.00 2.97
5556 6813 2.479730 CGAAGACAGTTACCGCATAGCT 60.480 50.000 0.00 0.00 0.00 3.32
5557 6814 2.586258 AGACAGTTACCGCATAGCTG 57.414 50.000 0.00 7.14 45.21 4.24
5562 6819 4.244425 CAGTTACCGCATAGCTGTATCT 57.756 45.455 0.00 0.00 37.35 1.98
5563 6820 3.983988 CAGTTACCGCATAGCTGTATCTG 59.016 47.826 13.39 13.39 38.57 2.90
5564 6821 3.889538 AGTTACCGCATAGCTGTATCTGA 59.110 43.478 0.00 0.00 30.96 3.27
5565 6822 2.802787 ACCGCATAGCTGTATCTGAC 57.197 50.000 0.00 0.00 0.00 3.51
5566 6823 1.001268 ACCGCATAGCTGTATCTGACG 60.001 52.381 0.00 0.00 0.00 4.35
5567 6824 1.266989 CCGCATAGCTGTATCTGACGA 59.733 52.381 0.00 0.00 0.00 4.20
5568 6825 2.579541 CGCATAGCTGTATCTGACGAG 58.420 52.381 0.00 0.00 0.00 4.18
5569 6826 2.224314 CGCATAGCTGTATCTGACGAGA 59.776 50.000 0.00 0.00 0.00 4.04
5570 6827 3.120025 CGCATAGCTGTATCTGACGAGAT 60.120 47.826 0.00 0.00 42.03 2.75
5571 6828 4.165036 GCATAGCTGTATCTGACGAGATG 58.835 47.826 0.00 0.00 39.44 2.90
5572 6829 4.083057 GCATAGCTGTATCTGACGAGATGA 60.083 45.833 0.00 0.00 39.44 2.92
5573 6830 5.563671 GCATAGCTGTATCTGACGAGATGAA 60.564 44.000 0.00 0.00 39.44 2.57
5574 6831 4.300189 AGCTGTATCTGACGAGATGAAC 57.700 45.455 0.00 0.00 39.44 3.18
5575 6832 3.067461 AGCTGTATCTGACGAGATGAACC 59.933 47.826 0.00 0.00 39.44 3.62
5576 6833 3.181486 GCTGTATCTGACGAGATGAACCA 60.181 47.826 0.00 0.00 39.44 3.67
5577 6834 4.678044 GCTGTATCTGACGAGATGAACCAA 60.678 45.833 0.00 0.00 39.44 3.67
5578 6835 5.595885 CTGTATCTGACGAGATGAACCAAT 58.404 41.667 0.00 0.00 39.44 3.16
5579 6836 5.977635 TGTATCTGACGAGATGAACCAATT 58.022 37.500 0.00 0.00 39.44 2.32
5580 6837 6.406370 TGTATCTGACGAGATGAACCAATTT 58.594 36.000 0.00 0.00 39.44 1.82
5581 6838 6.535150 TGTATCTGACGAGATGAACCAATTTC 59.465 38.462 0.00 0.00 39.44 2.17
5592 6849 3.505680 TGAACCAATTTCATCTGGGAACG 59.494 43.478 0.00 0.00 39.45 3.95
5593 6850 3.433306 ACCAATTTCATCTGGGAACGA 57.567 42.857 0.00 0.00 37.00 3.85
5594 6851 3.968265 ACCAATTTCATCTGGGAACGAT 58.032 40.909 0.00 0.00 37.00 3.73
5595 6852 3.696051 ACCAATTTCATCTGGGAACGATG 59.304 43.478 0.00 0.00 40.40 3.84
5596 6853 3.696051 CCAATTTCATCTGGGAACGATGT 59.304 43.478 0.00 0.00 40.15 3.06
5597 6854 4.201950 CCAATTTCATCTGGGAACGATGTC 60.202 45.833 0.00 0.00 40.15 3.06
5598 6855 3.694043 TTTCATCTGGGAACGATGTCA 57.306 42.857 0.00 0.00 40.15 3.58
5599 6856 3.912496 TTCATCTGGGAACGATGTCAT 57.088 42.857 0.00 0.00 40.15 3.06
5600 6857 3.183793 TCATCTGGGAACGATGTCATG 57.816 47.619 0.00 0.00 40.15 3.07
5601 6858 2.765699 TCATCTGGGAACGATGTCATGA 59.234 45.455 0.00 0.00 40.15 3.07
5602 6859 3.197549 TCATCTGGGAACGATGTCATGAA 59.802 43.478 0.00 0.00 40.15 2.57
5603 6860 2.972625 TCTGGGAACGATGTCATGAAC 58.027 47.619 0.00 0.00 0.00 3.18
5604 6861 2.567169 TCTGGGAACGATGTCATGAACT 59.433 45.455 0.00 0.00 0.00 3.01
5605 6862 2.674852 CTGGGAACGATGTCATGAACTG 59.325 50.000 0.00 0.00 0.00 3.16
5606 6863 2.038426 TGGGAACGATGTCATGAACTGT 59.962 45.455 0.00 0.00 0.00 3.55
5607 6864 2.673368 GGGAACGATGTCATGAACTGTC 59.327 50.000 0.00 0.00 0.00 3.51
5608 6865 3.589988 GGAACGATGTCATGAACTGTCT 58.410 45.455 0.00 0.00 0.00 3.41
5609 6866 3.369147 GGAACGATGTCATGAACTGTCTG 59.631 47.826 0.00 0.00 0.00 3.51
5610 6867 2.341257 ACGATGTCATGAACTGTCTGC 58.659 47.619 0.00 0.00 0.00 4.26
5611 6868 2.289010 ACGATGTCATGAACTGTCTGCA 60.289 45.455 0.00 0.00 0.00 4.41
5613 6870 2.174363 TGTCATGAACTGTCTGCAGG 57.826 50.000 15.13 0.00 46.62 4.85
5615 6872 2.158769 TGTCATGAACTGTCTGCAGGTT 60.159 45.455 15.13 10.30 43.85 3.50
5616 6873 2.225019 GTCATGAACTGTCTGCAGGTTG 59.775 50.000 15.13 6.55 43.85 3.77
5617 6874 2.158769 TCATGAACTGTCTGCAGGTTGT 60.159 45.455 15.13 7.21 43.85 3.32
5618 6875 1.667236 TGAACTGTCTGCAGGTTGTG 58.333 50.000 15.13 2.90 43.85 3.33
5637 6894 4.465413 GCAGCAAGGCGTTTGATC 57.535 55.556 6.06 0.00 39.21 2.92
5638 6895 1.512734 GCAGCAAGGCGTTTGATCG 60.513 57.895 6.06 0.00 39.21 3.69
5639 6896 1.135315 CAGCAAGGCGTTTGATCGG 59.865 57.895 6.06 0.00 39.21 4.18
5640 6897 2.040544 AGCAAGGCGTTTGATCGGG 61.041 57.895 6.06 0.00 39.21 5.14
5641 6898 2.038269 GCAAGGCGTTTGATCGGGA 61.038 57.895 6.06 0.00 39.21 5.14
5642 6899 1.376609 GCAAGGCGTTTGATCGGGAT 61.377 55.000 6.06 0.00 39.21 3.85
5643 6900 1.094785 CAAGGCGTTTGATCGGGATT 58.905 50.000 0.00 0.00 39.21 3.01
5644 6901 1.094785 AAGGCGTTTGATCGGGATTG 58.905 50.000 0.00 0.00 0.00 2.67
5645 6902 1.064134 GGCGTTTGATCGGGATTGC 59.936 57.895 0.00 0.00 0.00 3.56
5646 6903 1.297598 GCGTTTGATCGGGATTGCG 60.298 57.895 0.00 0.00 0.00 4.85
5647 6904 1.297598 CGTTTGATCGGGATTGCGC 60.298 57.895 0.00 0.00 0.00 6.09
5648 6905 1.064134 GTTTGATCGGGATTGCGCC 59.936 57.895 4.18 0.00 0.00 6.53
5649 6906 1.377856 TTTGATCGGGATTGCGCCA 60.378 52.632 4.18 0.00 0.00 5.69
5650 6907 0.751277 TTTGATCGGGATTGCGCCAT 60.751 50.000 4.18 0.00 0.00 4.40
5651 6908 0.751277 TTGATCGGGATTGCGCCATT 60.751 50.000 4.18 0.00 0.00 3.16
5652 6909 1.283793 GATCGGGATTGCGCCATTG 59.716 57.895 4.18 0.00 0.00 2.82
5653 6910 1.152984 ATCGGGATTGCGCCATTGA 60.153 52.632 4.18 0.00 0.00 2.57
5654 6911 0.538057 ATCGGGATTGCGCCATTGAT 60.538 50.000 4.18 1.97 0.00 2.57
5655 6912 1.008194 CGGGATTGCGCCATTGATG 60.008 57.895 4.18 0.00 0.00 3.07
5666 6923 1.325355 CCATTGATGGTGGAGGATGC 58.675 55.000 1.73 0.00 43.05 3.91
5667 6924 0.949397 CATTGATGGTGGAGGATGCG 59.051 55.000 0.00 0.00 0.00 4.73
5668 6925 0.820891 ATTGATGGTGGAGGATGCGC 60.821 55.000 0.00 0.00 35.60 6.09
5669 6926 1.913951 TTGATGGTGGAGGATGCGCT 61.914 55.000 9.73 0.00 37.02 5.92
5670 6927 1.890979 GATGGTGGAGGATGCGCTG 60.891 63.158 9.73 0.00 37.02 5.18
5671 6928 3.411114 ATGGTGGAGGATGCGCTGG 62.411 63.158 9.73 0.00 37.02 4.85
5672 6929 3.785859 GGTGGAGGATGCGCTGGA 61.786 66.667 9.73 0.00 37.02 3.86
5673 6930 2.202987 GTGGAGGATGCGCTGGAG 60.203 66.667 9.73 0.00 32.59 3.86
5674 6931 4.166888 TGGAGGATGCGCTGGAGC 62.167 66.667 9.73 0.00 37.78 4.70
5685 6942 2.583520 CTGGAGCAGCTGGAGGAC 59.416 66.667 17.12 0.00 0.00 3.85
5686 6943 3.368190 CTGGAGCAGCTGGAGGACG 62.368 68.421 17.12 0.00 0.00 4.79
5687 6944 3.386237 GGAGCAGCTGGAGGACGT 61.386 66.667 17.12 0.00 0.00 4.34
5688 6945 2.659610 GAGCAGCTGGAGGACGTT 59.340 61.111 17.12 0.00 0.00 3.99
5689 6946 1.739562 GAGCAGCTGGAGGACGTTG 60.740 63.158 17.12 0.00 0.00 4.10
5690 6947 2.159819 GAGCAGCTGGAGGACGTTGA 62.160 60.000 17.12 0.00 0.00 3.18
5691 6948 1.078848 GCAGCTGGAGGACGTTGAT 60.079 57.895 17.12 0.00 0.00 2.57
5692 6949 1.086634 GCAGCTGGAGGACGTTGATC 61.087 60.000 17.12 0.00 0.00 2.92
5693 6950 0.247460 CAGCTGGAGGACGTTGATCA 59.753 55.000 5.57 0.00 0.00 2.92
5694 6951 1.134580 CAGCTGGAGGACGTTGATCAT 60.135 52.381 5.57 0.00 0.00 2.45
5695 6952 1.134580 AGCTGGAGGACGTTGATCATG 60.135 52.381 0.00 0.00 0.00 3.07
5696 6953 1.134699 GCTGGAGGACGTTGATCATGA 60.135 52.381 0.00 0.00 0.00 3.07
5697 6954 2.544685 CTGGAGGACGTTGATCATGAC 58.455 52.381 0.00 0.00 0.00 3.06
5698 6955 2.167281 CTGGAGGACGTTGATCATGACT 59.833 50.000 0.00 0.00 0.00 3.41
5699 6956 2.567169 TGGAGGACGTTGATCATGACTT 59.433 45.455 0.00 0.00 0.00 3.01
5700 6957 2.932614 GGAGGACGTTGATCATGACTTG 59.067 50.000 0.00 0.00 0.00 3.16
5701 6958 2.932614 GAGGACGTTGATCATGACTTGG 59.067 50.000 0.00 0.00 0.00 3.61
5702 6959 2.303022 AGGACGTTGATCATGACTTGGT 59.697 45.455 0.00 0.00 0.00 3.67
5703 6960 2.416547 GGACGTTGATCATGACTTGGTG 59.583 50.000 0.00 0.00 0.00 4.17
5704 6961 1.806542 ACGTTGATCATGACTTGGTGC 59.193 47.619 0.00 0.00 0.00 5.01
5705 6962 1.805943 CGTTGATCATGACTTGGTGCA 59.194 47.619 0.00 0.00 0.00 4.57
5706 6963 2.421073 CGTTGATCATGACTTGGTGCAT 59.579 45.455 0.00 0.00 0.00 3.96
5707 6964 3.729762 CGTTGATCATGACTTGGTGCATG 60.730 47.826 0.00 0.00 42.41 4.06
5708 6965 1.746787 TGATCATGACTTGGTGCATGC 59.253 47.619 11.82 11.82 41.18 4.06
5709 6966 0.736636 ATCATGACTTGGTGCATGCG 59.263 50.000 14.09 0.00 41.18 4.73
5710 6967 1.515519 CATGACTTGGTGCATGCGC 60.516 57.895 23.05 23.05 35.93 6.09
5711 6968 2.703798 ATGACTTGGTGCATGCGCC 61.704 57.895 37.81 37.81 46.15 6.53
5712 6969 4.120331 GACTTGGTGCATGCGCCC 62.120 66.667 39.85 28.58 45.42 6.13
5715 6972 3.993614 CTTGGTGCATGCGCCCCTA 62.994 63.158 39.85 26.22 45.42 3.53
5716 6973 4.794648 TGGTGCATGCGCCCCTAC 62.795 66.667 39.85 19.80 45.42 3.18
5717 6974 4.489771 GGTGCATGCGCCCCTACT 62.490 66.667 35.47 0.00 40.51 2.57
5718 6975 2.438434 GTGCATGCGCCCCTACTT 60.438 61.111 20.70 0.00 37.32 2.24
5719 6976 2.438254 TGCATGCGCCCCTACTTG 60.438 61.111 14.09 0.00 37.32 3.16
5720 6977 2.124736 GCATGCGCCCCTACTTGA 60.125 61.111 4.18 0.00 0.00 3.02
5721 6978 2.182842 GCATGCGCCCCTACTTGAG 61.183 63.158 4.18 0.00 0.00 3.02
5722 6979 1.522092 CATGCGCCCCTACTTGAGA 59.478 57.895 4.18 0.00 0.00 3.27
5723 6980 0.531532 CATGCGCCCCTACTTGAGAG 60.532 60.000 4.18 0.00 0.00 3.20
5724 6981 1.690219 ATGCGCCCCTACTTGAGAGG 61.690 60.000 4.18 0.00 0.00 3.69
5725 6982 2.058595 GCGCCCCTACTTGAGAGGA 61.059 63.158 0.00 0.00 35.99 3.71
5726 6983 1.614241 GCGCCCCTACTTGAGAGGAA 61.614 60.000 0.00 0.00 35.99 3.36
5727 6984 1.123928 CGCCCCTACTTGAGAGGAAT 58.876 55.000 0.00 0.00 35.99 3.01
5728 6985 1.202580 CGCCCCTACTTGAGAGGAATG 60.203 57.143 0.00 0.00 35.99 2.67
5729 6986 2.119495 GCCCCTACTTGAGAGGAATGA 58.881 52.381 0.00 0.00 35.99 2.57
5730 6987 2.103941 GCCCCTACTTGAGAGGAATGAG 59.896 54.545 0.00 0.00 35.99 2.90
5731 6988 2.103941 CCCCTACTTGAGAGGAATGAGC 59.896 54.545 0.00 0.00 35.99 4.26
5732 6989 2.223923 CCCTACTTGAGAGGAATGAGCG 60.224 54.545 0.00 0.00 35.99 5.03
5733 6990 2.223923 CCTACTTGAGAGGAATGAGCGG 60.224 54.545 0.00 0.00 35.99 5.52
5734 6991 0.107945 ACTTGAGAGGAATGAGCGGC 60.108 55.000 0.00 0.00 0.00 6.53
5735 6992 0.177604 CTTGAGAGGAATGAGCGGCT 59.822 55.000 0.00 0.00 0.00 5.52
5736 6993 1.410517 CTTGAGAGGAATGAGCGGCTA 59.589 52.381 0.60 0.00 0.00 3.93
5737 6994 0.747255 TGAGAGGAATGAGCGGCTAC 59.253 55.000 0.60 0.00 0.00 3.58
5738 6995 0.747255 GAGAGGAATGAGCGGCTACA 59.253 55.000 0.60 3.37 0.00 2.74
5739 6996 0.461961 AGAGGAATGAGCGGCTACAC 59.538 55.000 0.60 0.00 0.00 2.90
5740 6997 0.530870 GAGGAATGAGCGGCTACACC 60.531 60.000 0.60 4.70 0.00 4.16
5751 7008 2.821991 GGCTACACCGATAAGCTGAT 57.178 50.000 0.00 0.00 36.48 2.90
5752 7009 2.678324 GGCTACACCGATAAGCTGATC 58.322 52.381 0.21 0.21 36.48 2.92
5753 7010 2.297597 GGCTACACCGATAAGCTGATCT 59.702 50.000 9.49 0.00 36.48 2.75
5754 7011 3.312828 GCTACACCGATAAGCTGATCTG 58.687 50.000 9.49 5.23 33.40 2.90
5755 7012 2.231215 ACACCGATAAGCTGATCTGC 57.769 50.000 16.18 16.18 0.00 4.26
5756 7013 1.135046 CACCGATAAGCTGATCTGCG 58.865 55.000 17.62 6.21 38.13 5.18
5757 7014 0.747255 ACCGATAAGCTGATCTGCGT 59.253 50.000 17.62 16.97 38.13 5.24
5758 7015 1.137086 ACCGATAAGCTGATCTGCGTT 59.863 47.619 17.21 14.02 38.13 4.84
5759 7016 2.205074 CCGATAAGCTGATCTGCGTTT 58.795 47.619 17.21 10.29 38.13 3.60
5760 7017 2.033407 CCGATAAGCTGATCTGCGTTTG 60.033 50.000 17.21 10.37 38.13 2.93
5761 7018 2.598439 CGATAAGCTGATCTGCGTTTGC 60.598 50.000 17.21 7.62 43.20 3.68
5762 7019 2.099141 TAAGCTGATCTGCGTTTGCT 57.901 45.000 17.21 0.00 43.34 3.91
5763 7020 1.242076 AAGCTGATCTGCGTTTGCTT 58.758 45.000 17.62 4.11 43.34 3.91
5764 7021 1.242076 AGCTGATCTGCGTTTGCTTT 58.758 45.000 17.62 0.00 43.34 3.51
5765 7022 1.198637 AGCTGATCTGCGTTTGCTTTC 59.801 47.619 17.62 0.00 43.34 2.62
5766 7023 1.730446 GCTGATCTGCGTTTGCTTTCC 60.730 52.381 8.95 0.00 43.34 3.13
5767 7024 1.808945 CTGATCTGCGTTTGCTTTCCT 59.191 47.619 0.00 0.00 43.34 3.36
5768 7025 1.806542 TGATCTGCGTTTGCTTTCCTC 59.193 47.619 0.00 0.00 43.34 3.71
5769 7026 1.131315 GATCTGCGTTTGCTTTCCTCC 59.869 52.381 0.00 0.00 43.34 4.30
5770 7027 0.179032 TCTGCGTTTGCTTTCCTCCA 60.179 50.000 0.00 0.00 43.34 3.86
5771 7028 0.883833 CTGCGTTTGCTTTCCTCCAT 59.116 50.000 0.00 0.00 43.34 3.41
5772 7029 0.597568 TGCGTTTGCTTTCCTCCATG 59.402 50.000 0.00 0.00 43.34 3.66
5773 7030 0.109132 GCGTTTGCTTTCCTCCATGG 60.109 55.000 4.97 4.97 38.39 3.66
5774 7031 1.533625 CGTTTGCTTTCCTCCATGGA 58.466 50.000 15.27 15.27 44.51 3.41
5785 7042 4.292186 TCCTCCATGGAAGAAGAGTTTG 57.708 45.455 17.00 0.00 42.94 2.93
5786 7043 3.652869 TCCTCCATGGAAGAAGAGTTTGT 59.347 43.478 17.00 0.00 42.94 2.83
5787 7044 4.104738 TCCTCCATGGAAGAAGAGTTTGTT 59.895 41.667 17.00 0.00 42.94 2.83
5788 7045 4.217118 CCTCCATGGAAGAAGAGTTTGTTG 59.783 45.833 17.00 0.00 38.35 3.33
5789 7046 4.792068 TCCATGGAAGAAGAGTTTGTTGT 58.208 39.130 13.46 0.00 0.00 3.32
5790 7047 4.580167 TCCATGGAAGAAGAGTTTGTTGTG 59.420 41.667 13.46 0.00 0.00 3.33
5791 7048 4.293415 CATGGAAGAAGAGTTTGTTGTGC 58.707 43.478 0.00 0.00 0.00 4.57
5792 7049 3.351740 TGGAAGAAGAGTTTGTTGTGCA 58.648 40.909 0.00 0.00 0.00 4.57
5793 7050 3.128589 TGGAAGAAGAGTTTGTTGTGCAC 59.871 43.478 10.75 10.75 0.00 4.57
5794 7051 3.128589 GGAAGAAGAGTTTGTTGTGCACA 59.871 43.478 17.42 17.42 0.00 4.57
5795 7052 4.202050 GGAAGAAGAGTTTGTTGTGCACAT 60.202 41.667 22.39 3.78 34.43 3.21
5796 7053 5.008613 GGAAGAAGAGTTTGTTGTGCACATA 59.991 40.000 22.39 10.42 34.43 2.29
5797 7054 5.424121 AGAAGAGTTTGTTGTGCACATAC 57.576 39.130 22.39 20.31 37.55 2.39
5798 7055 4.881273 AGAAGAGTTTGTTGTGCACATACA 59.119 37.500 22.39 22.51 39.22 2.29
5799 7056 4.552166 AGAGTTTGTTGTGCACATACAC 57.448 40.909 22.39 16.62 39.22 2.90
5800 7057 3.002246 AGAGTTTGTTGTGCACATACACG 59.998 43.478 22.39 0.00 43.74 4.49
5801 7058 1.778591 GTTTGTTGTGCACATACACGC 59.221 47.619 22.39 16.45 43.74 5.34
5802 7059 1.017387 TTGTTGTGCACATACACGCA 58.983 45.000 22.39 10.03 43.74 5.24
5803 7060 1.233919 TGTTGTGCACATACACGCAT 58.766 45.000 22.39 0.00 43.74 4.73
5804 7061 1.069364 TGTTGTGCACATACACGCATG 60.069 47.619 22.39 0.00 43.74 4.06
5805 7062 1.196581 GTTGTGCACATACACGCATGA 59.803 47.619 22.39 0.00 43.74 3.07
5806 7063 1.517242 TGTGCACATACACGCATGAA 58.483 45.000 17.42 0.00 43.74 2.57
5807 7064 2.083002 TGTGCACATACACGCATGAAT 58.917 42.857 17.42 0.00 43.74 2.57
5808 7065 3.265791 TGTGCACATACACGCATGAATA 58.734 40.909 17.42 0.00 43.74 1.75
5809 7066 3.686726 TGTGCACATACACGCATGAATAA 59.313 39.130 17.42 0.00 43.74 1.40
5810 7067 4.154918 TGTGCACATACACGCATGAATAAA 59.845 37.500 17.42 0.00 43.74 1.40
5811 7068 4.730042 GTGCACATACACGCATGAATAAAG 59.270 41.667 13.17 0.00 40.89 1.85
5812 7069 4.201901 TGCACATACACGCATGAATAAAGG 60.202 41.667 0.00 0.00 31.95 3.11
5813 7070 4.789481 GCACATACACGCATGAATAAAGGG 60.789 45.833 0.00 0.00 0.00 3.95
5814 7071 4.574421 CACATACACGCATGAATAAAGGGA 59.426 41.667 0.00 0.00 0.00 4.20
5815 7072 4.816385 ACATACACGCATGAATAAAGGGAG 59.184 41.667 0.00 0.00 0.00 4.30
5816 7073 3.627395 ACACGCATGAATAAAGGGAGA 57.373 42.857 0.00 0.00 0.00 3.71
5817 7074 4.156455 ACACGCATGAATAAAGGGAGAT 57.844 40.909 0.00 0.00 0.00 2.75
5818 7075 5.290493 ACACGCATGAATAAAGGGAGATA 57.710 39.130 0.00 0.00 0.00 1.98
5819 7076 5.057149 ACACGCATGAATAAAGGGAGATAC 58.943 41.667 0.00 0.00 0.00 2.24
5820 7077 5.163301 ACACGCATGAATAAAGGGAGATACT 60.163 40.000 0.00 0.00 0.00 2.12
5821 7078 6.041637 ACACGCATGAATAAAGGGAGATACTA 59.958 38.462 0.00 0.00 0.00 1.82
5822 7079 6.366332 CACGCATGAATAAAGGGAGATACTAC 59.634 42.308 0.00 0.00 0.00 2.73
5823 7080 6.267928 ACGCATGAATAAAGGGAGATACTACT 59.732 38.462 0.00 0.00 0.00 2.57
5824 7081 7.450634 ACGCATGAATAAAGGGAGATACTACTA 59.549 37.037 0.00 0.00 0.00 1.82
5825 7082 7.755822 CGCATGAATAAAGGGAGATACTACTAC 59.244 40.741 0.00 0.00 0.00 2.73
5826 7083 8.808092 GCATGAATAAAGGGAGATACTACTACT 58.192 37.037 0.00 0.00 0.00 2.57
5828 7085 8.937207 TGAATAAAGGGAGATACTACTACTCC 57.063 38.462 0.00 0.00 46.44 3.85
5835 7092 6.448207 GGAGATACTACTACTCCGTTTGTT 57.552 41.667 0.00 0.00 40.28 2.83
5836 7093 6.861144 GGAGATACTACTACTCCGTTTGTTT 58.139 40.000 0.00 0.00 40.28 2.83
5837 7094 7.318893 GGAGATACTACTACTCCGTTTGTTTT 58.681 38.462 0.00 0.00 40.28 2.43
5838 7095 7.816513 GGAGATACTACTACTCCGTTTGTTTTT 59.183 37.037 0.00 0.00 40.28 1.94
5839 7096 9.846248 GAGATACTACTACTCCGTTTGTTTTTA 57.154 33.333 0.00 0.00 0.00 1.52
5849 7106 8.538409 ACTCCGTTTGTTTTTATATAAGACGT 57.462 30.769 0.00 0.00 0.00 4.34
5850 7107 8.992073 ACTCCGTTTGTTTTTATATAAGACGTT 58.008 29.630 0.00 0.00 0.00 3.99
5851 7108 9.815936 CTCCGTTTGTTTTTATATAAGACGTTT 57.184 29.630 0.00 0.00 0.00 3.60
5870 7127 5.949233 GTTTTCGACAGTTTGCTTTGAAT 57.051 34.783 0.00 0.00 0.00 2.57
5871 7128 6.331170 GTTTTCGACAGTTTGCTTTGAATT 57.669 33.333 0.00 0.00 0.00 2.17
5872 7129 5.947503 TTTCGACAGTTTGCTTTGAATTG 57.052 34.783 0.00 0.00 0.00 2.32
5873 7130 4.630894 TCGACAGTTTGCTTTGAATTGT 57.369 36.364 0.00 0.00 30.85 2.71
5874 7131 4.992688 TCGACAGTTTGCTTTGAATTGTT 58.007 34.783 0.00 0.00 28.73 2.83
5875 7132 5.406649 TCGACAGTTTGCTTTGAATTGTTT 58.593 33.333 0.00 0.00 28.73 2.83
5876 7133 5.866633 TCGACAGTTTGCTTTGAATTGTTTT 59.133 32.000 0.00 0.00 28.73 2.43
5877 7134 7.030165 TCGACAGTTTGCTTTGAATTGTTTTA 58.970 30.769 0.00 0.00 28.73 1.52
5878 7135 7.219917 TCGACAGTTTGCTTTGAATTGTTTTAG 59.780 33.333 0.00 0.00 28.73 1.85
5879 7136 7.515059 CGACAGTTTGCTTTGAATTGTTTTAGG 60.515 37.037 0.00 0.00 28.73 2.69
5880 7137 6.037062 ACAGTTTGCTTTGAATTGTTTTAGGC 59.963 34.615 0.00 0.00 0.00 3.93
5881 7138 6.036953 CAGTTTGCTTTGAATTGTTTTAGGCA 59.963 34.615 0.00 0.00 0.00 4.75
5882 7139 5.982465 TTGCTTTGAATTGTTTTAGGCAC 57.018 34.783 0.00 0.00 0.00 5.01
5883 7140 5.275067 TGCTTTGAATTGTTTTAGGCACT 57.725 34.783 0.00 0.00 46.37 4.40
5884 7141 5.049167 TGCTTTGAATTGTTTTAGGCACTG 58.951 37.500 0.00 0.00 41.52 3.66
5885 7142 5.049828 GCTTTGAATTGTTTTAGGCACTGT 58.950 37.500 0.00 0.00 41.52 3.55
5886 7143 5.175673 GCTTTGAATTGTTTTAGGCACTGTC 59.824 40.000 0.00 0.00 41.52 3.51
5887 7144 6.463995 TTTGAATTGTTTTAGGCACTGTCT 57.536 33.333 0.00 0.00 41.52 3.41
5888 7145 5.437289 TGAATTGTTTTAGGCACTGTCTG 57.563 39.130 0.00 0.00 41.52 3.51
5889 7146 5.129634 TGAATTGTTTTAGGCACTGTCTGA 58.870 37.500 0.00 0.00 41.52 3.27
5890 7147 5.592282 TGAATTGTTTTAGGCACTGTCTGAA 59.408 36.000 0.00 0.00 41.52 3.02
5891 7148 4.893424 TTGTTTTAGGCACTGTCTGAAC 57.107 40.909 0.00 0.00 41.52 3.18
5892 7149 4.150897 TGTTTTAGGCACTGTCTGAACT 57.849 40.909 10.98 0.00 41.52 3.01
5893 7150 3.876914 TGTTTTAGGCACTGTCTGAACTG 59.123 43.478 10.98 0.00 41.52 3.16
5894 7151 3.838244 TTTAGGCACTGTCTGAACTGT 57.162 42.857 0.00 0.00 41.52 3.55
5895 7152 3.386768 TTAGGCACTGTCTGAACTGTC 57.613 47.619 0.00 0.00 41.52 3.51
5896 7153 1.418334 AGGCACTGTCTGAACTGTCT 58.582 50.000 0.00 0.00 37.18 3.41
5897 7154 2.598565 AGGCACTGTCTGAACTGTCTA 58.401 47.619 0.00 0.00 37.18 2.59
5898 7155 2.965831 AGGCACTGTCTGAACTGTCTAA 59.034 45.455 0.00 0.00 37.18 2.10
5899 7156 3.388024 AGGCACTGTCTGAACTGTCTAAA 59.612 43.478 0.00 0.00 37.18 1.85
5900 7157 4.127171 GGCACTGTCTGAACTGTCTAAAA 58.873 43.478 0.00 0.00 35.60 1.52
5901 7158 4.024809 GGCACTGTCTGAACTGTCTAAAAC 60.025 45.833 0.00 0.00 35.60 2.43
5902 7159 4.318121 GCACTGTCTGAACTGTCTAAAACG 60.318 45.833 0.00 0.00 35.60 3.60
5903 7160 4.804139 CACTGTCTGAACTGTCTAAAACGT 59.196 41.667 0.00 0.00 35.60 3.99
5904 7161 5.041940 ACTGTCTGAACTGTCTAAAACGTC 58.958 41.667 0.00 0.00 32.69 4.34
5905 7162 5.163540 ACTGTCTGAACTGTCTAAAACGTCT 60.164 40.000 0.00 0.00 32.69 4.18
5906 7163 5.657474 TGTCTGAACTGTCTAAAACGTCTT 58.343 37.500 0.00 0.00 0.00 3.01
5907 7164 6.798482 TGTCTGAACTGTCTAAAACGTCTTA 58.202 36.000 0.00 0.00 0.00 2.10
5908 7165 7.431249 TGTCTGAACTGTCTAAAACGTCTTAT 58.569 34.615 0.00 0.00 0.00 1.73
5909 7166 8.570488 TGTCTGAACTGTCTAAAACGTCTTATA 58.430 33.333 0.00 0.00 0.00 0.98
5910 7167 9.570488 GTCTGAACTGTCTAAAACGTCTTATAT 57.430 33.333 0.00 0.00 0.00 0.86
5925 7182 8.928270 ACGTCTTATATAAAAGTGAACAGAGG 57.072 34.615 0.00 0.00 0.00 3.69
5926 7183 8.746530 ACGTCTTATATAAAAGTGAACAGAGGA 58.253 33.333 0.00 0.00 0.00 3.71
5927 7184 9.582431 CGTCTTATATAAAAGTGAACAGAGGAA 57.418 33.333 0.00 0.00 0.00 3.36
5935 7192 7.598759 AAAAGTGAACAGAGGAAGTACTAGA 57.401 36.000 0.00 0.00 0.00 2.43
5936 7193 7.784470 AAAGTGAACAGAGGAAGTACTAGAT 57.216 36.000 0.00 0.00 0.00 1.98
5937 7194 8.880991 AAAGTGAACAGAGGAAGTACTAGATA 57.119 34.615 0.00 0.00 0.00 1.98
5938 7195 8.514330 AAGTGAACAGAGGAAGTACTAGATAG 57.486 38.462 0.00 0.00 0.00 2.08
5939 7196 7.863722 AGTGAACAGAGGAAGTACTAGATAGA 58.136 38.462 0.00 0.00 0.00 1.98
5940 7197 8.330247 AGTGAACAGAGGAAGTACTAGATAGAA 58.670 37.037 0.00 0.00 0.00 2.10
5941 7198 8.958506 GTGAACAGAGGAAGTACTAGATAGAAA 58.041 37.037 0.00 0.00 0.00 2.52
5942 7199 9.702253 TGAACAGAGGAAGTACTAGATAGAAAT 57.298 33.333 0.00 0.00 0.00 2.17
5945 7202 9.702253 ACAGAGGAAGTACTAGATAGAAATTCA 57.298 33.333 0.00 0.00 0.00 2.57
5953 7210 9.790389 AGTACTAGATAGAAATTCAACTGAACG 57.210 33.333 0.00 0.00 36.80 3.95
5954 7211 9.784680 GTACTAGATAGAAATTCAACTGAACGA 57.215 33.333 0.00 0.00 36.80 3.85
5955 7212 8.918961 ACTAGATAGAAATTCAACTGAACGAG 57.081 34.615 0.00 0.00 36.80 4.18
5956 7213 8.524487 ACTAGATAGAAATTCAACTGAACGAGT 58.476 33.333 0.00 0.00 36.80 4.18
5957 7214 7.588143 AGATAGAAATTCAACTGAACGAGTG 57.412 36.000 0.00 0.00 36.80 3.51
5958 7215 6.591834 AGATAGAAATTCAACTGAACGAGTGG 59.408 38.462 0.00 0.00 36.80 4.00
5959 7216 4.451900 AGAAATTCAACTGAACGAGTGGT 58.548 39.130 0.00 0.00 36.80 4.16
5960 7217 4.273480 AGAAATTCAACTGAACGAGTGGTG 59.727 41.667 0.00 0.00 36.80 4.17
5961 7218 2.684001 TTCAACTGAACGAGTGGTGT 57.316 45.000 0.00 0.00 34.02 4.16
5962 7219 3.804786 TTCAACTGAACGAGTGGTGTA 57.195 42.857 0.00 0.00 34.02 2.90
5963 7220 3.088194 TCAACTGAACGAGTGGTGTAC 57.912 47.619 0.00 0.00 34.02 2.90
5964 7221 1.784856 CAACTGAACGAGTGGTGTACG 59.215 52.381 0.00 0.00 34.02 3.67
5965 7222 1.027357 ACTGAACGAGTGGTGTACGT 58.973 50.000 0.00 0.00 41.97 3.57
5966 7223 1.268896 ACTGAACGAGTGGTGTACGTG 60.269 52.381 0.00 0.00 40.10 4.49
5967 7224 0.740149 TGAACGAGTGGTGTACGTGT 59.260 50.000 0.00 0.00 40.10 4.49
5968 7225 1.126079 GAACGAGTGGTGTACGTGTG 58.874 55.000 0.00 0.00 40.10 3.82
5969 7226 0.249155 AACGAGTGGTGTACGTGTGG 60.249 55.000 0.00 0.00 40.10 4.17
5970 7227 1.361271 CGAGTGGTGTACGTGTGGT 59.639 57.895 0.00 0.00 0.00 4.16
5971 7228 0.937699 CGAGTGGTGTACGTGTGGTG 60.938 60.000 0.00 0.00 0.00 4.17
5972 7229 1.219522 GAGTGGTGTACGTGTGGTGC 61.220 60.000 0.00 0.00 0.00 5.01
5973 7230 1.521906 GTGGTGTACGTGTGGTGCA 60.522 57.895 0.00 0.00 39.05 4.57
5974 7231 1.227409 TGGTGTACGTGTGGTGCAG 60.227 57.895 0.00 0.00 42.14 4.41
5975 7232 1.227438 GGTGTACGTGTGGTGCAGT 60.227 57.895 0.00 0.00 42.14 4.40
5976 7233 1.495584 GGTGTACGTGTGGTGCAGTG 61.496 60.000 0.00 0.00 42.14 3.66
5977 7234 1.885388 TGTACGTGTGGTGCAGTGC 60.885 57.895 8.58 8.58 36.25 4.40
5978 7235 1.885388 GTACGTGTGGTGCAGTGCA 60.885 57.895 15.37 15.37 35.60 4.57
5979 7236 1.153349 TACGTGTGGTGCAGTGCAA 60.153 52.632 21.67 1.42 41.47 4.08
5980 7237 1.157257 TACGTGTGGTGCAGTGCAAG 61.157 55.000 21.67 9.59 41.47 4.01
5981 7238 2.026590 GTGTGGTGCAGTGCAAGC 59.973 61.111 21.67 13.99 41.47 4.01
5982 7239 2.439883 TGTGGTGCAGTGCAAGCA 60.440 55.556 21.67 16.45 41.47 3.91
5983 7240 2.050934 TGTGGTGCAGTGCAAGCAA 61.051 52.632 21.67 3.36 44.64 3.91
5984 7241 1.364901 GTGGTGCAGTGCAAGCAAT 59.635 52.632 21.67 0.00 44.64 3.56
5985 7242 0.665369 GTGGTGCAGTGCAAGCAATC 60.665 55.000 21.67 5.94 44.64 2.67
5986 7243 1.443194 GGTGCAGTGCAAGCAATCG 60.443 57.895 21.67 0.00 44.64 3.34
5987 7244 1.575922 GTGCAGTGCAAGCAATCGA 59.424 52.632 21.67 0.00 44.64 3.59
5988 7245 0.453950 GTGCAGTGCAAGCAATCGAG 60.454 55.000 21.67 0.00 44.64 4.04
5989 7246 0.603439 TGCAGTGCAAGCAATCGAGA 60.603 50.000 17.26 0.00 39.39 4.04
5990 7247 0.731417 GCAGTGCAAGCAATCGAGAT 59.269 50.000 11.09 0.00 0.00 2.75
5991 7248 1.935873 GCAGTGCAAGCAATCGAGATA 59.064 47.619 11.09 0.00 0.00 1.98
5992 7249 2.352651 GCAGTGCAAGCAATCGAGATAA 59.647 45.455 11.09 0.00 0.00 1.75
5993 7250 3.181507 GCAGTGCAAGCAATCGAGATAAA 60.182 43.478 11.09 0.00 0.00 1.40
5994 7251 4.337763 CAGTGCAAGCAATCGAGATAAAC 58.662 43.478 0.00 0.00 0.00 2.01
5995 7252 4.002982 AGTGCAAGCAATCGAGATAAACA 58.997 39.130 0.00 0.00 0.00 2.83
5996 7253 4.093998 AGTGCAAGCAATCGAGATAAACAG 59.906 41.667 0.00 0.00 0.00 3.16
5997 7254 3.181507 TGCAAGCAATCGAGATAAACAGC 60.182 43.478 0.00 0.00 0.00 4.40
5998 7255 3.181507 GCAAGCAATCGAGATAAACAGCA 60.182 43.478 0.00 0.00 0.00 4.41
5999 7256 4.585364 CAAGCAATCGAGATAAACAGCAG 58.415 43.478 0.00 0.00 0.00 4.24
6000 7257 4.128925 AGCAATCGAGATAAACAGCAGA 57.871 40.909 0.00 0.00 0.00 4.26
6001 7258 4.118410 AGCAATCGAGATAAACAGCAGAG 58.882 43.478 0.00 0.00 0.00 3.35
6002 7259 3.247173 GCAATCGAGATAAACAGCAGAGG 59.753 47.826 0.00 0.00 0.00 3.69
6003 7260 2.586258 TCGAGATAAACAGCAGAGGC 57.414 50.000 0.00 0.00 41.61 4.70
6004 7261 1.824852 TCGAGATAAACAGCAGAGGCA 59.175 47.619 0.00 0.00 44.61 4.75
6005 7262 2.233676 TCGAGATAAACAGCAGAGGCAA 59.766 45.455 0.00 0.00 44.61 4.52
6006 7263 2.606725 CGAGATAAACAGCAGAGGCAAG 59.393 50.000 0.00 0.00 44.61 4.01
6007 7264 3.677148 CGAGATAAACAGCAGAGGCAAGA 60.677 47.826 0.00 0.00 44.61 3.02
6008 7265 4.450053 GAGATAAACAGCAGAGGCAAGAT 58.550 43.478 0.00 0.00 44.61 2.40
6009 7266 4.197750 AGATAAACAGCAGAGGCAAGATG 58.802 43.478 0.00 0.00 44.61 2.90
6010 7267 1.542492 AAACAGCAGAGGCAAGATGG 58.458 50.000 0.00 0.00 44.61 3.51
6011 7268 0.694771 AACAGCAGAGGCAAGATGGA 59.305 50.000 0.00 0.00 44.61 3.41
6012 7269 0.252479 ACAGCAGAGGCAAGATGGAG 59.748 55.000 0.00 0.00 44.61 3.86
6013 7270 0.464013 CAGCAGAGGCAAGATGGAGG 60.464 60.000 0.00 0.00 44.61 4.30
6014 7271 0.619832 AGCAGAGGCAAGATGGAGGA 60.620 55.000 0.00 0.00 44.61 3.71
6015 7272 0.473326 GCAGAGGCAAGATGGAGGAT 59.527 55.000 0.00 0.00 40.72 3.24
6016 7273 1.133853 GCAGAGGCAAGATGGAGGATT 60.134 52.381 0.00 0.00 40.72 3.01
6017 7274 2.105477 GCAGAGGCAAGATGGAGGATTA 59.895 50.000 0.00 0.00 40.72 1.75
6018 7275 3.434167 GCAGAGGCAAGATGGAGGATTAA 60.434 47.826 0.00 0.00 40.72 1.40
6019 7276 4.749166 GCAGAGGCAAGATGGAGGATTAAT 60.749 45.833 0.00 0.00 40.72 1.40
6020 7277 5.383476 CAGAGGCAAGATGGAGGATTAATT 58.617 41.667 0.00 0.00 0.00 1.40
6021 7278 5.472820 CAGAGGCAAGATGGAGGATTAATTC 59.527 44.000 0.00 0.00 0.00 2.17
6022 7279 5.133322 AGAGGCAAGATGGAGGATTAATTCA 59.867 40.000 0.00 0.00 0.00 2.57
6023 7280 5.383476 AGGCAAGATGGAGGATTAATTCAG 58.617 41.667 0.00 0.00 0.00 3.02
6024 7281 5.133322 AGGCAAGATGGAGGATTAATTCAGA 59.867 40.000 0.00 0.00 0.00 3.27
6025 7282 5.240403 GGCAAGATGGAGGATTAATTCAGAC 59.760 44.000 0.00 0.00 0.00 3.51
6026 7283 5.824624 GCAAGATGGAGGATTAATTCAGACA 59.175 40.000 0.00 0.00 0.00 3.41
6027 7284 6.238593 GCAAGATGGAGGATTAATTCAGACAC 60.239 42.308 0.00 0.00 0.00 3.67
6028 7285 6.566079 AGATGGAGGATTAATTCAGACACA 57.434 37.500 0.00 0.00 0.00 3.72
6029 7286 7.146715 AGATGGAGGATTAATTCAGACACAT 57.853 36.000 0.00 0.00 0.00 3.21
6030 7287 7.222872 AGATGGAGGATTAATTCAGACACATC 58.777 38.462 0.00 3.04 0.00 3.06
6031 7288 5.359756 TGGAGGATTAATTCAGACACATCG 58.640 41.667 0.00 0.00 0.00 3.84
6032 7289 4.212214 GGAGGATTAATTCAGACACATCGC 59.788 45.833 0.00 0.00 0.00 4.58
6033 7290 4.130118 AGGATTAATTCAGACACATCGCC 58.870 43.478 0.00 0.00 0.00 5.54
6034 7291 3.876914 GGATTAATTCAGACACATCGCCA 59.123 43.478 0.00 0.00 0.00 5.69
6035 7292 4.335315 GGATTAATTCAGACACATCGCCAA 59.665 41.667 0.00 0.00 0.00 4.52
6036 7293 5.009010 GGATTAATTCAGACACATCGCCAAT 59.991 40.000 0.00 0.00 0.00 3.16
6037 7294 5.484173 TTAATTCAGACACATCGCCAATC 57.516 39.130 0.00 0.00 0.00 2.67
6038 7295 1.737838 TTCAGACACATCGCCAATCC 58.262 50.000 0.00 0.00 0.00 3.01
6039 7296 0.612744 TCAGACACATCGCCAATCCA 59.387 50.000 0.00 0.00 0.00 3.41
6040 7297 0.729116 CAGACACATCGCCAATCCAC 59.271 55.000 0.00 0.00 0.00 4.02
6041 7298 0.392998 AGACACATCGCCAATCCACC 60.393 55.000 0.00 0.00 0.00 4.61
6042 7299 1.705337 GACACATCGCCAATCCACCG 61.705 60.000 0.00 0.00 0.00 4.94
6043 7300 2.124736 ACATCGCCAATCCACCGG 60.125 61.111 0.00 0.00 0.00 5.28
6044 7301 3.585990 CATCGCCAATCCACCGGC 61.586 66.667 0.00 0.00 45.28 6.13
6049 7306 4.016838 CCAATCCACCGGCAATGT 57.983 55.556 0.00 0.00 0.00 2.71
6050 7307 1.809207 CCAATCCACCGGCAATGTC 59.191 57.895 0.00 0.00 0.00 3.06
6051 7308 0.964860 CCAATCCACCGGCAATGTCA 60.965 55.000 0.00 0.00 0.00 3.58
6052 7309 0.171007 CAATCCACCGGCAATGTCAC 59.829 55.000 0.00 0.00 0.00 3.67
6053 7310 0.965363 AATCCACCGGCAATGTCACC 60.965 55.000 0.00 0.00 0.00 4.02
6054 7311 2.135903 ATCCACCGGCAATGTCACCA 62.136 55.000 0.00 0.00 0.00 4.17
6055 7312 1.678635 CCACCGGCAATGTCACCAT 60.679 57.895 0.00 0.00 0.00 3.55
6056 7313 1.656818 CCACCGGCAATGTCACCATC 61.657 60.000 0.00 0.00 0.00 3.51
6057 7314 1.378514 ACCGGCAATGTCACCATCC 60.379 57.895 0.00 0.00 0.00 3.51
6058 7315 1.378382 CCGGCAATGTCACCATCCA 60.378 57.895 0.00 0.00 0.00 3.41
6059 7316 0.964860 CCGGCAATGTCACCATCCAA 60.965 55.000 0.00 0.00 0.00 3.53
6060 7317 0.452987 CGGCAATGTCACCATCCAAG 59.547 55.000 0.00 0.00 0.00 3.61
6061 7318 1.838112 GGCAATGTCACCATCCAAGA 58.162 50.000 0.00 0.00 0.00 3.02
6062 7319 1.474077 GGCAATGTCACCATCCAAGAC 59.526 52.381 0.00 0.00 0.00 3.01
6063 7320 2.161855 GCAATGTCACCATCCAAGACA 58.838 47.619 0.00 0.00 45.26 3.41
6064 7321 2.557924 GCAATGTCACCATCCAAGACAA 59.442 45.455 0.00 0.00 44.47 3.18
6065 7322 3.612479 GCAATGTCACCATCCAAGACAAC 60.612 47.826 0.00 0.00 44.47 3.32
6066 7323 1.877637 TGTCACCATCCAAGACAACG 58.122 50.000 0.00 0.00 39.15 4.10
6067 7324 1.414550 TGTCACCATCCAAGACAACGA 59.585 47.619 0.00 0.00 39.15 3.85
6068 7325 2.158885 TGTCACCATCCAAGACAACGAA 60.159 45.455 0.00 0.00 39.15 3.85
6069 7326 2.480419 GTCACCATCCAAGACAACGAAG 59.520 50.000 0.00 0.00 32.68 3.79
6070 7327 1.806542 CACCATCCAAGACAACGAAGG 59.193 52.381 0.00 0.00 0.00 3.46
6071 7328 1.697432 ACCATCCAAGACAACGAAGGA 59.303 47.619 0.00 0.00 0.00 3.36
6072 7329 2.289694 ACCATCCAAGACAACGAAGGAG 60.290 50.000 0.00 0.00 0.00 3.69
6073 7330 1.734465 CATCCAAGACAACGAAGGAGC 59.266 52.381 0.00 0.00 0.00 4.70
6074 7331 0.756294 TCCAAGACAACGAAGGAGCA 59.244 50.000 0.00 0.00 0.00 4.26
6075 7332 1.151668 CCAAGACAACGAAGGAGCAG 58.848 55.000 0.00 0.00 0.00 4.24
6076 7333 1.541233 CCAAGACAACGAAGGAGCAGT 60.541 52.381 0.00 0.00 0.00 4.40
6077 7334 1.528586 CAAGACAACGAAGGAGCAGTG 59.471 52.381 0.00 0.00 0.00 3.66
6078 7335 1.040646 AGACAACGAAGGAGCAGTGA 58.959 50.000 0.00 0.00 0.00 3.41
6079 7336 1.620819 AGACAACGAAGGAGCAGTGAT 59.379 47.619 0.00 0.00 0.00 3.06
6080 7337 1.996191 GACAACGAAGGAGCAGTGATC 59.004 52.381 0.00 0.00 0.00 2.92
6081 7338 1.338200 ACAACGAAGGAGCAGTGATCC 60.338 52.381 20.05 20.05 38.56 3.36
6082 7339 0.976641 AACGAAGGAGCAGTGATCCA 59.023 50.000 28.35 0.00 41.08 3.41
6083 7340 1.198713 ACGAAGGAGCAGTGATCCAT 58.801 50.000 28.35 17.94 41.08 3.41
6084 7341 1.134580 ACGAAGGAGCAGTGATCCATG 60.135 52.381 28.35 18.79 41.08 3.66
6085 7342 1.809271 CGAAGGAGCAGTGATCCATGG 60.809 57.143 28.35 14.91 41.08 3.66
6086 7343 0.106819 AAGGAGCAGTGATCCATGGC 60.107 55.000 28.35 1.72 41.08 4.40
6087 7344 0.987081 AGGAGCAGTGATCCATGGCT 60.987 55.000 28.35 5.19 41.08 4.75
6088 7345 3.003740 GAGCAGTGATCCATGGCTC 57.996 57.895 6.96 7.95 43.41 4.70
6089 7346 0.879400 GAGCAGTGATCCATGGCTCG 60.879 60.000 6.96 0.00 41.18 5.03
6090 7347 1.153289 GCAGTGATCCATGGCTCGT 60.153 57.895 6.96 0.00 0.00 4.18
6091 7348 1.156645 GCAGTGATCCATGGCTCGTC 61.157 60.000 6.96 4.71 0.00 4.20
6092 7349 0.463204 CAGTGATCCATGGCTCGTCT 59.537 55.000 6.96 7.06 0.00 4.18
6093 7350 0.463204 AGTGATCCATGGCTCGTCTG 59.537 55.000 6.96 0.00 0.00 3.51
6094 7351 0.531532 GTGATCCATGGCTCGTCTGG 60.532 60.000 6.96 0.00 0.00 3.86
6095 7352 0.977627 TGATCCATGGCTCGTCTGGT 60.978 55.000 6.96 0.00 0.00 4.00
6096 7353 0.249657 GATCCATGGCTCGTCTGGTC 60.250 60.000 6.96 0.00 0.00 4.02
6097 7354 2.021068 ATCCATGGCTCGTCTGGTCG 62.021 60.000 6.96 0.00 0.00 4.79
6098 7355 2.887568 CATGGCTCGTCTGGTCGC 60.888 66.667 0.00 0.00 0.00 5.19
6099 7356 4.148825 ATGGCTCGTCTGGTCGCC 62.149 66.667 0.00 0.00 42.78 5.54
6103 7360 4.813526 CTCGTCTGGTCGCCGTCG 62.814 72.222 0.00 0.00 0.00 5.12
6106 7363 4.773117 GTCTGGTCGCCGTCGTCC 62.773 72.222 0.00 0.00 42.81 4.79
6110 7367 4.867599 GGTCGCCGTCGTCCCATC 62.868 72.222 0.00 0.00 37.83 3.51
6113 7370 3.879682 CGCCGTCGTCCCATCGTA 61.880 66.667 0.00 0.00 0.00 3.43
6114 7371 2.025727 GCCGTCGTCCCATCGTAG 59.974 66.667 0.00 0.00 0.00 3.51
6115 7372 2.475466 GCCGTCGTCCCATCGTAGA 61.475 63.158 0.00 0.00 45.75 2.59
6116 7373 1.793134 GCCGTCGTCCCATCGTAGAT 61.793 60.000 0.00 0.00 45.12 1.98
6117 7374 0.237761 CCGTCGTCCCATCGTAGATC 59.762 60.000 0.00 0.00 45.12 2.75
6118 7375 0.942252 CGTCGTCCCATCGTAGATCA 59.058 55.000 0.00 0.00 45.12 2.92
6119 7376 1.535896 CGTCGTCCCATCGTAGATCAT 59.464 52.381 0.00 0.00 45.12 2.45
6120 7377 2.412977 CGTCGTCCCATCGTAGATCATC 60.413 54.545 0.00 0.00 45.12 2.92
6121 7378 1.804748 TCGTCCCATCGTAGATCATCG 59.195 52.381 0.00 0.00 45.12 3.84
6122 7379 1.135660 CGTCCCATCGTAGATCATCGG 60.136 57.143 9.08 0.00 45.12 4.18
6123 7380 1.202582 GTCCCATCGTAGATCATCGGG 59.797 57.143 9.08 0.00 45.12 5.14
6124 7381 1.203013 TCCCATCGTAGATCATCGGGT 60.203 52.381 9.08 0.00 45.12 5.28
6125 7382 1.202582 CCCATCGTAGATCATCGGGTC 59.797 57.143 9.08 0.00 45.12 4.46
6126 7383 1.886542 CCATCGTAGATCATCGGGTCA 59.113 52.381 9.08 0.00 45.12 4.02
6127 7384 2.296190 CCATCGTAGATCATCGGGTCAA 59.704 50.000 9.08 0.00 45.12 3.18
6128 7385 3.056536 CCATCGTAGATCATCGGGTCAAT 60.057 47.826 9.08 0.00 45.12 2.57
6129 7386 3.643159 TCGTAGATCATCGGGTCAATG 57.357 47.619 9.08 0.00 0.00 2.82
6130 7387 3.219281 TCGTAGATCATCGGGTCAATGA 58.781 45.455 9.08 0.00 37.53 2.57
6131 7388 3.634910 TCGTAGATCATCGGGTCAATGAA 59.365 43.478 9.08 0.00 36.75 2.57
6132 7389 3.983988 CGTAGATCATCGGGTCAATGAAG 59.016 47.826 0.00 0.00 36.75 3.02
6133 7390 3.482156 AGATCATCGGGTCAATGAAGG 57.518 47.619 0.00 0.00 36.75 3.46
6134 7391 3.041211 AGATCATCGGGTCAATGAAGGA 58.959 45.455 0.00 0.00 36.75 3.36
6135 7392 2.988010 TCATCGGGTCAATGAAGGAG 57.012 50.000 0.00 0.00 30.37 3.69
6136 7393 2.466846 TCATCGGGTCAATGAAGGAGA 58.533 47.619 0.00 0.00 30.37 3.71
6137 7394 3.041211 TCATCGGGTCAATGAAGGAGAT 58.959 45.455 0.00 0.00 30.37 2.75
6138 7395 3.455910 TCATCGGGTCAATGAAGGAGATT 59.544 43.478 0.00 0.00 30.37 2.40
6139 7396 3.266510 TCGGGTCAATGAAGGAGATTG 57.733 47.619 0.00 0.00 32.91 2.67
6140 7397 2.571653 TCGGGTCAATGAAGGAGATTGT 59.428 45.455 0.00 0.00 33.33 2.71
6141 7398 2.679837 CGGGTCAATGAAGGAGATTGTG 59.320 50.000 0.00 0.00 33.33 3.33
6142 7399 3.690460 GGGTCAATGAAGGAGATTGTGT 58.310 45.455 0.00 0.00 33.33 3.72
6143 7400 4.622933 CGGGTCAATGAAGGAGATTGTGTA 60.623 45.833 0.00 0.00 33.33 2.90
6144 7401 5.440610 GGGTCAATGAAGGAGATTGTGTAT 58.559 41.667 0.00 0.00 33.33 2.29
6145 7402 6.591935 GGGTCAATGAAGGAGATTGTGTATA 58.408 40.000 0.00 0.00 33.33 1.47
6146 7403 7.227156 GGGTCAATGAAGGAGATTGTGTATAT 58.773 38.462 0.00 0.00 33.33 0.86
6147 7404 7.173907 GGGTCAATGAAGGAGATTGTGTATATG 59.826 40.741 0.00 0.00 33.33 1.78
6148 7405 7.308229 GGTCAATGAAGGAGATTGTGTATATGC 60.308 40.741 0.00 0.00 33.33 3.14
6149 7406 7.443575 GTCAATGAAGGAGATTGTGTATATGCT 59.556 37.037 0.00 0.00 33.33 3.79
6150 7407 8.650490 TCAATGAAGGAGATTGTGTATATGCTA 58.350 33.333 0.00 0.00 33.33 3.49
6151 7408 9.445878 CAATGAAGGAGATTGTGTATATGCTAT 57.554 33.333 0.00 0.00 0.00 2.97
6152 7409 9.664332 AATGAAGGAGATTGTGTATATGCTATC 57.336 33.333 0.00 0.00 0.00 2.08
6153 7410 7.615403 TGAAGGAGATTGTGTATATGCTATCC 58.385 38.462 0.00 0.00 0.00 2.59
6154 7411 6.214191 AGGAGATTGTGTATATGCTATCCG 57.786 41.667 0.00 0.00 0.00 4.18
6155 7412 5.127845 AGGAGATTGTGTATATGCTATCCGG 59.872 44.000 0.00 0.00 0.00 5.14
6156 7413 4.759782 AGATTGTGTATATGCTATCCGGC 58.240 43.478 0.00 0.00 0.00 6.13
6157 7414 4.222810 AGATTGTGTATATGCTATCCGGCA 59.777 41.667 0.00 0.00 46.63 5.69
6158 7415 4.344359 TTGTGTATATGCTATCCGGCAA 57.656 40.909 0.00 0.00 45.68 4.52
6159 7416 3.925379 TGTGTATATGCTATCCGGCAAG 58.075 45.455 0.00 0.00 45.68 4.01
6160 7417 3.576550 TGTGTATATGCTATCCGGCAAGA 59.423 43.478 0.00 0.00 45.68 3.02
6161 7418 4.039852 TGTGTATATGCTATCCGGCAAGAA 59.960 41.667 0.00 0.00 45.68 2.52
6162 7419 4.994852 GTGTATATGCTATCCGGCAAGAAA 59.005 41.667 0.00 0.00 45.68 2.52
6163 7420 5.468746 GTGTATATGCTATCCGGCAAGAAAA 59.531 40.000 0.00 0.00 45.68 2.29
6164 7421 6.017440 GTGTATATGCTATCCGGCAAGAAAAA 60.017 38.462 0.00 0.00 45.68 1.94
6185 7442 4.363991 AAGATGGAGATTGGGAGTATGC 57.636 45.455 0.00 0.00 0.00 3.14
6186 7443 3.596101 AGATGGAGATTGGGAGTATGCT 58.404 45.455 0.00 0.00 0.00 3.79
6187 7444 3.979347 AGATGGAGATTGGGAGTATGCTT 59.021 43.478 0.00 0.00 0.00 3.91
6188 7445 3.565764 TGGAGATTGGGAGTATGCTTG 57.434 47.619 0.00 0.00 0.00 4.01
6189 7446 3.114606 TGGAGATTGGGAGTATGCTTGA 58.885 45.455 0.00 0.00 0.00 3.02
6190 7447 3.118261 TGGAGATTGGGAGTATGCTTGAC 60.118 47.826 0.00 0.00 0.00 3.18
6191 7448 3.471680 GAGATTGGGAGTATGCTTGACC 58.528 50.000 0.00 0.00 0.00 4.02
6192 7449 3.118531 AGATTGGGAGTATGCTTGACCT 58.881 45.455 0.00 0.00 0.00 3.85
6193 7450 3.525199 AGATTGGGAGTATGCTTGACCTT 59.475 43.478 0.00 0.00 0.00 3.50
6194 7451 3.806949 TTGGGAGTATGCTTGACCTTT 57.193 42.857 0.00 0.00 0.00 3.11
6195 7452 3.350219 TGGGAGTATGCTTGACCTTTC 57.650 47.619 0.00 0.00 0.00 2.62
6196 7453 2.642311 TGGGAGTATGCTTGACCTTTCA 59.358 45.455 0.00 0.00 0.00 2.69
6197 7454 3.274288 GGGAGTATGCTTGACCTTTCAG 58.726 50.000 0.00 0.00 31.71 3.02
6198 7455 3.055094 GGGAGTATGCTTGACCTTTCAGA 60.055 47.826 0.00 0.00 31.71 3.27
6199 7456 3.935828 GGAGTATGCTTGACCTTTCAGAC 59.064 47.826 0.00 0.00 31.71 3.51
6200 7457 3.589988 AGTATGCTTGACCTTTCAGACG 58.410 45.455 0.00 0.00 31.71 4.18
6201 7458 2.839486 ATGCTTGACCTTTCAGACGA 57.161 45.000 0.00 0.00 31.71 4.20
6202 7459 1.865865 TGCTTGACCTTTCAGACGAC 58.134 50.000 0.00 0.00 31.71 4.34
6203 7460 1.412710 TGCTTGACCTTTCAGACGACT 59.587 47.619 0.00 0.00 31.71 4.18
6204 7461 2.158957 TGCTTGACCTTTCAGACGACTT 60.159 45.455 0.00 0.00 31.71 3.01
6205 7462 2.221981 GCTTGACCTTTCAGACGACTTG 59.778 50.000 0.00 0.00 31.71 3.16
6206 7463 3.717707 CTTGACCTTTCAGACGACTTGA 58.282 45.455 0.00 0.00 31.71 3.02
6207 7464 3.093717 TGACCTTTCAGACGACTTGAC 57.906 47.619 0.00 0.00 0.00 3.18
6208 7465 2.429250 TGACCTTTCAGACGACTTGACA 59.571 45.455 0.00 0.00 0.00 3.58
6209 7466 3.118920 TGACCTTTCAGACGACTTGACAA 60.119 43.478 0.00 0.00 0.00 3.18
6210 7467 3.869065 ACCTTTCAGACGACTTGACAAA 58.131 40.909 0.00 0.00 0.00 2.83
6211 7468 3.871594 ACCTTTCAGACGACTTGACAAAG 59.128 43.478 0.00 0.00 39.49 2.77
6213 7470 4.260375 CCTTTCAGACGACTTGACAAAGTG 60.260 45.833 0.00 0.00 46.84 3.16
6214 7471 2.201732 TCAGACGACTTGACAAAGTGC 58.798 47.619 0.00 0.00 46.84 4.40
6215 7472 2.159099 TCAGACGACTTGACAAAGTGCT 60.159 45.455 0.00 0.00 46.84 4.40
6216 7473 2.219674 CAGACGACTTGACAAAGTGCTC 59.780 50.000 0.00 0.00 46.84 4.26
6217 7474 1.190323 GACGACTTGACAAAGTGCTCG 59.810 52.381 0.00 0.00 46.84 5.03
6218 7475 0.508641 CGACTTGACAAAGTGCTCGG 59.491 55.000 0.00 0.00 46.84 4.63
6219 7476 0.235926 GACTTGACAAAGTGCTCGGC 59.764 55.000 0.00 0.00 46.84 5.54
6220 7477 1.205064 CTTGACAAAGTGCTCGGCG 59.795 57.895 0.00 0.00 0.00 6.46
6221 7478 2.770587 CTTGACAAAGTGCTCGGCGC 62.771 60.000 0.00 0.00 39.59 6.53
6228 7485 3.099574 GTGCTCGGCGCTTTTTGC 61.100 61.111 7.64 5.92 40.11 3.68
6229 7486 3.286751 TGCTCGGCGCTTTTTGCT 61.287 55.556 7.64 0.00 40.11 3.91
6230 7487 1.963855 TGCTCGGCGCTTTTTGCTA 60.964 52.632 7.64 0.00 40.11 3.49
6231 7488 1.512098 GCTCGGCGCTTTTTGCTAC 60.512 57.895 7.64 0.00 40.11 3.58
6232 7489 1.225745 CTCGGCGCTTTTTGCTACG 60.226 57.895 7.64 0.00 40.11 3.51
6233 7490 1.623081 CTCGGCGCTTTTTGCTACGA 61.623 55.000 7.64 3.11 42.14 3.43
6234 7491 1.017177 TCGGCGCTTTTTGCTACGAT 61.017 50.000 7.64 0.00 40.54 3.73
6235 7492 0.586502 CGGCGCTTTTTGCTACGATC 60.587 55.000 7.64 0.00 39.57 3.69
6236 7493 0.446222 GGCGCTTTTTGCTACGATCA 59.554 50.000 7.64 0.00 40.11 2.92
6237 7494 1.064060 GGCGCTTTTTGCTACGATCAT 59.936 47.619 7.64 0.00 40.11 2.45
6238 7495 2.366859 GCGCTTTTTGCTACGATCATC 58.633 47.619 0.00 0.00 40.11 2.92
6239 7496 2.851008 GCGCTTTTTGCTACGATCATCC 60.851 50.000 0.00 0.00 40.11 3.51
6240 7497 2.609459 CGCTTTTTGCTACGATCATCCT 59.391 45.455 0.00 0.00 40.11 3.24
6241 7498 3.063997 CGCTTTTTGCTACGATCATCCTT 59.936 43.478 0.00 0.00 40.11 3.36
6242 7499 4.437390 CGCTTTTTGCTACGATCATCCTTT 60.437 41.667 0.00 0.00 40.11 3.11
6243 7500 5.402398 GCTTTTTGCTACGATCATCCTTTT 58.598 37.500 0.00 0.00 38.95 2.27
6244 7501 6.551736 GCTTTTTGCTACGATCATCCTTTTA 58.448 36.000 0.00 0.00 38.95 1.52
6245 7502 6.469275 GCTTTTTGCTACGATCATCCTTTTAC 59.531 38.462 0.00 0.00 38.95 2.01
6246 7503 5.712217 TTTGCTACGATCATCCTTTTACG 57.288 39.130 0.00 0.00 0.00 3.18
6247 7504 3.120792 TGCTACGATCATCCTTTTACGC 58.879 45.455 0.00 0.00 0.00 4.42
6248 7505 2.153247 GCTACGATCATCCTTTTACGCG 59.847 50.000 3.53 3.53 0.00 6.01
6249 7506 2.288961 ACGATCATCCTTTTACGCGT 57.711 45.000 19.17 19.17 0.00 6.01
6250 7507 1.924524 ACGATCATCCTTTTACGCGTG 59.075 47.619 24.59 4.25 0.00 5.34
6251 7508 1.257936 CGATCATCCTTTTACGCGTGG 59.742 52.381 24.59 15.04 0.00 4.94
6252 7509 2.546778 GATCATCCTTTTACGCGTGGA 58.453 47.619 24.59 20.39 0.00 4.02
6253 7510 2.459060 TCATCCTTTTACGCGTGGAA 57.541 45.000 24.59 13.97 31.87 3.53
6254 7511 2.768698 TCATCCTTTTACGCGTGGAAA 58.231 42.857 24.59 20.29 31.87 3.13
6255 7512 2.481185 TCATCCTTTTACGCGTGGAAAC 59.519 45.455 24.59 0.00 31.87 2.78
6256 7513 1.228533 TCCTTTTACGCGTGGAAACC 58.771 50.000 24.59 0.00 0.00 3.27
6257 7514 0.239082 CCTTTTACGCGTGGAAACCC 59.761 55.000 24.59 0.00 0.00 4.11
6258 7515 0.239082 CTTTTACGCGTGGAAACCCC 59.761 55.000 24.59 0.00 0.00 4.95
6259 7516 0.465097 TTTTACGCGTGGAAACCCCA 60.465 50.000 24.59 0.00 44.25 4.96
6272 7529 6.613153 TGGAAACCCCATCGAATTTTTATT 57.387 33.333 0.00 0.00 40.82 1.40
6273 7530 7.719871 TGGAAACCCCATCGAATTTTTATTA 57.280 32.000 0.00 0.00 40.82 0.98
6274 7531 8.135382 TGGAAACCCCATCGAATTTTTATTAA 57.865 30.769 0.00 0.00 40.82 1.40
6275 7532 8.254508 TGGAAACCCCATCGAATTTTTATTAAG 58.745 33.333 0.00 0.00 40.82 1.85
6276 7533 7.709182 GGAAACCCCATCGAATTTTTATTAAGG 59.291 37.037 0.00 0.00 34.14 2.69
6277 7534 6.724893 ACCCCATCGAATTTTTATTAAGGG 57.275 37.500 0.00 0.00 35.70 3.95
6278 7535 5.069914 ACCCCATCGAATTTTTATTAAGGGC 59.930 40.000 0.00 0.00 32.67 5.19
6279 7536 5.510690 CCCCATCGAATTTTTATTAAGGGCC 60.511 44.000 0.00 0.00 0.00 5.80
6280 7537 5.069781 CCCATCGAATTTTTATTAAGGGCCA 59.930 40.000 6.18 0.00 0.00 5.36
6281 7538 5.983118 CCATCGAATTTTTATTAAGGGCCAC 59.017 40.000 6.18 0.00 0.00 5.01
6282 7539 5.238006 TCGAATTTTTATTAAGGGCCACG 57.762 39.130 6.18 0.00 0.00 4.94
6283 7540 4.096682 TCGAATTTTTATTAAGGGCCACGG 59.903 41.667 6.18 0.00 0.00 4.94
6284 7541 4.689071 GAATTTTTATTAAGGGCCACGGG 58.311 43.478 6.18 0.00 0.00 5.28
6285 7542 3.453059 TTTTTATTAAGGGCCACGGGA 57.547 42.857 6.18 0.00 0.00 5.14
6286 7543 3.673543 TTTTATTAAGGGCCACGGGAT 57.326 42.857 6.18 0.00 0.00 3.85
6287 7544 2.943036 TTATTAAGGGCCACGGGATC 57.057 50.000 6.18 0.00 0.00 3.36
6288 7545 1.061546 TATTAAGGGCCACGGGATCC 58.938 55.000 6.18 1.92 0.00 3.36
6289 7546 0.697854 ATTAAGGGCCACGGGATCCT 60.698 55.000 12.58 0.00 31.25 3.24
6290 7547 1.632018 TTAAGGGCCACGGGATCCTG 61.632 60.000 19.66 19.66 30.64 3.86
6291 7548 2.539277 TAAGGGCCACGGGATCCTGA 62.539 60.000 27.90 0.00 30.64 3.86
6292 7549 3.866582 GGGCCACGGGATCCTGAG 61.867 72.222 27.90 19.16 0.00 3.35
6293 7550 4.554036 GGCCACGGGATCCTGAGC 62.554 72.222 27.90 25.53 0.00 4.26
6294 7551 4.554036 GCCACGGGATCCTGAGCC 62.554 72.222 27.90 5.25 35.80 4.70
6295 7552 2.765807 CCACGGGATCCTGAGCCT 60.766 66.667 27.90 0.93 37.00 4.58
6298 7555 4.277552 CGGGATCCTGAGCCTGTA 57.722 61.111 16.28 0.00 38.41 2.74
6299 7556 2.751991 CGGGATCCTGAGCCTGTAT 58.248 57.895 16.28 0.00 38.41 2.29
6300 7557 0.319728 CGGGATCCTGAGCCTGTATG 59.680 60.000 16.28 0.00 38.41 2.39
6301 7558 1.428869 GGGATCCTGAGCCTGTATGT 58.571 55.000 12.58 0.00 37.00 2.29
6302 7559 2.609747 GGGATCCTGAGCCTGTATGTA 58.390 52.381 12.58 0.00 37.00 2.29
6303 7560 2.300437 GGGATCCTGAGCCTGTATGTAC 59.700 54.545 12.58 0.00 37.00 2.90
6304 7561 2.965831 GGATCCTGAGCCTGTATGTACA 59.034 50.000 3.84 0.00 33.23 2.90
6305 7562 3.388024 GGATCCTGAGCCTGTATGTACAA 59.612 47.826 3.84 0.00 35.50 2.41
6306 7563 4.502259 GGATCCTGAGCCTGTATGTACAAG 60.502 50.000 3.84 0.00 35.50 3.16
6307 7564 3.708451 TCCTGAGCCTGTATGTACAAGA 58.292 45.455 0.00 0.00 35.50 3.02
6308 7565 4.290093 TCCTGAGCCTGTATGTACAAGAT 58.710 43.478 0.00 0.00 35.50 2.40
6309 7566 4.100035 TCCTGAGCCTGTATGTACAAGATG 59.900 45.833 0.00 0.00 35.50 2.90
6310 7567 4.100035 CCTGAGCCTGTATGTACAAGATGA 59.900 45.833 0.00 0.00 35.50 2.92
6311 7568 5.395657 CCTGAGCCTGTATGTACAAGATGAA 60.396 44.000 0.00 0.00 35.50 2.57
6312 7569 5.419542 TGAGCCTGTATGTACAAGATGAAC 58.580 41.667 0.00 0.00 35.50 3.18
6313 7570 4.433615 AGCCTGTATGTACAAGATGAACG 58.566 43.478 0.00 0.00 35.50 3.95
6314 7571 3.001330 GCCTGTATGTACAAGATGAACGC 59.999 47.826 0.00 0.00 35.50 4.84
6315 7572 4.433615 CCTGTATGTACAAGATGAACGCT 58.566 43.478 0.00 0.00 35.50 5.07
6316 7573 4.870426 CCTGTATGTACAAGATGAACGCTT 59.130 41.667 0.00 0.00 35.50 4.68
6317 7574 5.220472 CCTGTATGTACAAGATGAACGCTTG 60.220 44.000 0.00 0.00 46.20 4.01
6318 7575 3.747099 ATGTACAAGATGAACGCTTGC 57.253 42.857 0.00 0.00 45.00 4.01
6319 7576 2.488952 TGTACAAGATGAACGCTTGCA 58.511 42.857 0.00 0.00 45.00 4.08
6320 7577 3.073678 TGTACAAGATGAACGCTTGCAT 58.926 40.909 0.00 0.00 45.00 3.96
6321 7578 3.501828 TGTACAAGATGAACGCTTGCATT 59.498 39.130 0.00 0.00 45.00 3.56
6322 7579 3.648339 ACAAGATGAACGCTTGCATTT 57.352 38.095 0.00 0.00 45.00 2.32
6323 7580 3.981211 ACAAGATGAACGCTTGCATTTT 58.019 36.364 0.00 0.00 45.00 1.82
6324 7581 3.983344 ACAAGATGAACGCTTGCATTTTC 59.017 39.130 0.00 0.00 45.00 2.29
6325 7582 3.921119 AGATGAACGCTTGCATTTTCA 57.079 38.095 0.00 0.00 32.71 2.69
6326 7583 4.445452 AGATGAACGCTTGCATTTTCAT 57.555 36.364 10.64 10.64 40.57 2.57
6327 7584 4.813027 AGATGAACGCTTGCATTTTCATT 58.187 34.783 11.63 3.40 38.51 2.57
6328 7585 5.232463 AGATGAACGCTTGCATTTTCATTT 58.768 33.333 11.63 5.97 38.51 2.32
6329 7586 5.697633 AGATGAACGCTTGCATTTTCATTTT 59.302 32.000 11.63 4.40 38.51 1.82
6330 7587 5.327502 TGAACGCTTGCATTTTCATTTTC 57.672 34.783 0.00 0.00 0.00 2.29
6331 7588 4.210955 TGAACGCTTGCATTTTCATTTTCC 59.789 37.500 0.00 0.00 0.00 3.13
6332 7589 3.066380 ACGCTTGCATTTTCATTTTCCC 58.934 40.909 0.00 0.00 0.00 3.97
6333 7590 2.416202 CGCTTGCATTTTCATTTTCCCC 59.584 45.455 0.00 0.00 0.00 4.81
6334 7591 3.410508 GCTTGCATTTTCATTTTCCCCA 58.589 40.909 0.00 0.00 0.00 4.96
6335 7592 4.011698 GCTTGCATTTTCATTTTCCCCAT 58.988 39.130 0.00 0.00 0.00 4.00
6336 7593 4.142556 GCTTGCATTTTCATTTTCCCCATG 60.143 41.667 0.00 0.00 0.00 3.66
6337 7594 4.637387 TGCATTTTCATTTTCCCCATGT 57.363 36.364 0.00 0.00 0.00 3.21
6338 7595 4.983053 TGCATTTTCATTTTCCCCATGTT 58.017 34.783 0.00 0.00 0.00 2.71
6339 7596 5.383476 TGCATTTTCATTTTCCCCATGTTT 58.617 33.333 0.00 0.00 0.00 2.83
6340 7597 6.537355 TGCATTTTCATTTTCCCCATGTTTA 58.463 32.000 0.00 0.00 0.00 2.01
6341 7598 7.173722 TGCATTTTCATTTTCCCCATGTTTAT 58.826 30.769 0.00 0.00 0.00 1.40
6342 7599 8.324306 TGCATTTTCATTTTCCCCATGTTTATA 58.676 29.630 0.00 0.00 0.00 0.98
6343 7600 8.611757 GCATTTTCATTTTCCCCATGTTTATAC 58.388 33.333 0.00 0.00 0.00 1.47
6344 7601 9.664332 CATTTTCATTTTCCCCATGTTTATACA 57.336 29.630 0.00 0.00 38.95 2.29
6351 7608 9.881773 ATTTTCCCCATGTTTATACATATCTGT 57.118 29.630 0.00 0.00 43.07 3.41
6352 7609 8.690203 TTTCCCCATGTTTATACATATCTGTG 57.310 34.615 0.00 0.00 43.07 3.66
6353 7610 7.625498 TCCCCATGTTTATACATATCTGTGA 57.375 36.000 0.00 0.00 43.07 3.58
6354 7611 7.450074 TCCCCATGTTTATACATATCTGTGAC 58.550 38.462 0.00 0.00 43.07 3.67
6355 7612 6.368791 CCCCATGTTTATACATATCTGTGACG 59.631 42.308 0.00 0.00 43.07 4.35
6356 7613 6.128553 CCCATGTTTATACATATCTGTGACGC 60.129 42.308 0.00 0.00 43.07 5.19
6357 7614 6.128553 CCATGTTTATACATATCTGTGACGCC 60.129 42.308 0.00 0.00 43.07 5.68
6358 7615 5.908341 TGTTTATACATATCTGTGACGCCA 58.092 37.500 0.00 0.00 36.79 5.69
6359 7616 5.751509 TGTTTATACATATCTGTGACGCCAC 59.248 40.000 0.00 0.00 43.46 5.01
6360 7617 7.900440 ATGTTTATACATATCTGTGACGCCACA 60.900 37.037 4.00 4.00 45.33 4.17
6368 7625 2.616969 GTGACGCCACATCAACTGT 58.383 52.632 0.00 0.00 42.72 3.55
6406 7663 8.697507 AGGACTTGTTTGAAATAATGAACTCT 57.302 30.769 0.00 0.00 0.00 3.24
6407 7664 9.136323 AGGACTTGTTTGAAATAATGAACTCTT 57.864 29.630 0.00 0.00 0.00 2.85
6408 7665 9.750125 GGACTTGTTTGAAATAATGAACTCTTT 57.250 29.630 0.00 0.00 0.00 2.52
6439 7696 9.841295 AATACGTGATTATTTTGTATACAGGGT 57.159 29.630 5.56 0.00 0.00 4.34
6442 7699 9.841295 ACGTGATTATTTTGTATACAGGGTATT 57.159 29.630 5.56 0.00 0.00 1.89
6454 7711 9.826574 TGTATACAGGGTATTTTGTTCTATCAC 57.173 33.333 0.08 0.00 0.00 3.06
6455 7712 9.826574 GTATACAGGGTATTTTGTTCTATCACA 57.173 33.333 0.00 0.00 0.00 3.58
6457 7714 7.630242 ACAGGGTATTTTGTTCTATCACATG 57.370 36.000 0.00 0.00 0.00 3.21
6458 7715 7.402054 ACAGGGTATTTTGTTCTATCACATGA 58.598 34.615 0.00 0.00 0.00 3.07
6459 7716 7.554118 ACAGGGTATTTTGTTCTATCACATGAG 59.446 37.037 0.00 0.00 0.00 2.90
6460 7717 7.770433 CAGGGTATTTTGTTCTATCACATGAGA 59.230 37.037 0.00 0.00 0.00 3.27
6461 7718 8.497745 AGGGTATTTTGTTCTATCACATGAGAT 58.502 33.333 10.58 10.58 0.00 2.75
6462 7719 8.562892 GGGTATTTTGTTCTATCACATGAGATG 58.437 37.037 15.03 6.17 0.00 2.90
6463 7720 8.562892 GGTATTTTGTTCTATCACATGAGATGG 58.437 37.037 15.03 12.33 33.60 3.51
6464 7721 9.330063 GTATTTTGTTCTATCACATGAGATGGA 57.670 33.333 13.77 13.77 34.26 3.41
6465 7722 8.812513 ATTTTGTTCTATCACATGAGATGGAA 57.187 30.769 22.01 22.01 41.36 3.53
6466 7723 8.634335 TTTTGTTCTATCACATGAGATGGAAA 57.366 30.769 25.61 16.39 43.90 3.13
6467 7724 7.615582 TTGTTCTATCACATGAGATGGAAAC 57.384 36.000 25.61 20.40 43.90 2.78
6468 7725 6.710278 TGTTCTATCACATGAGATGGAAACA 58.290 36.000 25.61 21.99 43.90 2.83
6527 7784 9.802039 TTTTGTAGTATGGATTTTTCCACTACT 57.198 29.630 17.03 16.09 43.37 2.57
6528 7785 9.802039 TTTGTAGTATGGATTTTTCCACTACTT 57.198 29.630 17.03 0.00 43.37 2.24
6533 7790 9.239551 AGTATGGATTTTTCCACTACTTAAACC 57.760 33.333 0.00 0.00 43.37 3.27
6534 7791 9.239551 GTATGGATTTTTCCACTACTTAAACCT 57.760 33.333 0.00 0.00 43.37 3.50
6536 7793 9.816787 ATGGATTTTTCCACTACTTAAACCTAA 57.183 29.630 0.00 0.00 43.37 2.69
6537 7794 9.816787 TGGATTTTTCCACTACTTAAACCTAAT 57.183 29.630 0.00 0.00 34.33 1.73
6542 7799 8.741603 TTTCCACTACTTAAACCTAATATGGC 57.258 34.615 0.00 0.00 0.00 4.40
6543 7800 7.440505 TCCACTACTTAAACCTAATATGGCA 57.559 36.000 0.00 0.00 0.00 4.92
6544 7801 7.863722 TCCACTACTTAAACCTAATATGGCAA 58.136 34.615 0.00 0.00 0.00 4.52
6545 7802 8.330247 TCCACTACTTAAACCTAATATGGCAAA 58.670 33.333 0.00 0.00 0.00 3.68
6546 7803 8.962679 CCACTACTTAAACCTAATATGGCAAAA 58.037 33.333 0.00 0.00 0.00 2.44
6548 7805 8.683615 ACTACTTAAACCTAATATGGCAAAAGC 58.316 33.333 0.00 0.00 0.00 3.51
6549 7806 7.475137 ACTTAAACCTAATATGGCAAAAGCA 57.525 32.000 0.00 0.00 0.00 3.91
6550 7807 7.902087 ACTTAAACCTAATATGGCAAAAGCAA 58.098 30.769 0.00 0.00 0.00 3.91
6551 7808 8.539544 ACTTAAACCTAATATGGCAAAAGCAAT 58.460 29.630 0.00 0.00 0.00 3.56
6552 7809 9.382275 CTTAAACCTAATATGGCAAAAGCAATT 57.618 29.630 0.00 0.00 0.00 2.32
6555 7812 9.732130 AAACCTAATATGGCAAAAGCAATTAAA 57.268 25.926 0.00 0.00 0.00 1.52
6556 7813 9.732130 AACCTAATATGGCAAAAGCAATTAAAA 57.268 25.926 0.00 0.00 0.00 1.52
6557 7814 9.732130 ACCTAATATGGCAAAAGCAATTAAAAA 57.268 25.926 0.00 0.00 0.00 1.94
6993 8250 7.766219 AGATAAAAATCAGCATTGCATTCAC 57.234 32.000 11.91 0.00 0.00 3.18
6994 8251 7.324935 AGATAAAAATCAGCATTGCATTCACA 58.675 30.769 11.91 0.00 0.00 3.58
6995 8252 5.856126 AAAAATCAGCATTGCATTCACAG 57.144 34.783 11.91 0.00 0.00 3.66
6996 8253 2.579207 ATCAGCATTGCATTCACAGC 57.421 45.000 11.91 0.00 0.00 4.40
6997 8254 0.528924 TCAGCATTGCATTCACAGCC 59.471 50.000 11.91 0.00 0.00 4.85
6998 8255 0.530744 CAGCATTGCATTCACAGCCT 59.469 50.000 11.91 0.00 0.00 4.58
6999 8256 1.746787 CAGCATTGCATTCACAGCCTA 59.253 47.619 11.91 0.00 0.00 3.93
7000 8257 2.361119 CAGCATTGCATTCACAGCCTAT 59.639 45.455 11.91 0.00 0.00 2.57
7001 8258 2.361119 AGCATTGCATTCACAGCCTATG 59.639 45.455 11.91 0.00 0.00 2.23
7002 8259 2.739292 CATTGCATTCACAGCCTATGC 58.261 47.619 0.00 0.00 43.74 3.14
7004 8261 1.097232 TGCATTCACAGCCTATGCAC 58.903 50.000 4.99 0.00 46.89 4.57
7005 8262 1.340308 TGCATTCACAGCCTATGCACT 60.340 47.619 4.99 0.00 46.89 4.40
7006 8263 2.093021 TGCATTCACAGCCTATGCACTA 60.093 45.455 4.99 0.00 46.89 2.74
7007 8264 2.289002 GCATTCACAGCCTATGCACTAC 59.711 50.000 0.00 0.00 43.13 2.73
7008 8265 3.534554 CATTCACAGCCTATGCACTACA 58.465 45.455 0.00 0.00 41.13 2.74
7009 8266 2.672961 TCACAGCCTATGCACTACAC 57.327 50.000 0.00 0.00 41.13 2.90
7010 8267 1.899142 TCACAGCCTATGCACTACACA 59.101 47.619 0.00 0.00 41.13 3.72
7011 8268 2.301583 TCACAGCCTATGCACTACACAA 59.698 45.455 0.00 0.00 41.13 3.33
7012 8269 2.674852 CACAGCCTATGCACTACACAAG 59.325 50.000 0.00 0.00 41.13 3.16
7013 8270 2.567169 ACAGCCTATGCACTACACAAGA 59.433 45.455 0.00 0.00 41.13 3.02
7014 8271 3.198635 ACAGCCTATGCACTACACAAGAT 59.801 43.478 0.00 0.00 41.13 2.40
7015 8272 3.806521 CAGCCTATGCACTACACAAGATC 59.193 47.826 0.00 0.00 41.13 2.75
7016 8273 3.708631 AGCCTATGCACTACACAAGATCT 59.291 43.478 0.00 0.00 41.13 2.75
7017 8274 4.163078 AGCCTATGCACTACACAAGATCTT 59.837 41.667 0.88 0.88 41.13 2.40
7018 8275 5.363868 AGCCTATGCACTACACAAGATCTTA 59.636 40.000 7.86 0.00 41.13 2.10
7019 8276 5.694006 GCCTATGCACTACACAAGATCTTAG 59.306 44.000 7.86 4.50 37.47 2.18
7020 8277 6.684111 GCCTATGCACTACACAAGATCTTAGT 60.684 42.308 7.86 12.20 37.47 2.24
7021 8278 6.699204 CCTATGCACTACACAAGATCTTAGTG 59.301 42.308 23.26 23.26 42.88 2.74
7023 8280 6.584185 TGCACTACACAAGATCTTAGTGTA 57.416 37.500 28.98 28.98 44.02 2.90
7024 8281 6.387465 TGCACTACACAAGATCTTAGTGTAC 58.613 40.000 28.20 22.87 44.02 2.90
7025 8282 6.015772 TGCACTACACAAGATCTTAGTGTACA 60.016 38.462 28.20 24.18 44.02 2.90
7026 8283 7.036220 GCACTACACAAGATCTTAGTGTACAT 58.964 38.462 28.20 21.63 44.02 2.29
7027 8284 7.545965 GCACTACACAAGATCTTAGTGTACATT 59.454 37.037 28.20 19.55 44.02 2.71
7028 8285 9.077674 CACTACACAAGATCTTAGTGTACATTC 57.922 37.037 28.20 0.00 44.02 2.67
7029 8286 8.803235 ACTACACAAGATCTTAGTGTACATTCA 58.197 33.333 28.20 18.31 44.02 2.57
7030 8287 9.809096 CTACACAAGATCTTAGTGTACATTCAT 57.191 33.333 28.20 15.68 44.02 2.57
7031 8288 8.484641 ACACAAGATCTTAGTGTACATTCATG 57.515 34.615 27.59 9.74 44.02 3.07
7032 8289 8.314021 ACACAAGATCTTAGTGTACATTCATGA 58.686 33.333 27.59 0.00 44.02 3.07
7033 8290 8.598924 CACAAGATCTTAGTGTACATTCATGAC 58.401 37.037 20.71 0.00 0.00 3.06
7034 8291 8.535335 ACAAGATCTTAGTGTACATTCATGACT 58.465 33.333 7.86 0.00 0.00 3.41
7035 8292 8.815189 CAAGATCTTAGTGTACATTCATGACTG 58.185 37.037 7.86 11.24 0.00 3.51
7036 8293 7.495901 AGATCTTAGTGTACATTCATGACTGG 58.504 38.462 16.50 2.33 0.00 4.00
7037 8294 6.605471 TCTTAGTGTACATTCATGACTGGT 57.395 37.500 16.50 7.94 0.00 4.00
7038 8295 7.004555 TCTTAGTGTACATTCATGACTGGTT 57.995 36.000 16.50 0.34 0.00 3.67
7039 8296 6.873605 TCTTAGTGTACATTCATGACTGGTTG 59.126 38.462 16.50 3.26 0.00 3.77
7040 8297 3.753272 AGTGTACATTCATGACTGGTTGC 59.247 43.478 16.50 2.15 0.00 4.17
7041 8298 3.501828 GTGTACATTCATGACTGGTTGCA 59.498 43.478 16.50 4.55 0.00 4.08
7042 8299 4.023279 GTGTACATTCATGACTGGTTGCAA 60.023 41.667 16.50 0.00 0.00 4.08
7043 8300 3.648339 ACATTCATGACTGGTTGCAAC 57.352 42.857 21.59 21.59 0.00 4.17
7044 8301 3.225104 ACATTCATGACTGGTTGCAACT 58.775 40.909 27.64 9.61 0.00 3.16
7045 8302 3.638160 ACATTCATGACTGGTTGCAACTT 59.362 39.130 27.64 13.36 0.00 2.66
7046 8303 3.713858 TTCATGACTGGTTGCAACTTG 57.286 42.857 27.64 21.40 0.00 3.16
7047 8304 1.337703 TCATGACTGGTTGCAACTTGC 59.662 47.619 27.64 12.92 45.29 4.01
7061 8318 4.610945 GCAACTTGCAACTCAACTTATGT 58.389 39.130 8.97 0.00 44.26 2.29
7062 8319 4.442073 GCAACTTGCAACTCAACTTATGTG 59.558 41.667 8.97 0.00 44.26 3.21
7063 8320 5.733091 GCAACTTGCAACTCAACTTATGTGA 60.733 40.000 8.97 0.00 44.26 3.58
7064 8321 6.264832 CAACTTGCAACTCAACTTATGTGAA 58.735 36.000 0.00 0.00 0.00 3.18
7065 8322 5.821204 ACTTGCAACTCAACTTATGTGAAC 58.179 37.500 0.00 0.00 0.00 3.18
7066 8323 5.590259 ACTTGCAACTCAACTTATGTGAACT 59.410 36.000 0.00 0.00 0.00 3.01
7067 8324 6.765989 ACTTGCAACTCAACTTATGTGAACTA 59.234 34.615 0.00 0.00 0.00 2.24
7068 8325 6.785488 TGCAACTCAACTTATGTGAACTAG 57.215 37.500 0.00 0.00 0.00 2.57
7069 8326 6.521162 TGCAACTCAACTTATGTGAACTAGA 58.479 36.000 0.00 0.00 0.00 2.43
7070 8327 7.161404 TGCAACTCAACTTATGTGAACTAGAT 58.839 34.615 0.00 0.00 0.00 1.98
7071 8328 8.311109 TGCAACTCAACTTATGTGAACTAGATA 58.689 33.333 0.00 0.00 0.00 1.98
7072 8329 9.151471 GCAACTCAACTTATGTGAACTAGATAA 57.849 33.333 0.00 0.00 0.00 1.75
7085 8342 9.256228 TGTGAACTAGATAATCTAAACTGGAGT 57.744 33.333 0.00 0.00 0.00 3.85
7093 8350 8.816894 AGATAATCTAAACTGGAGTTTGTCTCA 58.183 33.333 13.87 0.00 46.56 3.27
7094 8351 9.436957 GATAATCTAAACTGGAGTTTGTCTCAA 57.563 33.333 13.87 0.00 46.56 3.02
7095 8352 7.497925 AATCTAAACTGGAGTTTGTCTCAAC 57.502 36.000 13.87 0.00 46.56 3.18
7096 8353 6.235231 TCTAAACTGGAGTTTGTCTCAACT 57.765 37.500 13.87 0.00 46.56 3.16
7097 8354 6.049149 TCTAAACTGGAGTTTGTCTCAACTG 58.951 40.000 13.87 0.00 46.56 3.16
7098 8355 4.487714 AACTGGAGTTTGTCTCAACTGA 57.512 40.909 0.00 0.00 44.40 3.41
7099 8356 4.487714 ACTGGAGTTTGTCTCAACTGAA 57.512 40.909 0.00 0.00 44.40 3.02
7100 8357 4.192317 ACTGGAGTTTGTCTCAACTGAAC 58.808 43.478 0.00 0.00 44.40 3.18
7101 8358 4.191544 CTGGAGTTTGTCTCAACTGAACA 58.808 43.478 0.00 0.00 44.40 3.18
7102 8359 4.584874 TGGAGTTTGTCTCAACTGAACAA 58.415 39.130 0.00 4.43 44.40 2.83
7103 8360 4.394920 TGGAGTTTGTCTCAACTGAACAAC 59.605 41.667 6.84 0.00 44.40 3.32
7104 8361 4.394920 GGAGTTTGTCTCAACTGAACAACA 59.605 41.667 6.84 0.00 44.40 3.33
7105 8362 5.106317 GGAGTTTGTCTCAACTGAACAACAA 60.106 40.000 6.84 3.72 44.40 2.83
7106 8363 6.325919 AGTTTGTCTCAACTGAACAACAAA 57.674 33.333 9.13 9.13 0.00 2.83
7107 8364 6.924111 AGTTTGTCTCAACTGAACAACAAAT 58.076 32.000 13.42 5.46 0.00 2.32
7108 8365 7.378181 AGTTTGTCTCAACTGAACAACAAATT 58.622 30.769 13.42 9.31 0.00 1.82
7109 8366 8.519526 AGTTTGTCTCAACTGAACAACAAATTA 58.480 29.630 13.42 0.00 0.00 1.40
7110 8367 9.134734 GTTTGTCTCAACTGAACAACAAATTAA 57.865 29.630 13.42 0.00 0.00 1.40
7111 8368 9.868277 TTTGTCTCAACTGAACAACAAATTAAT 57.132 25.926 9.13 0.00 0.00 1.40
7112 8369 8.854979 TGTCTCAACTGAACAACAAATTAATG 57.145 30.769 0.00 0.00 0.00 1.90
7113 8370 7.434897 TGTCTCAACTGAACAACAAATTAATGC 59.565 33.333 0.00 0.00 0.00 3.56
7114 8371 7.434897 GTCTCAACTGAACAACAAATTAATGCA 59.565 33.333 0.00 0.00 0.00 3.96
7115 8372 7.648908 TCTCAACTGAACAACAAATTAATGCAG 59.351 33.333 0.00 0.00 0.00 4.41
7116 8373 6.700960 TCAACTGAACAACAAATTAATGCAGG 59.299 34.615 0.00 0.00 0.00 4.85
7117 8374 5.540911 ACTGAACAACAAATTAATGCAGGG 58.459 37.500 0.00 0.00 0.00 4.45
7118 8375 4.892433 TGAACAACAAATTAATGCAGGGG 58.108 39.130 0.00 0.00 0.00 4.79
7119 8376 3.979101 ACAACAAATTAATGCAGGGGG 57.021 42.857 0.00 0.00 0.00 5.40
7120 8377 3.515562 ACAACAAATTAATGCAGGGGGA 58.484 40.909 0.00 0.00 0.00 4.81
7121 8378 3.515104 ACAACAAATTAATGCAGGGGGAG 59.485 43.478 0.00 0.00 0.00 4.30
7122 8379 2.750814 ACAAATTAATGCAGGGGGAGG 58.249 47.619 0.00 0.00 0.00 4.30
7123 8380 2.044353 ACAAATTAATGCAGGGGGAGGT 59.956 45.455 0.00 0.00 0.00 3.85
7124 8381 2.431782 CAAATTAATGCAGGGGGAGGTG 59.568 50.000 0.00 0.00 0.00 4.00
7125 8382 1.607225 ATTAATGCAGGGGGAGGTGA 58.393 50.000 0.00 0.00 0.00 4.02
7126 8383 1.377690 TTAATGCAGGGGGAGGTGAA 58.622 50.000 0.00 0.00 0.00 3.18
7127 8384 0.623723 TAATGCAGGGGGAGGTGAAC 59.376 55.000 0.00 0.00 0.00 3.18
7128 8385 1.434513 AATGCAGGGGGAGGTGAACA 61.435 55.000 0.00 0.00 0.00 3.18
7129 8386 1.217057 ATGCAGGGGGAGGTGAACAT 61.217 55.000 0.00 0.00 0.00 2.71
7130 8387 1.077429 GCAGGGGGAGGTGAACATC 60.077 63.158 0.00 0.00 0.00 3.06
7131 8388 1.609783 CAGGGGGAGGTGAACATCC 59.390 63.158 5.57 5.57 45.46 3.51
7132 8389 0.916358 CAGGGGGAGGTGAACATCCT 60.916 60.000 13.38 3.19 45.49 3.24
7133 8390 0.916358 AGGGGGAGGTGAACATCCTG 60.916 60.000 13.38 0.00 45.49 3.86
7134 8391 1.208165 GGGGGAGGTGAACATCCTGT 61.208 60.000 13.38 0.00 45.49 4.00
7135 8392 1.580059 GGGGAGGTGAACATCCTGTA 58.420 55.000 13.38 0.00 45.49 2.74
7136 8393 1.209747 GGGGAGGTGAACATCCTGTAC 59.790 57.143 13.38 0.00 45.49 2.90
7137 8394 1.906574 GGGAGGTGAACATCCTGTACA 59.093 52.381 13.38 0.00 45.49 2.90
7138 8395 2.304761 GGGAGGTGAACATCCTGTACAA 59.695 50.000 13.38 0.00 45.49 2.41
7139 8396 3.600388 GGAGGTGAACATCCTGTACAAG 58.400 50.000 6.89 0.00 43.07 3.16
7140 8397 3.260884 GGAGGTGAACATCCTGTACAAGA 59.739 47.826 6.89 0.00 43.07 3.02
7141 8398 4.499183 GAGGTGAACATCCTGTACAAGAG 58.501 47.826 0.00 0.00 35.20 2.85
7142 8399 3.003480 GGTGAACATCCTGTACAAGAGC 58.997 50.000 0.00 0.00 0.00 4.09
7143 8400 3.307059 GGTGAACATCCTGTACAAGAGCT 60.307 47.826 0.00 0.00 0.00 4.09
7144 8401 3.681897 GTGAACATCCTGTACAAGAGCTG 59.318 47.826 0.00 0.00 0.00 4.24
7145 8402 3.578282 TGAACATCCTGTACAAGAGCTGA 59.422 43.478 0.00 0.00 0.00 4.26
7146 8403 3.883830 ACATCCTGTACAAGAGCTGAG 57.116 47.619 0.00 0.00 0.00 3.35
7147 8404 2.499289 ACATCCTGTACAAGAGCTGAGG 59.501 50.000 0.00 0.00 0.00 3.86
7148 8405 2.604912 TCCTGTACAAGAGCTGAGGA 57.395 50.000 0.00 0.00 0.00 3.71
7149 8406 2.889512 TCCTGTACAAGAGCTGAGGAA 58.110 47.619 0.00 0.00 0.00 3.36
7150 8407 2.828520 TCCTGTACAAGAGCTGAGGAAG 59.171 50.000 0.00 0.00 0.00 3.46
7151 8408 2.093764 CCTGTACAAGAGCTGAGGAAGG 60.094 54.545 0.00 0.00 0.00 3.46
7152 8409 2.828520 CTGTACAAGAGCTGAGGAAGGA 59.171 50.000 0.00 0.00 0.00 3.36
7153 8410 2.828520 TGTACAAGAGCTGAGGAAGGAG 59.171 50.000 0.00 0.00 0.00 3.69
7154 8411 1.274712 ACAAGAGCTGAGGAAGGAGG 58.725 55.000 0.00 0.00 0.00 4.30
7155 8412 0.540923 CAAGAGCTGAGGAAGGAGGG 59.459 60.000 0.00 0.00 0.00 4.30
7156 8413 0.415429 AAGAGCTGAGGAAGGAGGGA 59.585 55.000 0.00 0.00 0.00 4.20
7157 8414 0.032217 AGAGCTGAGGAAGGAGGGAG 60.032 60.000 0.00 0.00 0.00 4.30
7158 8415 1.002792 AGCTGAGGAAGGAGGGAGG 59.997 63.158 0.00 0.00 0.00 4.30
7159 8416 2.069430 GCTGAGGAAGGAGGGAGGG 61.069 68.421 0.00 0.00 0.00 4.30
7160 8417 1.394151 CTGAGGAAGGAGGGAGGGT 59.606 63.158 0.00 0.00 0.00 4.34
7161 8418 0.252927 CTGAGGAAGGAGGGAGGGTT 60.253 60.000 0.00 0.00 0.00 4.11
7162 8419 0.252742 TGAGGAAGGAGGGAGGGTTC 60.253 60.000 0.00 0.00 0.00 3.62
7163 8420 1.306226 AGGAAGGAGGGAGGGTTCG 60.306 63.158 0.00 0.00 0.00 3.95
7164 8421 2.368011 GGAAGGAGGGAGGGTTCGG 61.368 68.421 0.00 0.00 0.00 4.30
7165 8422 1.305887 GAAGGAGGGAGGGTTCGGA 60.306 63.158 0.00 0.00 0.00 4.55
7166 8423 1.612739 AAGGAGGGAGGGTTCGGAC 60.613 63.158 0.00 0.00 0.00 4.79
7167 8424 2.039137 GGAGGGAGGGTTCGGACT 59.961 66.667 0.00 0.00 0.00 3.85
7168 8425 2.059190 GGAGGGAGGGTTCGGACTC 61.059 68.421 0.00 0.00 0.00 3.36
7169 8426 1.305046 GAGGGAGGGTTCGGACTCA 60.305 63.158 0.00 0.00 35.45 3.41
7170 8427 0.688087 GAGGGAGGGTTCGGACTCAT 60.688 60.000 0.00 0.00 35.45 2.90
7171 8428 0.688087 AGGGAGGGTTCGGACTCATC 60.688 60.000 0.00 0.00 35.45 2.92
7172 8429 0.976073 GGGAGGGTTCGGACTCATCA 60.976 60.000 0.00 0.00 35.45 3.07
7173 8430 1.123928 GGAGGGTTCGGACTCATCAT 58.876 55.000 0.00 0.00 35.45 2.45
7174 8431 1.069358 GGAGGGTTCGGACTCATCATC 59.931 57.143 0.00 0.00 35.45 2.92
7175 8432 1.069358 GAGGGTTCGGACTCATCATCC 59.931 57.143 0.00 0.00 33.95 3.51
7176 8433 0.106894 GGGTTCGGACTCATCATCCC 59.893 60.000 0.00 0.00 31.99 3.85
7177 8434 0.106894 GGTTCGGACTCATCATCCCC 59.893 60.000 0.00 0.00 31.99 4.81
7178 8435 0.830648 GTTCGGACTCATCATCCCCA 59.169 55.000 0.00 0.00 31.99 4.96
7179 8436 1.123077 TTCGGACTCATCATCCCCAG 58.877 55.000 0.00 0.00 31.99 4.45
7180 8437 0.760567 TCGGACTCATCATCCCCAGG 60.761 60.000 0.00 0.00 31.99 4.45
7181 8438 1.453669 GGACTCATCATCCCCAGGC 59.546 63.158 0.00 0.00 0.00 4.85
7182 8439 1.348008 GGACTCATCATCCCCAGGCA 61.348 60.000 0.00 0.00 0.00 4.75
7183 8440 0.108207 GACTCATCATCCCCAGGCAG 59.892 60.000 0.00 0.00 0.00 4.85
7184 8441 1.351080 ACTCATCATCCCCAGGCAGG 61.351 60.000 0.00 0.00 37.03 4.85
7185 8442 1.004626 TCATCATCCCCAGGCAGGA 59.995 57.895 0.00 0.00 41.22 3.86
7186 8443 1.150081 CATCATCCCCAGGCAGGAC 59.850 63.158 0.00 0.00 41.22 3.85
7187 8444 2.446848 ATCATCCCCAGGCAGGACG 61.447 63.158 0.00 0.00 41.22 4.79
7188 8445 4.181010 CATCCCCAGGCAGGACGG 62.181 72.222 0.00 0.00 41.22 4.79
7197 8454 4.451150 GCAGGACGGCCATGTCGA 62.451 66.667 11.69 0.00 39.83 4.20
7198 8455 2.509336 CAGGACGGCCATGTCGAC 60.509 66.667 11.69 9.11 39.83 4.20
7199 8456 2.994995 AGGACGGCCATGTCGACA 60.995 61.111 22.48 22.48 39.83 4.35
7200 8457 2.047655 GGACGGCCATGTCGACAA 60.048 61.111 24.13 6.23 39.83 3.18
7201 8458 2.100631 GGACGGCCATGTCGACAAG 61.101 63.158 24.13 18.59 39.83 3.16
7202 8459 2.047274 ACGGCCATGTCGACAAGG 60.047 61.111 30.60 30.60 37.74 3.61
7206 8463 3.578456 CCATGTCGACAAGGCCAC 58.422 61.111 25.31 0.00 0.00 5.01
7207 8464 2.040544 CCATGTCGACAAGGCCACC 61.041 63.158 25.31 0.00 0.00 4.61
7208 8465 2.047274 ATGTCGACAAGGCCACCG 60.047 61.111 24.13 2.24 0.00 4.94
7209 8466 2.879233 ATGTCGACAAGGCCACCGT 61.879 57.895 24.13 0.00 0.00 4.83
7210 8467 2.737376 GTCGACAAGGCCACCGTC 60.737 66.667 11.55 7.37 0.00 4.79
7211 8468 3.228017 TCGACAAGGCCACCGTCA 61.228 61.111 5.01 0.00 0.00 4.35
7212 8469 2.280524 CGACAAGGCCACCGTCAA 60.281 61.111 5.01 0.00 0.00 3.18
7213 8470 2.604174 CGACAAGGCCACCGTCAAC 61.604 63.158 5.01 0.00 0.00 3.18
7214 8471 2.590575 ACAAGGCCACCGTCAACG 60.591 61.111 5.01 0.00 39.44 4.10
7215 8472 4.025401 CAAGGCCACCGTCAACGC 62.025 66.667 5.01 0.00 38.18 4.84
7219 8476 4.025401 GCCACCGTCAACGCCAAG 62.025 66.667 0.00 0.00 38.18 3.61
7220 8477 3.353836 CCACCGTCAACGCCAAGG 61.354 66.667 0.00 0.00 38.18 3.61
7221 8478 2.280524 CACCGTCAACGCCAAGGA 60.281 61.111 0.00 0.00 38.18 3.36
7222 8479 2.030562 ACCGTCAACGCCAAGGAG 59.969 61.111 0.00 0.00 38.18 3.69
7223 8480 3.423154 CCGTCAACGCCAAGGAGC 61.423 66.667 0.00 0.00 38.18 4.70
7224 8481 2.664851 CGTCAACGCCAAGGAGCA 60.665 61.111 0.00 0.00 0.00 4.26
7225 8482 2.946762 GTCAACGCCAAGGAGCAC 59.053 61.111 0.00 0.00 0.00 4.40
7226 8483 2.281484 TCAACGCCAAGGAGCACC 60.281 61.111 0.00 0.00 0.00 5.01
7227 8484 3.365265 CAACGCCAAGGAGCACCC 61.365 66.667 0.00 0.00 36.73 4.61
7228 8485 4.660938 AACGCCAAGGAGCACCCC 62.661 66.667 0.00 0.00 36.73 4.95
7232 8489 4.760047 CCAAGGAGCACCCCGTCG 62.760 72.222 0.00 0.00 36.73 5.12
7250 8507 4.477975 CCGGCTGACCTCGTCGTC 62.478 72.222 0.00 0.00 34.95 4.20
7251 8508 4.813526 CGGCTGACCTCGTCGTCG 62.814 72.222 0.00 0.00 34.95 5.12
7252 8509 3.735029 GGCTGACCTCGTCGTCGT 61.735 66.667 1.33 0.00 34.95 4.34
7253 8510 2.202324 GCTGACCTCGTCGTCGTC 60.202 66.667 1.33 7.29 34.95 4.20
7254 8511 2.678956 GCTGACCTCGTCGTCGTCT 61.679 63.158 13.11 0.00 34.95 4.18
7255 8512 1.420702 CTGACCTCGTCGTCGTCTC 59.579 63.158 13.11 0.00 34.95 3.36
7256 8513 1.968703 CTGACCTCGTCGTCGTCTCC 61.969 65.000 13.11 0.00 34.95 3.71
7257 8514 1.741032 GACCTCGTCGTCGTCTCCT 60.741 63.158 1.33 0.00 38.33 3.69
7258 8515 1.694955 GACCTCGTCGTCGTCTCCTC 61.695 65.000 1.33 0.00 38.33 3.71
7259 8516 1.740664 CCTCGTCGTCGTCTCCTCA 60.741 63.158 1.33 0.00 38.33 3.86
7260 8517 1.420702 CTCGTCGTCGTCTCCTCAC 59.579 63.158 1.33 0.00 38.33 3.51
7261 8518 1.968703 CTCGTCGTCGTCTCCTCACC 61.969 65.000 1.33 0.00 38.33 4.02
7262 8519 2.322830 CGTCGTCGTCTCCTCACCA 61.323 63.158 0.00 0.00 0.00 4.17
7263 8520 1.209640 GTCGTCGTCTCCTCACCAC 59.790 63.158 0.00 0.00 0.00 4.16
7264 8521 2.176055 CGTCGTCTCCTCACCACG 59.824 66.667 0.00 0.00 34.78 4.94
7265 8522 2.322830 CGTCGTCTCCTCACCACGA 61.323 63.158 0.00 0.00 40.14 4.35
7266 8523 3.664495 TCGTCTCCTCACCACGAC 58.336 61.111 0.00 0.00 37.62 4.34
7267 8524 1.228033 TCGTCTCCTCACCACGACA 60.228 57.895 0.00 0.00 37.62 4.35
7268 8525 1.081376 CGTCTCCTCACCACGACAC 60.081 63.158 0.00 0.00 35.49 3.67
7269 8526 1.289380 GTCTCCTCACCACGACACC 59.711 63.158 0.00 0.00 0.00 4.16
7270 8527 1.152631 TCTCCTCACCACGACACCA 60.153 57.895 0.00 0.00 0.00 4.17
7271 8528 0.757561 TCTCCTCACCACGACACCAA 60.758 55.000 0.00 0.00 0.00 3.67
7272 8529 0.319900 CTCCTCACCACGACACCAAG 60.320 60.000 0.00 0.00 0.00 3.61
7273 8530 1.046472 TCCTCACCACGACACCAAGT 61.046 55.000 0.00 0.00 0.00 3.16
7274 8531 0.600255 CCTCACCACGACACCAAGTC 60.600 60.000 0.00 0.00 44.02 3.01
7284 8541 2.531206 GACACCAAGTCGATCACTAGC 58.469 52.381 0.00 0.00 37.53 3.42
7285 8542 2.164624 GACACCAAGTCGATCACTAGCT 59.835 50.000 0.00 0.00 37.53 3.32
7286 8543 2.094494 ACACCAAGTCGATCACTAGCTG 60.094 50.000 0.00 0.00 32.30 4.24
7287 8544 2.094494 CACCAAGTCGATCACTAGCTGT 60.094 50.000 0.00 0.00 32.30 4.40
7288 8545 3.128764 CACCAAGTCGATCACTAGCTGTA 59.871 47.826 0.00 0.00 32.30 2.74
7289 8546 3.378742 ACCAAGTCGATCACTAGCTGTAG 59.621 47.826 0.00 0.00 32.30 2.74
7290 8547 3.367607 CAAGTCGATCACTAGCTGTAGC 58.632 50.000 0.00 0.00 36.17 3.58
7303 8560 2.359900 GCTGTAGCTGCATTAGTTGGT 58.640 47.619 4.51 0.00 38.21 3.67
7304 8561 2.352960 GCTGTAGCTGCATTAGTTGGTC 59.647 50.000 4.51 0.00 38.21 4.02
7305 8562 3.866651 CTGTAGCTGCATTAGTTGGTCT 58.133 45.455 4.51 0.00 0.00 3.85
7306 8563 3.599343 TGTAGCTGCATTAGTTGGTCTG 58.401 45.455 0.00 0.00 0.00 3.51
7307 8564 2.867109 AGCTGCATTAGTTGGTCTGT 57.133 45.000 1.02 0.00 0.00 3.41
7308 8565 3.146104 AGCTGCATTAGTTGGTCTGTT 57.854 42.857 1.02 0.00 0.00 3.16
7309 8566 3.490348 AGCTGCATTAGTTGGTCTGTTT 58.510 40.909 1.02 0.00 0.00 2.83
7310 8567 3.891366 AGCTGCATTAGTTGGTCTGTTTT 59.109 39.130 1.02 0.00 0.00 2.43
7311 8568 4.342092 AGCTGCATTAGTTGGTCTGTTTTT 59.658 37.500 1.02 0.00 0.00 1.94
7327 8584 2.008242 TTTTTCCCTGATGGTGGTGG 57.992 50.000 0.00 0.00 34.77 4.61
7328 8585 0.856982 TTTTCCCTGATGGTGGTGGT 59.143 50.000 0.00 0.00 34.77 4.16
7329 8586 0.112218 TTTCCCTGATGGTGGTGGTG 59.888 55.000 0.00 0.00 34.77 4.17
7330 8587 1.788518 TTCCCTGATGGTGGTGGTGG 61.789 60.000 0.00 0.00 34.77 4.61
7331 8588 2.356278 CCTGATGGTGGTGGTGGG 59.644 66.667 0.00 0.00 0.00 4.61
7332 8589 2.538141 CCTGATGGTGGTGGTGGGT 61.538 63.158 0.00 0.00 0.00 4.51
7333 8590 1.303561 CTGATGGTGGTGGTGGGTG 60.304 63.158 0.00 0.00 0.00 4.61
7334 8591 2.067932 CTGATGGTGGTGGTGGGTGT 62.068 60.000 0.00 0.00 0.00 4.16
7335 8592 1.303317 GATGGTGGTGGTGGGTGTC 60.303 63.158 0.00 0.00 0.00 3.67
7336 8593 1.774217 ATGGTGGTGGTGGGTGTCT 60.774 57.895 0.00 0.00 0.00 3.41
7337 8594 2.067932 ATGGTGGTGGTGGGTGTCTG 62.068 60.000 0.00 0.00 0.00 3.51
7338 8595 2.752807 GGTGGTGGTGGGTGTCTGT 61.753 63.158 0.00 0.00 0.00 3.41
7339 8596 1.227853 GTGGTGGTGGGTGTCTGTC 60.228 63.158 0.00 0.00 0.00 3.51
7340 8597 1.383943 TGGTGGTGGGTGTCTGTCT 60.384 57.895 0.00 0.00 0.00 3.41
7341 8598 1.071471 GGTGGTGGGTGTCTGTCTG 59.929 63.158 0.00 0.00 0.00 3.51
7342 8599 1.696097 GGTGGTGGGTGTCTGTCTGT 61.696 60.000 0.00 0.00 0.00 3.41
7343 8600 0.249911 GTGGTGGGTGTCTGTCTGTC 60.250 60.000 0.00 0.00 0.00 3.51
7344 8601 0.398522 TGGTGGGTGTCTGTCTGTCT 60.399 55.000 0.00 0.00 0.00 3.41
7345 8602 0.034059 GGTGGGTGTCTGTCTGTCTG 59.966 60.000 0.00 0.00 0.00 3.51
7346 8603 0.753262 GTGGGTGTCTGTCTGTCTGT 59.247 55.000 0.00 0.00 0.00 3.41
7347 8604 0.752658 TGGGTGTCTGTCTGTCTGTG 59.247 55.000 0.00 0.00 0.00 3.66
7348 8605 1.040646 GGGTGTCTGTCTGTCTGTGA 58.959 55.000 0.00 0.00 0.00 3.58
7349 8606 1.412710 GGGTGTCTGTCTGTCTGTGAA 59.587 52.381 0.00 0.00 0.00 3.18
7350 8607 2.546795 GGGTGTCTGTCTGTCTGTGAAG 60.547 54.545 0.00 0.00 0.00 3.02
7351 8608 2.131183 GTGTCTGTCTGTCTGTGAAGC 58.869 52.381 0.00 0.00 0.00 3.86
7352 8609 1.756538 TGTCTGTCTGTCTGTGAAGCA 59.243 47.619 0.00 0.00 0.00 3.91
7353 8610 2.168313 TGTCTGTCTGTCTGTGAAGCAA 59.832 45.455 0.00 0.00 0.00 3.91
7354 8611 2.799412 GTCTGTCTGTCTGTGAAGCAAG 59.201 50.000 0.00 0.00 0.00 4.01
7355 8612 2.432146 TCTGTCTGTCTGTGAAGCAAGT 59.568 45.455 0.00 0.00 0.00 3.16
7356 8613 2.543012 CTGTCTGTCTGTGAAGCAAGTG 59.457 50.000 0.00 0.00 0.00 3.16
7357 8614 2.093500 TGTCTGTCTGTGAAGCAAGTGT 60.093 45.455 0.00 0.00 0.00 3.55
7358 8615 2.541762 GTCTGTCTGTGAAGCAAGTGTC 59.458 50.000 0.00 0.00 0.00 3.67
7359 8616 2.168313 TCTGTCTGTGAAGCAAGTGTCA 59.832 45.455 0.00 0.00 0.00 3.58
7360 8617 2.938451 CTGTCTGTGAAGCAAGTGTCAA 59.062 45.455 0.00 0.00 0.00 3.18
7361 8618 2.677836 TGTCTGTGAAGCAAGTGTCAAC 59.322 45.455 0.00 0.00 0.00 3.18
7362 8619 2.677836 GTCTGTGAAGCAAGTGTCAACA 59.322 45.455 0.00 0.00 0.00 3.33
7363 8620 3.126858 GTCTGTGAAGCAAGTGTCAACAA 59.873 43.478 0.00 0.00 0.00 2.83
7364 8621 3.374988 TCTGTGAAGCAAGTGTCAACAAG 59.625 43.478 0.00 0.00 0.00 3.16
7365 8622 3.081061 TGTGAAGCAAGTGTCAACAAGT 58.919 40.909 0.00 0.00 0.00 3.16
7366 8623 3.119884 TGTGAAGCAAGTGTCAACAAGTG 60.120 43.478 0.00 0.00 0.00 3.16
7367 8624 2.159393 TGAAGCAAGTGTCAACAAGTGC 60.159 45.455 9.99 9.99 37.86 4.40
7368 8625 1.755179 AGCAAGTGTCAACAAGTGCT 58.245 45.000 13.33 13.33 40.97 4.40
7369 8626 1.402968 AGCAAGTGTCAACAAGTGCTG 59.597 47.619 16.71 0.00 42.85 4.41
7370 8627 1.534595 GCAAGTGTCAACAAGTGCTGG 60.535 52.381 10.50 0.00 35.92 4.85
7371 8628 1.745087 CAAGTGTCAACAAGTGCTGGT 59.255 47.619 0.00 0.00 0.00 4.00
7372 8629 1.382522 AGTGTCAACAAGTGCTGGTG 58.617 50.000 0.00 0.00 44.90 4.17
7373 8630 1.094785 GTGTCAACAAGTGCTGGTGT 58.905 50.000 0.00 0.00 43.84 4.16
7374 8631 1.472480 GTGTCAACAAGTGCTGGTGTT 59.528 47.619 0.00 0.00 43.84 3.32
7375 8632 2.094752 GTGTCAACAAGTGCTGGTGTTT 60.095 45.455 0.00 0.00 43.84 2.83
7376 8633 2.163412 TGTCAACAAGTGCTGGTGTTTC 59.837 45.455 0.00 0.00 43.84 2.78
7377 8634 2.163412 GTCAACAAGTGCTGGTGTTTCA 59.837 45.455 0.00 0.00 43.84 2.69
7378 8635 3.023119 TCAACAAGTGCTGGTGTTTCAT 58.977 40.909 0.00 0.00 43.84 2.57
7379 8636 3.066621 TCAACAAGTGCTGGTGTTTCATC 59.933 43.478 0.00 0.00 43.84 2.92
7380 8637 2.653726 ACAAGTGCTGGTGTTTCATCA 58.346 42.857 0.00 0.00 0.00 3.07
7381 8638 3.225104 ACAAGTGCTGGTGTTTCATCAT 58.775 40.909 0.00 0.00 0.00 2.45
7382 8639 3.254166 ACAAGTGCTGGTGTTTCATCATC 59.746 43.478 0.00 0.00 0.00 2.92
7383 8640 3.144657 AGTGCTGGTGTTTCATCATCA 57.855 42.857 0.00 0.00 0.00 3.07
7384 8641 3.079578 AGTGCTGGTGTTTCATCATCAG 58.920 45.455 3.01 3.01 45.94 2.90
7385 8642 3.076621 GTGCTGGTGTTTCATCATCAGA 58.923 45.455 10.55 0.00 46.04 3.27
7386 8643 3.693085 GTGCTGGTGTTTCATCATCAGAT 59.307 43.478 10.55 0.00 46.04 2.90
7387 8644 3.943381 TGCTGGTGTTTCATCATCAGATC 59.057 43.478 10.55 0.00 46.04 2.75
7388 8645 3.943381 GCTGGTGTTTCATCATCAGATCA 59.057 43.478 10.55 0.00 46.04 2.92
7389 8646 4.035324 GCTGGTGTTTCATCATCAGATCAG 59.965 45.833 10.55 0.00 46.04 2.90
7390 8647 5.425196 TGGTGTTTCATCATCAGATCAGA 57.575 39.130 0.00 0.00 30.20 3.27
7391 8648 5.181009 TGGTGTTTCATCATCAGATCAGAC 58.819 41.667 0.00 0.00 30.20 3.51
7392 8649 5.181009 GGTGTTTCATCATCAGATCAGACA 58.819 41.667 0.00 0.00 30.20 3.41
7393 8650 5.293814 GGTGTTTCATCATCAGATCAGACAG 59.706 44.000 0.00 0.00 30.20 3.51
7394 8651 5.873712 GTGTTTCATCATCAGATCAGACAGT 59.126 40.000 0.00 0.00 30.20 3.55
7395 8652 6.035866 GTGTTTCATCATCAGATCAGACAGTC 59.964 42.308 0.00 0.00 30.20 3.51
7396 8653 4.933505 TCATCATCAGATCAGACAGTCC 57.066 45.455 0.00 0.00 30.20 3.85
7397 8654 3.640498 TCATCATCAGATCAGACAGTCCC 59.360 47.826 0.00 0.00 30.20 4.46
7398 8655 3.395054 TCATCAGATCAGACAGTCCCT 57.605 47.619 0.00 0.00 0.00 4.20
7399 8656 3.295093 TCATCAGATCAGACAGTCCCTC 58.705 50.000 0.00 0.00 0.00 4.30
7400 8657 2.151502 TCAGATCAGACAGTCCCTCC 57.848 55.000 0.00 0.00 0.00 4.30
7401 8658 1.643286 TCAGATCAGACAGTCCCTCCT 59.357 52.381 0.00 0.00 0.00 3.69
7402 8659 2.043664 TCAGATCAGACAGTCCCTCCTT 59.956 50.000 0.00 0.00 0.00 3.36
7403 8660 2.836981 CAGATCAGACAGTCCCTCCTTT 59.163 50.000 0.00 0.00 0.00 3.11
7404 8661 2.836981 AGATCAGACAGTCCCTCCTTTG 59.163 50.000 0.00 0.00 0.00 2.77
7405 8662 2.103153 TCAGACAGTCCCTCCTTTGT 57.897 50.000 0.00 0.00 0.00 2.83
7406 8663 1.694150 TCAGACAGTCCCTCCTTTGTG 59.306 52.381 0.00 0.00 0.00 3.33
7407 8664 0.398318 AGACAGTCCCTCCTTTGTGC 59.602 55.000 0.00 0.00 0.00 4.57
7408 8665 0.108585 GACAGTCCCTCCTTTGTGCA 59.891 55.000 0.00 0.00 0.00 4.57
7409 8666 0.550914 ACAGTCCCTCCTTTGTGCAA 59.449 50.000 0.00 0.00 0.00 4.08
7410 8667 1.064017 ACAGTCCCTCCTTTGTGCAAA 60.064 47.619 0.00 0.00 0.00 3.68
7411 8668 2.242043 CAGTCCCTCCTTTGTGCAAAT 58.758 47.619 0.00 0.00 0.00 2.32
7412 8669 2.629617 CAGTCCCTCCTTTGTGCAAATT 59.370 45.455 0.00 0.00 0.00 1.82
7413 8670 3.826157 CAGTCCCTCCTTTGTGCAAATTA 59.174 43.478 0.00 0.00 0.00 1.40
7414 8671 4.280677 CAGTCCCTCCTTTGTGCAAATTAA 59.719 41.667 0.00 0.00 0.00 1.40
7415 8672 4.280929 AGTCCCTCCTTTGTGCAAATTAAC 59.719 41.667 0.00 0.00 0.00 2.01
7416 8673 4.038642 GTCCCTCCTTTGTGCAAATTAACA 59.961 41.667 0.00 0.00 0.00 2.41
7417 8674 4.280677 TCCCTCCTTTGTGCAAATTAACAG 59.719 41.667 0.00 0.00 0.00 3.16
7418 8675 4.280677 CCCTCCTTTGTGCAAATTAACAGA 59.719 41.667 0.00 0.00 0.00 3.41
7419 8676 5.222631 CCTCCTTTGTGCAAATTAACAGAC 58.777 41.667 0.00 0.00 0.00 3.51
7420 8677 4.854399 TCCTTTGTGCAAATTAACAGACG 58.146 39.130 0.00 0.00 0.00 4.18
7421 8678 3.425193 CCTTTGTGCAAATTAACAGACGC 59.575 43.478 0.00 0.00 0.00 5.19
7422 8679 3.980646 TTGTGCAAATTAACAGACGCT 57.019 38.095 0.00 0.00 0.00 5.07
7423 8680 3.980646 TGTGCAAATTAACAGACGCTT 57.019 38.095 0.00 0.00 0.00 4.68
7424 8681 4.300189 TGTGCAAATTAACAGACGCTTT 57.700 36.364 0.00 0.00 0.00 3.51
7425 8682 4.286910 TGTGCAAATTAACAGACGCTTTC 58.713 39.130 0.00 0.00 0.00 2.62
7426 8683 4.036262 TGTGCAAATTAACAGACGCTTTCT 59.964 37.500 0.00 0.00 33.33 2.52
7439 8696 0.444260 GCTTTCTGAGCCGTGTTAGC 59.556 55.000 0.00 0.00 46.01 3.09
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 4.569943 AGCCTGCATATCGGTATAACTTG 58.430 43.478 0.00 0.00 0.00 3.16
3 4 4.152402 CACAAGCCTGCATATCGGTATAAC 59.848 45.833 0.00 0.00 0.00 1.89
5 6 3.864540 GCACAAGCCTGCATATCGGTATA 60.865 47.826 0.00 0.00 37.11 1.47
6 7 2.771089 CACAAGCCTGCATATCGGTAT 58.229 47.619 0.00 0.00 0.00 2.73
8 9 1.097547 GCACAAGCCTGCATATCGGT 61.098 55.000 0.00 0.00 37.11 4.69
9 10 1.650912 GCACAAGCCTGCATATCGG 59.349 57.895 0.00 0.00 37.11 4.18
20 21 0.593128 AATTCGTCACAGGCACAAGC 59.407 50.000 0.00 0.00 41.10 4.01
21 22 2.653890 CAAATTCGTCACAGGCACAAG 58.346 47.619 0.00 0.00 0.00 3.16
22 23 1.268999 GCAAATTCGTCACAGGCACAA 60.269 47.619 0.00 0.00 0.00 3.33
23 24 0.310543 GCAAATTCGTCACAGGCACA 59.689 50.000 0.00 0.00 0.00 4.57
24 25 0.593128 AGCAAATTCGTCACAGGCAC 59.407 50.000 0.00 0.00 0.00 5.01
25 26 2.076100 CTAGCAAATTCGTCACAGGCA 58.924 47.619 0.00 0.00 0.00 4.75
26 27 2.346803 TCTAGCAAATTCGTCACAGGC 58.653 47.619 0.00 0.00 0.00 4.85
27 28 5.122239 TCAAATCTAGCAAATTCGTCACAGG 59.878 40.000 0.00 0.00 0.00 4.00
28 29 6.169419 TCAAATCTAGCAAATTCGTCACAG 57.831 37.500 0.00 0.00 0.00 3.66
29 30 6.371271 TGATCAAATCTAGCAAATTCGTCACA 59.629 34.615 0.00 0.00 0.00 3.58
30 31 6.775088 TGATCAAATCTAGCAAATTCGTCAC 58.225 36.000 0.00 0.00 0.00 3.67
31 32 6.983474 TGATCAAATCTAGCAAATTCGTCA 57.017 33.333 0.00 0.00 0.00 4.35
32 33 8.847444 AAATGATCAAATCTAGCAAATTCGTC 57.153 30.769 0.00 0.00 0.00 4.20
33 34 9.722056 GTAAATGATCAAATCTAGCAAATTCGT 57.278 29.630 0.00 0.00 0.00 3.85
34 35 9.720667 TGTAAATGATCAAATCTAGCAAATTCG 57.279 29.630 0.00 0.00 0.00 3.34
38 39 9.624697 GTGTTGTAAATGATCAAATCTAGCAAA 57.375 29.630 0.00 0.00 0.00 3.68
39 40 9.013229 AGTGTTGTAAATGATCAAATCTAGCAA 57.987 29.630 0.00 0.00 0.00 3.91
40 41 8.565896 AGTGTTGTAAATGATCAAATCTAGCA 57.434 30.769 0.00 0.00 0.00 3.49
41 42 9.922305 GTAGTGTTGTAAATGATCAAATCTAGC 57.078 33.333 0.00 0.00 0.00 3.42
47 48 9.653287 CTCTAGGTAGTGTTGTAAATGATCAAA 57.347 33.333 0.00 0.00 0.00 2.69
48 49 9.031537 TCTCTAGGTAGTGTTGTAAATGATCAA 57.968 33.333 0.00 0.00 0.00 2.57
49 50 8.589701 TCTCTAGGTAGTGTTGTAAATGATCA 57.410 34.615 0.00 0.00 0.00 2.92
50 51 9.522804 CTTCTCTAGGTAGTGTTGTAAATGATC 57.477 37.037 0.00 0.00 0.00 2.92
51 52 7.982354 GCTTCTCTAGGTAGTGTTGTAAATGAT 59.018 37.037 0.00 0.00 0.00 2.45
52 53 7.321153 GCTTCTCTAGGTAGTGTTGTAAATGA 58.679 38.462 0.00 0.00 0.00 2.57
53 54 6.535508 GGCTTCTCTAGGTAGTGTTGTAAATG 59.464 42.308 0.00 0.00 0.00 2.32
54 55 6.627508 CGGCTTCTCTAGGTAGTGTTGTAAAT 60.628 42.308 0.00 0.00 0.00 1.40
55 56 5.336213 CGGCTTCTCTAGGTAGTGTTGTAAA 60.336 44.000 0.00 0.00 0.00 2.01
56 57 4.157289 CGGCTTCTCTAGGTAGTGTTGTAA 59.843 45.833 0.00 0.00 0.00 2.41
57 58 3.693085 CGGCTTCTCTAGGTAGTGTTGTA 59.307 47.826 0.00 0.00 0.00 2.41
58 59 2.492484 CGGCTTCTCTAGGTAGTGTTGT 59.508 50.000 0.00 0.00 0.00 3.32
59 60 2.492484 ACGGCTTCTCTAGGTAGTGTTG 59.508 50.000 0.00 0.00 0.00 3.33
60 61 2.805194 ACGGCTTCTCTAGGTAGTGTT 58.195 47.619 0.00 0.00 0.00 3.32
61 62 2.510928 ACGGCTTCTCTAGGTAGTGT 57.489 50.000 0.00 0.00 0.00 3.55
62 63 3.870633 AAACGGCTTCTCTAGGTAGTG 57.129 47.619 0.00 0.00 0.00 2.74
63 64 3.616802 GCAAAACGGCTTCTCTAGGTAGT 60.617 47.826 0.00 0.00 0.00 2.73
64 65 2.930682 GCAAAACGGCTTCTCTAGGTAG 59.069 50.000 0.00 0.00 0.00 3.18
65 66 2.300723 TGCAAAACGGCTTCTCTAGGTA 59.699 45.455 0.00 0.00 34.04 3.08
66 67 1.071699 TGCAAAACGGCTTCTCTAGGT 59.928 47.619 0.00 0.00 34.04 3.08
67 68 1.734465 CTGCAAAACGGCTTCTCTAGG 59.266 52.381 0.00 0.00 34.04 3.02
68 69 2.688507 TCTGCAAAACGGCTTCTCTAG 58.311 47.619 0.00 0.00 34.04 2.43
69 70 2.831685 TCTGCAAAACGGCTTCTCTA 57.168 45.000 0.00 0.00 34.04 2.43
70 71 1.967319 TTCTGCAAAACGGCTTCTCT 58.033 45.000 0.00 0.00 34.04 3.10
71 72 2.997485 ATTCTGCAAAACGGCTTCTC 57.003 45.000 0.00 0.00 34.04 2.87
72 73 3.068024 TGAAATTCTGCAAAACGGCTTCT 59.932 39.130 0.00 0.00 34.04 2.85
73 74 3.380142 TGAAATTCTGCAAAACGGCTTC 58.620 40.909 0.00 0.00 34.04 3.86
74 75 3.451141 TGAAATTCTGCAAAACGGCTT 57.549 38.095 0.00 0.00 34.04 4.35
75 76 3.665745 ATGAAATTCTGCAAAACGGCT 57.334 38.095 0.00 0.00 34.04 5.52
76 77 3.859386 CCTATGAAATTCTGCAAAACGGC 59.141 43.478 0.00 0.00 0.00 5.68
77 78 3.859386 GCCTATGAAATTCTGCAAAACGG 59.141 43.478 0.00 0.00 0.00 4.44
78 79 4.324402 GTGCCTATGAAATTCTGCAAAACG 59.676 41.667 0.00 0.00 0.00 3.60
79 80 5.473039 AGTGCCTATGAAATTCTGCAAAAC 58.527 37.500 0.00 0.00 0.00 2.43
80 81 5.619757 CGAGTGCCTATGAAATTCTGCAAAA 60.620 40.000 0.00 0.00 0.00 2.44
81 82 4.142622 CGAGTGCCTATGAAATTCTGCAAA 60.143 41.667 0.00 0.00 0.00 3.68
82 83 3.374988 CGAGTGCCTATGAAATTCTGCAA 59.625 43.478 0.00 0.00 0.00 4.08
83 84 2.938451 CGAGTGCCTATGAAATTCTGCA 59.062 45.455 0.00 0.00 0.00 4.41
84 85 3.198068 TCGAGTGCCTATGAAATTCTGC 58.802 45.455 0.00 0.00 0.00 4.26
85 86 3.806521 CCTCGAGTGCCTATGAAATTCTG 59.193 47.826 12.31 0.00 0.00 3.02
86 87 3.706594 TCCTCGAGTGCCTATGAAATTCT 59.293 43.478 12.31 0.00 0.00 2.40
87 88 4.060038 TCCTCGAGTGCCTATGAAATTC 57.940 45.455 12.31 0.00 0.00 2.17
88 89 4.487714 TTCCTCGAGTGCCTATGAAATT 57.512 40.909 12.31 0.00 0.00 1.82
89 90 4.101585 TCATTCCTCGAGTGCCTATGAAAT 59.898 41.667 12.31 0.00 0.00 2.17
90 91 3.450817 TCATTCCTCGAGTGCCTATGAAA 59.549 43.478 12.31 0.00 0.00 2.69
91 92 3.031013 TCATTCCTCGAGTGCCTATGAA 58.969 45.455 12.31 6.10 0.00 2.57
92 93 2.666317 TCATTCCTCGAGTGCCTATGA 58.334 47.619 12.31 9.37 0.00 2.15
93 94 3.181471 ACTTCATTCCTCGAGTGCCTATG 60.181 47.826 12.31 7.30 0.00 2.23
100 101 2.175202 AGCAGACTTCATTCCTCGAGT 58.825 47.619 12.31 0.00 0.00 4.18
105 106 4.090761 TGTGAAAGCAGACTTCATTCCT 57.909 40.909 0.00 0.00 34.05 3.36
107 108 5.679734 TCTTGTGAAAGCAGACTTCATTC 57.320 39.130 0.00 0.00 34.05 2.67
109 110 5.106791 CGAATCTTGTGAAAGCAGACTTCAT 60.107 40.000 0.00 0.00 34.05 2.57
111 112 4.449068 TCGAATCTTGTGAAAGCAGACTTC 59.551 41.667 0.00 0.00 34.05 3.01
118 119 4.092091 CCTGTACTCGAATCTTGTGAAAGC 59.908 45.833 0.00 0.00 0.00 3.51
119 120 4.627467 CCCTGTACTCGAATCTTGTGAAAG 59.373 45.833 0.00 0.00 0.00 2.62
122 123 2.094182 GCCCTGTACTCGAATCTTGTGA 60.094 50.000 0.00 0.00 0.00 3.58
123 124 2.271800 GCCCTGTACTCGAATCTTGTG 58.728 52.381 0.00 0.00 0.00 3.33
124 125 1.899814 TGCCCTGTACTCGAATCTTGT 59.100 47.619 0.00 0.00 0.00 3.16
132 133 1.272490 TCTTGAGTTGCCCTGTACTCG 59.728 52.381 0.00 0.00 42.88 4.18
133 134 2.933056 GCTCTTGAGTTGCCCTGTACTC 60.933 54.545 0.00 0.00 40.89 2.59
134 135 1.002544 GCTCTTGAGTTGCCCTGTACT 59.997 52.381 0.00 0.00 0.00 2.73
135 136 1.002544 AGCTCTTGAGTTGCCCTGTAC 59.997 52.381 0.00 0.00 0.00 2.90
136 137 1.352083 AGCTCTTGAGTTGCCCTGTA 58.648 50.000 0.00 0.00 0.00 2.74
183 185 2.365293 GCTGTCACACCTTTCCCATTTT 59.635 45.455 0.00 0.00 0.00 1.82
186 188 0.773644 AGCTGTCACACCTTTCCCAT 59.226 50.000 0.00 0.00 0.00 4.00
188 190 0.606673 GGAGCTGTCACACCTTTCCC 60.607 60.000 0.00 0.00 0.00 3.97
189 191 0.606673 GGGAGCTGTCACACCTTTCC 60.607 60.000 0.00 0.00 0.00 3.13
190 192 0.951040 CGGGAGCTGTCACACCTTTC 60.951 60.000 0.00 0.00 0.00 2.62
191 193 1.071471 CGGGAGCTGTCACACCTTT 59.929 57.895 0.00 0.00 0.00 3.11
192 194 2.743718 CGGGAGCTGTCACACCTT 59.256 61.111 0.00 0.00 0.00 3.50
193 195 3.314331 CCGGGAGCTGTCACACCT 61.314 66.667 0.00 0.00 0.00 4.00
194 196 4.394712 CCCGGGAGCTGTCACACC 62.395 72.222 18.48 0.00 0.00 4.16
195 197 3.626924 ACCCGGGAGCTGTCACAC 61.627 66.667 32.02 0.00 0.00 3.82
199 201 4.767255 CTGCACCCGGGAGCTGTC 62.767 72.222 37.52 17.77 33.00 3.51
216 218 1.379044 CTGTTCATGAGGGTGCCCC 60.379 63.158 3.17 2.16 45.90 5.80
217 219 0.618458 TACTGTTCATGAGGGTGCCC 59.382 55.000 0.00 0.00 0.00 5.36
218 220 2.084546 GTTACTGTTCATGAGGGTGCC 58.915 52.381 0.00 0.00 0.00 5.01
219 221 3.059352 AGTTACTGTTCATGAGGGTGC 57.941 47.619 0.00 0.00 0.00 5.01
220 222 4.641396 TCAAGTTACTGTTCATGAGGGTG 58.359 43.478 0.00 0.00 0.00 4.61
221 223 4.974645 TCAAGTTACTGTTCATGAGGGT 57.025 40.909 0.00 0.00 0.00 4.34
222 224 6.039270 TGTTTTCAAGTTACTGTTCATGAGGG 59.961 38.462 0.00 0.00 0.00 4.30
223 225 7.026631 TGTTTTCAAGTTACTGTTCATGAGG 57.973 36.000 0.00 0.00 0.00 3.86
258 260 8.631797 CCCCAACATTTCAGAATTTTTCAATTT 58.368 29.630 0.00 0.00 32.35 1.82
259 261 7.231115 CCCCCAACATTTCAGAATTTTTCAATT 59.769 33.333 0.00 0.00 35.12 2.32
260 262 6.716173 CCCCCAACATTTCAGAATTTTTCAAT 59.284 34.615 0.00 0.00 0.00 2.57
261 263 6.060788 CCCCCAACATTTCAGAATTTTTCAA 58.939 36.000 0.00 0.00 0.00 2.69
262 264 5.367937 TCCCCCAACATTTCAGAATTTTTCA 59.632 36.000 0.00 0.00 0.00 2.69
263 265 5.863965 TCCCCCAACATTTCAGAATTTTTC 58.136 37.500 0.00 0.00 0.00 2.29
264 266 5.903198 TCCCCCAACATTTCAGAATTTTT 57.097 34.783 0.00 0.00 0.00 1.94
265 267 5.547276 TGATCCCCCAACATTTCAGAATTTT 59.453 36.000 0.00 0.00 0.00 1.82
266 268 5.092968 TGATCCCCCAACATTTCAGAATTT 58.907 37.500 0.00 0.00 0.00 1.82
267 269 4.686891 TGATCCCCCAACATTTCAGAATT 58.313 39.130 0.00 0.00 0.00 2.17
268 270 4.335735 TGATCCCCCAACATTTCAGAAT 57.664 40.909 0.00 0.00 0.00 2.40
269 271 3.824001 TGATCCCCCAACATTTCAGAA 57.176 42.857 0.00 0.00 0.00 3.02
270 272 3.824001 TTGATCCCCCAACATTTCAGA 57.176 42.857 0.00 0.00 0.00 3.27
271 273 6.324512 TCATATTTGATCCCCCAACATTTCAG 59.675 38.462 0.00 0.00 0.00 3.02
272 274 6.200852 TCATATTTGATCCCCCAACATTTCA 58.799 36.000 0.00 0.00 0.00 2.69
273 275 6.729690 TCATATTTGATCCCCCAACATTTC 57.270 37.500 0.00 0.00 0.00 2.17
298 300 5.947503 TTTGCGAGAACATCAAAAGTTTG 57.052 34.783 0.00 0.00 39.48 2.93
299 301 7.538303 AAATTTGCGAGAACATCAAAAGTTT 57.462 28.000 0.00 0.00 34.00 2.66
300 302 7.277539 TGAAAATTTGCGAGAACATCAAAAGTT 59.722 29.630 0.00 0.00 34.00 2.66
301 303 6.756074 TGAAAATTTGCGAGAACATCAAAAGT 59.244 30.769 0.00 0.00 34.00 2.66
302 304 7.164226 TGAAAATTTGCGAGAACATCAAAAG 57.836 32.000 0.00 0.00 34.00 2.27
303 305 6.292274 GCTGAAAATTTGCGAGAACATCAAAA 60.292 34.615 0.00 0.00 34.00 2.44
304 306 5.175491 GCTGAAAATTTGCGAGAACATCAAA 59.825 36.000 0.00 0.00 34.68 2.69
305 307 4.681025 GCTGAAAATTTGCGAGAACATCAA 59.319 37.500 0.00 0.00 0.00 2.57
306 308 4.229096 GCTGAAAATTTGCGAGAACATCA 58.771 39.130 0.00 0.00 0.00 3.07
307 309 3.609807 GGCTGAAAATTTGCGAGAACATC 59.390 43.478 0.00 0.00 0.00 3.06
308 310 3.005684 TGGCTGAAAATTTGCGAGAACAT 59.994 39.130 0.00 0.00 0.00 2.71
309 311 2.360483 TGGCTGAAAATTTGCGAGAACA 59.640 40.909 0.00 0.00 0.00 3.18
310 312 2.982470 CTGGCTGAAAATTTGCGAGAAC 59.018 45.455 5.42 0.00 35.12 3.01
311 313 2.884012 TCTGGCTGAAAATTTGCGAGAA 59.116 40.909 10.08 0.00 38.30 2.87
312 314 2.503331 TCTGGCTGAAAATTTGCGAGA 58.497 42.857 8.88 8.88 38.77 4.04
313 315 2.995466 TCTGGCTGAAAATTTGCGAG 57.005 45.000 5.09 5.09 34.60 5.03
314 316 3.724508 TTTCTGGCTGAAAATTTGCGA 57.275 38.095 15.97 0.00 41.23 5.10
322 324 2.033299 CGAGTGCTTTTTCTGGCTGAAA 59.967 45.455 14.58 14.58 42.33 2.69
323 325 1.603802 CGAGTGCTTTTTCTGGCTGAA 59.396 47.619 2.37 2.37 0.00 3.02
324 326 1.202639 TCGAGTGCTTTTTCTGGCTGA 60.203 47.619 0.00 0.00 0.00 4.26
325 327 1.196354 CTCGAGTGCTTTTTCTGGCTG 59.804 52.381 3.62 0.00 0.00 4.85
326 328 1.517242 CTCGAGTGCTTTTTCTGGCT 58.483 50.000 3.62 0.00 0.00 4.75
327 329 0.519077 CCTCGAGTGCTTTTTCTGGC 59.481 55.000 12.31 0.00 0.00 4.85
328 330 2.072298 CTCCTCGAGTGCTTTTTCTGG 58.928 52.381 12.31 0.00 0.00 3.86
329 331 1.462670 GCTCCTCGAGTGCTTTTTCTG 59.537 52.381 12.31 0.00 32.10 3.02
330 332 1.609320 GGCTCCTCGAGTGCTTTTTCT 60.609 52.381 21.45 0.00 35.28 2.52
331 333 0.799393 GGCTCCTCGAGTGCTTTTTC 59.201 55.000 21.45 6.43 35.28 2.29
332 334 0.606673 GGGCTCCTCGAGTGCTTTTT 60.607 55.000 21.45 0.00 35.28 1.94
333 335 1.003233 GGGCTCCTCGAGTGCTTTT 60.003 57.895 21.45 0.00 35.28 2.27
334 336 1.893919 GAGGGCTCCTCGAGTGCTTT 61.894 60.000 21.45 13.00 41.08 3.51
335 337 2.284258 AGGGCTCCTCGAGTGCTT 60.284 61.111 21.45 11.39 35.28 3.91
336 338 2.757917 GAGGGCTCCTCGAGTGCT 60.758 66.667 21.45 7.97 41.08 4.40
361 363 8.682710 TGTACTTTTGAGCAGTAATCTGTTTTT 58.317 29.630 0.00 0.00 43.05 1.94
362 364 8.129211 GTGTACTTTTGAGCAGTAATCTGTTTT 58.871 33.333 0.00 0.00 43.05 2.43
363 365 7.282224 TGTGTACTTTTGAGCAGTAATCTGTTT 59.718 33.333 0.00 0.00 43.05 2.83
364 366 6.765989 TGTGTACTTTTGAGCAGTAATCTGTT 59.234 34.615 0.00 0.00 43.05 3.16
365 367 6.288294 TGTGTACTTTTGAGCAGTAATCTGT 58.712 36.000 0.00 0.00 43.05 3.41
366 368 6.785488 TGTGTACTTTTGAGCAGTAATCTG 57.215 37.500 0.00 0.00 43.87 2.90
367 369 8.936864 GTTATGTGTACTTTTGAGCAGTAATCT 58.063 33.333 0.00 0.00 0.00 2.40
368 370 8.936864 AGTTATGTGTACTTTTGAGCAGTAATC 58.063 33.333 0.00 0.00 0.00 1.75
369 371 8.848474 AGTTATGTGTACTTTTGAGCAGTAAT 57.152 30.769 0.00 0.00 0.00 1.89
370 372 8.671384 AAGTTATGTGTACTTTTGAGCAGTAA 57.329 30.769 0.00 0.00 32.06 2.24
371 373 8.556194 CAAAGTTATGTGTACTTTTGAGCAGTA 58.444 33.333 0.00 0.00 42.32 2.74
372 374 7.282224 TCAAAGTTATGTGTACTTTTGAGCAGT 59.718 33.333 0.00 0.00 42.32 4.40
373 375 7.639039 TCAAAGTTATGTGTACTTTTGAGCAG 58.361 34.615 0.00 0.00 42.32 4.24
374 376 7.561021 TCAAAGTTATGTGTACTTTTGAGCA 57.439 32.000 0.00 0.00 42.32 4.26
375 377 7.913297 TGTTCAAAGTTATGTGTACTTTTGAGC 59.087 33.333 0.00 5.15 42.32 4.26
376 378 9.221775 GTGTTCAAAGTTATGTGTACTTTTGAG 57.778 33.333 0.00 0.00 42.32 3.02
377 379 8.952278 AGTGTTCAAAGTTATGTGTACTTTTGA 58.048 29.630 0.00 0.00 42.32 2.69
378 380 9.009327 CAGTGTTCAAAGTTATGTGTACTTTTG 57.991 33.333 0.00 0.00 42.32 2.44
379 381 8.952278 TCAGTGTTCAAAGTTATGTGTACTTTT 58.048 29.630 0.00 0.00 42.32 2.27
380 382 8.500753 TCAGTGTTCAAAGTTATGTGTACTTT 57.499 30.769 0.00 0.00 44.38 2.66
381 383 8.677148 ATCAGTGTTCAAAGTTATGTGTACTT 57.323 30.769 0.00 0.00 37.43 2.24
382 384 8.677148 AATCAGTGTTCAAAGTTATGTGTACT 57.323 30.769 0.00 0.00 0.00 2.73
383 385 9.730420 AAAATCAGTGTTCAAAGTTATGTGTAC 57.270 29.630 0.00 0.00 0.00 2.90
384 386 9.729023 CAAAATCAGTGTTCAAAGTTATGTGTA 57.271 29.630 0.00 0.00 0.00 2.90
385 387 8.250332 ACAAAATCAGTGTTCAAAGTTATGTGT 58.750 29.630 0.00 0.00 0.00 3.72
386 388 8.633075 ACAAAATCAGTGTTCAAAGTTATGTG 57.367 30.769 0.00 0.00 0.00 3.21
387 389 9.651913 AAACAAAATCAGTGTTCAAAGTTATGT 57.348 25.926 0.00 0.00 38.24 2.29
416 418 2.359478 GGAGCCCTCGCCGAAAAA 60.359 61.111 0.00 0.00 34.57 1.94
417 419 2.966732 ATGGAGCCCTCGCCGAAAA 61.967 57.895 0.00 0.00 34.60 2.29
418 420 3.399181 ATGGAGCCCTCGCCGAAA 61.399 61.111 0.00 0.00 34.60 3.46
419 421 4.161295 CATGGAGCCCTCGCCGAA 62.161 66.667 0.00 0.00 34.60 4.30
421 423 3.466791 ATTCATGGAGCCCTCGCCG 62.467 63.158 0.00 0.00 34.60 6.46
422 424 1.895707 CATTCATGGAGCCCTCGCC 60.896 63.158 0.00 0.00 34.57 5.54
423 425 0.749454 AACATTCATGGAGCCCTCGC 60.749 55.000 0.00 0.00 0.00 5.03
424 426 1.755179 AAACATTCATGGAGCCCTCG 58.245 50.000 0.00 0.00 0.00 4.63
442 444 7.783090 TCATGCAAAGTTTTAGCATCAAAAA 57.217 28.000 9.76 0.00 46.39 1.94
443 445 7.516470 CGTTCATGCAAAGTTTTAGCATCAAAA 60.516 33.333 9.76 4.12 46.39 2.44
444 446 6.074409 CGTTCATGCAAAGTTTTAGCATCAAA 60.074 34.615 9.76 6.03 46.39 2.69
445 447 5.401972 CGTTCATGCAAAGTTTTAGCATCAA 59.598 36.000 9.76 2.49 46.39 2.57
446 448 4.916831 CGTTCATGCAAAGTTTTAGCATCA 59.083 37.500 9.76 0.00 46.39 3.07
447 449 4.917415 ACGTTCATGCAAAGTTTTAGCATC 59.083 37.500 9.76 0.96 46.39 3.91
449 451 4.300189 ACGTTCATGCAAAGTTTTAGCA 57.700 36.364 3.37 3.37 43.14 3.49
450 452 4.737765 TCAACGTTCATGCAAAGTTTTAGC 59.262 37.500 0.00 0.00 34.80 3.09
451 453 6.804534 TTCAACGTTCATGCAAAGTTTTAG 57.195 33.333 0.00 0.00 34.80 1.85
452 454 6.754209 ACATTCAACGTTCATGCAAAGTTTTA 59.246 30.769 14.35 1.23 34.80 1.52
453 455 5.580297 ACATTCAACGTTCATGCAAAGTTTT 59.420 32.000 14.35 0.00 34.80 2.43
454 456 5.108517 ACATTCAACGTTCATGCAAAGTTT 58.891 33.333 14.35 0.00 34.80 2.66
455 457 4.681744 ACATTCAACGTTCATGCAAAGTT 58.318 34.783 14.35 0.00 37.18 2.66
456 458 4.305989 ACATTCAACGTTCATGCAAAGT 57.694 36.364 14.35 0.00 0.00 2.66
457 459 5.231779 TCAAACATTCAACGTTCATGCAAAG 59.768 36.000 14.35 5.46 0.00 2.77
458 460 5.105063 TCAAACATTCAACGTTCATGCAAA 58.895 33.333 14.35 0.00 0.00 3.68
459 461 4.676546 TCAAACATTCAACGTTCATGCAA 58.323 34.783 14.35 0.00 0.00 4.08
460 462 4.298744 TCAAACATTCAACGTTCATGCA 57.701 36.364 14.35 0.00 0.00 3.96
461 463 4.916831 TGATCAAACATTCAACGTTCATGC 59.083 37.500