Multiple sequence alignment - TraesCS5B01G556200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G556200 chr5B 100.000 7649 0 0 1 7649 704877435 704885083 0.000000e+00 14126.0
1 TraesCS5B01G556200 chr5B 77.748 373 62 16 3135 3487 704879065 704879436 7.780000e-50 209.0
2 TraesCS5B01G556200 chr5B 77.748 373 62 16 1631 2002 704880569 704880921 7.780000e-50 209.0
3 TraesCS5B01G556200 chr5B 81.091 275 34 14 3843 4109 704880116 704880380 3.620000e-48 204.0
4 TraesCS5B01G556200 chr5B 81.022 274 36 12 2682 2946 704881277 704881543 3.620000e-48 204.0
5 TraesCS5B01G556200 chr5B 81.019 216 32 7 3843 4055 704880688 704880897 6.140000e-36 163.0
6 TraesCS5B01G556200 chr5B 81.019 216 32 7 3254 3463 704881277 704881489 6.140000e-36 163.0
7 TraesCS5B01G556200 chr4A 89.949 3303 225 39 3889 7124 610486948 610483686 0.000000e+00 4161.0
8 TraesCS5B01G556200 chr4A 90.622 949 46 16 2832 3750 610488634 610487699 0.000000e+00 1219.0
9 TraesCS5B01G556200 chr4A 91.506 883 66 6 1949 2826 610489599 610488721 0.000000e+00 1206.0
10 TraesCS5B01G556200 chr4A 85.651 1129 63 38 822 1938 610490727 610489686 0.000000e+00 1096.0
11 TraesCS5B01G556200 chr4A 77.578 1338 182 54 2235 3531 610488635 610487375 0.000000e+00 701.0
12 TraesCS5B01G556200 chr4A 84.887 708 57 21 3843 4522 610487643 610486958 0.000000e+00 669.0
13 TraesCS5B01G556200 chr4A 92.933 283 17 2 2135 2415 654455981 654455700 7.140000e-110 409.0
14 TraesCS5B01G556200 chr4A 92.933 283 17 2 2135 2415 654484778 654484497 7.140000e-110 409.0
15 TraesCS5B01G556200 chr4A 78.926 484 80 16 3178 3644 610489541 610489063 7.450000e-80 309.0
16 TraesCS5B01G556200 chr4A 79.341 334 51 10 1671 2000 610489547 610489228 1.290000e-52 219.0
17 TraesCS5B01G556200 chr4A 80.083 241 41 4 2001 2236 610489951 610489713 1.020000e-38 172.0
18 TraesCS5B01G556200 chr4A 88.889 90 10 0 1913 2002 610488637 610488548 2.260000e-20 111.0
19 TraesCS5B01G556200 chr4A 92.188 64 5 0 3992 4055 610488635 610488572 2.940000e-14 91.6
20 TraesCS5B01G556200 chr5D 94.282 2466 113 15 4591 7051 558244949 558242507 0.000000e+00 3747.0
21 TraesCS5B01G556200 chr5D 89.990 1039 71 15 1642 2673 558247180 558246168 0.000000e+00 1312.0
22 TraesCS5B01G556200 chr5D 85.363 731 63 18 3857 4558 558245666 558244951 0.000000e+00 717.0
23 TraesCS5B01G556200 chr5D 81.508 995 52 38 687 1648 558248132 558247237 0.000000e+00 697.0
24 TraesCS5B01G556200 chr5D 78.803 802 100 43 2756 3531 558246168 558245411 6.950000e-130 475.0
25 TraesCS5B01G556200 chr5D 85.575 409 32 8 3366 3750 558246128 558245723 3.320000e-108 403.0
26 TraesCS5B01G556200 chr5D 81.646 474 61 20 6580 7051 557658514 557658963 3.370000e-98 370.0
27 TraesCS5B01G556200 chr5D 79.959 489 72 19 3178 3646 558246839 558246357 3.420000e-88 337.0
28 TraesCS5B01G556200 chr5D 82.278 237 19 9 405 627 558248369 558248142 4.710000e-42 183.0
29 TraesCS5B01G556200 chr5D 91.011 89 7 1 1915 2002 558246094 558246006 1.350000e-22 119.0
30 TraesCS5B01G556200 chr5D 94.286 35 2 0 3751 3785 558245704 558245670 4.000000e-03 54.7
31 TraesCS5B01G556200 chr7D 94.192 396 20 3 3 397 202162366 202161973 1.100000e-167 601.0
32 TraesCS5B01G556200 chr3B 93.719 398 22 3 1 397 471806363 471805968 1.840000e-165 593.0
33 TraesCS5B01G556200 chr3B 93.909 394 20 3 4 397 246303001 246302612 6.610000e-165 592.0
34 TraesCS5B01G556200 chr3B 81.443 194 35 1 1107 1299 524325525 524325718 2.860000e-34 158.0
35 TraesCS5B01G556200 chr4B 93.467 398 24 2 1 397 553350427 553350031 2.380000e-164 590.0
36 TraesCS5B01G556200 chr4D 93.467 398 23 3 1 397 74420688 74420293 8.550000e-164 588.0
37 TraesCS5B01G556200 chr2B 92.714 398 27 2 1 397 148277631 148278027 2.390000e-159 573.0
38 TraesCS5B01G556200 chr2B 92.226 283 19 2 2135 2415 736694071 736693790 1.550000e-106 398.0
39 TraesCS5B01G556200 chr1D 92.211 398 29 2 1 397 431326749 431327145 5.180000e-156 562.0
40 TraesCS5B01G556200 chr1D 83.770 191 31 0 1110 1300 439022279 439022469 1.700000e-41 182.0
41 TraesCS5B01G556200 chr1B 92.211 398 30 1 1 397 315518231 315518628 5.180000e-156 562.0
42 TraesCS5B01G556200 chr1B 91.980 399 30 1 1 397 80625585 80625187 6.700000e-155 558.0
43 TraesCS5B01G556200 chr1B 92.580 283 18 2 2135 2415 588394251 588393970 3.320000e-108 403.0
44 TraesCS5B01G556200 chr1B 84.293 191 28 2 1110 1299 595176891 595177080 1.310000e-42 185.0
45 TraesCS5B01G556200 chrUn 92.933 283 17 2 2135 2415 387519492 387519773 7.140000e-110 409.0
46 TraesCS5B01G556200 chr3D 81.818 418 56 11 3843 4249 93068030 93067622 4.420000e-87 333.0
47 TraesCS5B01G556200 chr3D 82.639 288 35 12 3297 3576 93045590 93045310 2.760000e-59 241.0
48 TraesCS5B01G556200 chr3D 80.829 193 36 1 1107 1298 398299655 398299847 4.780000e-32 150.0
49 TraesCS5B01G556200 chr2A 83.598 189 31 0 1111 1299 92318254 92318066 2.190000e-40 178.0
50 TraesCS5B01G556200 chr1A 83.333 192 30 2 1110 1300 535312153 535312343 7.890000e-40 176.0
51 TraesCS5B01G556200 chr2D 83.152 184 31 0 1116 1299 94319386 94319203 1.320000e-37 169.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G556200 chr5B 704877435 704885083 7648 False 14126.000000 14126 100.0000 1 7649 1 chr5B.!!$F1 7648
1 TraesCS5B01G556200 chr4A 610483686 610490727 7041 True 904.963636 4161 85.4200 822 7124 11 chr4A.!!$R3 6302
2 TraesCS5B01G556200 chr5D 558242507 558248369 5862 True 804.470000 3747 86.3055 405 7051 10 chr5D.!!$R1 6646


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
669 683 0.036010 CGGCTCCACTCCACTCAAAT 60.036 55.0 0.00 0.00 0.00 2.32 F
702 716 0.455005 TCAGCTCAGCTCAGATCACG 59.545 55.0 0.00 0.00 36.40 4.35 F
1990 2182 0.381801 CAAGTGTGTGTGCTTGACCC 59.618 55.0 0.00 0.00 43.29 4.46 F
2340 2538 0.593128 ACCGTGCAGTGCTTTGATTC 59.407 50.0 17.60 0.00 0.00 2.52 F
2895 3174 0.031585 AGCTGTGCTGCAATTGTGTG 59.968 50.0 2.77 0.00 37.57 3.82 F
3047 3326 0.033366 ATTGCGGGTTTGGACAAAGC 59.967 50.0 16.27 16.27 45.21 3.51 F
3648 4514 0.178903 TCCTACTGGGAAGCAGTGGT 60.179 55.0 0.00 0.00 41.91 4.16 F
4911 6504 0.387929 GTCACACAGTCCTGAACCGA 59.612 55.0 0.40 0.00 0.00 4.69 F
5007 6600 0.037046 CAGAAGCAAATTGTGGGGCC 60.037 55.0 0.00 0.00 0.00 5.80 F
5757 7350 0.813184 TGGCTAAAGCAATGCAGAGC 59.187 50.0 8.35 12.40 44.36 4.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1869 1985 0.250553 TTTACTGGCAGGACGGGTTG 60.251 55.0 20.34 0.0 0.00 3.77 R
2684 2882 0.328592 AGTGCCTCGAGTAGACCTCA 59.671 55.0 12.31 0.0 40.48 3.86 R
2876 3155 0.031585 CACACAATTGCAGCACAGCT 59.968 50.0 5.05 0.0 40.77 4.24 R
3364 3643 0.696501 AGGGTTTATTGGCAGGACGT 59.303 50.0 0.00 0.0 0.00 4.34 R
4353 5274 0.836606 CAAAGGGGCCAAACTGGTTT 59.163 50.0 4.39 0.0 40.46 3.27 R
4932 6525 0.676466 GATGGCCATGGTCAACGACA 60.676 55.0 25.51 0.0 33.68 4.35 R
4991 6584 0.841594 ATGGGCCCCACAATTTGCTT 60.842 50.0 22.27 0.0 35.80 3.91 R
5817 7410 0.039165 GCCTCCTTTTCTTGTTGGCG 60.039 55.0 0.00 0.0 0.00 5.69 R
6534 8127 0.394192 TTGTGTCCAGCAGACCTGAG 59.606 55.0 0.47 0.0 45.68 3.35 R
7281 8900 0.026803 GGACTGTTTCGCATCGCATC 59.973 55.0 0.00 0.0 0.00 3.91 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 5.314923 TGCTTTTCATTCAAGGCACTATC 57.685 39.130 0.00 0.00 38.49 2.08
23 24 4.142622 TGCTTTTCATTCAAGGCACTATCG 60.143 41.667 0.00 0.00 38.49 2.92
24 25 4.142600 GCTTTTCATTCAAGGCACTATCGT 60.143 41.667 0.00 0.00 38.49 3.73
25 26 4.944962 TTTCATTCAAGGCACTATCGTG 57.055 40.909 0.00 0.00 38.49 4.35
26 27 3.885724 TCATTCAAGGCACTATCGTGA 57.114 42.857 0.75 0.00 43.97 4.35
27 28 4.200838 TCATTCAAGGCACTATCGTGAA 57.799 40.909 0.75 0.00 43.97 3.18
28 29 4.769688 TCATTCAAGGCACTATCGTGAAT 58.230 39.130 0.75 0.00 43.97 2.57
29 30 4.811024 TCATTCAAGGCACTATCGTGAATC 59.189 41.667 0.75 0.00 43.97 2.52
30 31 3.885724 TCAAGGCACTATCGTGAATCA 57.114 42.857 0.75 0.00 43.97 2.57
31 32 3.521560 TCAAGGCACTATCGTGAATCAC 58.478 45.455 2.75 2.75 43.97 3.06
32 33 3.056179 TCAAGGCACTATCGTGAATCACA 60.056 43.478 14.24 1.25 43.97 3.58
33 34 3.827008 AGGCACTATCGTGAATCACAT 57.173 42.857 14.24 8.54 43.97 3.21
34 35 4.142609 AGGCACTATCGTGAATCACATT 57.857 40.909 14.24 2.39 43.97 2.71
35 36 5.276461 AGGCACTATCGTGAATCACATTA 57.724 39.130 14.24 3.45 43.97 1.90
36 37 5.858381 AGGCACTATCGTGAATCACATTAT 58.142 37.500 14.24 6.20 43.97 1.28
37 38 6.993079 AGGCACTATCGTGAATCACATTATA 58.007 36.000 14.24 6.98 43.97 0.98
38 39 7.441836 AGGCACTATCGTGAATCACATTATAA 58.558 34.615 14.24 0.00 43.97 0.98
39 40 8.097038 AGGCACTATCGTGAATCACATTATAAT 58.903 33.333 14.24 0.00 43.97 1.28
40 41 8.721478 GGCACTATCGTGAATCACATTATAATT 58.279 33.333 14.24 0.00 43.97 1.40
63 64 7.810766 TTTTCTTGTTTCAACACTTCATCAC 57.189 32.000 0.00 0.00 38.92 3.06
64 65 6.507958 TTCTTGTTTCAACACTTCATCACA 57.492 33.333 0.00 0.00 38.92 3.58
65 66 6.507958 TCTTGTTTCAACACTTCATCACAA 57.492 33.333 0.00 0.00 38.92 3.33
66 67 7.099266 TCTTGTTTCAACACTTCATCACAAT 57.901 32.000 0.00 0.00 38.92 2.71
67 68 7.546358 TCTTGTTTCAACACTTCATCACAATT 58.454 30.769 0.00 0.00 38.92 2.32
68 69 8.034215 TCTTGTTTCAACACTTCATCACAATTT 58.966 29.630 0.00 0.00 38.92 1.82
69 70 7.754069 TGTTTCAACACTTCATCACAATTTC 57.246 32.000 0.00 0.00 33.17 2.17
70 71 6.756074 TGTTTCAACACTTCATCACAATTTCC 59.244 34.615 0.00 0.00 33.17 3.13
71 72 6.462552 TTCAACACTTCATCACAATTTCCA 57.537 33.333 0.00 0.00 0.00 3.53
72 73 6.075762 TCAACACTTCATCACAATTTCCAG 57.924 37.500 0.00 0.00 0.00 3.86
73 74 5.827267 TCAACACTTCATCACAATTTCCAGA 59.173 36.000 0.00 0.00 0.00 3.86
74 75 6.491062 TCAACACTTCATCACAATTTCCAGAT 59.509 34.615 0.00 0.00 0.00 2.90
75 76 6.906157 ACACTTCATCACAATTTCCAGATT 57.094 33.333 0.00 0.00 0.00 2.40
76 77 6.917533 ACACTTCATCACAATTTCCAGATTC 58.082 36.000 0.00 0.00 0.00 2.52
77 78 6.491062 ACACTTCATCACAATTTCCAGATTCA 59.509 34.615 0.00 0.00 0.00 2.57
78 79 7.177921 ACACTTCATCACAATTTCCAGATTCAT 59.822 33.333 0.00 0.00 0.00 2.57
79 80 7.488150 CACTTCATCACAATTTCCAGATTCATG 59.512 37.037 0.00 0.00 0.00 3.07
80 81 7.395206 ACTTCATCACAATTTCCAGATTCATGA 59.605 33.333 0.00 0.00 0.00 3.07
81 82 7.706100 TCATCACAATTTCCAGATTCATGAA 57.294 32.000 11.26 11.26 0.00 2.57
82 83 8.301252 TCATCACAATTTCCAGATTCATGAAT 57.699 30.769 20.85 20.85 0.00 2.57
83 84 8.755028 TCATCACAATTTCCAGATTCATGAATT 58.245 29.630 21.57 9.39 0.00 2.17
84 85 9.378551 CATCACAATTTCCAGATTCATGAATTT 57.621 29.630 21.57 13.77 0.00 1.82
85 86 9.953565 ATCACAATTTCCAGATTCATGAATTTT 57.046 25.926 21.57 10.87 0.00 1.82
90 91 9.947433 AATTTCCAGATTCATGAATTTTAAGCA 57.053 25.926 21.57 5.19 0.00 3.91
91 92 9.947433 ATTTCCAGATTCATGAATTTTAAGCAA 57.053 25.926 21.57 9.78 0.00 3.91
92 93 9.775854 TTTCCAGATTCATGAATTTTAAGCAAA 57.224 25.926 21.57 11.42 0.00 3.68
93 94 9.775854 TTCCAGATTCATGAATTTTAAGCAAAA 57.224 25.926 21.57 5.39 38.00 2.44
94 95 9.206870 TCCAGATTCATGAATTTTAAGCAAAAC 57.793 29.630 21.57 5.01 36.49 2.43
95 96 8.445493 CCAGATTCATGAATTTTAAGCAAAACC 58.555 33.333 21.57 4.82 36.49 3.27
96 97 9.211485 CAGATTCATGAATTTTAAGCAAAACCT 57.789 29.630 21.57 6.96 36.49 3.50
97 98 9.428097 AGATTCATGAATTTTAAGCAAAACCTC 57.572 29.630 21.57 4.62 36.49 3.85
98 99 9.206870 GATTCATGAATTTTAAGCAAAACCTCA 57.793 29.630 21.57 0.00 36.49 3.86
99 100 9.729281 ATTCATGAATTTTAAGCAAAACCTCAT 57.271 25.926 15.36 0.00 38.67 2.90
101 102 9.859427 TCATGAATTTTAAGCAAAACCTCATAG 57.141 29.630 0.00 5.07 37.40 2.23
102 103 9.859427 CATGAATTTTAAGCAAAACCTCATAGA 57.141 29.630 0.00 0.00 37.40 1.98
104 105 9.295825 TGAATTTTAAGCAAAACCTCATAGAGA 57.704 29.630 0.00 0.00 36.49 3.10
112 113 9.995003 AAGCAAAACCTCATAGAGATAATCTAG 57.005 33.333 0.00 0.00 43.78 2.43
113 114 9.153479 AGCAAAACCTCATAGAGATAATCTAGT 57.847 33.333 0.00 0.00 43.78 2.57
114 115 9.202273 GCAAAACCTCATAGAGATAATCTAGTG 57.798 37.037 0.00 0.00 43.78 2.74
115 116 9.202273 CAAAACCTCATAGAGATAATCTAGTGC 57.798 37.037 0.00 0.00 43.78 4.40
116 117 8.484214 AAACCTCATAGAGATAATCTAGTGCA 57.516 34.615 0.00 0.00 43.78 4.57
117 118 7.461182 ACCTCATAGAGATAATCTAGTGCAC 57.539 40.000 9.40 9.40 43.78 4.57
118 119 7.237982 ACCTCATAGAGATAATCTAGTGCACT 58.762 38.462 25.12 25.12 43.78 4.40
119 120 7.393234 ACCTCATAGAGATAATCTAGTGCACTC 59.607 40.741 25.56 7.32 43.78 3.51
120 121 7.392953 CCTCATAGAGATAATCTAGTGCACTCA 59.607 40.741 25.56 12.09 43.78 3.41
121 122 8.697507 TCATAGAGATAATCTAGTGCACTCAA 57.302 34.615 25.56 13.33 43.78 3.02
122 123 9.306777 TCATAGAGATAATCTAGTGCACTCAAT 57.693 33.333 25.56 15.17 43.78 2.57
123 124 9.926158 CATAGAGATAATCTAGTGCACTCAATT 57.074 33.333 25.56 23.77 43.78 2.32
125 126 8.016301 AGAGATAATCTAGTGCACTCAATTCA 57.984 34.615 25.56 12.45 36.10 2.57
126 127 7.925483 AGAGATAATCTAGTGCACTCAATTCAC 59.075 37.037 25.56 18.26 36.10 3.18
127 128 7.790027 AGATAATCTAGTGCACTCAATTCACT 58.210 34.615 25.56 19.82 42.89 3.41
128 129 8.918116 AGATAATCTAGTGCACTCAATTCACTA 58.082 33.333 25.56 9.33 40.96 2.74
131 132 3.407424 AGTGCACTCAATTCACTAGCA 57.593 42.857 15.25 0.00 39.08 3.49
132 133 3.743521 AGTGCACTCAATTCACTAGCAA 58.256 40.909 15.25 0.00 39.08 3.91
133 134 4.330250 AGTGCACTCAATTCACTAGCAAT 58.670 39.130 15.25 0.00 39.08 3.56
134 135 4.763793 AGTGCACTCAATTCACTAGCAATT 59.236 37.500 15.25 0.00 39.08 2.32
135 136 4.855388 GTGCACTCAATTCACTAGCAATTG 59.145 41.667 10.32 16.59 40.99 2.32
136 137 4.082625 TGCACTCAATTCACTAGCAATTGG 60.083 41.667 20.11 15.25 40.33 3.16
137 138 4.082571 GCACTCAATTCACTAGCAATTGGT 60.083 41.667 15.47 15.47 40.33 3.67
138 139 5.565439 GCACTCAATTCACTAGCAATTGGTT 60.565 40.000 16.43 0.00 40.33 3.67
139 140 6.088824 CACTCAATTCACTAGCAATTGGTTC 58.911 40.000 16.43 0.00 40.33 3.62
140 141 5.769662 ACTCAATTCACTAGCAATTGGTTCA 59.230 36.000 16.43 0.00 40.33 3.18
141 142 6.435277 ACTCAATTCACTAGCAATTGGTTCAT 59.565 34.615 16.43 0.00 40.33 2.57
142 143 6.855836 TCAATTCACTAGCAATTGGTTCATC 58.144 36.000 16.43 0.00 40.33 2.92
143 144 6.433716 TCAATTCACTAGCAATTGGTTCATCA 59.566 34.615 16.43 0.00 40.33 3.07
144 145 7.123098 TCAATTCACTAGCAATTGGTTCATCAT 59.877 33.333 16.43 0.84 40.33 2.45
145 146 8.407832 CAATTCACTAGCAATTGGTTCATCATA 58.592 33.333 16.43 0.00 37.51 2.15
146 147 7.936496 TTCACTAGCAATTGGTTCATCATAA 57.064 32.000 16.43 0.00 0.00 1.90
147 148 8.523915 TTCACTAGCAATTGGTTCATCATAAT 57.476 30.769 16.43 0.00 0.00 1.28
148 149 8.523915 TCACTAGCAATTGGTTCATCATAATT 57.476 30.769 16.43 0.00 0.00 1.40
149 150 8.407832 TCACTAGCAATTGGTTCATCATAATTG 58.592 33.333 16.43 0.00 41.23 2.32
150 151 7.650504 CACTAGCAATTGGTTCATCATAATTGG 59.349 37.037 16.43 0.00 39.61 3.16
151 152 6.795144 AGCAATTGGTTCATCATAATTGGA 57.205 33.333 3.82 0.00 39.61 3.53
152 153 7.369551 AGCAATTGGTTCATCATAATTGGAT 57.630 32.000 3.82 0.00 39.61 3.41
153 154 7.439381 AGCAATTGGTTCATCATAATTGGATC 58.561 34.615 3.82 0.00 39.61 3.36
154 155 7.289317 AGCAATTGGTTCATCATAATTGGATCT 59.711 33.333 3.82 0.00 39.61 2.75
155 156 7.929785 GCAATTGGTTCATCATAATTGGATCTT 59.070 33.333 7.72 0.00 39.61 2.40
156 157 9.826574 CAATTGGTTCATCATAATTGGATCTTT 57.173 29.630 0.00 0.00 37.05 2.52
184 185 9.620259 AAAAAGATTAGTAAGTGGATGAGGATC 57.380 33.333 0.00 0.00 0.00 3.36
198 199 7.684937 GGATGAGGATCCATAAATCTCTTTG 57.315 40.000 15.82 0.00 46.93 2.77
199 200 6.150809 GGATGAGGATCCATAAATCTCTTTGC 59.849 42.308 15.82 0.00 46.93 3.68
200 201 6.257994 TGAGGATCCATAAATCTCTTTGCT 57.742 37.500 15.82 0.00 0.00 3.91
201 202 6.666678 TGAGGATCCATAAATCTCTTTGCTT 58.333 36.000 15.82 0.00 0.00 3.91
202 203 6.769822 TGAGGATCCATAAATCTCTTTGCTTC 59.230 38.462 15.82 0.00 0.00 3.86
203 204 6.909076 AGGATCCATAAATCTCTTTGCTTCT 58.091 36.000 15.82 0.00 0.00 2.85
204 205 6.771749 AGGATCCATAAATCTCTTTGCTTCTG 59.228 38.462 15.82 0.00 0.00 3.02
205 206 6.769822 GGATCCATAAATCTCTTTGCTTCTGA 59.230 38.462 6.95 0.00 0.00 3.27
206 207 7.284034 GGATCCATAAATCTCTTTGCTTCTGAA 59.716 37.037 6.95 0.00 0.00 3.02
207 208 8.763984 ATCCATAAATCTCTTTGCTTCTGAAT 57.236 30.769 0.00 0.00 0.00 2.57
208 209 8.585471 TCCATAAATCTCTTTGCTTCTGAATT 57.415 30.769 0.00 0.00 0.00 2.17
209 210 9.028284 TCCATAAATCTCTTTGCTTCTGAATTT 57.972 29.630 0.00 0.00 0.00 1.82
210 211 9.084164 CCATAAATCTCTTTGCTTCTGAATTTG 57.916 33.333 0.00 0.00 0.00 2.32
211 212 9.850628 CATAAATCTCTTTGCTTCTGAATTTGA 57.149 29.630 0.00 0.00 0.00 2.69
217 218 9.683069 TCTCTTTGCTTCTGAATTTGAATAAAC 57.317 29.630 0.00 0.00 0.00 2.01
218 219 9.467258 CTCTTTGCTTCTGAATTTGAATAAACA 57.533 29.630 0.00 0.00 0.00 2.83
219 220 9.248291 TCTTTGCTTCTGAATTTGAATAAACAC 57.752 29.630 0.00 0.00 0.00 3.32
220 221 8.939201 TTTGCTTCTGAATTTGAATAAACACA 57.061 26.923 0.00 0.00 0.00 3.72
221 222 8.939201 TTGCTTCTGAATTTGAATAAACACAA 57.061 26.923 0.00 0.00 0.00 3.33
222 223 9.545105 TTGCTTCTGAATTTGAATAAACACAAT 57.455 25.926 0.00 0.00 0.00 2.71
223 224 9.545105 TGCTTCTGAATTTGAATAAACACAATT 57.455 25.926 0.00 0.00 0.00 2.32
229 230 9.716531 TGAATTTGAATAAACACAATTATGCCA 57.283 25.926 0.00 0.00 0.00 4.92
232 233 9.723601 ATTTGAATAAACACAATTATGCCAAGT 57.276 25.926 0.00 0.00 0.00 3.16
237 238 8.682128 ATAAACACAATTATGCCAAGTAAACG 57.318 30.769 0.00 0.00 0.00 3.60
238 239 5.950758 ACACAATTATGCCAAGTAAACGA 57.049 34.783 0.00 0.00 0.00 3.85
239 240 5.938322 ACACAATTATGCCAAGTAAACGAG 58.062 37.500 0.00 0.00 0.00 4.18
240 241 4.793216 CACAATTATGCCAAGTAAACGAGC 59.207 41.667 0.00 0.00 0.00 5.03
241 242 4.457603 ACAATTATGCCAAGTAAACGAGCA 59.542 37.500 0.00 0.00 37.94 4.26
242 243 5.048364 ACAATTATGCCAAGTAAACGAGCAA 60.048 36.000 0.00 0.00 36.95 3.91
243 244 5.637006 ATTATGCCAAGTAAACGAGCAAA 57.363 34.783 0.00 0.00 36.95 3.68
244 245 2.766970 TGCCAAGTAAACGAGCAAAC 57.233 45.000 0.00 0.00 0.00 2.93
245 246 2.017782 TGCCAAGTAAACGAGCAAACA 58.982 42.857 0.00 0.00 0.00 2.83
246 247 2.423892 TGCCAAGTAAACGAGCAAACAA 59.576 40.909 0.00 0.00 0.00 2.83
247 248 3.119459 TGCCAAGTAAACGAGCAAACAAA 60.119 39.130 0.00 0.00 0.00 2.83
248 249 3.242016 GCCAAGTAAACGAGCAAACAAAC 59.758 43.478 0.00 0.00 0.00 2.93
249 250 3.794564 CCAAGTAAACGAGCAAACAAACC 59.205 43.478 0.00 0.00 0.00 3.27
250 251 3.328237 AGTAAACGAGCAAACAAACCG 57.672 42.857 0.00 0.00 0.00 4.44
251 252 2.937799 AGTAAACGAGCAAACAAACCGA 59.062 40.909 0.00 0.00 0.00 4.69
252 253 2.468532 AAACGAGCAAACAAACCGAG 57.531 45.000 0.00 0.00 0.00 4.63
253 254 1.375551 AACGAGCAAACAAACCGAGT 58.624 45.000 0.00 0.00 0.00 4.18
254 255 2.228138 ACGAGCAAACAAACCGAGTA 57.772 45.000 0.00 0.00 0.00 2.59
255 256 2.553086 ACGAGCAAACAAACCGAGTAA 58.447 42.857 0.00 0.00 0.00 2.24
256 257 2.542595 ACGAGCAAACAAACCGAGTAAG 59.457 45.455 0.00 0.00 0.00 2.34
257 258 2.798283 CGAGCAAACAAACCGAGTAAGA 59.202 45.455 0.00 0.00 0.00 2.10
258 259 3.362693 CGAGCAAACAAACCGAGTAAGAC 60.363 47.826 0.00 0.00 0.00 3.01
259 260 3.537580 AGCAAACAAACCGAGTAAGACA 58.462 40.909 0.00 0.00 0.00 3.41
260 261 4.134563 AGCAAACAAACCGAGTAAGACAT 58.865 39.130 0.00 0.00 0.00 3.06
261 262 5.302360 AGCAAACAAACCGAGTAAGACATA 58.698 37.500 0.00 0.00 0.00 2.29
262 263 5.761234 AGCAAACAAACCGAGTAAGACATAA 59.239 36.000 0.00 0.00 0.00 1.90
263 264 6.261381 AGCAAACAAACCGAGTAAGACATAAA 59.739 34.615 0.00 0.00 0.00 1.40
264 265 6.577427 GCAAACAAACCGAGTAAGACATAAAG 59.423 38.462 0.00 0.00 0.00 1.85
265 266 6.796705 AACAAACCGAGTAAGACATAAAGG 57.203 37.500 0.00 0.00 0.00 3.11
266 267 4.694037 ACAAACCGAGTAAGACATAAAGGC 59.306 41.667 0.00 0.00 0.00 4.35
267 268 4.546829 AACCGAGTAAGACATAAAGGCA 57.453 40.909 0.00 0.00 0.00 4.75
268 269 4.546829 ACCGAGTAAGACATAAAGGCAA 57.453 40.909 0.00 0.00 0.00 4.52
269 270 4.901868 ACCGAGTAAGACATAAAGGCAAA 58.098 39.130 0.00 0.00 0.00 3.68
270 271 5.497474 ACCGAGTAAGACATAAAGGCAAAT 58.503 37.500 0.00 0.00 0.00 2.32
271 272 5.354234 ACCGAGTAAGACATAAAGGCAAATG 59.646 40.000 0.00 0.00 0.00 2.32
272 273 5.220854 CCGAGTAAGACATAAAGGCAAATGG 60.221 44.000 0.00 0.00 0.00 3.16
273 274 5.584649 CGAGTAAGACATAAAGGCAAATGGA 59.415 40.000 0.00 0.00 0.00 3.41
274 275 6.093495 CGAGTAAGACATAAAGGCAAATGGAA 59.907 38.462 0.00 0.00 0.00 3.53
275 276 7.361713 CGAGTAAGACATAAAGGCAAATGGAAA 60.362 37.037 0.00 0.00 0.00 3.13
276 277 7.830739 AGTAAGACATAAAGGCAAATGGAAAG 58.169 34.615 0.00 0.00 0.00 2.62
277 278 6.916360 AAGACATAAAGGCAAATGGAAAGA 57.084 33.333 0.00 0.00 0.00 2.52
278 279 6.916360 AGACATAAAGGCAAATGGAAAGAA 57.084 33.333 0.00 0.00 0.00 2.52
279 280 6.928520 AGACATAAAGGCAAATGGAAAGAAG 58.071 36.000 0.00 0.00 0.00 2.85
280 281 6.041423 ACATAAAGGCAAATGGAAAGAAGG 57.959 37.500 0.00 0.00 0.00 3.46
281 282 5.543790 ACATAAAGGCAAATGGAAAGAAGGT 59.456 36.000 0.00 0.00 0.00 3.50
282 283 4.341366 AAAGGCAAATGGAAAGAAGGTG 57.659 40.909 0.00 0.00 0.00 4.00
283 284 3.243359 AGGCAAATGGAAAGAAGGTGA 57.757 42.857 0.00 0.00 0.00 4.02
284 285 3.575805 AGGCAAATGGAAAGAAGGTGAA 58.424 40.909 0.00 0.00 0.00 3.18
285 286 4.162651 AGGCAAATGGAAAGAAGGTGAAT 58.837 39.130 0.00 0.00 0.00 2.57
286 287 5.332743 AGGCAAATGGAAAGAAGGTGAATA 58.667 37.500 0.00 0.00 0.00 1.75
287 288 5.779771 AGGCAAATGGAAAGAAGGTGAATAA 59.220 36.000 0.00 0.00 0.00 1.40
288 289 6.269769 AGGCAAATGGAAAGAAGGTGAATAAA 59.730 34.615 0.00 0.00 0.00 1.40
289 290 6.934083 GGCAAATGGAAAGAAGGTGAATAAAA 59.066 34.615 0.00 0.00 0.00 1.52
290 291 7.443879 GGCAAATGGAAAGAAGGTGAATAAAAA 59.556 33.333 0.00 0.00 0.00 1.94
291 292 8.498358 GCAAATGGAAAGAAGGTGAATAAAAAG 58.502 33.333 0.00 0.00 0.00 2.27
292 293 8.992073 CAAATGGAAAGAAGGTGAATAAAAAGG 58.008 33.333 0.00 0.00 0.00 3.11
293 294 6.096673 TGGAAAGAAGGTGAATAAAAAGGC 57.903 37.500 0.00 0.00 0.00 4.35
294 295 5.600484 TGGAAAGAAGGTGAATAAAAAGGCA 59.400 36.000 0.00 0.00 0.00 4.75
295 296 6.098982 TGGAAAGAAGGTGAATAAAAAGGCAA 59.901 34.615 0.00 0.00 0.00 4.52
296 297 6.989759 GGAAAGAAGGTGAATAAAAAGGCAAA 59.010 34.615 0.00 0.00 0.00 3.68
297 298 7.661437 GGAAAGAAGGTGAATAAAAAGGCAAAT 59.339 33.333 0.00 0.00 0.00 2.32
298 299 9.705290 GAAAGAAGGTGAATAAAAAGGCAAATA 57.295 29.630 0.00 0.00 0.00 1.40
313 314 9.786105 AAAAGGCAAATATTTTTGTGTTTTCTG 57.214 25.926 9.87 0.00 43.43 3.02
314 315 8.729805 AAGGCAAATATTTTTGTGTTTTCTGA 57.270 26.923 9.87 0.00 43.43 3.27
315 316 8.729805 AGGCAAATATTTTTGTGTTTTCTGAA 57.270 26.923 9.87 0.00 43.43 3.02
316 317 9.171877 AGGCAAATATTTTTGTGTTTTCTGAAA 57.828 25.926 9.87 0.00 43.43 2.69
317 318 9.780413 GGCAAATATTTTTGTGTTTTCTGAAAA 57.220 25.926 11.33 11.33 43.43 2.29
327 328 9.627395 TTTGTGTTTTCTGAAAATCGTTTTAGA 57.373 25.926 17.63 0.00 37.52 2.10
328 329 9.627395 TTGTGTTTTCTGAAAATCGTTTTAGAA 57.373 25.926 17.63 3.17 43.68 2.10
329 330 9.284594 TGTGTTTTCTGAAAATCGTTTTAGAAG 57.715 29.630 17.63 0.00 45.06 2.85
330 331 9.285770 GTGTTTTCTGAAAATCGTTTTAGAAGT 57.714 29.630 17.63 0.00 45.06 3.01
331 332 9.284594 TGTTTTCTGAAAATCGTTTTAGAAGTG 57.715 29.630 17.63 0.00 45.06 3.16
332 333 8.743099 GTTTTCTGAAAATCGTTTTAGAAGTGG 58.257 33.333 17.63 0.00 45.06 4.00
333 334 6.554334 TCTGAAAATCGTTTTAGAAGTGGG 57.446 37.500 0.00 0.00 36.66 4.61
334 335 5.472137 TCTGAAAATCGTTTTAGAAGTGGGG 59.528 40.000 0.00 0.00 36.66 4.96
335 336 4.521256 TGAAAATCGTTTTAGAAGTGGGGG 59.479 41.667 0.00 0.00 31.94 5.40
336 337 4.376225 AAATCGTTTTAGAAGTGGGGGA 57.624 40.909 0.00 0.00 0.00 4.81
337 338 3.629142 ATCGTTTTAGAAGTGGGGGAG 57.371 47.619 0.00 0.00 0.00 4.30
338 339 2.612000 TCGTTTTAGAAGTGGGGGAGA 58.388 47.619 0.00 0.00 0.00 3.71
339 340 2.565834 TCGTTTTAGAAGTGGGGGAGAG 59.434 50.000 0.00 0.00 0.00 3.20
340 341 2.565834 CGTTTTAGAAGTGGGGGAGAGA 59.434 50.000 0.00 0.00 0.00 3.10
341 342 3.007614 CGTTTTAGAAGTGGGGGAGAGAA 59.992 47.826 0.00 0.00 0.00 2.87
342 343 4.504340 CGTTTTAGAAGTGGGGGAGAGAAA 60.504 45.833 0.00 0.00 0.00 2.52
343 344 5.382616 GTTTTAGAAGTGGGGGAGAGAAAA 58.617 41.667 0.00 0.00 0.00 2.29
344 345 5.656549 TTTAGAAGTGGGGGAGAGAAAAA 57.343 39.130 0.00 0.00 0.00 1.94
345 346 5.860648 TTAGAAGTGGGGGAGAGAAAAAT 57.139 39.130 0.00 0.00 0.00 1.82
346 347 4.039603 AGAAGTGGGGGAGAGAAAAATG 57.960 45.455 0.00 0.00 0.00 2.32
347 348 3.657727 AGAAGTGGGGGAGAGAAAAATGA 59.342 43.478 0.00 0.00 0.00 2.57
348 349 3.728385 AGTGGGGGAGAGAAAAATGAG 57.272 47.619 0.00 0.00 0.00 2.90
349 350 3.260205 AGTGGGGGAGAGAAAAATGAGA 58.740 45.455 0.00 0.00 0.00 3.27
350 351 3.265479 AGTGGGGGAGAGAAAAATGAGAG 59.735 47.826 0.00 0.00 0.00 3.20
351 352 2.578021 TGGGGGAGAGAAAAATGAGAGG 59.422 50.000 0.00 0.00 0.00 3.69
352 353 2.649190 GGGGAGAGAAAAATGAGAGGC 58.351 52.381 0.00 0.00 0.00 4.70
353 354 2.025887 GGGGAGAGAAAAATGAGAGGCA 60.026 50.000 0.00 0.00 0.00 4.75
354 355 3.562176 GGGGAGAGAAAAATGAGAGGCAA 60.562 47.826 0.00 0.00 0.00 4.52
355 356 4.082125 GGGAGAGAAAAATGAGAGGCAAA 58.918 43.478 0.00 0.00 0.00 3.68
356 357 4.708909 GGGAGAGAAAAATGAGAGGCAAAT 59.291 41.667 0.00 0.00 0.00 2.32
357 358 5.393896 GGGAGAGAAAAATGAGAGGCAAATG 60.394 44.000 0.00 0.00 0.00 2.32
358 359 5.416952 GGAGAGAAAAATGAGAGGCAAATGA 59.583 40.000 0.00 0.00 0.00 2.57
359 360 6.264841 AGAGAAAAATGAGAGGCAAATGAC 57.735 37.500 0.00 0.00 0.00 3.06
360 361 5.771666 AGAGAAAAATGAGAGGCAAATGACA 59.228 36.000 0.00 0.00 0.00 3.58
361 362 6.266103 AGAGAAAAATGAGAGGCAAATGACAA 59.734 34.615 0.00 0.00 0.00 3.18
362 363 6.819284 AGAAAAATGAGAGGCAAATGACAAA 58.181 32.000 0.00 0.00 0.00 2.83
363 364 7.447594 AGAAAAATGAGAGGCAAATGACAAAT 58.552 30.769 0.00 0.00 0.00 2.32
364 365 8.587608 AGAAAAATGAGAGGCAAATGACAAATA 58.412 29.630 0.00 0.00 0.00 1.40
365 366 9.206870 GAAAAATGAGAGGCAAATGACAAATAA 57.793 29.630 0.00 0.00 0.00 1.40
366 367 9.729281 AAAAATGAGAGGCAAATGACAAATAAT 57.271 25.926 0.00 0.00 0.00 1.28
367 368 8.712285 AAATGAGAGGCAAATGACAAATAATG 57.288 30.769 0.00 0.00 0.00 1.90
369 370 7.936496 TGAGAGGCAAATGACAAATAATGTA 57.064 32.000 0.00 0.00 44.12 2.29
370 371 8.347004 TGAGAGGCAAATGACAAATAATGTAA 57.653 30.769 0.00 0.00 44.12 2.41
371 372 8.970020 TGAGAGGCAAATGACAAATAATGTAAT 58.030 29.630 0.00 0.00 44.12 1.89
372 373 9.241317 GAGAGGCAAATGACAAATAATGTAATG 57.759 33.333 0.00 0.00 44.12 1.90
373 374 7.707893 AGAGGCAAATGACAAATAATGTAATGC 59.292 33.333 0.00 0.00 44.12 3.56
374 375 7.329499 AGGCAAATGACAAATAATGTAATGCA 58.671 30.769 0.00 0.00 44.12 3.96
375 376 7.823310 AGGCAAATGACAAATAATGTAATGCAA 59.177 29.630 0.00 0.00 44.12 4.08
376 377 8.117988 GGCAAATGACAAATAATGTAATGCAAG 58.882 33.333 0.00 0.00 44.12 4.01
377 378 8.871862 GCAAATGACAAATAATGTAATGCAAGA 58.128 29.630 0.00 0.00 44.12 3.02
381 382 9.961265 ATGACAAATAATGTAATGCAAGAGATG 57.039 29.630 0.00 0.00 44.12 2.90
382 383 9.176460 TGACAAATAATGTAATGCAAGAGATGA 57.824 29.630 0.00 0.00 44.12 2.92
383 384 9.661187 GACAAATAATGTAATGCAAGAGATGAG 57.339 33.333 0.00 0.00 44.12 2.90
384 385 9.399797 ACAAATAATGTAATGCAAGAGATGAGA 57.600 29.630 0.00 0.00 41.63 3.27
385 386 9.880064 CAAATAATGTAATGCAAGAGATGAGAG 57.120 33.333 0.00 0.00 0.00 3.20
386 387 9.624373 AAATAATGTAATGCAAGAGATGAGAGT 57.376 29.630 0.00 0.00 0.00 3.24
387 388 9.624373 AATAATGTAATGCAAGAGATGAGAGTT 57.376 29.630 0.00 0.00 0.00 3.01
388 389 7.934855 AATGTAATGCAAGAGATGAGAGTTT 57.065 32.000 0.00 0.00 0.00 2.66
390 391 9.624373 AATGTAATGCAAGAGATGAGAGTTTAT 57.376 29.630 0.00 0.00 0.00 1.40
391 392 8.429493 TGTAATGCAAGAGATGAGAGTTTATG 57.571 34.615 0.00 0.00 0.00 1.90
392 393 8.260114 TGTAATGCAAGAGATGAGAGTTTATGA 58.740 33.333 0.00 0.00 0.00 2.15
393 394 9.270640 GTAATGCAAGAGATGAGAGTTTATGAT 57.729 33.333 0.00 0.00 0.00 2.45
394 395 7.731882 ATGCAAGAGATGAGAGTTTATGATG 57.268 36.000 0.00 0.00 0.00 3.07
395 396 6.053650 TGCAAGAGATGAGAGTTTATGATGG 58.946 40.000 0.00 0.00 0.00 3.51
396 397 5.469421 GCAAGAGATGAGAGTTTATGATGGG 59.531 44.000 0.00 0.00 0.00 4.00
397 398 5.226194 AGAGATGAGAGTTTATGATGGGC 57.774 43.478 0.00 0.00 0.00 5.36
398 399 4.657504 AGAGATGAGAGTTTATGATGGGCA 59.342 41.667 0.00 0.00 0.00 5.36
399 400 4.970711 AGATGAGAGTTTATGATGGGCAG 58.029 43.478 0.00 0.00 0.00 4.85
400 401 4.657504 AGATGAGAGTTTATGATGGGCAGA 59.342 41.667 0.00 0.00 0.00 4.26
401 402 4.842531 TGAGAGTTTATGATGGGCAGAA 57.157 40.909 0.00 0.00 0.00 3.02
402 403 4.774124 TGAGAGTTTATGATGGGCAGAAG 58.226 43.478 0.00 0.00 0.00 2.85
403 404 4.133078 GAGAGTTTATGATGGGCAGAAGG 58.867 47.826 0.00 0.00 0.00 3.46
420 421 2.254350 GCAAGGTTTCCGTTCCGC 59.746 61.111 0.00 0.00 0.00 5.54
422 423 3.351416 AAGGTTTCCGTTCCGCGC 61.351 61.111 0.00 0.00 39.71 6.86
428 429 2.968330 TTTCCGTTCCGCGCAAAACG 62.968 55.000 27.74 27.74 45.83 3.60
444 445 4.636975 CAAAACGCTGAAAAACACAAAGG 58.363 39.130 0.00 0.00 0.00 3.11
445 446 3.586100 AACGCTGAAAAACACAAAGGT 57.414 38.095 0.00 0.00 0.00 3.50
465 467 6.538945 AGGTGTTTGTTCCTACACATTTTT 57.461 33.333 0.00 0.00 44.94 1.94
523 525 0.179348 CGAACGAACGAACGAACGTC 60.179 55.000 17.60 12.52 45.83 4.34
524 526 0.157475 GAACGAACGAACGAACGTCC 59.843 55.000 17.60 7.34 45.83 4.79
525 527 0.525242 AACGAACGAACGAACGTCCA 60.525 50.000 17.60 0.00 45.83 4.02
541 551 0.911053 TCCATATCACAGGCACAGCA 59.089 50.000 0.00 0.00 0.00 4.41
581 595 5.061853 GGTTCCCCGGAGATATTTTTACTC 58.938 45.833 0.73 0.00 0.00 2.59
584 598 3.393278 CCCCGGAGATATTTTTACTCCCA 59.607 47.826 0.73 0.00 44.96 4.37
660 674 4.459089 GGCTCACCGGCTCCACTC 62.459 72.222 0.00 0.00 34.85 3.51
661 675 4.459089 GCTCACCGGCTCCACTCC 62.459 72.222 0.00 0.00 0.00 3.85
662 676 2.997315 CTCACCGGCTCCACTCCA 60.997 66.667 0.00 0.00 0.00 3.86
663 677 3.302347 CTCACCGGCTCCACTCCAC 62.302 68.421 0.00 0.00 0.00 4.02
664 678 3.314331 CACCGGCTCCACTCCACT 61.314 66.667 0.00 0.00 0.00 4.00
665 679 2.997897 ACCGGCTCCACTCCACTC 60.998 66.667 0.00 0.00 0.00 3.51
666 680 2.997315 CCGGCTCCACTCCACTCA 60.997 66.667 0.00 0.00 0.00 3.41
667 681 2.583441 CCGGCTCCACTCCACTCAA 61.583 63.158 0.00 0.00 0.00 3.02
668 682 1.371183 CGGCTCCACTCCACTCAAA 59.629 57.895 0.00 0.00 0.00 2.69
669 683 0.036010 CGGCTCCACTCCACTCAAAT 60.036 55.000 0.00 0.00 0.00 2.32
670 684 1.743996 GGCTCCACTCCACTCAAATC 58.256 55.000 0.00 0.00 0.00 2.17
671 685 1.003580 GGCTCCACTCCACTCAAATCA 59.996 52.381 0.00 0.00 0.00 2.57
672 686 2.553028 GGCTCCACTCCACTCAAATCAA 60.553 50.000 0.00 0.00 0.00 2.57
673 687 3.149196 GCTCCACTCCACTCAAATCAAA 58.851 45.455 0.00 0.00 0.00 2.69
674 688 3.760684 GCTCCACTCCACTCAAATCAAAT 59.239 43.478 0.00 0.00 0.00 2.32
675 689 4.142513 GCTCCACTCCACTCAAATCAAATC 60.143 45.833 0.00 0.00 0.00 2.17
676 690 4.984295 TCCACTCCACTCAAATCAAATCA 58.016 39.130 0.00 0.00 0.00 2.57
677 691 5.005740 TCCACTCCACTCAAATCAAATCAG 58.994 41.667 0.00 0.00 0.00 2.90
678 692 4.763793 CCACTCCACTCAAATCAAATCAGT 59.236 41.667 0.00 0.00 0.00 3.41
679 693 5.242393 CCACTCCACTCAAATCAAATCAGTT 59.758 40.000 0.00 0.00 0.00 3.16
680 694 6.376978 CACTCCACTCAAATCAAATCAGTTC 58.623 40.000 0.00 0.00 0.00 3.01
681 695 5.180117 ACTCCACTCAAATCAAATCAGTTCG 59.820 40.000 0.00 0.00 0.00 3.95
682 696 4.083324 TCCACTCAAATCAAATCAGTTCGC 60.083 41.667 0.00 0.00 0.00 4.70
683 697 4.083110 CCACTCAAATCAAATCAGTTCGCT 60.083 41.667 0.00 0.00 0.00 4.93
684 698 5.084722 CACTCAAATCAAATCAGTTCGCTC 58.915 41.667 0.00 0.00 0.00 5.03
685 699 4.756642 ACTCAAATCAAATCAGTTCGCTCA 59.243 37.500 0.00 0.00 0.00 4.26
686 700 5.106791 ACTCAAATCAAATCAGTTCGCTCAG 60.107 40.000 0.00 0.00 0.00 3.35
687 701 3.754188 AATCAAATCAGTTCGCTCAGC 57.246 42.857 0.00 0.00 0.00 4.26
688 702 2.462456 TCAAATCAGTTCGCTCAGCT 57.538 45.000 0.00 0.00 0.00 4.24
689 703 2.341257 TCAAATCAGTTCGCTCAGCTC 58.659 47.619 0.00 0.00 0.00 4.09
690 704 2.071540 CAAATCAGTTCGCTCAGCTCA 58.928 47.619 0.00 0.00 0.00 4.26
702 716 0.455005 TCAGCTCAGCTCAGATCACG 59.545 55.000 0.00 0.00 36.40 4.35
705 719 0.865218 GCTCAGCTCAGATCACGTCG 60.865 60.000 0.00 0.00 0.00 5.12
733 747 2.164338 GAAACGCCCCTGGATTAAACA 58.836 47.619 0.00 0.00 0.00 2.83
734 748 2.296073 AACGCCCCTGGATTAAACAA 57.704 45.000 0.00 0.00 0.00 2.83
770 784 3.448469 CCCCCGCTATCTCTCTCTT 57.552 57.895 0.00 0.00 0.00 2.85
790 804 1.938585 TCTTGTCGTCTCCTTCCCAT 58.061 50.000 0.00 0.00 0.00 4.00
799 813 1.387347 TCCTTCCCATCCATCCCCC 60.387 63.158 0.00 0.00 0.00 5.40
889 909 1.935931 CCCAAATCCCCCACTCCCT 60.936 63.158 0.00 0.00 0.00 4.20
890 910 1.615262 CCAAATCCCCCACTCCCTC 59.385 63.158 0.00 0.00 0.00 4.30
891 911 0.921256 CCAAATCCCCCACTCCCTCT 60.921 60.000 0.00 0.00 0.00 3.69
892 912 0.548510 CAAATCCCCCACTCCCTCTC 59.451 60.000 0.00 0.00 0.00 3.20
893 913 0.983378 AAATCCCCCACTCCCTCTCG 60.983 60.000 0.00 0.00 0.00 4.04
894 914 4.779733 TCCCCCACTCCCTCTCGC 62.780 72.222 0.00 0.00 0.00 5.03
1315 1342 2.931105 TGCGTGCCCTCCCCTTTA 60.931 61.111 0.00 0.00 0.00 1.85
1318 1345 2.681591 GTGCCCTCCCCTTTACCC 59.318 66.667 0.00 0.00 0.00 3.69
1320 1347 3.426836 GCCCTCCCCTTTACCCCC 61.427 72.222 0.00 0.00 0.00 5.40
1321 1348 2.464550 CCCTCCCCTTTACCCCCT 59.535 66.667 0.00 0.00 0.00 4.79
1335 1362 2.041928 CCCTCCTCTCCCCTGCTT 59.958 66.667 0.00 0.00 0.00 3.91
1360 1387 1.047801 AGCCCCGCTTTGTTTTCATT 58.952 45.000 0.00 0.00 33.89 2.57
1369 1396 4.024977 CGCTTTGTTTTCATTTTCTTGGGG 60.025 41.667 0.00 0.00 0.00 4.96
1370 1397 4.275689 GCTTTGTTTTCATTTTCTTGGGGG 59.724 41.667 0.00 0.00 0.00 5.40
1371 1398 5.679601 CTTTGTTTTCATTTTCTTGGGGGA 58.320 37.500 0.00 0.00 0.00 4.81
1372 1399 5.903198 TTGTTTTCATTTTCTTGGGGGAT 57.097 34.783 0.00 0.00 0.00 3.85
1373 1400 5.903198 TGTTTTCATTTTCTTGGGGGATT 57.097 34.783 0.00 0.00 0.00 3.01
1374 1401 7.380423 TTGTTTTCATTTTCTTGGGGGATTA 57.620 32.000 0.00 0.00 0.00 1.75
1375 1402 6.764379 TGTTTTCATTTTCTTGGGGGATTAC 58.236 36.000 0.00 0.00 0.00 1.89
1376 1403 6.170506 GTTTTCATTTTCTTGGGGGATTACC 58.829 40.000 0.00 0.00 39.11 2.85
1377 1404 3.626930 TCATTTTCTTGGGGGATTACCG 58.373 45.455 0.00 0.00 41.60 4.02
1378 1405 3.267291 TCATTTTCTTGGGGGATTACCGA 59.733 43.478 0.00 0.00 41.60 4.69
1391 1418 1.310933 TTACCGACCGTCTCTCTGCC 61.311 60.000 0.00 0.00 0.00 4.85
1398 1425 2.665603 GTCTCTCTGCCACCCACC 59.334 66.667 0.00 0.00 0.00 4.61
1420 1447 3.540738 CGCGATTAAAATTCGGGTGTTTC 59.459 43.478 0.00 0.00 35.57 2.78
1461 1509 2.127271 TTGATTGATCATGGCCGTGT 57.873 45.000 24.24 11.96 36.56 4.49
1491 1539 1.595382 GATCTGATCCCCAACGCCG 60.595 63.158 6.37 0.00 0.00 6.46
1519 1567 2.415512 GCCTGTAGTTTCTAGTTTGCGG 59.584 50.000 0.00 0.00 0.00 5.69
1520 1568 2.415512 CCTGTAGTTTCTAGTTTGCGGC 59.584 50.000 0.00 0.00 0.00 6.53
1521 1569 2.415512 CTGTAGTTTCTAGTTTGCGGCC 59.584 50.000 0.00 0.00 0.00 6.13
1560 1608 3.487574 GCTTGAACCAGATCGAGAATACG 59.512 47.826 0.00 0.00 33.35 3.06
1567 1615 3.243569 CCAGATCGAGAATACGGCTTTCT 60.244 47.826 0.00 0.00 36.16 2.52
1568 1616 4.363999 CAGATCGAGAATACGGCTTTCTT 58.636 43.478 0.00 0.00 33.65 2.52
1569 1617 4.208047 CAGATCGAGAATACGGCTTTCTTG 59.792 45.833 0.00 5.56 36.38 3.02
1570 1618 3.861276 TCGAGAATACGGCTTTCTTGA 57.139 42.857 9.06 9.06 39.97 3.02
1571 1619 4.386867 TCGAGAATACGGCTTTCTTGAT 57.613 40.909 9.06 0.00 38.24 2.57
1590 1638 7.930217 TCTTGATTTGACTTCAACAACTTAGG 58.070 34.615 0.00 0.00 35.28 2.69
1624 1674 2.360165 AGGTTTTCACTGCTGCTTTCTG 59.640 45.455 0.00 0.00 0.00 3.02
1625 1675 2.358898 GGTTTTCACTGCTGCTTTCTGA 59.641 45.455 0.00 0.00 0.00 3.27
1626 1676 3.366719 GTTTTCACTGCTGCTTTCTGAC 58.633 45.455 0.00 0.00 0.00 3.51
1627 1677 2.627515 TTCACTGCTGCTTTCTGACT 57.372 45.000 0.00 0.00 0.00 3.41
1629 1679 3.751479 TCACTGCTGCTTTCTGACTTA 57.249 42.857 0.00 0.00 0.00 2.24
1654 1770 5.568620 AACAACATAAGAGGAGGACTTGT 57.431 39.130 0.00 0.00 0.00 3.16
1673 1789 6.735130 ACTTGTTCAGGTTTATTACTGTTGC 58.265 36.000 0.00 0.00 36.17 4.17
1708 1824 0.588252 GCAAGTGACATGTTGCTCGT 59.412 50.000 12.04 0.00 44.68 4.18
1728 1844 3.492313 GTTTCCAGCTTATGCAAGAACG 58.508 45.455 3.16 0.00 42.74 3.95
1733 1849 3.425359 CCAGCTTATGCAAGAACGAGTTG 60.425 47.826 3.16 0.00 42.74 3.16
1813 1929 2.216046 ACCTGCGTGATCTTGCATATG 58.784 47.619 11.90 0.00 40.89 1.78
1841 1957 1.002544 AGCAGTTTACTGGAGTCCTGC 59.997 52.381 15.54 11.99 43.94 4.85
1869 1985 5.382618 TTTCTCCTAGTGTTCGAGGTTAC 57.617 43.478 0.00 0.00 37.64 2.50
1872 1988 4.217118 TCTCCTAGTGTTCGAGGTTACAAC 59.783 45.833 0.00 0.00 37.64 3.32
1884 2000 0.953960 GTTACAACCCGTCCTGCCAG 60.954 60.000 0.00 0.00 0.00 4.85
1896 2012 1.628846 TCCTGCCAGTAAACCCTTCTC 59.371 52.381 0.00 0.00 0.00 2.87
1911 2027 7.770366 AACCCTTCTCGGTTTATTAAAACAT 57.230 32.000 5.13 0.00 43.88 2.71
1987 2179 0.734309 CTGCAAGTGTGTGTGCTTGA 59.266 50.000 8.27 0.00 43.29 3.02
1990 2182 0.381801 CAAGTGTGTGTGCTTGACCC 59.618 55.000 0.00 0.00 43.29 4.46
2022 2214 2.223900 TGTTCTGTGAGAGTGACAGCAG 60.224 50.000 0.00 0.00 40.64 4.24
2036 2228 2.209064 CAGCAGGTGGCATGTTGCTC 62.209 60.000 16.92 0.00 44.49 4.26
2091 2285 3.181469 ACGTTGGCACTTTCTTAGACAGA 60.181 43.478 2.08 0.00 0.00 3.41
2095 2289 4.825422 TGGCACTTTCTTAGACAGAGATG 58.175 43.478 2.08 0.00 31.12 2.90
2105 2299 5.358442 TCTTAGACAGAGATGTACTTGAGGC 59.642 44.000 0.00 0.00 0.00 4.70
2117 2311 1.421268 ACTTGAGGCAGTGGAATCACA 59.579 47.619 0.00 0.00 45.91 3.58
2125 2319 5.150715 AGGCAGTGGAATCACAGATATCTA 58.849 41.667 4.54 0.00 45.91 1.98
2191 2385 8.610248 TTTCAATTTTCCTCGTAGTATGTGAA 57.390 30.769 0.00 0.00 0.00 3.18
2285 2480 1.438651 TGTTTACGCATGTGAGCCTC 58.561 50.000 14.43 0.28 0.00 4.70
2340 2538 0.593128 ACCGTGCAGTGCTTTGATTC 59.407 50.000 17.60 0.00 0.00 2.52
2398 2596 1.677966 CTGAATGCCACCTGCTGCT 60.678 57.895 0.00 0.00 42.00 4.24
2413 2611 3.875727 CTGCTGCTGTAGTTTCTGCATAT 59.124 43.478 0.00 0.00 40.37 1.78
2416 2614 4.574013 GCTGCTGTAGTTTCTGCATATTCT 59.426 41.667 0.00 0.00 40.37 2.40
2447 2645 6.119144 TCGAATCTTAACCAAATTGCTAGC 57.881 37.500 8.10 8.10 0.00 3.42
2472 2670 7.363793 GCCTGTTGTTATTTTGGACAATCCTAT 60.364 37.037 0.00 0.00 37.98 2.57
2509 2707 1.552719 GGACCAGGAAGTGTAGGGTCT 60.553 57.143 8.80 0.00 45.69 3.85
2518 2716 2.461695 AGTGTAGGGTCTCTGTGATGG 58.538 52.381 0.00 0.00 0.00 3.51
2553 2751 9.238368 CTCTGGAATACCTCTTCCTTATACTAG 57.762 40.741 4.63 0.00 44.27 2.57
2620 2818 1.202639 TGTGAGTGTAACAGCAGGTGG 60.203 52.381 4.26 0.00 41.43 4.61
2630 2828 3.368571 GCAGGTGGCAGGTTGCTC 61.369 66.667 9.72 0.00 44.28 4.26
2665 2863 6.925610 ATGTACGAACAAAGTGCATATCAT 57.074 33.333 0.00 0.00 41.78 2.45
2670 2868 6.573434 ACGAACAAAGTGCATATCATCTAGA 58.427 36.000 0.00 0.00 0.00 2.43
2711 2909 2.086054 ACTCGAGGCACTGAAATCAC 57.914 50.000 18.41 0.00 41.55 3.06
2712 2910 1.338200 ACTCGAGGCACTGAAATCACC 60.338 52.381 18.41 0.00 41.55 4.02
2730 2928 1.001746 ACCGGATATCTGCATGCTCTG 59.998 52.381 20.33 12.19 0.00 3.35
2746 2944 4.318332 TGCTCTGGCATATAGTATTGCAC 58.682 43.478 14.90 8.20 44.28 4.57
2773 2971 7.366913 CCCTTTACAGGATTCTAGGGATTTTCT 60.367 40.741 0.46 0.00 44.19 2.52
2776 2974 6.899892 ACAGGATTCTAGGGATTTTCTTCT 57.100 37.500 0.00 0.00 0.00 2.85
2861 3140 8.974060 AGTTGAGTTTATTTTGTAGACTCCAA 57.026 30.769 0.00 0.00 36.72 3.53
2862 3141 9.574516 AGTTGAGTTTATTTTGTAGACTCCAAT 57.425 29.630 0.00 0.00 36.72 3.16
2863 3142 9.612620 GTTGAGTTTATTTTGTAGACTCCAATG 57.387 33.333 0.00 0.00 36.72 2.82
2864 3143 8.918202 TGAGTTTATTTTGTAGACTCCAATGT 57.082 30.769 0.00 0.00 36.72 2.71
2865 3144 9.349713 TGAGTTTATTTTGTAGACTCCAATGTT 57.650 29.630 0.00 0.00 36.72 2.71
2870 3149 6.569179 TTTTGTAGACTCCAATGTTTAGGC 57.431 37.500 0.00 0.00 0.00 3.93
2871 3150 4.901197 TGTAGACTCCAATGTTTAGGCA 57.099 40.909 0.00 0.00 0.00 4.75
2872 3151 5.435686 TGTAGACTCCAATGTTTAGGCAT 57.564 39.130 0.00 0.00 0.00 4.40
2873 3152 5.185454 TGTAGACTCCAATGTTTAGGCATG 58.815 41.667 0.00 0.00 0.00 4.06
2874 3153 4.307032 AGACTCCAATGTTTAGGCATGT 57.693 40.909 0.00 0.00 0.00 3.21
2875 3154 4.012374 AGACTCCAATGTTTAGGCATGTG 58.988 43.478 0.00 0.00 0.00 3.21
2876 3155 4.009675 GACTCCAATGTTTAGGCATGTGA 58.990 43.478 0.00 0.00 0.00 3.58
2877 3156 4.012374 ACTCCAATGTTTAGGCATGTGAG 58.988 43.478 0.00 0.00 35.35 3.51
2878 3157 2.754552 TCCAATGTTTAGGCATGTGAGC 59.245 45.455 0.00 0.00 0.00 4.26
2879 3158 2.756760 CCAATGTTTAGGCATGTGAGCT 59.243 45.455 0.00 0.00 34.17 4.09
2880 3159 3.428452 CCAATGTTTAGGCATGTGAGCTG 60.428 47.826 0.00 0.00 34.17 4.24
2881 3160 2.566833 TGTTTAGGCATGTGAGCTGT 57.433 45.000 0.00 0.00 34.17 4.40
2882 3161 2.153645 TGTTTAGGCATGTGAGCTGTG 58.846 47.619 0.00 0.00 34.17 3.66
2883 3162 1.135575 GTTTAGGCATGTGAGCTGTGC 60.136 52.381 0.00 0.00 38.12 4.57
2884 3163 0.325933 TTAGGCATGTGAGCTGTGCT 59.674 50.000 0.00 0.00 43.88 4.40
2885 3164 0.392060 TAGGCATGTGAGCTGTGCTG 60.392 55.000 0.00 0.00 39.88 4.41
2886 3165 2.178521 GCATGTGAGCTGTGCTGC 59.821 61.111 0.00 0.00 39.88 5.25
2887 3166 2.622962 GCATGTGAGCTGTGCTGCA 61.623 57.895 0.00 0.00 39.88 4.41
2888 3167 1.953772 CATGTGAGCTGTGCTGCAA 59.046 52.632 2.77 0.00 39.88 4.08
2889 3168 0.526211 CATGTGAGCTGTGCTGCAAT 59.474 50.000 2.77 0.00 39.88 3.56
2890 3169 1.067846 CATGTGAGCTGTGCTGCAATT 60.068 47.619 2.77 0.00 39.88 2.32
2891 3170 0.312729 TGTGAGCTGTGCTGCAATTG 59.687 50.000 2.77 0.00 39.88 2.32
2892 3171 0.313043 GTGAGCTGTGCTGCAATTGT 59.687 50.000 2.77 0.00 39.88 2.71
2893 3172 0.312729 TGAGCTGTGCTGCAATTGTG 59.687 50.000 2.77 1.87 39.88 3.33
2894 3173 0.313043 GAGCTGTGCTGCAATTGTGT 59.687 50.000 2.77 0.00 39.88 3.72
2895 3174 0.031585 AGCTGTGCTGCAATTGTGTG 59.968 50.000 2.77 0.00 37.57 3.82
2896 3175 0.249155 GCTGTGCTGCAATTGTGTGT 60.249 50.000 2.77 0.00 0.00 3.72
2897 3176 1.001487 GCTGTGCTGCAATTGTGTGTA 60.001 47.619 2.77 0.00 0.00 2.90
2898 3177 2.653890 CTGTGCTGCAATTGTGTGTAC 58.346 47.619 2.77 7.80 0.00 2.90
2899 3178 2.291465 CTGTGCTGCAATTGTGTGTACT 59.709 45.455 2.77 0.00 0.00 2.73
2900 3179 3.471680 TGTGCTGCAATTGTGTGTACTA 58.528 40.909 2.77 0.00 0.00 1.82
2901 3180 3.498018 TGTGCTGCAATTGTGTGTACTAG 59.502 43.478 2.77 0.00 0.00 2.57
2902 3181 3.745975 GTGCTGCAATTGTGTGTACTAGA 59.254 43.478 2.77 0.00 0.00 2.43
2903 3182 3.745975 TGCTGCAATTGTGTGTACTAGAC 59.254 43.478 7.40 0.00 0.00 2.59
2904 3183 3.125316 GCTGCAATTGTGTGTACTAGACC 59.875 47.826 7.40 0.00 0.00 3.85
2905 3184 4.314961 CTGCAATTGTGTGTACTAGACCA 58.685 43.478 7.40 0.00 0.00 4.02
2906 3185 4.062293 TGCAATTGTGTGTACTAGACCAC 58.938 43.478 7.40 3.09 32.72 4.16
2907 3186 4.202315 TGCAATTGTGTGTACTAGACCACT 60.202 41.667 7.40 0.00 33.08 4.00
2908 3187 4.389077 GCAATTGTGTGTACTAGACCACTC 59.611 45.833 7.40 12.14 33.08 3.51
2909 3188 5.784177 CAATTGTGTGTACTAGACCACTCT 58.216 41.667 14.52 0.00 33.08 3.24
2910 3189 6.571731 GCAATTGTGTGTACTAGACCACTCTA 60.572 42.308 7.40 9.94 33.08 2.43
2911 3190 7.375834 CAATTGTGTGTACTAGACCACTCTAA 58.624 38.462 14.52 9.11 33.08 2.10
2912 3191 6.964807 TTGTGTGTACTAGACCACTCTAAA 57.035 37.500 14.52 4.02 33.08 1.85
2913 3192 6.964807 TGTGTGTACTAGACCACTCTAAAA 57.035 37.500 14.52 0.00 33.08 1.52
2914 3193 7.350744 TGTGTGTACTAGACCACTCTAAAAA 57.649 36.000 14.52 0.00 33.08 1.94
2915 3194 7.959175 TGTGTGTACTAGACCACTCTAAAAAT 58.041 34.615 14.52 0.00 33.08 1.82
2916 3195 8.426489 TGTGTGTACTAGACCACTCTAAAAATT 58.574 33.333 14.52 0.00 33.08 1.82
2917 3196 9.269453 GTGTGTACTAGACCACTCTAAAAATTT 57.731 33.333 14.52 0.00 32.76 1.82
2918 3197 9.485206 TGTGTACTAGACCACTCTAAAAATTTC 57.515 33.333 14.52 0.00 32.76 2.17
2919 3198 9.708092 GTGTACTAGACCACTCTAAAAATTTCT 57.292 33.333 0.00 0.00 0.00 2.52
2931 3210 9.929180 ACTCTAAAAATTTCTTTATTTCTGGCC 57.071 29.630 0.00 0.00 0.00 5.36
2932 3211 9.927668 CTCTAAAAATTTCTTTATTTCTGGCCA 57.072 29.630 4.71 4.71 0.00 5.36
2936 3215 7.984422 AAATTTCTTTATTTCTGGCCAAAGG 57.016 32.000 7.01 0.00 0.00 3.11
2937 3216 6.933514 ATTTCTTTATTTCTGGCCAAAGGA 57.066 33.333 7.01 0.03 0.00 3.36
2938 3217 5.982890 TTCTTTATTTCTGGCCAAAGGAG 57.017 39.130 7.01 0.00 0.00 3.69
2939 3218 3.763897 TCTTTATTTCTGGCCAAAGGAGC 59.236 43.478 7.01 0.00 0.00 4.70
2940 3219 1.750193 TATTTCTGGCCAAAGGAGCG 58.250 50.000 7.01 0.00 0.00 5.03
2941 3220 1.598701 ATTTCTGGCCAAAGGAGCGC 61.599 55.000 7.01 0.00 0.00 5.92
2942 3221 4.722700 TCTGGCCAAAGGAGCGCC 62.723 66.667 7.01 0.00 43.32 6.53
2947 3226 4.697756 CCAAAGGAGCGCCACCGA 62.698 66.667 9.88 0.00 36.29 4.69
2948 3227 3.423154 CAAAGGAGCGCCACCGAC 61.423 66.667 9.88 0.00 36.29 4.79
2949 3228 4.699522 AAAGGAGCGCCACCGACC 62.700 66.667 9.88 0.00 36.29 4.79
2953 3232 4.699522 GAGCGCCACCGACCCTTT 62.700 66.667 2.29 0.00 36.29 3.11
2956 3235 2.046314 CGCCACCGACCCTTTGAT 60.046 61.111 0.00 0.00 36.29 2.57
2957 3236 2.106683 CGCCACCGACCCTTTGATC 61.107 63.158 0.00 0.00 36.29 2.92
2958 3237 1.749258 GCCACCGACCCTTTGATCC 60.749 63.158 0.00 0.00 0.00 3.36
2959 3238 1.991230 CCACCGACCCTTTGATCCT 59.009 57.895 0.00 0.00 0.00 3.24
2960 3239 0.392998 CCACCGACCCTTTGATCCTG 60.393 60.000 0.00 0.00 0.00 3.86
2961 3240 0.613260 CACCGACCCTTTGATCCTGA 59.387 55.000 0.00 0.00 0.00 3.86
2962 3241 1.003118 CACCGACCCTTTGATCCTGAA 59.997 52.381 0.00 0.00 0.00 3.02
2963 3242 1.916181 ACCGACCCTTTGATCCTGAAT 59.084 47.619 0.00 0.00 0.00 2.57
2964 3243 2.292267 CCGACCCTTTGATCCTGAATG 58.708 52.381 0.00 0.00 0.00 2.67
2965 3244 1.672881 CGACCCTTTGATCCTGAATGC 59.327 52.381 0.00 0.00 0.00 3.56
2966 3245 2.027385 GACCCTTTGATCCTGAATGCC 58.973 52.381 0.00 0.00 0.00 4.40
2967 3246 1.358787 ACCCTTTGATCCTGAATGCCA 59.641 47.619 0.00 0.00 0.00 4.92
2968 3247 1.753073 CCCTTTGATCCTGAATGCCAC 59.247 52.381 0.00 0.00 0.00 5.01
2969 3248 1.753073 CCTTTGATCCTGAATGCCACC 59.247 52.381 0.00 0.00 0.00 4.61
2970 3249 2.622452 CCTTTGATCCTGAATGCCACCT 60.622 50.000 0.00 0.00 0.00 4.00
2971 3250 2.133281 TTGATCCTGAATGCCACCTG 57.867 50.000 0.00 0.00 0.00 4.00
2972 3251 0.394762 TGATCCTGAATGCCACCTGC 60.395 55.000 0.00 0.00 41.77 4.85
2973 3252 0.106819 GATCCTGAATGCCACCTGCT 60.107 55.000 0.00 0.00 42.00 4.24
2974 3253 0.395311 ATCCTGAATGCCACCTGCTG 60.395 55.000 0.00 0.00 42.00 4.41
2975 3254 2.707849 CCTGAATGCCACCTGCTGC 61.708 63.158 0.00 0.00 42.00 5.25
2976 3255 2.677524 TGAATGCCACCTGCTGCC 60.678 61.111 0.00 0.00 42.00 4.85
2977 3256 3.818787 GAATGCCACCTGCTGCCG 61.819 66.667 0.00 0.00 42.00 5.69
2987 3266 2.203195 TGCTGCCGCAGTTTCTGT 60.203 55.556 21.29 0.00 42.25 3.41
2988 3267 2.253452 GCTGCCGCAGTTTCTGTG 59.747 61.111 21.29 3.68 41.13 3.66
2989 3268 2.546494 GCTGCCGCAGTTTCTGTGT 61.546 57.895 21.29 0.00 39.99 3.72
2990 3269 1.227999 GCTGCCGCAGTTTCTGTGTA 61.228 55.000 21.29 0.00 39.99 2.90
2991 3270 0.512952 CTGCCGCAGTTTCTGTGTAC 59.487 55.000 12.54 0.00 39.99 2.90
2992 3271 1.218875 TGCCGCAGTTTCTGTGTACG 61.219 55.000 9.01 0.00 39.99 3.67
2993 3272 1.491563 CCGCAGTTTCTGTGTACGC 59.508 57.895 0.00 0.00 39.99 4.42
2994 3273 1.218875 CCGCAGTTTCTGTGTACGCA 61.219 55.000 9.13 9.13 39.99 5.24
2995 3274 0.161658 CGCAGTTTCTGTGTACGCAG 59.838 55.000 27.05 27.05 37.23 5.18
2996 3275 0.110644 GCAGTTTCTGTGTACGCAGC 60.111 55.000 27.91 16.08 36.49 5.25
2997 3276 0.512952 CAGTTTCTGTGTACGCAGCC 59.487 55.000 27.91 18.40 36.49 4.85
2998 3277 0.944311 AGTTTCTGTGTACGCAGCCG 60.944 55.000 27.91 9.45 36.49 5.52
3008 3287 3.916439 CGCAGCCGTTTTCAAACC 58.084 55.556 0.00 0.00 35.51 3.27
3009 3288 1.358759 CGCAGCCGTTTTCAAACCT 59.641 52.632 0.00 0.00 35.51 3.50
3010 3289 0.660300 CGCAGCCGTTTTCAAACCTC 60.660 55.000 0.00 0.00 35.51 3.85
3011 3290 0.383949 GCAGCCGTTTTCAAACCTCA 59.616 50.000 0.00 0.00 35.51 3.86
3012 3291 1.202359 GCAGCCGTTTTCAAACCTCAA 60.202 47.619 0.00 0.00 35.51 3.02
3013 3292 2.459934 CAGCCGTTTTCAAACCTCAAC 58.540 47.619 0.00 0.00 35.51 3.18
3014 3293 2.099098 CAGCCGTTTTCAAACCTCAACT 59.901 45.455 0.00 0.00 35.51 3.16
3015 3294 3.314080 CAGCCGTTTTCAAACCTCAACTA 59.686 43.478 0.00 0.00 35.51 2.24
3016 3295 3.949113 AGCCGTTTTCAAACCTCAACTAA 59.051 39.130 0.00 0.00 35.51 2.24
3017 3296 4.399934 AGCCGTTTTCAAACCTCAACTAAA 59.600 37.500 0.00 0.00 35.51 1.85
3018 3297 5.068591 AGCCGTTTTCAAACCTCAACTAAAT 59.931 36.000 0.00 0.00 35.51 1.40
3019 3298 5.751509 GCCGTTTTCAAACCTCAACTAAATT 59.248 36.000 0.00 0.00 35.51 1.82
3020 3299 6.292114 GCCGTTTTCAAACCTCAACTAAATTG 60.292 38.462 0.00 0.00 36.25 2.32
3021 3300 6.292114 CCGTTTTCAAACCTCAACTAAATTGC 60.292 38.462 0.00 0.00 35.52 3.56
3022 3301 6.475402 CGTTTTCAAACCTCAACTAAATTGCT 59.525 34.615 0.00 0.00 35.52 3.91
3023 3302 7.646130 CGTTTTCAAACCTCAACTAAATTGCTA 59.354 33.333 0.00 0.00 35.52 3.49
3024 3303 8.968242 GTTTTCAAACCTCAACTAAATTGCTAG 58.032 33.333 0.00 0.00 34.14 3.42
3025 3304 7.817418 TTCAAACCTCAACTAAATTGCTAGT 57.183 32.000 0.00 0.00 38.29 2.57
3026 3305 7.435068 TCAAACCTCAACTAAATTGCTAGTC 57.565 36.000 0.00 0.00 38.29 2.59
3027 3306 7.224297 TCAAACCTCAACTAAATTGCTAGTCT 58.776 34.615 0.00 0.00 38.29 3.24
3028 3307 8.372459 TCAAACCTCAACTAAATTGCTAGTCTA 58.628 33.333 0.00 0.00 38.29 2.59
3029 3308 9.167311 CAAACCTCAACTAAATTGCTAGTCTAT 57.833 33.333 0.00 0.00 38.29 1.98
3030 3309 9.740710 AAACCTCAACTAAATTGCTAGTCTATT 57.259 29.630 0.00 0.00 38.29 1.73
3031 3310 8.723942 ACCTCAACTAAATTGCTAGTCTATTG 57.276 34.615 0.00 0.00 38.29 1.90
3032 3311 7.281100 ACCTCAACTAAATTGCTAGTCTATTGC 59.719 37.037 0.00 0.00 38.29 3.56
3033 3312 7.234187 TCAACTAAATTGCTAGTCTATTGCG 57.766 36.000 0.00 0.00 38.29 4.85
3034 3313 6.257849 TCAACTAAATTGCTAGTCTATTGCGG 59.742 38.462 0.00 0.00 38.29 5.69
3035 3314 5.057149 ACTAAATTGCTAGTCTATTGCGGG 58.943 41.667 0.00 0.00 31.64 6.13
3036 3315 3.560636 AATTGCTAGTCTATTGCGGGT 57.439 42.857 0.00 0.00 31.64 5.28
3037 3316 3.560636 ATTGCTAGTCTATTGCGGGTT 57.439 42.857 0.00 0.00 31.64 4.11
3038 3317 3.343941 TTGCTAGTCTATTGCGGGTTT 57.656 42.857 0.00 0.00 31.64 3.27
3039 3318 2.627945 TGCTAGTCTATTGCGGGTTTG 58.372 47.619 0.00 0.00 31.64 2.93
3040 3319 1.940613 GCTAGTCTATTGCGGGTTTGG 59.059 52.381 0.00 0.00 0.00 3.28
3041 3320 2.419574 GCTAGTCTATTGCGGGTTTGGA 60.420 50.000 0.00 0.00 0.00 3.53
3042 3321 2.109425 AGTCTATTGCGGGTTTGGAC 57.891 50.000 0.00 0.00 0.00 4.02
3043 3322 1.349688 AGTCTATTGCGGGTTTGGACA 59.650 47.619 0.00 0.00 0.00 4.02
3044 3323 2.156098 GTCTATTGCGGGTTTGGACAA 58.844 47.619 0.00 0.00 0.00 3.18
3045 3324 2.554893 GTCTATTGCGGGTTTGGACAAA 59.445 45.455 0.00 0.00 0.00 2.83
3046 3325 2.817258 TCTATTGCGGGTTTGGACAAAG 59.183 45.455 0.00 0.00 0.00 2.77
3047 3326 0.033366 ATTGCGGGTTTGGACAAAGC 59.967 50.000 16.27 16.27 45.21 3.51
3053 3332 2.287977 GGTTTGGACAAAGCCTACCT 57.712 50.000 14.23 0.00 41.47 3.08
3054 3333 2.160205 GGTTTGGACAAAGCCTACCTC 58.840 52.381 14.23 0.00 41.47 3.85
3055 3334 2.160205 GTTTGGACAAAGCCTACCTCC 58.840 52.381 0.00 0.00 0.00 4.30
3056 3335 0.696501 TTGGACAAAGCCTACCTCCC 59.303 55.000 0.00 0.00 0.00 4.30
3057 3336 1.221021 GGACAAAGCCTACCTCCCG 59.779 63.158 0.00 0.00 0.00 5.14
3058 3337 1.221021 GACAAAGCCTACCTCCCGG 59.779 63.158 0.00 0.00 0.00 5.73
3059 3338 2.124695 CAAAGCCTACCTCCCGGC 60.125 66.667 0.00 0.00 46.65 6.13
3063 3342 3.851128 GCCTACCTCCCGGCAGTC 61.851 72.222 0.00 0.00 45.59 3.51
3064 3343 2.363795 CCTACCTCCCGGCAGTCA 60.364 66.667 0.00 0.00 0.00 3.41
3065 3344 2.427245 CCTACCTCCCGGCAGTCAG 61.427 68.421 0.00 0.00 0.00 3.51
3066 3345 2.363795 TACCTCCCGGCAGTCAGG 60.364 66.667 0.00 0.00 0.00 3.86
3067 3346 2.856039 CTACCTCCCGGCAGTCAGGA 62.856 65.000 0.00 0.00 0.00 3.86
3068 3347 2.449967 TACCTCCCGGCAGTCAGGAA 62.450 60.000 0.00 0.00 0.00 3.36
3069 3348 2.581354 CTCCCGGCAGTCAGGAAG 59.419 66.667 0.00 0.00 0.00 3.46
3070 3349 1.984570 CTCCCGGCAGTCAGGAAGA 60.985 63.158 0.00 0.00 0.00 2.87
3081 3360 1.066787 GTCAGGAAGACCAGGTAGTGC 60.067 57.143 0.00 0.00 41.56 4.40
3082 3361 0.976641 CAGGAAGACCAGGTAGTGCA 59.023 55.000 0.00 0.00 38.94 4.57
3083 3362 1.066573 CAGGAAGACCAGGTAGTGCAG 60.067 57.143 0.00 0.00 38.94 4.41
3084 3363 0.250513 GGAAGACCAGGTAGTGCAGG 59.749 60.000 0.00 0.00 35.97 4.85
3085 3364 0.250513 GAAGACCAGGTAGTGCAGGG 59.749 60.000 0.00 0.00 0.00 4.45
3086 3365 0.473886 AAGACCAGGTAGTGCAGGGT 60.474 55.000 0.00 0.00 33.78 4.34
3087 3366 0.905337 AGACCAGGTAGTGCAGGGTC 60.905 60.000 11.09 11.09 46.54 4.46
3088 3367 1.152118 ACCAGGTAGTGCAGGGTCA 60.152 57.895 0.00 0.00 0.00 4.02
3089 3368 1.296715 CCAGGTAGTGCAGGGTCAC 59.703 63.158 0.00 0.00 37.24 3.67
3102 3381 3.947868 CAGGGTCACTGTGATGAATTCT 58.052 45.455 14.37 3.28 42.42 2.40
3103 3382 5.089970 CAGGGTCACTGTGATGAATTCTA 57.910 43.478 14.37 0.00 42.42 2.10
3104 3383 5.678583 CAGGGTCACTGTGATGAATTCTAT 58.321 41.667 14.37 0.00 42.42 1.98
3105 3384 5.757320 CAGGGTCACTGTGATGAATTCTATC 59.243 44.000 14.37 8.62 42.42 2.08
3106 3385 5.664908 AGGGTCACTGTGATGAATTCTATCT 59.335 40.000 14.37 0.00 0.00 1.98
3107 3386 5.988561 GGGTCACTGTGATGAATTCTATCTC 59.011 44.000 14.37 9.26 0.00 2.75
3108 3387 6.183360 GGGTCACTGTGATGAATTCTATCTCT 60.183 42.308 14.37 0.00 0.00 3.10
3109 3388 6.700960 GGTCACTGTGATGAATTCTATCTCTG 59.299 42.308 14.37 13.28 0.00 3.35
3110 3389 6.700960 GTCACTGTGATGAATTCTATCTCTGG 59.299 42.308 14.37 8.53 0.00 3.86
3111 3390 6.608808 TCACTGTGATGAATTCTATCTCTGGA 59.391 38.462 6.36 9.07 0.00 3.86
3112 3391 7.124750 TCACTGTGATGAATTCTATCTCTGGAA 59.875 37.037 6.36 4.25 0.00 3.53
3113 3392 7.932491 CACTGTGATGAATTCTATCTCTGGAAT 59.068 37.037 7.05 0.00 34.35 3.01
3114 3393 9.152327 ACTGTGATGAATTCTATCTCTGGAATA 57.848 33.333 7.05 0.00 31.96 1.75
3115 3394 9.421806 CTGTGATGAATTCTATCTCTGGAATAC 57.578 37.037 7.05 1.82 31.96 1.89
3116 3395 9.152327 TGTGATGAATTCTATCTCTGGAATACT 57.848 33.333 7.05 0.00 31.96 2.12
3117 3396 9.421806 GTGATGAATTCTATCTCTGGAATACTG 57.578 37.037 7.05 0.00 31.96 2.74
3118 3397 8.093307 TGATGAATTCTATCTCTGGAATACTGC 58.907 37.037 7.05 0.00 31.96 4.40
3119 3398 7.609097 TGAATTCTATCTCTGGAATACTGCT 57.391 36.000 7.05 0.00 31.96 4.24
3120 3399 8.027524 TGAATTCTATCTCTGGAATACTGCTT 57.972 34.615 7.05 0.00 31.96 3.91
3121 3400 8.489489 TGAATTCTATCTCTGGAATACTGCTTT 58.511 33.333 7.05 0.00 31.96 3.51
3122 3401 8.900983 AATTCTATCTCTGGAATACTGCTTTC 57.099 34.615 0.00 0.00 31.96 2.62
3123 3402 7.667575 TTCTATCTCTGGAATACTGCTTTCT 57.332 36.000 0.00 0.00 0.00 2.52
3124 3403 7.667575 TCTATCTCTGGAATACTGCTTTCTT 57.332 36.000 0.00 0.00 0.00 2.52
3125 3404 8.768501 TCTATCTCTGGAATACTGCTTTCTTA 57.231 34.615 0.00 0.00 0.00 2.10
3126 3405 9.373450 TCTATCTCTGGAATACTGCTTTCTTAT 57.627 33.333 0.00 0.00 0.00 1.73
3156 3435 9.921637 AACTTAAAGAACATAGAGAAGAGTCAG 57.078 33.333 0.00 0.00 0.00 3.51
3157 3436 9.084533 ACTTAAAGAACATAGAGAAGAGTCAGT 57.915 33.333 0.00 0.00 0.00 3.41
3158 3437 9.567848 CTTAAAGAACATAGAGAAGAGTCAGTC 57.432 37.037 0.00 0.00 0.00 3.51
3159 3438 7.531857 AAAGAACATAGAGAAGAGTCAGTCA 57.468 36.000 0.00 0.00 0.00 3.41
3160 3439 6.757897 AGAACATAGAGAAGAGTCAGTCAG 57.242 41.667 0.00 0.00 0.00 3.51
3161 3440 6.480763 AGAACATAGAGAAGAGTCAGTCAGA 58.519 40.000 0.00 0.00 0.00 3.27
3162 3441 7.118723 AGAACATAGAGAAGAGTCAGTCAGAT 58.881 38.462 0.00 0.00 0.00 2.90
3163 3442 7.615365 AGAACATAGAGAAGAGTCAGTCAGATT 59.385 37.037 0.00 0.00 0.00 2.40
3164 3443 7.716799 ACATAGAGAAGAGTCAGTCAGATTT 57.283 36.000 0.00 0.00 0.00 2.17
3165 3444 8.815565 ACATAGAGAAGAGTCAGTCAGATTTA 57.184 34.615 0.00 0.00 0.00 1.40
3166 3445 9.249053 ACATAGAGAAGAGTCAGTCAGATTTAA 57.751 33.333 0.00 0.00 0.00 1.52
3170 3449 9.474313 AGAGAAGAGTCAGTCAGATTTAATACT 57.526 33.333 0.00 0.00 0.00 2.12
3171 3450 9.730420 GAGAAGAGTCAGTCAGATTTAATACTC 57.270 37.037 0.00 0.00 33.86 2.59
3172 3451 9.474313 AGAAGAGTCAGTCAGATTTAATACTCT 57.526 33.333 0.00 0.00 43.09 3.24
3173 3452 9.515020 GAAGAGTCAGTCAGATTTAATACTCTG 57.485 37.037 0.00 0.00 41.04 3.35
3174 3453 8.588290 AGAGTCAGTCAGATTTAATACTCTGT 57.412 34.615 0.00 0.00 40.55 3.41
3175 3454 8.682710 AGAGTCAGTCAGATTTAATACTCTGTC 58.317 37.037 0.00 5.34 40.55 3.51
3176 3455 8.354711 AGTCAGTCAGATTTAATACTCTGTCA 57.645 34.615 8.98 0.00 39.87 3.58
3177 3456 8.976353 AGTCAGTCAGATTTAATACTCTGTCAT 58.024 33.333 8.98 0.00 39.87 3.06
3178 3457 9.029243 GTCAGTCAGATTTAATACTCTGTCATG 57.971 37.037 8.98 0.00 39.87 3.07
3179 3458 8.753133 TCAGTCAGATTTAATACTCTGTCATGT 58.247 33.333 8.98 0.00 39.87 3.21
3180 3459 8.815189 CAGTCAGATTTAATACTCTGTCATGTG 58.185 37.037 8.98 0.00 39.87 3.21
3181 3460 8.753133 AGTCAGATTTAATACTCTGTCATGTGA 58.247 33.333 8.98 0.00 39.87 3.58
3182 3461 9.029243 GTCAGATTTAATACTCTGTCATGTGAG 57.971 37.037 10.09 10.09 39.87 3.51
3183 3462 8.753133 TCAGATTTAATACTCTGTCATGTGAGT 58.247 33.333 17.54 17.54 44.56 3.41
3184 3463 8.815189 CAGATTTAATACTCTGTCATGTGAGTG 58.185 37.037 20.43 10.04 42.67 3.51
3185 3464 8.535335 AGATTTAATACTCTGTCATGTGAGTGT 58.465 33.333 20.43 14.75 42.67 3.55
3186 3465 7.889589 TTTAATACTCTGTCATGTGAGTGTG 57.110 36.000 20.43 6.11 42.67 3.82
3187 3466 5.728637 AATACTCTGTCATGTGAGTGTGA 57.271 39.130 20.43 8.39 42.67 3.58
3188 3467 3.377346 ACTCTGTCATGTGAGTGTGAC 57.623 47.619 14.44 0.00 41.40 3.67
3191 3470 1.869774 TGTCATGTGAGTGTGACAGC 58.130 50.000 4.25 0.00 46.97 4.40
3192 3471 1.138661 TGTCATGTGAGTGTGACAGCA 59.861 47.619 4.25 0.00 46.97 4.41
3193 3472 2.212652 GTCATGTGAGTGTGACAGCAA 58.787 47.619 0.00 0.00 43.20 3.91
3194 3473 2.222678 GTCATGTGAGTGTGACAGCAAG 59.777 50.000 0.00 0.00 43.20 4.01
3195 3474 2.158914 TCATGTGAGTGTGACAGCAAGT 60.159 45.455 0.00 0.00 0.00 3.16
3196 3475 1.655484 TGTGAGTGTGACAGCAAGTG 58.345 50.000 0.00 0.00 0.00 3.16
3197 3476 1.206849 TGTGAGTGTGACAGCAAGTGA 59.793 47.619 0.00 0.00 0.00 3.41
3198 3477 2.279741 GTGAGTGTGACAGCAAGTGAA 58.720 47.619 0.00 0.00 0.00 3.18
3199 3478 2.677836 GTGAGTGTGACAGCAAGTGAAA 59.322 45.455 0.00 0.00 0.00 2.69
3200 3479 2.938451 TGAGTGTGACAGCAAGTGAAAG 59.062 45.455 0.00 0.00 0.00 2.62
3201 3480 2.289002 GAGTGTGACAGCAAGTGAAAGG 59.711 50.000 0.00 0.00 0.00 3.11
3202 3481 2.017049 GTGTGACAGCAAGTGAAAGGT 58.983 47.619 0.00 0.00 0.00 3.50
3203 3482 2.423538 GTGTGACAGCAAGTGAAAGGTT 59.576 45.455 0.00 0.00 0.00 3.50
3204 3483 2.423185 TGTGACAGCAAGTGAAAGGTTG 59.577 45.455 0.00 0.00 0.00 3.77
3208 3487 3.575399 GCAAGTGAAAGGTTGCCTG 57.425 52.632 0.00 0.00 42.73 4.85
3209 3488 0.746659 GCAAGTGAAAGGTTGCCTGT 59.253 50.000 0.00 0.00 42.73 4.00
3210 3489 1.136891 GCAAGTGAAAGGTTGCCTGTT 59.863 47.619 0.00 0.00 42.73 3.16
3211 3490 2.418609 GCAAGTGAAAGGTTGCCTGTTT 60.419 45.455 0.00 0.00 42.73 2.83
3212 3491 3.447742 CAAGTGAAAGGTTGCCTGTTTC 58.552 45.455 0.00 0.00 32.13 2.78
3213 3492 2.733956 AGTGAAAGGTTGCCTGTTTCA 58.266 42.857 0.00 0.00 32.13 2.69
3214 3493 2.689983 AGTGAAAGGTTGCCTGTTTCAG 59.310 45.455 3.35 0.00 32.93 3.02
3230 3509 8.506168 CCTGTTTCAGGCTTATTATGTAAGAA 57.494 34.615 2.77 0.00 45.13 2.52
3231 3510 9.125026 CCTGTTTCAGGCTTATTATGTAAGAAT 57.875 33.333 2.77 0.00 45.13 2.40
3260 3539 9.727627 GAATAAAATGCATTTCTTAGACAGAGG 57.272 33.333 24.28 0.00 31.12 3.69
3261 3540 8.814038 ATAAAATGCATTTCTTAGACAGAGGT 57.186 30.769 24.28 7.20 31.12 3.85
3262 3541 6.749923 AAATGCATTTCTTAGACAGAGGTC 57.250 37.500 18.99 0.00 44.66 3.85
3263 3542 8.103305 TAAAATGCATTTCTTAGACAGAGGTCT 58.897 33.333 24.28 6.16 43.32 3.85
3273 3552 3.876274 GACAGAGGTCTACTTGATGCA 57.124 47.619 0.00 0.00 40.99 3.96
3274 3553 3.516615 GACAGAGGTCTACTTGATGCAC 58.483 50.000 0.00 0.00 40.99 4.57
3275 3554 3.169099 ACAGAGGTCTACTTGATGCACT 58.831 45.455 0.00 0.00 0.00 4.40
3276 3555 3.194542 ACAGAGGTCTACTTGATGCACTC 59.805 47.826 0.00 0.00 0.00 3.51
3277 3556 3.194329 CAGAGGTCTACTTGATGCACTCA 59.806 47.826 0.00 0.00 0.00 3.41
3278 3557 3.834813 AGAGGTCTACTTGATGCACTCAA 59.165 43.478 10.01 10.01 41.61 3.02
3279 3558 4.284490 AGAGGTCTACTTGATGCACTCAAA 59.716 41.667 11.14 0.48 43.20 2.69
3280 3559 5.046014 AGAGGTCTACTTGATGCACTCAAAT 60.046 40.000 11.14 5.83 43.20 2.32
3281 3560 5.564550 AGGTCTACTTGATGCACTCAAATT 58.435 37.500 11.14 5.85 43.20 1.82
3282 3561 6.711277 AGGTCTACTTGATGCACTCAAATTA 58.289 36.000 11.14 6.45 43.20 1.40
3283 3562 7.341805 AGGTCTACTTGATGCACTCAAATTAT 58.658 34.615 11.14 3.25 43.20 1.28
3284 3563 8.486210 AGGTCTACTTGATGCACTCAAATTATA 58.514 33.333 11.14 3.95 43.20 0.98
3285 3564 8.768955 GGTCTACTTGATGCACTCAAATTATAG 58.231 37.037 11.14 10.27 43.20 1.31
3286 3565 9.534565 GTCTACTTGATGCACTCAAATTATAGA 57.465 33.333 11.14 11.65 43.20 1.98
3290 3569 9.053840 ACTTGATGCACTCAAATTATAGATCTG 57.946 33.333 5.18 0.00 43.20 2.90
3291 3570 7.430992 TGATGCACTCAAATTATAGATCTGC 57.569 36.000 5.18 0.00 0.00 4.26
3292 3571 5.912360 TGCACTCAAATTATAGATCTGCG 57.088 39.130 5.18 0.00 0.00 5.18
3293 3572 5.359756 TGCACTCAAATTATAGATCTGCGT 58.640 37.500 5.18 0.00 0.00 5.24
3294 3573 5.817296 TGCACTCAAATTATAGATCTGCGTT 59.183 36.000 5.18 0.00 0.00 4.84
3295 3574 6.132056 GCACTCAAATTATAGATCTGCGTTG 58.868 40.000 5.18 3.13 0.00 4.10
3296 3575 6.238211 GCACTCAAATTATAGATCTGCGTTGT 60.238 38.462 5.18 0.00 0.00 3.32
3297 3576 7.340699 CACTCAAATTATAGATCTGCGTTGTC 58.659 38.462 5.18 0.00 0.00 3.18
3298 3577 7.223582 CACTCAAATTATAGATCTGCGTTGTCT 59.776 37.037 5.18 0.00 0.00 3.41
3299 3578 7.766278 ACTCAAATTATAGATCTGCGTTGTCTT 59.234 33.333 5.18 0.00 0.00 3.01
3300 3579 7.909267 TCAAATTATAGATCTGCGTTGTCTTG 58.091 34.615 5.18 0.00 0.00 3.02
3301 3580 5.914085 ATTATAGATCTGCGTTGTCTTGC 57.086 39.130 5.18 0.00 0.00 4.01
3302 3581 2.741759 TAGATCTGCGTTGTCTTGCA 57.258 45.000 5.18 0.00 39.13 4.08
3303 3582 2.105006 AGATCTGCGTTGTCTTGCAT 57.895 45.000 0.00 0.00 40.89 3.96
3304 3583 3.251479 AGATCTGCGTTGTCTTGCATA 57.749 42.857 0.00 0.00 40.89 3.14
3305 3584 3.801698 AGATCTGCGTTGTCTTGCATAT 58.198 40.909 0.00 0.00 40.89 1.78
3306 3585 4.948847 AGATCTGCGTTGTCTTGCATATA 58.051 39.130 0.00 0.00 40.89 0.86
3307 3586 4.987285 AGATCTGCGTTGTCTTGCATATAG 59.013 41.667 0.00 0.00 40.89 1.31
3308 3587 4.123497 TCTGCGTTGTCTTGCATATAGT 57.877 40.909 0.00 0.00 40.89 2.12
3309 3588 5.257082 TCTGCGTTGTCTTGCATATAGTA 57.743 39.130 0.00 0.00 40.89 1.82
3310 3589 5.842907 TCTGCGTTGTCTTGCATATAGTAT 58.157 37.500 0.00 0.00 40.89 2.12
3311 3590 6.280643 TCTGCGTTGTCTTGCATATAGTATT 58.719 36.000 0.00 0.00 40.89 1.89
3312 3591 6.200854 TCTGCGTTGTCTTGCATATAGTATTG 59.799 38.462 0.00 0.00 40.89 1.90
3313 3592 5.140177 GCGTTGTCTTGCATATAGTATTGC 58.860 41.667 9.18 9.18 39.33 3.56
3314 3593 5.277297 GCGTTGTCTTGCATATAGTATTGCA 60.277 40.000 12.90 12.90 46.51 4.08
3323 3602 7.144722 TGCATATAGTATTGCAGCCATTTAC 57.855 36.000 12.90 0.00 43.54 2.01
3324 3603 6.942005 TGCATATAGTATTGCAGCCATTTACT 59.058 34.615 12.90 0.00 43.54 2.24
3325 3604 7.448161 TGCATATAGTATTGCAGCCATTTACTT 59.552 33.333 12.90 0.00 43.54 2.24
3326 3605 7.752239 GCATATAGTATTGCAGCCATTTACTTG 59.248 37.037 10.55 0.00 38.72 3.16
3327 3606 9.002600 CATATAGTATTGCAGCCATTTACTTGA 57.997 33.333 0.00 0.00 0.00 3.02
3328 3607 5.824904 AGTATTGCAGCCATTTACTTGAG 57.175 39.130 0.00 0.00 0.00 3.02
3329 3608 5.256474 AGTATTGCAGCCATTTACTTGAGT 58.744 37.500 0.00 0.00 0.00 3.41
3330 3609 4.708726 ATTGCAGCCATTTACTTGAGTC 57.291 40.909 0.00 0.00 0.00 3.36
3331 3610 3.423539 TGCAGCCATTTACTTGAGTCT 57.576 42.857 0.00 0.00 0.00 3.24
3332 3611 3.754965 TGCAGCCATTTACTTGAGTCTT 58.245 40.909 0.00 0.00 0.00 3.01
3333 3612 3.503363 TGCAGCCATTTACTTGAGTCTTG 59.497 43.478 0.00 0.00 0.00 3.02
3334 3613 3.119708 GCAGCCATTTACTTGAGTCTTGG 60.120 47.826 0.00 0.00 0.00 3.61
3335 3614 3.441572 CAGCCATTTACTTGAGTCTTGGG 59.558 47.826 0.00 0.00 0.00 4.12
3336 3615 3.330701 AGCCATTTACTTGAGTCTTGGGA 59.669 43.478 0.00 0.00 0.00 4.37
3337 3616 4.018050 AGCCATTTACTTGAGTCTTGGGAT 60.018 41.667 0.00 0.00 0.00 3.85
3338 3617 4.706962 GCCATTTACTTGAGTCTTGGGATT 59.293 41.667 0.00 0.00 0.00 3.01
3339 3618 5.185828 GCCATTTACTTGAGTCTTGGGATTT 59.814 40.000 0.00 0.00 0.00 2.17
3340 3619 6.295292 GCCATTTACTTGAGTCTTGGGATTTT 60.295 38.462 0.00 0.00 0.00 1.82
3341 3620 7.670364 CCATTTACTTGAGTCTTGGGATTTTT 58.330 34.615 0.00 0.00 0.00 1.94
3342 3621 7.814587 CCATTTACTTGAGTCTTGGGATTTTTC 59.185 37.037 0.00 0.00 0.00 2.29
3343 3622 6.894339 TTACTTGAGTCTTGGGATTTTTCC 57.106 37.500 0.00 0.00 0.00 3.13
3344 3623 5.066913 ACTTGAGTCTTGGGATTTTTCCT 57.933 39.130 0.00 0.00 0.00 3.36
3345 3624 5.073428 ACTTGAGTCTTGGGATTTTTCCTC 58.927 41.667 0.00 0.00 0.00 3.71
3346 3625 3.674997 TGAGTCTTGGGATTTTTCCTCG 58.325 45.455 0.00 0.00 0.00 4.63
3347 3626 3.072476 TGAGTCTTGGGATTTTTCCTCGT 59.928 43.478 0.00 0.00 0.00 4.18
3348 3627 4.285003 TGAGTCTTGGGATTTTTCCTCGTA 59.715 41.667 0.00 0.00 0.00 3.43
3349 3628 4.833390 AGTCTTGGGATTTTTCCTCGTAG 58.167 43.478 0.00 0.00 0.00 3.51
3350 3629 4.286291 AGTCTTGGGATTTTTCCTCGTAGT 59.714 41.667 0.00 0.00 0.00 2.73
3351 3630 4.392138 GTCTTGGGATTTTTCCTCGTAGTG 59.608 45.833 0.00 0.00 0.00 2.74
3352 3631 2.706890 TGGGATTTTTCCTCGTAGTGC 58.293 47.619 0.00 0.00 0.00 4.40
3353 3632 2.039216 TGGGATTTTTCCTCGTAGTGCA 59.961 45.455 0.00 0.00 0.00 4.57
3354 3633 2.418976 GGGATTTTTCCTCGTAGTGCAC 59.581 50.000 9.40 9.40 0.00 4.57
3381 3660 3.653539 AAAACGTCCTGCCAATAAACC 57.346 42.857 0.00 0.00 0.00 3.27
3382 3661 1.541379 AACGTCCTGCCAATAAACCC 58.459 50.000 0.00 0.00 0.00 4.11
3383 3662 0.696501 ACGTCCTGCCAATAAACCCT 59.303 50.000 0.00 0.00 0.00 4.34
3384 3663 1.074889 ACGTCCTGCCAATAAACCCTT 59.925 47.619 0.00 0.00 0.00 3.95
3385 3664 1.743394 CGTCCTGCCAATAAACCCTTC 59.257 52.381 0.00 0.00 0.00 3.46
3386 3665 2.618045 CGTCCTGCCAATAAACCCTTCT 60.618 50.000 0.00 0.00 0.00 2.85
3387 3666 3.431415 GTCCTGCCAATAAACCCTTCTT 58.569 45.455 0.00 0.00 0.00 2.52
3388 3667 3.193479 GTCCTGCCAATAAACCCTTCTTG 59.807 47.826 0.00 0.00 0.00 3.02
3389 3668 2.497273 CCTGCCAATAAACCCTTCTTGG 59.503 50.000 0.00 0.00 40.25 3.61
3390 3669 3.165071 CTGCCAATAAACCCTTCTTGGT 58.835 45.455 0.00 0.00 39.72 3.67
3402 3681 6.340962 ACCCTTCTTGGTTTAAAACATAGC 57.659 37.500 6.80 0.00 33.91 2.97
3403 3682 6.075315 ACCCTTCTTGGTTTAAAACATAGCT 58.925 36.000 6.80 0.00 33.91 3.32
3404 3683 6.208797 ACCCTTCTTGGTTTAAAACATAGCTC 59.791 38.462 6.80 0.00 33.91 4.09
3405 3684 6.208599 CCCTTCTTGGTTTAAAACATAGCTCA 59.791 38.462 6.80 0.00 0.00 4.26
3406 3685 7.093771 CCCTTCTTGGTTTAAAACATAGCTCAT 60.094 37.037 6.80 0.00 0.00 2.90
3407 3686 8.306761 CCTTCTTGGTTTAAAACATAGCTCATT 58.693 33.333 6.80 0.00 0.00 2.57
3408 3687 9.696917 CTTCTTGGTTTAAAACATAGCTCATTT 57.303 29.630 6.80 0.00 0.00 2.32
3409 3688 9.474920 TTCTTGGTTTAAAACATAGCTCATTTG 57.525 29.630 6.80 0.00 0.00 2.32
3410 3689 8.855110 TCTTGGTTTAAAACATAGCTCATTTGA 58.145 29.630 6.80 0.00 0.00 2.69
3411 3690 9.132521 CTTGGTTTAAAACATAGCTCATTTGAG 57.867 33.333 6.80 3.13 44.75 3.02
3412 3691 8.177119 TGGTTTAAAACATAGCTCATTTGAGT 57.823 30.769 0.61 0.00 43.85 3.41
3413 3692 8.296713 TGGTTTAAAACATAGCTCATTTGAGTC 58.703 33.333 0.61 2.41 43.85 3.36
3414 3693 8.515414 GGTTTAAAACATAGCTCATTTGAGTCT 58.485 33.333 9.21 8.94 43.85 3.24
3417 3696 9.944376 TTAAAACATAGCTCATTTGAGTCTAGT 57.056 29.630 9.21 8.09 43.85 2.57
3418 3697 8.854614 AAAACATAGCTCATTTGAGTCTAGTT 57.145 30.769 9.21 11.90 43.85 2.24
3419 3698 8.854614 AAACATAGCTCATTTGAGTCTAGTTT 57.145 30.769 9.21 15.29 43.85 2.66
3420 3699 7.840342 ACATAGCTCATTTGAGTCTAGTTTG 57.160 36.000 9.21 8.57 43.85 2.93
3421 3700 7.390027 ACATAGCTCATTTGAGTCTAGTTTGT 58.610 34.615 9.21 9.04 43.85 2.83
3422 3701 8.531982 ACATAGCTCATTTGAGTCTAGTTTGTA 58.468 33.333 9.21 0.00 43.85 2.41
3423 3702 9.029243 CATAGCTCATTTGAGTCTAGTTTGTAG 57.971 37.037 9.21 0.00 43.85 2.74
3424 3703 7.233389 AGCTCATTTGAGTCTAGTTTGTAGA 57.767 36.000 9.21 0.00 43.85 2.59
3425 3704 7.093992 AGCTCATTTGAGTCTAGTTTGTAGAC 58.906 38.462 9.21 4.33 43.85 2.59
3426 3705 6.868864 GCTCATTTGAGTCTAGTTTGTAGACA 59.131 38.462 13.30 0.00 44.66 3.41
3427 3706 7.547370 GCTCATTTGAGTCTAGTTTGTAGACAT 59.453 37.037 13.30 0.89 44.66 3.06
3533 4377 2.925170 AGAGGAGCGCCACCAACT 60.925 61.111 20.53 15.93 36.29 3.16
3538 4382 1.578206 GGAGCGCCACCAACTCTTTC 61.578 60.000 14.98 0.00 0.00 2.62
3560 4404 1.320344 CCTGAATGCCACATGCTGCT 61.320 55.000 0.00 0.00 42.00 4.24
3571 4415 1.808945 ACATGCTGCTGTAGTTTCTGC 59.191 47.619 0.00 0.00 0.00 4.26
3572 4416 1.808343 CATGCTGCTGTAGTTTCTGCA 59.192 47.619 0.00 0.00 39.29 4.41
3574 4418 3.333029 TGCTGCTGTAGTTTCTGCATA 57.667 42.857 0.00 0.00 40.37 3.14
3576 4420 4.264253 TGCTGCTGTAGTTTCTGCATATT 58.736 39.130 0.00 0.00 40.37 1.28
3582 4426 3.871006 TGTAGTTTCTGCATATTCAGCCG 59.129 43.478 0.00 0.00 34.19 5.52
3607 4451 9.019764 CGTTTAGGAATATTAACCAAATTGCTG 57.980 33.333 0.00 0.00 33.89 4.41
3608 4452 9.869757 GTTTAGGAATATTAACCAAATTGCTGT 57.130 29.630 0.00 0.00 33.89 4.40
3648 4514 0.178903 TCCTACTGGGAAGCAGTGGT 60.179 55.000 0.00 0.00 41.91 4.16
3679 4545 7.733773 TGAAACTCTTATCTCTGGAATACCA 57.266 36.000 0.00 0.00 44.76 3.25
3782 4666 5.804979 ACTAAAACGCATATGTTGGCAATTC 59.195 36.000 1.92 0.00 31.10 2.17
3785 4669 3.550820 ACGCATATGTTGGCAATTCCTA 58.449 40.909 1.92 0.00 35.26 2.94
3787 4671 4.400884 ACGCATATGTTGGCAATTCCTAAA 59.599 37.500 1.92 0.00 35.26 1.85
3788 4672 5.068987 ACGCATATGTTGGCAATTCCTAAAT 59.931 36.000 1.92 0.00 35.26 1.40
3789 4673 6.264292 ACGCATATGTTGGCAATTCCTAAATA 59.736 34.615 1.92 0.00 35.26 1.40
3790 4674 7.039784 ACGCATATGTTGGCAATTCCTAAATAT 60.040 33.333 1.92 0.00 32.77 1.28
3791 4675 8.458052 CGCATATGTTGGCAATTCCTAAATATA 58.542 33.333 1.92 0.00 31.41 0.86
3829 4713 9.447040 AAACGCTTTCTTATTAACTTGAAGAAC 57.553 29.630 0.00 0.00 38.56 3.01
3830 4714 8.149973 ACGCTTTCTTATTAACTTGAAGAACA 57.850 30.769 0.00 0.00 38.56 3.18
3831 4715 8.784043 ACGCTTTCTTATTAACTTGAAGAACAT 58.216 29.630 0.00 0.00 38.56 2.71
3841 4725 8.902540 TTAACTTGAAGAACATATGTGAGTGT 57.097 30.769 9.63 0.00 0.00 3.55
3873 4757 6.100668 GTCTACTTGAGGGTACTGAAATCAC 58.899 44.000 0.00 0.00 0.00 3.06
3885 4769 4.504858 ACTGAAATCACGGATACCTTCAC 58.495 43.478 0.00 0.00 0.00 3.18
3931 4815 5.705905 GCTGTTTACTGTAGTCTTGGGATTT 59.294 40.000 0.00 0.00 0.00 2.17
3932 4816 6.206829 GCTGTTTACTGTAGTCTTGGGATTTT 59.793 38.462 0.00 0.00 0.00 1.82
3933 4817 7.573283 GCTGTTTACTGTAGTCTTGGGATTTTC 60.573 40.741 0.00 0.00 0.00 2.29
3934 4818 6.713450 TGTTTACTGTAGTCTTGGGATTTTCC 59.287 38.462 0.00 0.00 35.23 3.13
3935 4819 6.697641 TTACTGTAGTCTTGGGATTTTCCT 57.302 37.500 0.00 0.00 36.57 3.36
3936 4820 5.584551 ACTGTAGTCTTGGGATTTTCCTT 57.415 39.130 0.00 0.00 36.57 3.36
3937 4821 5.316987 ACTGTAGTCTTGGGATTTTCCTTG 58.683 41.667 0.00 0.00 36.57 3.61
3938 4822 4.079253 TGTAGTCTTGGGATTTTCCTTGC 58.921 43.478 0.00 0.00 36.57 4.01
4000 4884 9.827411 CTTCTTGGTTTAAAACATAGCTTAGTC 57.173 33.333 6.80 0.00 0.00 2.59
4002 4886 7.874016 TCTTGGTTTAAAACATAGCTTAGTCGA 59.126 33.333 6.80 0.00 0.00 4.20
4017 4901 7.083230 AGCTTAGTCGAGTTTAGTTTGTAGAC 58.917 38.462 0.00 0.00 0.00 2.59
4072 4974 6.730960 AAGTGTACTTGAAAGTTTGAACGA 57.269 33.333 0.21 0.00 40.37 3.85
4078 4980 4.809426 ACTTGAAAGTTTGAACGATCGAGT 59.191 37.500 24.34 9.13 37.82 4.18
4103 5006 0.453390 GATTTCTGGCCAAAGGAGCG 59.547 55.000 7.01 0.00 0.00 5.03
4126 5029 4.655963 CCACCAGTTGGCATATATAAGCT 58.344 43.478 9.63 0.00 39.07 3.74
4127 5030 5.072741 CCACCAGTTGGCATATATAAGCTT 58.927 41.667 3.48 3.48 39.07 3.74
4143 5047 4.817318 AAGCTTATAGATCTGGCTAGCC 57.183 45.455 27.71 27.71 32.64 3.93
4147 5051 4.609301 CTTATAGATCTGGCTAGCCTCCT 58.391 47.826 33.07 23.81 36.94 3.69
4158 5062 2.659428 CTAGCCTCCTTCCCCATTTTG 58.341 52.381 0.00 0.00 0.00 2.44
4160 5064 2.000048 AGCCTCCTTCCCCATTTTGTA 59.000 47.619 0.00 0.00 0.00 2.41
4171 5075 6.272953 TCCCCATTTTGTATACATCATGGA 57.727 37.500 29.35 18.53 37.72 3.41
4185 5089 8.908786 ATACATCATGGACTATTTCGTGAAAT 57.091 30.769 12.10 12.10 42.95 2.17
4198 5102 3.921677 TCGTGAAATCGCCTTAACTCTT 58.078 40.909 0.00 0.00 0.00 2.85
4199 5103 3.678072 TCGTGAAATCGCCTTAACTCTTG 59.322 43.478 0.00 0.00 0.00 3.02
4204 5116 6.367969 GTGAAATCGCCTTAACTCTTGAGTTA 59.632 38.462 16.50 16.50 33.59 2.24
4254 5166 1.202927 ACATCACAGTTTGGTCCCAGG 60.203 52.381 0.00 0.00 0.00 4.45
4261 5173 3.783362 TTTGGTCCCAGGGCGTGTG 62.783 63.158 0.00 0.00 0.00 3.82
4266 5178 1.305802 TCCCAGGGCGTGTGATACT 60.306 57.895 0.00 0.00 0.00 2.12
4345 5266 5.122239 GCAAATGCTGCGAATAGGTATGATA 59.878 40.000 0.00 0.00 42.37 2.15
4353 5274 7.630728 GCTGCGAATAGGTATGATATACTCCAA 60.631 40.741 0.00 0.00 0.00 3.53
4355 5276 8.590204 TGCGAATAGGTATGATATACTCCAAAA 58.410 33.333 0.00 0.00 0.00 2.44
4375 5296 1.747774 CAGTTTGGCCCCTTTGTGG 59.252 57.895 0.00 0.00 0.00 4.17
4385 5306 3.085952 CCCCTTTGTGGCATCTAAAGA 57.914 47.619 17.73 0.00 34.23 2.52
4386 5307 3.430453 CCCCTTTGTGGCATCTAAAGAA 58.570 45.455 17.73 0.00 34.23 2.52
4387 5308 3.445096 CCCCTTTGTGGCATCTAAAGAAG 59.555 47.826 17.73 11.23 34.23 2.85
4388 5309 4.082125 CCCTTTGTGGCATCTAAAGAAGT 58.918 43.478 17.73 0.00 34.23 3.01
4389 5310 5.253330 CCCTTTGTGGCATCTAAAGAAGTA 58.747 41.667 17.73 0.00 34.23 2.24
4390 5311 5.355350 CCCTTTGTGGCATCTAAAGAAGTAG 59.645 44.000 17.73 6.05 34.23 2.57
4476 6053 8.986477 AACATTATGATTGCCTTTAAAGTGAC 57.014 30.769 14.03 4.15 0.00 3.67
4559 6138 0.603065 GTTGTGCAATCTCCCCAACC 59.397 55.000 0.00 0.00 31.50 3.77
4565 6144 1.467920 CAATCTCCCCAACCTCTTGC 58.532 55.000 0.00 0.00 0.00 4.01
4566 6145 1.005215 CAATCTCCCCAACCTCTTGCT 59.995 52.381 0.00 0.00 0.00 3.91
4575 6154 2.089980 CAACCTCTTGCTCTTGGGATG 58.910 52.381 0.00 0.00 0.00 3.51
4576 6155 1.661463 ACCTCTTGCTCTTGGGATGA 58.339 50.000 0.00 0.00 0.00 2.92
4586 6165 3.181489 GCTCTTGGGATGAAGCATGAAAG 60.181 47.826 0.00 0.00 0.00 2.62
4588 6167 4.665451 TCTTGGGATGAAGCATGAAAGAA 58.335 39.130 0.00 0.00 0.00 2.52
4634 6213 9.585099 TTTGCATTGAAAATTATGAGGTATGTC 57.415 29.630 0.00 0.00 0.00 3.06
4649 6228 8.661752 TGAGGTATGTCATCATATCTGAAGAT 57.338 34.615 5.85 0.00 44.93 2.40
4701 6293 8.251750 TCACATGAACTTCTAGAAATTAACCG 57.748 34.615 6.63 0.00 0.00 4.44
4712 6304 7.388437 TCTAGAAATTAACCGGAAAGTAGCAA 58.612 34.615 9.46 0.00 0.00 3.91
4730 6322 6.763135 AGTAGCAATACACAATACACTGGATG 59.237 38.462 0.00 0.00 0.00 3.51
4753 6345 6.039616 TGTGTTCCTGTGCTTGTTATTTTTC 58.960 36.000 0.00 0.00 0.00 2.29
4754 6346 6.039616 GTGTTCCTGTGCTTGTTATTTTTCA 58.960 36.000 0.00 0.00 0.00 2.69
4831 6424 8.487028 AGTGAAGAACTATTTATTCCAGGTAGG 58.513 37.037 0.00 0.00 37.36 3.18
4838 6431 7.073854 ACTATTTATTCCAGGTAGGCTGTCTA 58.926 38.462 0.00 0.00 37.29 2.59
4840 6433 5.808366 TTATTCCAGGTAGGCTGTCTATG 57.192 43.478 0.00 0.00 37.29 2.23
4865 6458 5.006153 TGATTGTCTGTAGTTCCATACCG 57.994 43.478 0.00 0.00 0.00 4.02
4869 6462 3.194116 TGTCTGTAGTTCCATACCGTTCC 59.806 47.826 0.00 0.00 0.00 3.62
4870 6463 3.194116 GTCTGTAGTTCCATACCGTTCCA 59.806 47.826 0.00 0.00 0.00 3.53
4871 6464 4.028131 TCTGTAGTTCCATACCGTTCCAT 58.972 43.478 0.00 0.00 0.00 3.41
4874 6467 3.992943 AGTTCCATACCGTTCCATTGA 57.007 42.857 0.00 0.00 0.00 2.57
4879 6472 4.196193 TCCATACCGTTCCATTGATTGTC 58.804 43.478 0.00 0.00 0.00 3.18
4894 6487 5.282055 TGATTGTCTATCTGGATGTGGTC 57.718 43.478 0.00 0.00 34.17 4.02
4909 6502 0.468226 TGGTCACACAGTCCTGAACC 59.532 55.000 0.40 4.14 0.00 3.62
4911 6504 0.387929 GTCACACAGTCCTGAACCGA 59.612 55.000 0.40 0.00 0.00 4.69
4924 6517 3.817084 CCTGAACCGATGAATGCATATGT 59.183 43.478 0.00 0.00 34.11 2.29
4932 6525 4.698780 CGATGAATGCATATGTGATTCCCT 59.301 41.667 19.03 11.27 34.11 4.20
4936 6529 2.837498 TGCATATGTGATTCCCTGTCG 58.163 47.619 4.29 0.00 0.00 4.35
4943 6536 1.052617 TGATTCCCTGTCGTTGACCA 58.947 50.000 0.00 0.00 0.00 4.02
4944 6537 1.628340 TGATTCCCTGTCGTTGACCAT 59.372 47.619 0.00 0.00 0.00 3.55
4947 6540 2.040544 CCCTGTCGTTGACCATGGC 61.041 63.158 13.04 5.35 0.00 4.40
5007 6600 0.037046 CAGAAGCAAATTGTGGGGCC 60.037 55.000 0.00 0.00 0.00 5.80
5009 6602 1.461075 AAGCAAATTGTGGGGCCCA 60.461 52.632 24.76 24.76 0.00 5.36
5025 6618 1.628846 GCCCATGGATAACGGGATAGT 59.371 52.381 15.22 0.00 43.21 2.12
5042 6635 6.941436 CGGGATAGTTAGGACTTACTGACTAT 59.059 42.308 5.75 5.75 46.60 2.12
5092 6685 1.809684 GGTTCACCTGAGCCTGTTAC 58.190 55.000 1.09 0.00 41.53 2.50
5103 6696 5.336451 CCTGAGCCTGTTACCATTTTTAACC 60.336 44.000 0.00 0.00 0.00 2.85
5110 6703 8.878769 GCCTGTTACCATTTTTAACCATTTATG 58.121 33.333 0.00 0.00 0.00 1.90
5129 6722 9.039870 CATTTATGATTCTTACACAGAGGACTC 57.960 37.037 0.00 0.00 31.12 3.36
5174 6767 3.521531 TCATGCCCTTCTGTATTGTGGTA 59.478 43.478 0.00 0.00 0.00 3.25
5186 6779 8.263940 TCTGTATTGTGGTAAATTAGCTGTTC 57.736 34.615 0.00 0.00 0.00 3.18
5202 6795 1.211703 TGTTCCCTTGAGTTGCAGACA 59.788 47.619 0.00 0.00 0.00 3.41
5250 6843 1.950828 TTGTTTGGGTTGCATTGCTG 58.049 45.000 10.49 0.00 0.00 4.41
5530 7123 2.362120 ATCAGCAGCAACCCCAGC 60.362 61.111 0.00 0.00 0.00 4.85
5604 7197 6.070021 TGGAGGAAGAGATTGAGATGCTAAAA 60.070 38.462 0.00 0.00 0.00 1.52
5715 7308 0.953471 TTCACGGAATGGAGCAACGG 60.953 55.000 0.00 0.00 0.00 4.44
5757 7350 0.813184 TGGCTAAAGCAATGCAGAGC 59.187 50.000 8.35 12.40 44.36 4.09
5817 7410 3.933332 ACAGCAAACGAAGAATAGTAGCC 59.067 43.478 0.00 0.00 0.00 3.93
5863 7456 1.648467 GCAAGATGACGGCCTGAACC 61.648 60.000 0.00 0.00 0.00 3.62
5922 7515 3.396560 TCAGCCTATGATCAATGAAGCG 58.603 45.455 0.00 0.00 31.12 4.68
6120 7713 1.843368 GCATGCCATATATGCCCACT 58.157 50.000 6.36 0.00 43.88 4.00
6129 7722 2.405618 ATATGCCCACTAGCTCTGGA 57.594 50.000 11.28 0.00 0.00 3.86
6150 7743 5.302568 TGGACTTTCAGCAATTTGTTCATCT 59.697 36.000 0.00 0.00 0.00 2.90
6348 7941 9.209175 GACGCAATTAATATTCCTGTAGAGAAT 57.791 33.333 0.00 0.00 37.67 2.40
6441 8034 1.534805 CCCATCGACACTGATGAGACG 60.535 57.143 5.35 0.00 46.98 4.18
6603 8196 0.591659 GGACCGAGAACTTGGCAAAC 59.408 55.000 0.00 0.00 37.67 2.93
6606 8199 0.593128 CCGAGAACTTGGCAAACCTG 59.407 55.000 0.00 0.00 36.63 4.00
6685 8278 4.168291 CCTCTCTCAAGGCGCCCC 62.168 72.222 26.15 0.00 0.00 5.80
6804 8397 9.760077 GGACTCCGATCTTTTTGTATCTATAAA 57.240 33.333 0.00 0.00 0.00 1.40
6806 8399 9.765795 ACTCCGATCTTTTTGTATCTATAAAGG 57.234 33.333 0.00 0.00 0.00 3.11
6851 8444 0.042448 GACCGTGCGTTGTGTTTCTC 60.042 55.000 0.00 0.00 0.00 2.87
6852 8445 0.741574 ACCGTGCGTTGTGTTTCTCA 60.742 50.000 0.00 0.00 0.00 3.27
6859 8452 2.541588 GCGTTGTGTTTCTCATGTGCTT 60.542 45.455 0.00 0.00 0.00 3.91
6860 8453 3.694734 CGTTGTGTTTCTCATGTGCTTT 58.305 40.909 0.00 0.00 0.00 3.51
6890 8483 0.316204 ACTAACACCGACCTGAACCG 59.684 55.000 0.00 0.00 0.00 4.44
6927 8523 1.899054 CTCCTCGCGCTATCCAGGA 60.899 63.158 5.56 11.06 33.79 3.86
6957 8554 6.126215 TGGCCTCTATGGAATCCAGAAAAATA 60.126 38.462 8.40 0.00 36.75 1.40
6959 8556 6.072230 GCCTCTATGGAATCCAGAAAAATAGC 60.072 42.308 8.40 0.00 36.75 2.97
7051 8650 3.763897 CCAAGGATTGTTCTAGGTTTGGG 59.236 47.826 0.00 0.00 46.99 4.12
7058 8676 3.256704 TGTTCTAGGTTTGGGATGGAGT 58.743 45.455 0.00 0.00 0.00 3.85
7059 8677 3.655777 TGTTCTAGGTTTGGGATGGAGTT 59.344 43.478 0.00 0.00 0.00 3.01
7061 8679 3.526899 TCTAGGTTTGGGATGGAGTTGA 58.473 45.455 0.00 0.00 0.00 3.18
7062 8680 4.111577 TCTAGGTTTGGGATGGAGTTGAT 58.888 43.478 0.00 0.00 0.00 2.57
7064 8682 2.379907 AGGTTTGGGATGGAGTTGATGT 59.620 45.455 0.00 0.00 0.00 3.06
7124 8743 8.677300 CCTATATGTGTATTTTCTGTTGTTGCT 58.323 33.333 0.00 0.00 0.00 3.91
7128 8747 7.328277 TGTGTATTTTCTGTTGTTGCTTAGT 57.672 32.000 0.00 0.00 0.00 2.24
7129 8748 7.192913 TGTGTATTTTCTGTTGTTGCTTAGTG 58.807 34.615 0.00 0.00 0.00 2.74
7130 8749 6.142320 GTGTATTTTCTGTTGTTGCTTAGTGC 59.858 38.462 0.00 0.00 43.25 4.40
7131 8750 3.708563 TTTCTGTTGTTGCTTAGTGCC 57.291 42.857 0.00 0.00 42.00 5.01
7132 8751 2.638480 TCTGTTGTTGCTTAGTGCCT 57.362 45.000 0.00 0.00 42.00 4.75
7133 8752 3.762407 TCTGTTGTTGCTTAGTGCCTA 57.238 42.857 0.00 0.00 42.00 3.93
7134 8753 3.664107 TCTGTTGTTGCTTAGTGCCTAG 58.336 45.455 0.00 0.00 42.00 3.02
7135 8754 3.071023 TCTGTTGTTGCTTAGTGCCTAGT 59.929 43.478 0.00 0.00 42.00 2.57
7136 8755 4.282449 TCTGTTGTTGCTTAGTGCCTAGTA 59.718 41.667 0.00 0.00 42.00 1.82
7137 8756 5.046591 TCTGTTGTTGCTTAGTGCCTAGTAT 60.047 40.000 0.00 0.00 42.00 2.12
7138 8757 4.935205 TGTTGTTGCTTAGTGCCTAGTATG 59.065 41.667 0.00 0.00 42.00 2.39
7139 8758 5.175859 GTTGTTGCTTAGTGCCTAGTATGA 58.824 41.667 0.00 0.00 42.00 2.15
7140 8759 5.414789 TGTTGCTTAGTGCCTAGTATGAA 57.585 39.130 0.00 0.00 42.00 2.57
7141 8760 5.175859 TGTTGCTTAGTGCCTAGTATGAAC 58.824 41.667 0.00 0.00 42.00 3.18
7142 8761 5.046591 TGTTGCTTAGTGCCTAGTATGAACT 60.047 40.000 0.00 0.00 42.00 3.01
7143 8762 6.153851 TGTTGCTTAGTGCCTAGTATGAACTA 59.846 38.462 0.00 0.00 42.00 2.24
7144 8763 6.145338 TGCTTAGTGCCTAGTATGAACTAC 57.855 41.667 0.00 0.00 42.00 2.73
7145 8764 5.655090 TGCTTAGTGCCTAGTATGAACTACA 59.345 40.000 0.00 0.00 42.00 2.74
7146 8765 6.323996 TGCTTAGTGCCTAGTATGAACTACAT 59.676 38.462 0.00 0.00 42.00 2.29
7147 8766 7.504574 TGCTTAGTGCCTAGTATGAACTACATA 59.495 37.037 0.00 0.00 42.00 2.29
7148 8767 7.808856 GCTTAGTGCCTAGTATGAACTACATAC 59.191 40.741 10.73 10.73 46.15 2.39
7192 8811 9.494271 ACAGTAATTATGTAGCATATGACCTTG 57.506 33.333 6.97 0.00 0.00 3.61
7193 8812 8.446273 CAGTAATTATGTAGCATATGACCTTGC 58.554 37.037 6.97 0.00 39.17 4.01
7194 8813 8.156820 AGTAATTATGTAGCATATGACCTTGCA 58.843 33.333 6.97 0.00 41.35 4.08
7195 8814 7.822161 AATTATGTAGCATATGACCTTGCAA 57.178 32.000 6.97 0.00 41.35 4.08
7196 8815 7.822161 ATTATGTAGCATATGACCTTGCAAA 57.178 32.000 6.97 0.00 41.35 3.68
7197 8816 4.963276 TGTAGCATATGACCTTGCAAAC 57.037 40.909 6.97 0.00 41.35 2.93
7198 8817 4.331108 TGTAGCATATGACCTTGCAAACA 58.669 39.130 6.97 1.75 41.35 2.83
7199 8818 3.855689 AGCATATGACCTTGCAAACAC 57.144 42.857 6.97 0.00 41.35 3.32
7200 8819 3.156293 AGCATATGACCTTGCAAACACA 58.844 40.909 6.97 0.99 41.35 3.72
7201 8820 3.573538 AGCATATGACCTTGCAAACACAA 59.426 39.130 6.97 0.00 41.35 3.33
7202 8821 4.221262 AGCATATGACCTTGCAAACACAAT 59.779 37.500 6.97 0.00 41.35 2.71
7203 8822 4.563976 GCATATGACCTTGCAAACACAATC 59.436 41.667 6.97 0.00 38.72 2.67
7204 8823 5.622914 GCATATGACCTTGCAAACACAATCT 60.623 40.000 6.97 0.00 38.72 2.40
7205 8824 3.988379 TGACCTTGCAAACACAATCTC 57.012 42.857 0.00 0.00 0.00 2.75
7206 8825 3.554934 TGACCTTGCAAACACAATCTCT 58.445 40.909 0.00 0.00 0.00 3.10
7207 8826 3.316029 TGACCTTGCAAACACAATCTCTG 59.684 43.478 0.00 0.00 0.00 3.35
7208 8827 3.290710 ACCTTGCAAACACAATCTCTGT 58.709 40.909 0.00 0.00 39.56 3.41
7228 8847 6.976088 TCTGTGAAAACAAACAGAGAAAACA 58.024 32.000 1.50 0.00 45.97 2.83
7229 8848 7.601856 TCTGTGAAAACAAACAGAGAAAACAT 58.398 30.769 1.50 0.00 45.97 2.71
7230 8849 7.541783 TCTGTGAAAACAAACAGAGAAAACATG 59.458 33.333 1.50 0.00 45.97 3.21
7231 8850 6.090628 TGTGAAAACAAACAGAGAAAACATGC 59.909 34.615 0.00 0.00 0.00 4.06
7232 8851 6.311200 GTGAAAACAAACAGAGAAAACATGCT 59.689 34.615 0.00 0.00 0.00 3.79
7233 8852 6.310956 TGAAAACAAACAGAGAAAACATGCTG 59.689 34.615 0.00 0.00 34.65 4.41
7234 8853 4.989279 ACAAACAGAGAAAACATGCTGT 57.011 36.364 0.00 0.00 42.91 4.40
7235 8854 4.925068 ACAAACAGAGAAAACATGCTGTC 58.075 39.130 0.00 0.00 40.43 3.51
7236 8855 4.202050 ACAAACAGAGAAAACATGCTGTCC 60.202 41.667 0.00 0.00 40.43 4.02
7237 8856 3.213206 ACAGAGAAAACATGCTGTCCA 57.787 42.857 0.00 0.00 36.98 4.02
7238 8857 3.144506 ACAGAGAAAACATGCTGTCCAG 58.855 45.455 0.00 0.00 36.98 3.86
7239 8858 2.486982 CAGAGAAAACATGCTGTCCAGG 59.513 50.000 0.00 0.00 0.00 4.45
7240 8859 2.107204 AGAGAAAACATGCTGTCCAGGT 59.893 45.455 0.00 0.00 40.78 4.00
7241 8860 2.227388 GAGAAAACATGCTGTCCAGGTG 59.773 50.000 0.00 0.00 38.67 4.00
7242 8861 2.158623 AGAAAACATGCTGTCCAGGTGA 60.159 45.455 0.00 0.00 38.67 4.02
7243 8862 2.592102 AAACATGCTGTCCAGGTGAT 57.408 45.000 0.00 0.00 38.67 3.06
7244 8863 1.830279 AACATGCTGTCCAGGTGATG 58.170 50.000 0.00 0.00 38.67 3.07
7245 8864 0.679002 ACATGCTGTCCAGGTGATGC 60.679 55.000 0.00 0.00 37.03 3.91
7246 8865 0.678684 CATGCTGTCCAGGTGATGCA 60.679 55.000 0.00 0.00 38.83 3.96
7247 8866 0.257905 ATGCTGTCCAGGTGATGCAT 59.742 50.000 0.00 0.00 39.53 3.96
7248 8867 0.911053 TGCTGTCCAGGTGATGCATA 59.089 50.000 0.00 0.00 32.75 3.14
7249 8868 1.491754 TGCTGTCCAGGTGATGCATAT 59.508 47.619 0.00 0.00 32.75 1.78
7250 8869 1.878088 GCTGTCCAGGTGATGCATATG 59.122 52.381 0.00 0.00 0.00 1.78
7251 8870 2.486013 GCTGTCCAGGTGATGCATATGA 60.486 50.000 6.97 0.00 0.00 2.15
7252 8871 3.400255 CTGTCCAGGTGATGCATATGAG 58.600 50.000 6.97 0.00 0.00 2.90
7253 8872 2.149578 GTCCAGGTGATGCATATGAGC 58.850 52.381 6.97 0.00 0.00 4.26
7254 8873 1.154197 CCAGGTGATGCATATGAGCG 58.846 55.000 6.97 0.00 37.31 5.03
7255 8874 1.270465 CCAGGTGATGCATATGAGCGA 60.270 52.381 6.97 0.00 37.31 4.93
7256 8875 1.797046 CAGGTGATGCATATGAGCGAC 59.203 52.381 6.97 0.00 37.31 5.19
7257 8876 1.413812 AGGTGATGCATATGAGCGACA 59.586 47.619 6.97 0.00 37.31 4.35
7258 8877 2.038164 AGGTGATGCATATGAGCGACAT 59.962 45.455 6.97 0.00 42.39 3.06
7259 8878 3.259123 AGGTGATGCATATGAGCGACATA 59.741 43.478 6.97 8.57 44.21 2.29
7260 8879 3.615937 GGTGATGCATATGAGCGACATAG 59.384 47.826 6.97 6.16 43.48 2.23
7261 8880 4.488879 GTGATGCATATGAGCGACATAGA 58.511 43.478 6.97 1.41 43.48 1.98
7262 8881 4.562000 GTGATGCATATGAGCGACATAGAG 59.438 45.833 6.97 8.07 43.48 2.43
7263 8882 4.460382 TGATGCATATGAGCGACATAGAGA 59.540 41.667 6.97 0.88 43.48 3.10
7264 8883 4.853924 TGCATATGAGCGACATAGAGAA 57.146 40.909 6.97 1.36 43.48 2.87
7265 8884 5.200368 TGCATATGAGCGACATAGAGAAA 57.800 39.130 6.97 0.00 43.48 2.52
7266 8885 5.600696 TGCATATGAGCGACATAGAGAAAA 58.399 37.500 6.97 0.00 43.48 2.29
7267 8886 5.463392 TGCATATGAGCGACATAGAGAAAAC 59.537 40.000 6.97 0.00 43.48 2.43
7268 8887 5.463392 GCATATGAGCGACATAGAGAAAACA 59.537 40.000 6.97 0.00 43.48 2.83
7269 8888 6.146837 GCATATGAGCGACATAGAGAAAACAT 59.853 38.462 6.97 0.00 43.48 2.71
7270 8889 5.980698 ATGAGCGACATAGAGAAAACATG 57.019 39.130 0.00 0.00 37.46 3.21
7271 8890 3.618594 TGAGCGACATAGAGAAAACATGC 59.381 43.478 0.00 0.00 0.00 4.06
7272 8891 3.866651 AGCGACATAGAGAAAACATGCT 58.133 40.909 0.00 0.00 0.00 3.79
7273 8892 3.620374 AGCGACATAGAGAAAACATGCTG 59.380 43.478 0.00 0.00 0.00 4.41
7274 8893 3.372206 GCGACATAGAGAAAACATGCTGT 59.628 43.478 0.00 0.00 0.00 4.40
7275 8894 4.493220 GCGACATAGAGAAAACATGCTGTC 60.493 45.833 0.00 0.00 0.00 3.51
7276 8895 4.033358 CGACATAGAGAAAACATGCTGTCC 59.967 45.833 0.00 0.00 0.00 4.02
7277 8896 4.910195 ACATAGAGAAAACATGCTGTCCA 58.090 39.130 0.00 0.00 0.00 4.02
7278 8897 4.940046 ACATAGAGAAAACATGCTGTCCAG 59.060 41.667 0.00 0.00 0.00 3.86
7279 8898 2.787994 AGAGAAAACATGCTGTCCAGG 58.212 47.619 0.00 0.00 0.00 4.45
7280 8899 2.107204 AGAGAAAACATGCTGTCCAGGT 59.893 45.455 0.00 0.00 40.78 4.00
7281 8900 2.227388 GAGAAAACATGCTGTCCAGGTG 59.773 50.000 0.00 0.00 38.67 4.00
7282 8901 2.158623 AGAAAACATGCTGTCCAGGTGA 60.159 45.455 0.00 0.00 38.67 4.02
7283 8902 2.592102 AAACATGCTGTCCAGGTGAT 57.408 45.000 0.00 0.00 38.67 3.06
7284 8903 1.830279 AACATGCTGTCCAGGTGATG 58.170 50.000 0.00 0.00 38.67 3.07
7285 8904 0.679002 ACATGCTGTCCAGGTGATGC 60.679 55.000 0.00 0.00 37.03 3.91
7286 8905 1.450848 ATGCTGTCCAGGTGATGCG 60.451 57.895 0.00 0.00 0.00 4.73
7287 8906 1.902765 ATGCTGTCCAGGTGATGCGA 61.903 55.000 0.00 0.00 0.00 5.10
7288 8907 1.153289 GCTGTCCAGGTGATGCGAT 60.153 57.895 0.00 0.00 0.00 4.58
7289 8908 1.434622 GCTGTCCAGGTGATGCGATG 61.435 60.000 0.00 0.00 0.00 3.84
7290 8909 1.434622 CTGTCCAGGTGATGCGATGC 61.435 60.000 0.00 0.00 0.00 3.91
7291 8910 2.202919 TCCAGGTGATGCGATGCG 60.203 61.111 0.00 0.00 0.00 4.73
7292 8911 2.202919 CCAGGTGATGCGATGCGA 60.203 61.111 0.00 0.00 0.00 5.10
7293 8912 1.815003 CCAGGTGATGCGATGCGAA 60.815 57.895 0.00 0.00 0.00 4.70
7294 8913 1.368345 CCAGGTGATGCGATGCGAAA 61.368 55.000 0.00 0.00 0.00 3.46
7295 8914 0.247814 CAGGTGATGCGATGCGAAAC 60.248 55.000 0.00 0.00 0.00 2.78
7296 8915 0.673333 AGGTGATGCGATGCGAAACA 60.673 50.000 0.00 0.00 0.00 2.83
7297 8916 0.247814 GGTGATGCGATGCGAAACAG 60.248 55.000 0.00 0.00 0.00 3.16
7298 8917 0.443869 GTGATGCGATGCGAAACAGT 59.556 50.000 0.00 0.00 0.00 3.55
7299 8918 0.721154 TGATGCGATGCGAAACAGTC 59.279 50.000 0.00 0.00 0.00 3.51
7300 8919 0.026803 GATGCGATGCGAAACAGTCC 59.973 55.000 0.00 0.00 0.00 3.85
7301 8920 0.673333 ATGCGATGCGAAACAGTCCA 60.673 50.000 0.00 0.00 0.00 4.02
7302 8921 0.882484 TGCGATGCGAAACAGTCCAA 60.882 50.000 0.00 0.00 0.00 3.53
7303 8922 0.237235 GCGATGCGAAACAGTCCAAA 59.763 50.000 0.00 0.00 0.00 3.28
7304 8923 1.950472 CGATGCGAAACAGTCCAAAC 58.050 50.000 0.00 0.00 0.00 2.93
7305 8924 1.399727 CGATGCGAAACAGTCCAAACC 60.400 52.381 0.00 0.00 0.00 3.27
7306 8925 1.606668 GATGCGAAACAGTCCAAACCA 59.393 47.619 0.00 0.00 0.00 3.67
7307 8926 1.686355 TGCGAAACAGTCCAAACCAT 58.314 45.000 0.00 0.00 0.00 3.55
7308 8927 1.336440 TGCGAAACAGTCCAAACCATG 59.664 47.619 0.00 0.00 0.00 3.66
7309 8928 1.930371 GCGAAACAGTCCAAACCATGC 60.930 52.381 0.00 0.00 0.00 4.06
7310 8929 1.662876 CGAAACAGTCCAAACCATGCG 60.663 52.381 0.00 0.00 0.00 4.73
7311 8930 0.031994 AAACAGTCCAAACCATGCGC 59.968 50.000 0.00 0.00 0.00 6.09
7312 8931 0.823356 AACAGTCCAAACCATGCGCT 60.823 50.000 9.73 0.00 0.00 5.92
7313 8932 0.036164 ACAGTCCAAACCATGCGCTA 59.964 50.000 9.73 0.00 0.00 4.26
7314 8933 0.447801 CAGTCCAAACCATGCGCTAC 59.552 55.000 9.73 0.00 0.00 3.58
7315 8934 0.036164 AGTCCAAACCATGCGCTACA 59.964 50.000 9.73 0.00 0.00 2.74
7316 8935 0.168128 GTCCAAACCATGCGCTACAC 59.832 55.000 9.73 0.00 0.00 2.90
7317 8936 0.958382 TCCAAACCATGCGCTACACC 60.958 55.000 9.73 0.00 0.00 4.16
7318 8937 1.240641 CCAAACCATGCGCTACACCA 61.241 55.000 9.73 0.00 0.00 4.17
7319 8938 0.168788 CAAACCATGCGCTACACCAG 59.831 55.000 9.73 0.00 0.00 4.00
7320 8939 0.250727 AAACCATGCGCTACACCAGT 60.251 50.000 9.73 0.00 0.00 4.00
7321 8940 0.955428 AACCATGCGCTACACCAGTG 60.955 55.000 9.73 0.00 37.85 3.66
7322 8941 1.079197 CCATGCGCTACACCAGTGA 60.079 57.895 9.73 0.00 36.86 3.41
7323 8942 1.361668 CCATGCGCTACACCAGTGAC 61.362 60.000 9.73 0.00 36.86 3.67
7324 8943 1.079127 ATGCGCTACACCAGTGACC 60.079 57.895 9.73 0.00 36.86 4.02
7325 8944 1.826340 ATGCGCTACACCAGTGACCA 61.826 55.000 9.73 0.00 36.86 4.02
7326 8945 1.738099 GCGCTACACCAGTGACCAG 60.738 63.158 0.00 0.22 36.86 4.00
7327 8946 1.666011 CGCTACACCAGTGACCAGT 59.334 57.895 4.48 0.00 36.86 4.00
7328 8947 0.667487 CGCTACACCAGTGACCAGTG 60.667 60.000 4.48 1.50 36.86 3.66
7329 8948 0.951040 GCTACACCAGTGACCAGTGC 60.951 60.000 4.48 0.00 34.83 4.40
7330 8949 0.392706 CTACACCAGTGACCAGTGCA 59.607 55.000 4.48 0.00 34.83 4.57
7331 8950 0.833949 TACACCAGTGACCAGTGCAA 59.166 50.000 4.48 0.00 34.83 4.08
7332 8951 0.748005 ACACCAGTGACCAGTGCAAC 60.748 55.000 4.48 0.00 34.83 4.17
7356 8975 9.915629 AACTAGACAAGTTGTAAATCAGTAGAG 57.084 33.333 8.88 0.00 46.90 2.43
7357 8976 8.030106 ACTAGACAAGTTGTAAATCAGTAGAGC 58.970 37.037 8.88 0.00 33.35 4.09
7358 8977 6.759272 AGACAAGTTGTAAATCAGTAGAGCA 58.241 36.000 8.88 0.00 0.00 4.26
7359 8978 7.390027 AGACAAGTTGTAAATCAGTAGAGCAT 58.610 34.615 8.88 0.00 0.00 3.79
7360 8979 8.531982 AGACAAGTTGTAAATCAGTAGAGCATA 58.468 33.333 8.88 0.00 0.00 3.14
7361 8980 9.319143 GACAAGTTGTAAATCAGTAGAGCATAT 57.681 33.333 8.88 0.00 0.00 1.78
7372 8991 8.870075 ATCAGTAGAGCATATATACAGACACA 57.130 34.615 0.00 0.00 0.00 3.72
7373 8992 8.691661 TCAGTAGAGCATATATACAGACACAA 57.308 34.615 0.00 0.00 0.00 3.33
7374 8993 9.301897 TCAGTAGAGCATATATACAGACACAAT 57.698 33.333 0.00 0.00 0.00 2.71
7375 8994 9.566530 CAGTAGAGCATATATACAGACACAATC 57.433 37.037 0.00 0.00 0.00 2.67
7376 8995 8.744652 AGTAGAGCATATATACAGACACAATCC 58.255 37.037 0.00 0.00 0.00 3.01
7377 8996 6.625362 AGAGCATATATACAGACACAATCCG 58.375 40.000 0.00 0.00 0.00 4.18
7378 8997 6.209589 AGAGCATATATACAGACACAATCCGT 59.790 38.462 0.00 0.00 0.00 4.69
7379 8998 6.390721 AGCATATATACAGACACAATCCGTC 58.609 40.000 0.00 0.00 0.00 4.79
7380 8999 6.015434 AGCATATATACAGACACAATCCGTCA 60.015 38.462 0.00 0.00 35.77 4.35
7381 9000 6.309009 GCATATATACAGACACAATCCGTCAG 59.691 42.308 0.00 0.00 35.77 3.51
7382 9001 5.854010 ATATACAGACACAATCCGTCAGT 57.146 39.130 0.00 0.00 37.03 3.41
7383 9002 6.954487 ATATACAGACACAATCCGTCAGTA 57.046 37.500 0.00 0.00 38.98 2.74
7384 9003 3.577649 ACAGACACAATCCGTCAGTAG 57.422 47.619 0.00 0.00 35.77 2.57
7385 9004 2.231478 ACAGACACAATCCGTCAGTAGG 59.769 50.000 0.00 0.00 35.77 3.18
7386 9005 2.492088 CAGACACAATCCGTCAGTAGGA 59.508 50.000 0.00 0.00 42.69 2.94
7387 9006 2.755655 AGACACAATCCGTCAGTAGGAG 59.244 50.000 0.00 0.00 41.66 3.69
7388 9007 2.492484 GACACAATCCGTCAGTAGGAGT 59.508 50.000 0.00 0.00 41.66 3.85
7389 9008 2.492484 ACACAATCCGTCAGTAGGAGTC 59.508 50.000 0.00 0.00 41.66 3.36
7390 9009 2.755655 CACAATCCGTCAGTAGGAGTCT 59.244 50.000 0.00 0.00 41.66 3.24
7391 9010 3.018149 ACAATCCGTCAGTAGGAGTCTC 58.982 50.000 0.00 0.00 41.66 3.36
7392 9011 3.017442 CAATCCGTCAGTAGGAGTCTCA 58.983 50.000 1.47 0.00 41.66 3.27
7393 9012 2.404923 TCCGTCAGTAGGAGTCTCAG 57.595 55.000 1.47 0.00 33.19 3.35
7394 9013 1.907255 TCCGTCAGTAGGAGTCTCAGA 59.093 52.381 1.47 0.00 33.19 3.27
7395 9014 2.305052 TCCGTCAGTAGGAGTCTCAGAA 59.695 50.000 1.47 0.00 33.19 3.02
7396 9015 2.420722 CCGTCAGTAGGAGTCTCAGAAC 59.579 54.545 1.47 0.00 0.00 3.01
7397 9016 3.075148 CGTCAGTAGGAGTCTCAGAACA 58.925 50.000 1.47 0.00 0.00 3.18
7398 9017 3.502595 CGTCAGTAGGAGTCTCAGAACAA 59.497 47.826 1.47 0.00 0.00 2.83
7399 9018 4.023107 CGTCAGTAGGAGTCTCAGAACAAA 60.023 45.833 1.47 0.00 0.00 2.83
7400 9019 5.507482 CGTCAGTAGGAGTCTCAGAACAAAA 60.507 44.000 1.47 0.00 0.00 2.44
7401 9020 5.923684 GTCAGTAGGAGTCTCAGAACAAAAG 59.076 44.000 1.47 0.00 0.00 2.27
7402 9021 5.011125 TCAGTAGGAGTCTCAGAACAAAAGG 59.989 44.000 1.47 0.00 0.00 3.11
7403 9022 5.011125 CAGTAGGAGTCTCAGAACAAAAGGA 59.989 44.000 1.47 0.00 0.00 3.36
7404 9023 5.602978 AGTAGGAGTCTCAGAACAAAAGGAA 59.397 40.000 1.47 0.00 0.00 3.36
7405 9024 5.373812 AGGAGTCTCAGAACAAAAGGAAA 57.626 39.130 1.47 0.00 0.00 3.13
7406 9025 5.372373 AGGAGTCTCAGAACAAAAGGAAAG 58.628 41.667 1.47 0.00 0.00 2.62
7407 9026 4.517075 GGAGTCTCAGAACAAAAGGAAAGG 59.483 45.833 1.47 0.00 0.00 3.11
7408 9027 3.885901 AGTCTCAGAACAAAAGGAAAGGC 59.114 43.478 0.00 0.00 0.00 4.35
7409 9028 3.004839 GTCTCAGAACAAAAGGAAAGGCC 59.995 47.826 0.00 0.00 0.00 5.19
7410 9029 2.958355 CTCAGAACAAAAGGAAAGGCCA 59.042 45.455 5.01 0.00 40.02 5.36
7411 9030 2.958355 TCAGAACAAAAGGAAAGGCCAG 59.042 45.455 5.01 0.00 40.02 4.85
7412 9031 2.958355 CAGAACAAAAGGAAAGGCCAGA 59.042 45.455 5.01 0.00 40.02 3.86
7413 9032 3.005155 CAGAACAAAAGGAAAGGCCAGAG 59.995 47.826 5.01 0.00 40.02 3.35
7414 9033 3.117512 AGAACAAAAGGAAAGGCCAGAGA 60.118 43.478 5.01 0.00 40.02 3.10
7415 9034 2.587522 ACAAAAGGAAAGGCCAGAGAC 58.412 47.619 5.01 0.00 40.02 3.36
7416 9035 2.091885 ACAAAAGGAAAGGCCAGAGACA 60.092 45.455 5.01 0.00 40.02 3.41
7417 9036 2.278332 AAAGGAAAGGCCAGAGACAC 57.722 50.000 5.01 0.00 40.02 3.67
7418 9037 1.140312 AAGGAAAGGCCAGAGACACA 58.860 50.000 5.01 0.00 40.02 3.72
7419 9038 1.140312 AGGAAAGGCCAGAGACACAA 58.860 50.000 5.01 0.00 40.02 3.33
7420 9039 1.072965 AGGAAAGGCCAGAGACACAAG 59.927 52.381 5.01 0.00 40.02 3.16
7421 9040 1.528129 GAAAGGCCAGAGACACAAGG 58.472 55.000 5.01 0.00 0.00 3.61
7422 9041 0.538287 AAAGGCCAGAGACACAAGGC 60.538 55.000 5.01 0.00 46.28 4.35
7424 9043 3.978272 GCCAGAGACACAAGGCAG 58.022 61.111 0.00 0.00 46.26 4.85
7425 9044 1.673665 GCCAGAGACACAAGGCAGG 60.674 63.158 0.00 0.00 46.26 4.85
7426 9045 2.061220 CCAGAGACACAAGGCAGGA 58.939 57.895 0.00 0.00 0.00 3.86
7427 9046 0.036577 CCAGAGACACAAGGCAGGAG 60.037 60.000 0.00 0.00 0.00 3.69
7428 9047 0.036577 CAGAGACACAAGGCAGGAGG 60.037 60.000 0.00 0.00 0.00 4.30
7429 9048 0.178921 AGAGACACAAGGCAGGAGGA 60.179 55.000 0.00 0.00 0.00 3.71
7430 9049 0.908198 GAGACACAAGGCAGGAGGAT 59.092 55.000 0.00 0.00 0.00 3.24
7431 9050 0.617413 AGACACAAGGCAGGAGGATG 59.383 55.000 0.00 0.00 0.00 3.51
7432 9051 0.393537 GACACAAGGCAGGAGGATGG 60.394 60.000 0.00 0.00 0.00 3.51
7433 9052 1.751927 CACAAGGCAGGAGGATGGC 60.752 63.158 0.00 0.00 45.63 4.40
7437 9056 2.509916 GGCAGGAGGATGGCTCAG 59.490 66.667 0.00 0.00 42.21 3.35
7438 9057 2.373707 GGCAGGAGGATGGCTCAGT 61.374 63.158 0.00 0.00 42.21 3.41
7439 9058 1.050988 GGCAGGAGGATGGCTCAGTA 61.051 60.000 0.00 0.00 42.21 2.74
7440 9059 0.833287 GCAGGAGGATGGCTCAGTAA 59.167 55.000 0.00 0.00 0.00 2.24
7441 9060 1.210478 GCAGGAGGATGGCTCAGTAAA 59.790 52.381 0.00 0.00 0.00 2.01
7442 9061 2.911484 CAGGAGGATGGCTCAGTAAAC 58.089 52.381 0.00 0.00 0.00 2.01
7443 9062 2.237143 CAGGAGGATGGCTCAGTAAACA 59.763 50.000 0.00 0.00 0.00 2.83
7444 9063 2.503356 AGGAGGATGGCTCAGTAAACAG 59.497 50.000 0.00 0.00 0.00 3.16
7445 9064 2.284190 GAGGATGGCTCAGTAAACAGC 58.716 52.381 0.00 0.00 34.65 4.40
7446 9065 1.912043 AGGATGGCTCAGTAAACAGCT 59.088 47.619 0.00 0.00 35.82 4.24
7447 9066 2.093235 AGGATGGCTCAGTAAACAGCTC 60.093 50.000 0.00 0.00 35.82 4.09
7448 9067 2.093235 GGATGGCTCAGTAAACAGCTCT 60.093 50.000 0.00 0.00 35.82 4.09
7449 9068 2.751166 TGGCTCAGTAAACAGCTCTC 57.249 50.000 0.00 0.00 35.82 3.20
7450 9069 1.970640 TGGCTCAGTAAACAGCTCTCA 59.029 47.619 0.00 0.00 35.82 3.27
7451 9070 2.368548 TGGCTCAGTAAACAGCTCTCAA 59.631 45.455 0.00 0.00 35.82 3.02
7452 9071 3.181455 TGGCTCAGTAAACAGCTCTCAAA 60.181 43.478 0.00 0.00 35.82 2.69
7453 9072 3.815401 GGCTCAGTAAACAGCTCTCAAAA 59.185 43.478 0.00 0.00 35.82 2.44
7454 9073 4.457257 GGCTCAGTAAACAGCTCTCAAAAT 59.543 41.667 0.00 0.00 35.82 1.82
7455 9074 5.391416 GGCTCAGTAAACAGCTCTCAAAATC 60.391 44.000 0.00 0.00 35.82 2.17
7456 9075 5.180117 GCTCAGTAAACAGCTCTCAAAATCA 59.820 40.000 0.00 0.00 32.48 2.57
7457 9076 6.128063 GCTCAGTAAACAGCTCTCAAAATCAT 60.128 38.462 0.00 0.00 32.48 2.45
7458 9077 7.369803 TCAGTAAACAGCTCTCAAAATCATC 57.630 36.000 0.00 0.00 0.00 2.92
7459 9078 6.936335 TCAGTAAACAGCTCTCAAAATCATCA 59.064 34.615 0.00 0.00 0.00 3.07
7460 9079 7.020010 CAGTAAACAGCTCTCAAAATCATCAC 58.980 38.462 0.00 0.00 0.00 3.06
7461 9080 4.675190 AACAGCTCTCAAAATCATCACG 57.325 40.909 0.00 0.00 0.00 4.35
7462 9081 3.005554 ACAGCTCTCAAAATCATCACGG 58.994 45.455 0.00 0.00 0.00 4.94
7463 9082 3.005554 CAGCTCTCAAAATCATCACGGT 58.994 45.455 0.00 0.00 0.00 4.83
7464 9083 3.438087 CAGCTCTCAAAATCATCACGGTT 59.562 43.478 0.00 0.00 0.00 4.44
7465 9084 3.686726 AGCTCTCAAAATCATCACGGTTC 59.313 43.478 0.00 0.00 0.00 3.62
7466 9085 3.484229 GCTCTCAAAATCATCACGGTTCG 60.484 47.826 0.00 0.00 0.00 3.95
7467 9086 3.659786 TCTCAAAATCATCACGGTTCGT 58.340 40.909 0.00 0.00 42.36 3.85
7476 9095 4.771127 ACGGTTCGTGCTTGTGAT 57.229 50.000 0.00 0.00 39.18 3.06
7477 9096 3.000815 ACGGTTCGTGCTTGTGATT 57.999 47.368 0.00 0.00 39.18 2.57
7478 9097 1.305201 ACGGTTCGTGCTTGTGATTT 58.695 45.000 0.00 0.00 39.18 2.17
7479 9098 1.002900 ACGGTTCGTGCTTGTGATTTG 60.003 47.619 0.00 0.00 39.18 2.32
7480 9099 1.002900 CGGTTCGTGCTTGTGATTTGT 60.003 47.619 0.00 0.00 0.00 2.83
7481 9100 2.384382 GGTTCGTGCTTGTGATTTGTG 58.616 47.619 0.00 0.00 0.00 3.33
7482 9101 2.384382 GTTCGTGCTTGTGATTTGTGG 58.616 47.619 0.00 0.00 0.00 4.17
7483 9102 1.960417 TCGTGCTTGTGATTTGTGGA 58.040 45.000 0.00 0.00 0.00 4.02
7484 9103 2.503331 TCGTGCTTGTGATTTGTGGAT 58.497 42.857 0.00 0.00 0.00 3.41
7485 9104 2.226200 TCGTGCTTGTGATTTGTGGATG 59.774 45.455 0.00 0.00 0.00 3.51
7486 9105 2.331194 GTGCTTGTGATTTGTGGATGC 58.669 47.619 0.00 0.00 0.00 3.91
7487 9106 1.273048 TGCTTGTGATTTGTGGATGCC 59.727 47.619 0.00 0.00 0.00 4.40
7488 9107 1.273048 GCTTGTGATTTGTGGATGCCA 59.727 47.619 0.00 0.00 0.00 4.92
7489 9108 2.093869 GCTTGTGATTTGTGGATGCCAT 60.094 45.455 0.00 0.00 35.28 4.40
7490 9109 3.777478 CTTGTGATTTGTGGATGCCATC 58.223 45.455 0.00 0.00 35.28 3.51
7498 9117 4.477413 GGATGCCATCCTGCTCAG 57.523 61.111 16.71 0.00 46.19 3.35
7499 9118 1.897615 GGATGCCATCCTGCTCAGC 60.898 63.158 16.71 0.00 46.19 4.26
7500 9119 1.148723 GATGCCATCCTGCTCAGCT 59.851 57.895 0.00 0.00 0.00 4.24
7501 9120 0.885596 GATGCCATCCTGCTCAGCTC 60.886 60.000 0.00 0.00 0.00 4.09
7502 9121 1.632965 ATGCCATCCTGCTCAGCTCA 61.633 55.000 0.00 0.00 0.00 4.26
7503 9122 1.077930 GCCATCCTGCTCAGCTCAA 60.078 57.895 0.00 0.00 0.00 3.02
7504 9123 0.679002 GCCATCCTGCTCAGCTCAAA 60.679 55.000 0.00 0.00 0.00 2.69
7505 9124 2.022754 GCCATCCTGCTCAGCTCAAAT 61.023 52.381 0.00 0.00 0.00 2.32
7506 9125 1.676529 CCATCCTGCTCAGCTCAAATG 59.323 52.381 0.00 0.00 0.00 2.32
7507 9126 2.640184 CATCCTGCTCAGCTCAAATGA 58.360 47.619 0.00 0.00 0.00 2.57
7508 9127 3.215151 CATCCTGCTCAGCTCAAATGAT 58.785 45.455 0.00 0.00 0.00 2.45
7509 9128 2.915349 TCCTGCTCAGCTCAAATGATC 58.085 47.619 0.00 0.00 0.00 2.92
7510 9129 2.237893 TCCTGCTCAGCTCAAATGATCA 59.762 45.455 0.00 0.00 0.00 2.92
7511 9130 2.614520 CCTGCTCAGCTCAAATGATCAG 59.385 50.000 0.09 0.93 39.49 2.90
7512 9131 2.014857 TGCTCAGCTCAAATGATCAGC 58.985 47.619 0.09 0.00 0.00 4.26
7513 9132 2.014857 GCTCAGCTCAAATGATCAGCA 58.985 47.619 0.09 0.00 35.46 4.41
7514 9133 2.032302 GCTCAGCTCAAATGATCAGCAG 59.968 50.000 0.09 0.00 35.46 4.24
7515 9134 2.014857 TCAGCTCAAATGATCAGCAGC 58.985 47.619 0.09 5.76 35.46 5.25
7516 9135 1.015109 AGCTCAAATGATCAGCAGCG 58.985 50.000 0.09 0.00 35.46 5.18
7517 9136 0.731417 GCTCAAATGATCAGCAGCGT 59.269 50.000 0.09 0.00 33.06 5.07
7518 9137 1.531264 GCTCAAATGATCAGCAGCGTG 60.531 52.381 0.09 0.00 33.06 5.34
7519 9138 1.736126 CTCAAATGATCAGCAGCGTGT 59.264 47.619 0.09 0.00 0.00 4.49
7520 9139 1.733912 TCAAATGATCAGCAGCGTGTC 59.266 47.619 0.09 0.00 0.00 3.67
7521 9140 1.736126 CAAATGATCAGCAGCGTGTCT 59.264 47.619 0.09 0.00 0.00 3.41
7522 9141 1.649664 AATGATCAGCAGCGTGTCTC 58.350 50.000 0.09 0.00 0.00 3.36
7523 9142 0.179089 ATGATCAGCAGCGTGTCTCC 60.179 55.000 0.09 0.00 0.00 3.71
7524 9143 1.216444 GATCAGCAGCGTGTCTCCA 59.784 57.895 0.00 0.00 0.00 3.86
7525 9144 0.179089 GATCAGCAGCGTGTCTCCAT 60.179 55.000 0.00 0.00 0.00 3.41
7526 9145 0.461516 ATCAGCAGCGTGTCTCCATG 60.462 55.000 0.00 0.00 0.00 3.66
7527 9146 2.104859 CAGCAGCGTGTCTCCATGG 61.105 63.158 4.97 4.97 0.00 3.66
7528 9147 2.046892 GCAGCGTGTCTCCATGGT 60.047 61.111 12.58 0.00 38.83 3.55
7529 9148 2.103042 GCAGCGTGTCTCCATGGTC 61.103 63.158 12.58 4.59 36.19 4.02
7530 9149 1.593787 CAGCGTGTCTCCATGGTCT 59.406 57.895 12.58 0.00 36.19 3.85
7531 9150 0.459237 CAGCGTGTCTCCATGGTCTC 60.459 60.000 12.58 3.86 36.19 3.36
7532 9151 0.613292 AGCGTGTCTCCATGGTCTCT 60.613 55.000 12.58 0.00 33.05 3.10
7533 9152 0.459237 GCGTGTCTCCATGGTCTCTG 60.459 60.000 12.58 0.00 0.00 3.35
7534 9153 0.174389 CGTGTCTCCATGGTCTCTGG 59.826 60.000 12.58 0.00 34.93 3.86
7535 9154 1.561643 GTGTCTCCATGGTCTCTGGA 58.438 55.000 12.58 0.00 40.49 3.86
7540 9159 1.186200 TCCATGGTCTCTGGAGTTCG 58.814 55.000 12.58 0.00 37.87 3.95
7541 9160 0.460987 CCATGGTCTCTGGAGTTCGC 60.461 60.000 2.57 0.00 35.70 4.70
7542 9161 0.460987 CATGGTCTCTGGAGTTCGCC 60.461 60.000 0.00 0.00 0.00 5.54
7543 9162 0.904865 ATGGTCTCTGGAGTTCGCCA 60.905 55.000 0.00 0.00 36.30 5.69
7544 9163 0.904865 TGGTCTCTGGAGTTCGCCAT 60.905 55.000 0.00 0.00 37.30 4.40
7545 9164 0.179097 GGTCTCTGGAGTTCGCCATC 60.179 60.000 0.00 0.00 37.30 3.51
7546 9165 0.820871 GTCTCTGGAGTTCGCCATCT 59.179 55.000 0.00 0.00 37.30 2.90
7547 9166 1.205893 GTCTCTGGAGTTCGCCATCTT 59.794 52.381 0.00 0.00 37.30 2.40
7548 9167 1.478510 TCTCTGGAGTTCGCCATCTTC 59.521 52.381 0.00 0.00 37.30 2.87
7549 9168 1.480137 CTCTGGAGTTCGCCATCTTCT 59.520 52.381 0.00 0.00 37.30 2.85
7550 9169 1.902508 TCTGGAGTTCGCCATCTTCTT 59.097 47.619 0.00 0.00 37.30 2.52
7551 9170 2.005451 CTGGAGTTCGCCATCTTCTTG 58.995 52.381 0.00 0.00 37.30 3.02
7552 9171 0.729690 GGAGTTCGCCATCTTCTTGC 59.270 55.000 0.00 0.00 0.00 4.01
7553 9172 1.442769 GAGTTCGCCATCTTCTTGCA 58.557 50.000 0.00 0.00 0.00 4.08
7554 9173 1.396301 GAGTTCGCCATCTTCTTGCAG 59.604 52.381 0.00 0.00 0.00 4.41
7555 9174 1.002430 AGTTCGCCATCTTCTTGCAGA 59.998 47.619 0.00 0.00 0.00 4.26
7556 9175 2.012673 GTTCGCCATCTTCTTGCAGAT 58.987 47.619 0.00 0.00 33.44 2.90
7557 9176 1.660167 TCGCCATCTTCTTGCAGATG 58.340 50.000 6.68 6.68 46.89 2.90
7564 9183 3.622166 TCTTCTTGCAGATGATCAGCA 57.378 42.857 14.38 8.51 37.11 4.41
7565 9184 3.946606 TCTTCTTGCAGATGATCAGCAA 58.053 40.909 21.33 21.33 44.71 3.91
7566 9185 4.329392 TCTTCTTGCAGATGATCAGCAAA 58.671 39.130 22.51 10.73 45.83 3.68
7567 9186 4.395231 TCTTCTTGCAGATGATCAGCAAAG 59.605 41.667 22.51 18.19 45.83 2.77
7568 9187 3.682696 TCTTGCAGATGATCAGCAAAGT 58.317 40.909 22.51 0.00 45.83 2.66
7569 9188 3.688185 TCTTGCAGATGATCAGCAAAGTC 59.312 43.478 22.51 3.41 45.83 3.01
7570 9189 3.345508 TGCAGATGATCAGCAAAGTCT 57.654 42.857 14.38 0.73 35.94 3.24
7571 9190 3.268330 TGCAGATGATCAGCAAAGTCTC 58.732 45.455 14.38 0.00 35.94 3.36
7572 9191 3.268330 GCAGATGATCAGCAAAGTCTCA 58.732 45.455 14.38 0.00 0.00 3.27
7573 9192 3.063725 GCAGATGATCAGCAAAGTCTCAC 59.936 47.826 14.38 0.00 0.00 3.51
7574 9193 3.622163 CAGATGATCAGCAAAGTCTCACC 59.378 47.826 14.38 0.00 0.00 4.02
7575 9194 3.518705 AGATGATCAGCAAAGTCTCACCT 59.481 43.478 14.38 0.00 0.00 4.00
7576 9195 3.777106 TGATCAGCAAAGTCTCACCTT 57.223 42.857 0.00 0.00 0.00 3.50
7577 9196 3.668447 TGATCAGCAAAGTCTCACCTTC 58.332 45.455 0.00 0.00 0.00 3.46
7578 9197 3.326006 TGATCAGCAAAGTCTCACCTTCT 59.674 43.478 0.00 0.00 0.00 2.85
7579 9198 3.845781 TCAGCAAAGTCTCACCTTCTT 57.154 42.857 0.00 0.00 0.00 2.52
7580 9199 3.733337 TCAGCAAAGTCTCACCTTCTTC 58.267 45.455 0.00 0.00 0.00 2.87
7581 9200 2.478134 CAGCAAAGTCTCACCTTCTTCG 59.522 50.000 0.00 0.00 0.00 3.79
7582 9201 1.195674 GCAAAGTCTCACCTTCTTCGC 59.804 52.381 0.00 0.00 0.00 4.70
7583 9202 1.801178 CAAAGTCTCACCTTCTTCGCC 59.199 52.381 0.00 0.00 0.00 5.54
7584 9203 0.038159 AAGTCTCACCTTCTTCGCCG 60.038 55.000 0.00 0.00 0.00 6.46
7585 9204 1.446272 GTCTCACCTTCTTCGCCGG 60.446 63.158 0.00 0.00 0.00 6.13
7586 9205 1.906824 TCTCACCTTCTTCGCCGGT 60.907 57.895 1.90 0.00 0.00 5.28
7587 9206 1.004918 CTCACCTTCTTCGCCGGTT 60.005 57.895 1.90 0.00 0.00 4.44
7588 9207 1.005394 TCACCTTCTTCGCCGGTTC 60.005 57.895 1.90 0.00 0.00 3.62
7589 9208 2.033194 CACCTTCTTCGCCGGTTCC 61.033 63.158 1.90 0.00 0.00 3.62
7590 9209 2.214920 ACCTTCTTCGCCGGTTCCT 61.215 57.895 1.90 0.00 0.00 3.36
7591 9210 1.448013 CCTTCTTCGCCGGTTCCTC 60.448 63.158 1.90 0.00 0.00 3.71
7592 9211 1.292223 CTTCTTCGCCGGTTCCTCA 59.708 57.895 1.90 0.00 0.00 3.86
7593 9212 0.737715 CTTCTTCGCCGGTTCCTCAG 60.738 60.000 1.90 0.00 0.00 3.35
7594 9213 2.781595 TTCTTCGCCGGTTCCTCAGC 62.782 60.000 1.90 0.00 0.00 4.26
7601 9220 2.126031 GGTTCCTCAGCGACGGAC 60.126 66.667 0.00 0.00 0.00 4.79
7602 9221 2.504244 GTTCCTCAGCGACGGACG 60.504 66.667 0.00 0.00 45.66 4.79
7611 9230 3.117372 CGACGGACGCCTTATCCT 58.883 61.111 0.00 0.00 33.70 3.24
7612 9231 1.008767 CGACGGACGCCTTATCCTC 60.009 63.158 0.00 0.00 33.70 3.71
7613 9232 1.445716 CGACGGACGCCTTATCCTCT 61.446 60.000 0.00 0.00 33.70 3.69
7614 9233 1.602311 GACGGACGCCTTATCCTCTA 58.398 55.000 0.00 0.00 33.70 2.43
7615 9234 1.536331 GACGGACGCCTTATCCTCTAG 59.464 57.143 0.00 0.00 33.70 2.43
7616 9235 0.241481 CGGACGCCTTATCCTCTAGC 59.759 60.000 0.00 0.00 33.70 3.42
7617 9236 1.623163 GGACGCCTTATCCTCTAGCT 58.377 55.000 0.00 0.00 33.03 3.32
7618 9237 1.542472 GGACGCCTTATCCTCTAGCTC 59.458 57.143 0.00 0.00 33.03 4.09
7619 9238 2.231529 GACGCCTTATCCTCTAGCTCA 58.768 52.381 0.00 0.00 0.00 4.26
7620 9239 2.227865 GACGCCTTATCCTCTAGCTCAG 59.772 54.545 0.00 0.00 0.00 3.35
7621 9240 2.158593 ACGCCTTATCCTCTAGCTCAGA 60.159 50.000 0.00 0.00 0.00 3.27
7628 9247 2.732289 CTCTAGCTCAGAGGCCCTC 58.268 63.158 1.26 1.26 46.21 4.30
7629 9248 0.185901 CTCTAGCTCAGAGGCCCTCT 59.814 60.000 7.68 7.68 46.21 3.69
7630 9249 0.633921 TCTAGCTCAGAGGCCCTCTT 59.366 55.000 11.57 0.00 38.99 2.85
7631 9250 1.039856 CTAGCTCAGAGGCCCTCTTC 58.960 60.000 11.57 3.36 38.99 2.87
7632 9251 0.633921 TAGCTCAGAGGCCCTCTTCT 59.366 55.000 11.57 10.98 38.99 2.85
7633 9252 0.687427 AGCTCAGAGGCCCTCTTCTC 60.687 60.000 11.57 2.59 38.99 2.87
7634 9253 2.015227 GCTCAGAGGCCCTCTTCTCG 62.015 65.000 11.57 0.00 38.99 4.04
7635 9254 0.395036 CTCAGAGGCCCTCTTCTCGA 60.395 60.000 11.57 4.34 38.99 4.04
7636 9255 0.260230 TCAGAGGCCCTCTTCTCGAT 59.740 55.000 11.57 0.00 38.99 3.59
7637 9256 1.495148 TCAGAGGCCCTCTTCTCGATA 59.505 52.381 11.57 0.00 38.99 2.92
7638 9257 2.109128 TCAGAGGCCCTCTTCTCGATAT 59.891 50.000 11.57 0.00 38.99 1.63
7639 9258 3.330998 TCAGAGGCCCTCTTCTCGATATA 59.669 47.826 11.57 0.00 38.99 0.86
7640 9259 3.442273 CAGAGGCCCTCTTCTCGATATAC 59.558 52.174 11.57 0.00 38.99 1.47
7641 9260 3.332485 AGAGGCCCTCTTCTCGATATACT 59.668 47.826 7.68 0.00 37.60 2.12
7642 9261 3.692593 GAGGCCCTCTTCTCGATATACTC 59.307 52.174 2.64 0.00 0.00 2.59
7643 9262 3.074687 AGGCCCTCTTCTCGATATACTCA 59.925 47.826 0.00 0.00 0.00 3.41
7644 9263 3.191791 GGCCCTCTTCTCGATATACTCAC 59.808 52.174 0.00 0.00 0.00 3.51
7645 9264 3.120130 GCCCTCTTCTCGATATACTCACG 60.120 52.174 0.00 0.00 0.00 4.35
7646 9265 3.437395 CCCTCTTCTCGATATACTCACGG 59.563 52.174 0.00 0.00 0.00 4.94
7647 9266 4.066490 CCTCTTCTCGATATACTCACGGT 58.934 47.826 0.00 0.00 0.00 4.83
7648 9267 5.236282 CCTCTTCTCGATATACTCACGGTA 58.764 45.833 0.00 0.00 34.62 4.02
<
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 4.142622 CGATAGTGCCTTGAATGAAAAGCA 60.143 41.667 0.00 0.00 0.00 3.91
1 2 4.346129 CGATAGTGCCTTGAATGAAAAGC 58.654 43.478 0.00 0.00 0.00 3.51
37 38 8.872845 GTGATGAAGTGTTGAAACAAGAAAATT 58.127 29.630 0.00 0.00 41.21 1.82
38 39 8.034215 TGTGATGAAGTGTTGAAACAAGAAAAT 58.966 29.630 0.00 0.00 41.21 1.82
39 40 7.374272 TGTGATGAAGTGTTGAAACAAGAAAA 58.626 30.769 0.00 0.00 41.21 2.29
40 41 6.918626 TGTGATGAAGTGTTGAAACAAGAAA 58.081 32.000 0.00 0.00 41.21 2.52
41 42 6.507958 TGTGATGAAGTGTTGAAACAAGAA 57.492 33.333 0.00 0.00 41.21 2.52
42 43 6.507958 TTGTGATGAAGTGTTGAAACAAGA 57.492 33.333 0.00 0.00 41.21 3.02
43 44 7.760131 AATTGTGATGAAGTGTTGAAACAAG 57.240 32.000 0.00 0.00 41.21 3.16
44 45 7.277539 GGAAATTGTGATGAAGTGTTGAAACAA 59.722 33.333 0.00 0.00 41.21 2.83
45 46 6.756074 GGAAATTGTGATGAAGTGTTGAAACA 59.244 34.615 0.00 0.00 36.38 2.83
46 47 6.756074 TGGAAATTGTGATGAAGTGTTGAAAC 59.244 34.615 0.00 0.00 0.00 2.78
47 48 6.871844 TGGAAATTGTGATGAAGTGTTGAAA 58.128 32.000 0.00 0.00 0.00 2.69
48 49 6.320926 TCTGGAAATTGTGATGAAGTGTTGAA 59.679 34.615 0.00 0.00 0.00 2.69
49 50 5.827267 TCTGGAAATTGTGATGAAGTGTTGA 59.173 36.000 0.00 0.00 0.00 3.18
50 51 6.075762 TCTGGAAATTGTGATGAAGTGTTG 57.924 37.500 0.00 0.00 0.00 3.33
51 52 6.906157 ATCTGGAAATTGTGATGAAGTGTT 57.094 33.333 0.00 0.00 0.00 3.32
52 53 6.491062 TGAATCTGGAAATTGTGATGAAGTGT 59.509 34.615 0.00 0.00 0.00 3.55
53 54 6.916440 TGAATCTGGAAATTGTGATGAAGTG 58.084 36.000 0.00 0.00 0.00 3.16
54 55 7.395206 TCATGAATCTGGAAATTGTGATGAAGT 59.605 33.333 0.00 0.00 0.00 3.01
55 56 7.768240 TCATGAATCTGGAAATTGTGATGAAG 58.232 34.615 0.00 0.00 0.00 3.02
56 57 7.706100 TCATGAATCTGGAAATTGTGATGAA 57.294 32.000 0.00 0.00 0.00 2.57
57 58 7.706100 TTCATGAATCTGGAAATTGTGATGA 57.294 32.000 3.38 0.00 0.00 2.92
58 59 8.942338 AATTCATGAATCTGGAAATTGTGATG 57.058 30.769 20.95 0.00 0.00 3.07
59 60 9.953565 AAAATTCATGAATCTGGAAATTGTGAT 57.046 25.926 20.95 0.00 0.00 3.06
64 65 9.947433 TGCTTAAAATTCATGAATCTGGAAATT 57.053 25.926 20.95 7.36 0.00 1.82
65 66 9.947433 TTGCTTAAAATTCATGAATCTGGAAAT 57.053 25.926 20.95 1.04 0.00 2.17
66 67 9.775854 TTTGCTTAAAATTCATGAATCTGGAAA 57.224 25.926 20.95 17.06 0.00 3.13
67 68 9.775854 TTTTGCTTAAAATTCATGAATCTGGAA 57.224 25.926 20.95 13.04 0.00 3.53
68 69 9.206870 GTTTTGCTTAAAATTCATGAATCTGGA 57.793 29.630 20.95 8.38 0.00 3.86
69 70 8.445493 GGTTTTGCTTAAAATTCATGAATCTGG 58.555 33.333 20.95 10.79 0.00 3.86
70 71 9.211485 AGGTTTTGCTTAAAATTCATGAATCTG 57.789 29.630 20.95 10.51 0.00 2.90
71 72 9.428097 GAGGTTTTGCTTAAAATTCATGAATCT 57.572 29.630 20.95 13.54 0.00 2.40
72 73 9.206870 TGAGGTTTTGCTTAAAATTCATGAATC 57.793 29.630 20.95 8.32 0.00 2.52
73 74 9.729281 ATGAGGTTTTGCTTAAAATTCATGAAT 57.271 25.926 15.36 15.36 32.58 2.57
75 76 9.859427 CTATGAGGTTTTGCTTAAAATTCATGA 57.141 29.630 16.76 0.00 34.14 3.07
76 77 9.859427 TCTATGAGGTTTTGCTTAAAATTCATG 57.141 29.630 16.76 0.00 34.14 3.07
78 79 9.295825 TCTCTATGAGGTTTTGCTTAAAATTCA 57.704 29.630 0.00 0.00 0.00 2.57
86 87 9.995003 CTAGATTATCTCTATGAGGTTTTGCTT 57.005 33.333 0.00 0.00 35.89 3.91
87 88 9.153479 ACTAGATTATCTCTATGAGGTTTTGCT 57.847 33.333 0.00 0.00 35.89 3.91
88 89 9.202273 CACTAGATTATCTCTATGAGGTTTTGC 57.798 37.037 0.00 0.00 35.89 3.68
89 90 9.202273 GCACTAGATTATCTCTATGAGGTTTTG 57.798 37.037 0.00 0.00 35.89 2.44
90 91 8.928448 TGCACTAGATTATCTCTATGAGGTTTT 58.072 33.333 0.00 0.00 35.89 2.43
91 92 8.364142 GTGCACTAGATTATCTCTATGAGGTTT 58.636 37.037 10.32 0.00 35.89 3.27
92 93 7.728083 AGTGCACTAGATTATCTCTATGAGGTT 59.272 37.037 20.16 0.00 35.89 3.50
93 94 7.237982 AGTGCACTAGATTATCTCTATGAGGT 58.762 38.462 20.16 0.00 35.89 3.85
94 95 7.392953 TGAGTGCACTAGATTATCTCTATGAGG 59.607 40.741 21.73 0.00 35.89 3.86
95 96 8.334263 TGAGTGCACTAGATTATCTCTATGAG 57.666 38.462 21.73 0.00 35.89 2.90
96 97 8.697507 TTGAGTGCACTAGATTATCTCTATGA 57.302 34.615 21.73 0.00 35.89 2.15
97 98 9.926158 AATTGAGTGCACTAGATTATCTCTATG 57.074 33.333 21.73 0.00 35.89 2.23
99 100 9.136323 TGAATTGAGTGCACTAGATTATCTCTA 57.864 33.333 21.73 1.26 35.28 2.43
100 101 7.925483 GTGAATTGAGTGCACTAGATTATCTCT 59.075 37.037 21.73 0.44 38.06 3.10
101 102 7.925483 AGTGAATTGAGTGCACTAGATTATCTC 59.075 37.037 21.73 13.51 40.79 2.75
102 103 7.790027 AGTGAATTGAGTGCACTAGATTATCT 58.210 34.615 21.73 18.02 40.79 1.98
110 111 4.535526 TGCTAGTGAATTGAGTGCACTA 57.464 40.909 21.73 5.36 42.40 2.74
111 112 3.407424 TGCTAGTGAATTGAGTGCACT 57.593 42.857 21.88 21.88 44.38 4.40
112 113 4.691860 ATTGCTAGTGAATTGAGTGCAC 57.308 40.909 9.40 9.40 0.00 4.57
113 114 4.082625 CCAATTGCTAGTGAATTGAGTGCA 60.083 41.667 21.64 0.00 41.44 4.57
114 115 4.082571 ACCAATTGCTAGTGAATTGAGTGC 60.083 41.667 21.64 0.00 41.44 4.40
115 116 5.633830 ACCAATTGCTAGTGAATTGAGTG 57.366 39.130 21.64 12.69 41.44 3.51
116 117 5.769662 TGAACCAATTGCTAGTGAATTGAGT 59.230 36.000 21.64 16.67 41.44 3.41
117 118 6.258230 TGAACCAATTGCTAGTGAATTGAG 57.742 37.500 21.64 16.26 41.44 3.02
118 119 6.433716 TGATGAACCAATTGCTAGTGAATTGA 59.566 34.615 21.64 9.36 41.44 2.57
119 120 6.623486 TGATGAACCAATTGCTAGTGAATTG 58.377 36.000 16.56 16.56 39.52 2.32
120 121 6.839124 TGATGAACCAATTGCTAGTGAATT 57.161 33.333 0.00 0.00 0.00 2.17
121 122 8.523915 TTATGATGAACCAATTGCTAGTGAAT 57.476 30.769 0.00 0.00 0.00 2.57
122 123 7.936496 TTATGATGAACCAATTGCTAGTGAA 57.064 32.000 0.00 0.00 0.00 3.18
123 124 8.407832 CAATTATGATGAACCAATTGCTAGTGA 58.592 33.333 0.00 0.00 33.18 3.41
124 125 7.650504 CCAATTATGATGAACCAATTGCTAGTG 59.349 37.037 0.00 0.00 37.16 2.74
125 126 7.560991 TCCAATTATGATGAACCAATTGCTAGT 59.439 33.333 0.00 0.00 37.16 2.57
126 127 7.944061 TCCAATTATGATGAACCAATTGCTAG 58.056 34.615 0.00 0.00 37.16 3.42
127 128 7.894753 TCCAATTATGATGAACCAATTGCTA 57.105 32.000 0.00 0.00 37.16 3.49
128 129 6.795144 TCCAATTATGATGAACCAATTGCT 57.205 33.333 0.00 0.00 37.16 3.91
129 130 7.439381 AGATCCAATTATGATGAACCAATTGC 58.561 34.615 0.00 0.00 37.16 3.56
130 131 9.826574 AAAGATCCAATTATGATGAACCAATTG 57.173 29.630 0.00 0.00 37.86 2.32
158 159 9.620259 GATCCTCATCCACTTACTAATCTTTTT 57.380 33.333 0.00 0.00 0.00 1.94
175 176 6.941436 AGCAAAGAGATTTATGGATCCTCATC 59.059 38.462 14.23 8.82 0.00 2.92
176 177 6.850234 AGCAAAGAGATTTATGGATCCTCAT 58.150 36.000 14.23 1.09 0.00 2.90
177 178 6.257994 AGCAAAGAGATTTATGGATCCTCA 57.742 37.500 14.23 0.00 0.00 3.86
178 179 6.997476 AGAAGCAAAGAGATTTATGGATCCTC 59.003 38.462 14.23 1.10 0.00 3.71
179 180 6.771749 CAGAAGCAAAGAGATTTATGGATCCT 59.228 38.462 14.23 0.89 0.00 3.24
180 181 6.769822 TCAGAAGCAAAGAGATTTATGGATCC 59.230 38.462 4.20 4.20 0.00 3.36
181 182 7.798596 TCAGAAGCAAAGAGATTTATGGATC 57.201 36.000 0.00 0.00 0.00 3.36
182 183 8.763984 ATTCAGAAGCAAAGAGATTTATGGAT 57.236 30.769 0.00 0.00 0.00 3.41
183 184 8.585471 AATTCAGAAGCAAAGAGATTTATGGA 57.415 30.769 0.00 0.00 0.00 3.41
184 185 9.084164 CAAATTCAGAAGCAAAGAGATTTATGG 57.916 33.333 0.00 0.00 0.00 2.74
185 186 9.850628 TCAAATTCAGAAGCAAAGAGATTTATG 57.149 29.630 0.00 0.00 0.00 1.90
191 192 9.683069 GTTTATTCAAATTCAGAAGCAAAGAGA 57.317 29.630 0.00 0.00 0.00 3.10
192 193 9.467258 TGTTTATTCAAATTCAGAAGCAAAGAG 57.533 29.630 0.00 0.00 0.00 2.85
193 194 9.248291 GTGTTTATTCAAATTCAGAAGCAAAGA 57.752 29.630 0.00 0.55 0.00 2.52
194 195 9.033481 TGTGTTTATTCAAATTCAGAAGCAAAG 57.967 29.630 0.00 0.00 0.00 2.77
195 196 8.939201 TGTGTTTATTCAAATTCAGAAGCAAA 57.061 26.923 0.00 1.43 0.00 3.68
196 197 8.939201 TTGTGTTTATTCAAATTCAGAAGCAA 57.061 26.923 0.00 0.00 0.00 3.91
197 198 9.545105 AATTGTGTTTATTCAAATTCAGAAGCA 57.455 25.926 0.00 0.00 0.00 3.91
203 204 9.716531 TGGCATAATTGTGTTTATTCAAATTCA 57.283 25.926 4.00 0.00 0.00 2.57
206 207 9.723601 ACTTGGCATAATTGTGTTTATTCAAAT 57.276 25.926 4.00 0.00 0.00 2.32
211 212 9.134734 CGTTTACTTGGCATAATTGTGTTTATT 57.865 29.630 4.00 0.00 0.00 1.40
212 213 8.516234 TCGTTTACTTGGCATAATTGTGTTTAT 58.484 29.630 4.00 0.00 0.00 1.40
213 214 7.872881 TCGTTTACTTGGCATAATTGTGTTTA 58.127 30.769 4.00 0.00 0.00 2.01
214 215 6.740110 TCGTTTACTTGGCATAATTGTGTTT 58.260 32.000 4.00 0.00 0.00 2.83
215 216 6.320494 TCGTTTACTTGGCATAATTGTGTT 57.680 33.333 4.00 0.00 0.00 3.32
216 217 5.619086 GCTCGTTTACTTGGCATAATTGTGT 60.619 40.000 4.00 0.00 0.00 3.72
217 218 4.793216 GCTCGTTTACTTGGCATAATTGTG 59.207 41.667 0.00 0.00 0.00 3.33
218 219 4.457603 TGCTCGTTTACTTGGCATAATTGT 59.542 37.500 0.00 0.00 0.00 2.71
219 220 4.980590 TGCTCGTTTACTTGGCATAATTG 58.019 39.130 0.00 0.00 0.00 2.32
220 221 5.637006 TTGCTCGTTTACTTGGCATAATT 57.363 34.783 0.00 0.00 32.87 1.40
221 222 5.048364 TGTTTGCTCGTTTACTTGGCATAAT 60.048 36.000 0.00 0.00 32.87 1.28
222 223 4.276183 TGTTTGCTCGTTTACTTGGCATAA 59.724 37.500 0.00 0.00 32.87 1.90
223 224 3.815962 TGTTTGCTCGTTTACTTGGCATA 59.184 39.130 0.00 0.00 32.87 3.14
224 225 2.621055 TGTTTGCTCGTTTACTTGGCAT 59.379 40.909 0.00 0.00 32.87 4.40
225 226 2.017782 TGTTTGCTCGTTTACTTGGCA 58.982 42.857 0.00 0.00 0.00 4.92
226 227 2.766970 TGTTTGCTCGTTTACTTGGC 57.233 45.000 0.00 0.00 0.00 4.52
227 228 3.794564 GGTTTGTTTGCTCGTTTACTTGG 59.205 43.478 0.00 0.00 0.00 3.61
228 229 3.480668 CGGTTTGTTTGCTCGTTTACTTG 59.519 43.478 0.00 0.00 0.00 3.16
229 230 3.374678 TCGGTTTGTTTGCTCGTTTACTT 59.625 39.130 0.00 0.00 0.00 2.24
230 231 2.937799 TCGGTTTGTTTGCTCGTTTACT 59.062 40.909 0.00 0.00 0.00 2.24
231 232 3.242511 ACTCGGTTTGTTTGCTCGTTTAC 60.243 43.478 0.00 0.00 0.00 2.01
232 233 2.937799 ACTCGGTTTGTTTGCTCGTTTA 59.062 40.909 0.00 0.00 0.00 2.01
233 234 1.741145 ACTCGGTTTGTTTGCTCGTTT 59.259 42.857 0.00 0.00 0.00 3.60
234 235 1.375551 ACTCGGTTTGTTTGCTCGTT 58.624 45.000 0.00 0.00 0.00 3.85
235 236 2.228138 TACTCGGTTTGTTTGCTCGT 57.772 45.000 0.00 0.00 0.00 4.18
236 237 2.798283 TCTTACTCGGTTTGTTTGCTCG 59.202 45.455 0.00 0.00 0.00 5.03
237 238 3.558418 TGTCTTACTCGGTTTGTTTGCTC 59.442 43.478 0.00 0.00 0.00 4.26
238 239 3.537580 TGTCTTACTCGGTTTGTTTGCT 58.462 40.909 0.00 0.00 0.00 3.91
239 240 3.955771 TGTCTTACTCGGTTTGTTTGC 57.044 42.857 0.00 0.00 0.00 3.68
240 241 7.075741 CCTTTATGTCTTACTCGGTTTGTTTG 58.924 38.462 0.00 0.00 0.00 2.93
241 242 6.293790 GCCTTTATGTCTTACTCGGTTTGTTT 60.294 38.462 0.00 0.00 0.00 2.83
242 243 5.180680 GCCTTTATGTCTTACTCGGTTTGTT 59.819 40.000 0.00 0.00 0.00 2.83
243 244 4.694037 GCCTTTATGTCTTACTCGGTTTGT 59.306 41.667 0.00 0.00 0.00 2.83
244 245 4.693566 TGCCTTTATGTCTTACTCGGTTTG 59.306 41.667 0.00 0.00 0.00 2.93
245 246 4.901868 TGCCTTTATGTCTTACTCGGTTT 58.098 39.130 0.00 0.00 0.00 3.27
246 247 4.546829 TGCCTTTATGTCTTACTCGGTT 57.453 40.909 0.00 0.00 0.00 4.44
247 248 4.546829 TTGCCTTTATGTCTTACTCGGT 57.453 40.909 0.00 0.00 0.00 4.69
248 249 5.220854 CCATTTGCCTTTATGTCTTACTCGG 60.221 44.000 0.00 0.00 0.00 4.63
249 250 5.584649 TCCATTTGCCTTTATGTCTTACTCG 59.415 40.000 0.00 0.00 0.00 4.18
250 251 7.391148 TTCCATTTGCCTTTATGTCTTACTC 57.609 36.000 0.00 0.00 0.00 2.59
251 252 7.669722 TCTTTCCATTTGCCTTTATGTCTTACT 59.330 33.333 0.00 0.00 0.00 2.24
252 253 7.826690 TCTTTCCATTTGCCTTTATGTCTTAC 58.173 34.615 0.00 0.00 0.00 2.34
253 254 8.415950 TTCTTTCCATTTGCCTTTATGTCTTA 57.584 30.769 0.00 0.00 0.00 2.10
254 255 6.916360 TCTTTCCATTTGCCTTTATGTCTT 57.084 33.333 0.00 0.00 0.00 3.01
255 256 6.071165 CCTTCTTTCCATTTGCCTTTATGTCT 60.071 38.462 0.00 0.00 0.00 3.41
256 257 6.101997 CCTTCTTTCCATTTGCCTTTATGTC 58.898 40.000 0.00 0.00 0.00 3.06
257 258 5.543790 ACCTTCTTTCCATTTGCCTTTATGT 59.456 36.000 0.00 0.00 0.00 2.29
258 259 5.870978 CACCTTCTTTCCATTTGCCTTTATG 59.129 40.000 0.00 0.00 0.00 1.90
259 260 5.779771 TCACCTTCTTTCCATTTGCCTTTAT 59.220 36.000 0.00 0.00 0.00 1.40
260 261 5.144100 TCACCTTCTTTCCATTTGCCTTTA 58.856 37.500 0.00 0.00 0.00 1.85
261 262 3.966665 TCACCTTCTTTCCATTTGCCTTT 59.033 39.130 0.00 0.00 0.00 3.11
262 263 3.575805 TCACCTTCTTTCCATTTGCCTT 58.424 40.909 0.00 0.00 0.00 4.35
263 264 3.243359 TCACCTTCTTTCCATTTGCCT 57.757 42.857 0.00 0.00 0.00 4.75
264 265 4.541973 ATTCACCTTCTTTCCATTTGCC 57.458 40.909 0.00 0.00 0.00 4.52
265 266 7.961325 TTTTATTCACCTTCTTTCCATTTGC 57.039 32.000 0.00 0.00 0.00 3.68
266 267 8.992073 CCTTTTTATTCACCTTCTTTCCATTTG 58.008 33.333 0.00 0.00 0.00 2.32
267 268 7.661437 GCCTTTTTATTCACCTTCTTTCCATTT 59.339 33.333 0.00 0.00 0.00 2.32
268 269 7.161404 GCCTTTTTATTCACCTTCTTTCCATT 58.839 34.615 0.00 0.00 0.00 3.16
269 270 6.269769 TGCCTTTTTATTCACCTTCTTTCCAT 59.730 34.615 0.00 0.00 0.00 3.41
270 271 5.600484 TGCCTTTTTATTCACCTTCTTTCCA 59.400 36.000 0.00 0.00 0.00 3.53
271 272 6.096673 TGCCTTTTTATTCACCTTCTTTCC 57.903 37.500 0.00 0.00 0.00 3.13
272 273 8.607441 ATTTGCCTTTTTATTCACCTTCTTTC 57.393 30.769 0.00 0.00 0.00 2.62
301 302 9.627395 TCTAAAACGATTTTCAGAAAACACAAA 57.373 25.926 10.62 0.00 34.19 2.83
302 303 9.627395 TTCTAAAACGATTTTCAGAAAACACAA 57.373 25.926 10.62 0.00 34.19 3.33
303 304 9.284594 CTTCTAAAACGATTTTCAGAAAACACA 57.715 29.630 10.62 0.00 34.19 3.72
304 305 9.285770 ACTTCTAAAACGATTTTCAGAAAACAC 57.714 29.630 10.62 7.38 34.19 3.32
305 306 9.284594 CACTTCTAAAACGATTTTCAGAAAACA 57.715 29.630 10.62 0.00 34.19 2.83
306 307 8.743099 CCACTTCTAAAACGATTTTCAGAAAAC 58.257 33.333 10.62 4.66 34.19 2.43
307 308 7.918562 CCCACTTCTAAAACGATTTTCAGAAAA 59.081 33.333 10.80 10.80 34.19 2.29
308 309 7.422399 CCCACTTCTAAAACGATTTTCAGAAA 58.578 34.615 0.00 0.00 34.19 2.52
309 310 6.016610 CCCCACTTCTAAAACGATTTTCAGAA 60.017 38.462 0.00 0.01 34.19 3.02
310 311 5.472137 CCCCACTTCTAAAACGATTTTCAGA 59.528 40.000 0.00 0.00 34.19 3.27
311 312 5.335661 CCCCCACTTCTAAAACGATTTTCAG 60.336 44.000 0.00 0.00 34.19 3.02
312 313 4.521256 CCCCCACTTCTAAAACGATTTTCA 59.479 41.667 0.00 0.00 34.19 2.69
313 314 4.763279 TCCCCCACTTCTAAAACGATTTTC 59.237 41.667 0.00 0.00 34.19 2.29
314 315 4.732065 TCCCCCACTTCTAAAACGATTTT 58.268 39.130 0.00 0.00 36.67 1.82
315 316 4.042435 TCTCCCCCACTTCTAAAACGATTT 59.958 41.667 0.00 0.00 0.00 2.17
316 317 3.585732 TCTCCCCCACTTCTAAAACGATT 59.414 43.478 0.00 0.00 0.00 3.34
317 318 3.178865 TCTCCCCCACTTCTAAAACGAT 58.821 45.455 0.00 0.00 0.00 3.73
318 319 2.565834 CTCTCCCCCACTTCTAAAACGA 59.434 50.000 0.00 0.00 0.00 3.85
319 320 2.565834 TCTCTCCCCCACTTCTAAAACG 59.434 50.000 0.00 0.00 0.00 3.60
320 321 4.635699 TTCTCTCCCCCACTTCTAAAAC 57.364 45.455 0.00 0.00 0.00 2.43
321 322 5.656549 TTTTCTCTCCCCCACTTCTAAAA 57.343 39.130 0.00 0.00 0.00 1.52
322 323 5.656549 TTTTTCTCTCCCCCACTTCTAAA 57.343 39.130 0.00 0.00 0.00 1.85
323 324 5.312178 TCATTTTTCTCTCCCCCACTTCTAA 59.688 40.000 0.00 0.00 0.00 2.10
324 325 4.849810 TCATTTTTCTCTCCCCCACTTCTA 59.150 41.667 0.00 0.00 0.00 2.10
325 326 3.657727 TCATTTTTCTCTCCCCCACTTCT 59.342 43.478 0.00 0.00 0.00 2.85
326 327 4.013050 CTCATTTTTCTCTCCCCCACTTC 58.987 47.826 0.00 0.00 0.00 3.01
327 328 3.657727 TCTCATTTTTCTCTCCCCCACTT 59.342 43.478 0.00 0.00 0.00 3.16
328 329 3.260205 TCTCATTTTTCTCTCCCCCACT 58.740 45.455 0.00 0.00 0.00 4.00
329 330 3.615155 CTCTCATTTTTCTCTCCCCCAC 58.385 50.000 0.00 0.00 0.00 4.61
330 331 2.578021 CCTCTCATTTTTCTCTCCCCCA 59.422 50.000 0.00 0.00 0.00 4.96
331 332 2.685224 GCCTCTCATTTTTCTCTCCCCC 60.685 54.545 0.00 0.00 0.00 5.40
332 333 2.025887 TGCCTCTCATTTTTCTCTCCCC 60.026 50.000 0.00 0.00 0.00 4.81
333 334 3.356529 TGCCTCTCATTTTTCTCTCCC 57.643 47.619 0.00 0.00 0.00 4.30
334 335 5.416952 TCATTTGCCTCTCATTTTTCTCTCC 59.583 40.000 0.00 0.00 0.00 3.71
335 336 6.072286 TGTCATTTGCCTCTCATTTTTCTCTC 60.072 38.462 0.00 0.00 0.00 3.20
336 337 5.771666 TGTCATTTGCCTCTCATTTTTCTCT 59.228 36.000 0.00 0.00 0.00 3.10
337 338 6.017400 TGTCATTTGCCTCTCATTTTTCTC 57.983 37.500 0.00 0.00 0.00 2.87
338 339 6.409524 TTGTCATTTGCCTCTCATTTTTCT 57.590 33.333 0.00 0.00 0.00 2.52
339 340 7.662604 ATTTGTCATTTGCCTCTCATTTTTC 57.337 32.000 0.00 0.00 0.00 2.29
340 341 9.729281 ATTATTTGTCATTTGCCTCTCATTTTT 57.271 25.926 0.00 0.00 0.00 1.94
341 342 9.158233 CATTATTTGTCATTTGCCTCTCATTTT 57.842 29.630 0.00 0.00 0.00 1.82
342 343 8.316214 ACATTATTTGTCATTTGCCTCTCATTT 58.684 29.630 0.00 0.00 30.89 2.32
343 344 7.844009 ACATTATTTGTCATTTGCCTCTCATT 58.156 30.769 0.00 0.00 30.89 2.57
344 345 7.414222 ACATTATTTGTCATTTGCCTCTCAT 57.586 32.000 0.00 0.00 30.89 2.90
345 346 6.839124 ACATTATTTGTCATTTGCCTCTCA 57.161 33.333 0.00 0.00 30.89 3.27
346 347 9.241317 CATTACATTATTTGTCATTTGCCTCTC 57.759 33.333 0.00 0.00 39.87 3.20
347 348 7.707893 GCATTACATTATTTGTCATTTGCCTCT 59.292 33.333 0.00 0.00 39.87 3.69
348 349 7.492020 TGCATTACATTATTTGTCATTTGCCTC 59.508 33.333 0.00 0.00 39.87 4.70
349 350 7.329499 TGCATTACATTATTTGTCATTTGCCT 58.671 30.769 0.00 0.00 39.87 4.75
350 351 7.536895 TGCATTACATTATTTGTCATTTGCC 57.463 32.000 0.00 0.00 39.87 4.52
351 352 8.871862 TCTTGCATTACATTATTTGTCATTTGC 58.128 29.630 0.00 0.00 39.87 3.68
355 356 9.961265 CATCTCTTGCATTACATTATTTGTCAT 57.039 29.630 0.00 0.00 39.87 3.06
356 357 9.176460 TCATCTCTTGCATTACATTATTTGTCA 57.824 29.630 0.00 0.00 39.87 3.58
357 358 9.661187 CTCATCTCTTGCATTACATTATTTGTC 57.339 33.333 0.00 0.00 39.87 3.18
358 359 9.399797 TCTCATCTCTTGCATTACATTATTTGT 57.600 29.630 0.00 0.00 42.62 2.83
359 360 9.880064 CTCTCATCTCTTGCATTACATTATTTG 57.120 33.333 0.00 0.00 0.00 2.32
360 361 9.624373 ACTCTCATCTCTTGCATTACATTATTT 57.376 29.630 0.00 0.00 0.00 1.40
361 362 9.624373 AACTCTCATCTCTTGCATTACATTATT 57.376 29.630 0.00 0.00 0.00 1.40
362 363 9.624373 AAACTCTCATCTCTTGCATTACATTAT 57.376 29.630 0.00 0.00 0.00 1.28
364 365 7.934855 AAACTCTCATCTCTTGCATTACATT 57.065 32.000 0.00 0.00 0.00 2.71
365 366 9.053840 CATAAACTCTCATCTCTTGCATTACAT 57.946 33.333 0.00 0.00 0.00 2.29
366 367 8.260114 TCATAAACTCTCATCTCTTGCATTACA 58.740 33.333 0.00 0.00 0.00 2.41
367 368 8.654230 TCATAAACTCTCATCTCTTGCATTAC 57.346 34.615 0.00 0.00 0.00 1.89
368 369 9.269453 CATCATAAACTCTCATCTCTTGCATTA 57.731 33.333 0.00 0.00 0.00 1.90
369 370 7.228906 CCATCATAAACTCTCATCTCTTGCATT 59.771 37.037 0.00 0.00 0.00 3.56
370 371 6.711194 CCATCATAAACTCTCATCTCTTGCAT 59.289 38.462 0.00 0.00 0.00 3.96
371 372 6.053650 CCATCATAAACTCTCATCTCTTGCA 58.946 40.000 0.00 0.00 0.00 4.08
372 373 5.469421 CCCATCATAAACTCTCATCTCTTGC 59.531 44.000 0.00 0.00 0.00 4.01
373 374 5.469421 GCCCATCATAAACTCTCATCTCTTG 59.531 44.000 0.00 0.00 0.00 3.02
374 375 5.131642 TGCCCATCATAAACTCTCATCTCTT 59.868 40.000 0.00 0.00 0.00 2.85
375 376 4.657504 TGCCCATCATAAACTCTCATCTCT 59.342 41.667 0.00 0.00 0.00 3.10
376 377 4.965814 TGCCCATCATAAACTCTCATCTC 58.034 43.478 0.00 0.00 0.00 2.75
377 378 4.657504 TCTGCCCATCATAAACTCTCATCT 59.342 41.667 0.00 0.00 0.00 2.90
378 379 4.965814 TCTGCCCATCATAAACTCTCATC 58.034 43.478 0.00 0.00 0.00 2.92
379 380 5.374921 CTTCTGCCCATCATAAACTCTCAT 58.625 41.667 0.00 0.00 0.00 2.90
380 381 4.384537 CCTTCTGCCCATCATAAACTCTCA 60.385 45.833 0.00 0.00 0.00 3.27
381 382 4.133078 CCTTCTGCCCATCATAAACTCTC 58.867 47.826 0.00 0.00 0.00 3.20
382 383 3.686691 GCCTTCTGCCCATCATAAACTCT 60.687 47.826 0.00 0.00 0.00 3.24
383 384 2.620585 GCCTTCTGCCCATCATAAACTC 59.379 50.000 0.00 0.00 0.00 3.01
384 385 2.025037 TGCCTTCTGCCCATCATAAACT 60.025 45.455 0.00 0.00 40.16 2.66
385 386 2.378038 TGCCTTCTGCCCATCATAAAC 58.622 47.619 0.00 0.00 40.16 2.01
386 387 2.824689 TGCCTTCTGCCCATCATAAA 57.175 45.000 0.00 0.00 40.16 1.40
387 388 2.658285 CTTGCCTTCTGCCCATCATAA 58.342 47.619 0.00 0.00 40.16 1.90
388 389 1.133699 CCTTGCCTTCTGCCCATCATA 60.134 52.381 0.00 0.00 40.16 2.15
389 390 0.396695 CCTTGCCTTCTGCCCATCAT 60.397 55.000 0.00 0.00 40.16 2.45
390 391 1.000521 CCTTGCCTTCTGCCCATCA 60.001 57.895 0.00 0.00 40.16 3.07
391 392 0.613012 AACCTTGCCTTCTGCCCATC 60.613 55.000 0.00 0.00 40.16 3.51
392 393 0.178924 AAACCTTGCCTTCTGCCCAT 60.179 50.000 0.00 0.00 40.16 4.00
393 394 0.827507 GAAACCTTGCCTTCTGCCCA 60.828 55.000 0.00 0.00 40.16 5.36
394 395 1.536073 GGAAACCTTGCCTTCTGCCC 61.536 60.000 0.00 0.00 40.16 5.36
395 396 1.866853 CGGAAACCTTGCCTTCTGCC 61.867 60.000 0.00 0.00 40.16 4.85
396 397 1.172812 ACGGAAACCTTGCCTTCTGC 61.173 55.000 0.00 0.00 41.77 4.26
397 398 1.266989 GAACGGAAACCTTGCCTTCTG 59.733 52.381 0.00 0.00 34.65 3.02
398 399 1.605753 GAACGGAAACCTTGCCTTCT 58.394 50.000 0.00 0.00 0.00 2.85
399 400 0.596577 GGAACGGAAACCTTGCCTTC 59.403 55.000 0.00 0.00 0.00 3.46
400 401 2.728397 GGAACGGAAACCTTGCCTT 58.272 52.632 0.00 0.00 0.00 4.35
401 402 4.494515 GGAACGGAAACCTTGCCT 57.505 55.556 0.00 0.00 0.00 4.75
422 423 4.151512 ACCTTTGTGTTTTTCAGCGTTTTG 59.848 37.500 0.00 0.00 0.00 2.44
501 503 1.442813 CGTTCGTTCGTTCGTTCGTTA 59.557 47.619 9.89 1.51 0.00 3.18
522 524 0.911053 TGCTGTGCCTGTGATATGGA 59.089 50.000 0.00 0.00 0.00 3.41
523 525 1.019673 GTGCTGTGCCTGTGATATGG 58.980 55.000 0.00 0.00 0.00 2.74
524 526 1.399440 GTGTGCTGTGCCTGTGATATG 59.601 52.381 0.00 0.00 0.00 1.78
525 527 1.742761 GTGTGCTGTGCCTGTGATAT 58.257 50.000 0.00 0.00 0.00 1.63
581 595 2.757124 CCGGGGAAGGAAGGATGGG 61.757 68.421 0.00 0.00 0.00 4.00
584 598 3.480133 CGCCGGGGAAGGAAGGAT 61.480 66.667 14.46 0.00 0.00 3.24
643 657 4.459089 GAGTGGAGCCGGTGAGCC 62.459 72.222 1.90 0.00 0.00 4.70
658 672 5.625251 CGAACTGATTTGATTTGAGTGGAG 58.375 41.667 0.00 0.00 0.00 3.86
659 673 4.083324 GCGAACTGATTTGATTTGAGTGGA 60.083 41.667 0.00 0.00 0.00 4.02
660 674 4.083110 AGCGAACTGATTTGATTTGAGTGG 60.083 41.667 0.00 0.00 0.00 4.00
661 675 5.039480 AGCGAACTGATTTGATTTGAGTG 57.961 39.130 0.00 0.00 0.00 3.51
662 676 4.756642 TGAGCGAACTGATTTGATTTGAGT 59.243 37.500 0.00 0.00 0.00 3.41
663 677 5.287170 TGAGCGAACTGATTTGATTTGAG 57.713 39.130 0.00 0.00 0.00 3.02
664 678 4.378770 GCTGAGCGAACTGATTTGATTTGA 60.379 41.667 0.00 0.00 0.00 2.69
665 679 3.850273 GCTGAGCGAACTGATTTGATTTG 59.150 43.478 0.00 0.00 0.00 2.32
666 680 3.755378 AGCTGAGCGAACTGATTTGATTT 59.245 39.130 0.00 0.00 0.00 2.17
667 681 3.341823 AGCTGAGCGAACTGATTTGATT 58.658 40.909 0.00 0.00 0.00 2.57
668 682 2.935201 GAGCTGAGCGAACTGATTTGAT 59.065 45.455 0.00 0.00 0.00 2.57
669 683 2.289010 TGAGCTGAGCGAACTGATTTGA 60.289 45.455 0.00 0.00 0.00 2.69
670 684 2.071540 TGAGCTGAGCGAACTGATTTG 58.928 47.619 0.00 0.00 0.00 2.32
671 685 2.344950 CTGAGCTGAGCGAACTGATTT 58.655 47.619 0.00 0.00 0.00 2.17
672 686 2.006056 GCTGAGCTGAGCGAACTGATT 61.006 52.381 10.09 0.00 0.00 2.57
673 687 0.459934 GCTGAGCTGAGCGAACTGAT 60.460 55.000 10.09 0.00 0.00 2.90
674 688 1.080230 GCTGAGCTGAGCGAACTGA 60.080 57.895 10.09 0.00 0.00 3.41
675 689 1.077645 GAGCTGAGCTGAGCGAACTG 61.078 60.000 19.78 0.62 44.24 3.16
676 690 1.215117 GAGCTGAGCTGAGCGAACT 59.785 57.895 19.78 1.36 44.24 3.01
677 691 1.077645 CTGAGCTGAGCTGAGCGAAC 61.078 60.000 19.78 14.88 44.24 3.95
678 692 1.214853 CTGAGCTGAGCTGAGCGAA 59.785 57.895 19.78 10.83 44.24 4.70
679 693 1.036481 ATCTGAGCTGAGCTGAGCGA 61.036 55.000 19.78 11.43 44.24 4.93
680 694 0.595567 GATCTGAGCTGAGCTGAGCG 60.596 60.000 19.78 5.86 44.24 5.03
681 695 0.460722 TGATCTGAGCTGAGCTGAGC 59.539 55.000 18.32 18.32 39.63 4.26
682 696 1.534385 CGTGATCTGAGCTGAGCTGAG 60.534 57.143 13.71 14.45 41.09 3.35
683 697 0.455005 CGTGATCTGAGCTGAGCTGA 59.545 55.000 13.71 0.99 39.88 4.26
684 698 0.173029 ACGTGATCTGAGCTGAGCTG 59.827 55.000 13.71 0.00 39.88 4.24
685 699 0.455410 GACGTGATCTGAGCTGAGCT 59.545 55.000 6.69 6.69 43.88 4.09
686 700 0.865218 CGACGTGATCTGAGCTGAGC 60.865 60.000 0.00 0.00 0.00 4.26
687 701 0.449786 ACGACGTGATCTGAGCTGAG 59.550 55.000 0.00 0.00 0.00 3.35
688 702 0.881796 AACGACGTGATCTGAGCTGA 59.118 50.000 0.00 0.00 0.00 4.26
689 703 1.702886 AAACGACGTGATCTGAGCTG 58.297 50.000 0.00 0.00 0.00 4.24
690 704 2.440539 AAAACGACGTGATCTGAGCT 57.559 45.000 0.00 0.00 0.00 4.09
705 719 0.239082 CAGGGGCGTTTCCGTAAAAC 59.761 55.000 1.61 1.61 43.22 2.43
712 726 1.475280 GTTTAATCCAGGGGCGTTTCC 59.525 52.381 0.00 0.00 0.00 3.13
768 782 2.037251 TGGGAAGGAGACGACAAGAAAG 59.963 50.000 0.00 0.00 0.00 2.62
769 783 2.043992 TGGGAAGGAGACGACAAGAAA 58.956 47.619 0.00 0.00 0.00 2.52
770 784 1.712056 TGGGAAGGAGACGACAAGAA 58.288 50.000 0.00 0.00 0.00 2.52
799 813 0.998945 AGGAGGAGGAGGAGGAGAGG 60.999 65.000 0.00 0.00 0.00 3.69
800 814 0.933700 AAGGAGGAGGAGGAGGAGAG 59.066 60.000 0.00 0.00 0.00 3.20
801 815 0.930726 GAAGGAGGAGGAGGAGGAGA 59.069 60.000 0.00 0.00 0.00 3.71
802 816 0.633921 TGAAGGAGGAGGAGGAGGAG 59.366 60.000 0.00 0.00 0.00 3.69
803 817 1.093408 TTGAAGGAGGAGGAGGAGGA 58.907 55.000 0.00 0.00 0.00 3.71
804 818 1.836802 CTTTGAAGGAGGAGGAGGAGG 59.163 57.143 0.00 0.00 0.00 4.30
805 819 2.499693 GTCTTTGAAGGAGGAGGAGGAG 59.500 54.545 0.00 0.00 0.00 3.69
806 820 2.541466 GTCTTTGAAGGAGGAGGAGGA 58.459 52.381 0.00 0.00 0.00 3.71
807 821 1.557371 GGTCTTTGAAGGAGGAGGAGG 59.443 57.143 0.00 0.00 0.00 4.30
808 822 1.557371 GGGTCTTTGAAGGAGGAGGAG 59.443 57.143 0.00 0.00 0.00 3.69
809 823 1.657804 GGGTCTTTGAAGGAGGAGGA 58.342 55.000 0.00 0.00 0.00 3.71
810 824 0.621082 GGGGTCTTTGAAGGAGGAGG 59.379 60.000 0.00 0.00 0.00 4.30
811 825 1.003696 GTGGGGTCTTTGAAGGAGGAG 59.996 57.143 0.00 0.00 0.00 3.69
812 826 1.064825 GTGGGGTCTTTGAAGGAGGA 58.935 55.000 0.00 0.00 0.00 3.71
889 909 2.903357 GATTGGAGCAGGGCGAGA 59.097 61.111 0.00 0.00 0.00 4.04
890 910 2.587194 CGATTGGAGCAGGGCGAG 60.587 66.667 0.00 0.00 0.00 5.03
891 911 4.161295 CCGATTGGAGCAGGGCGA 62.161 66.667 0.00 0.00 37.49 5.54
892 912 4.161295 TCCGATTGGAGCAGGGCG 62.161 66.667 0.00 0.00 40.17 6.13
923 943 2.358737 GAACACCACCAGCCGGAG 60.359 66.667 5.05 0.00 35.59 4.63
1182 1209 2.912025 AAGCTGTTGTTGGCCGGG 60.912 61.111 2.18 0.00 0.00 5.73
1315 1342 3.700350 CAGGGGAGAGGAGGGGGT 61.700 72.222 0.00 0.00 0.00 4.95
1318 1345 2.041928 AAGCAGGGGAGAGGAGGG 59.958 66.667 0.00 0.00 0.00 4.30
1320 1347 1.970352 GAGCAAGCAGGGGAGAGGAG 61.970 65.000 0.00 0.00 0.00 3.69
1321 1348 1.992277 GAGCAAGCAGGGGAGAGGA 60.992 63.158 0.00 0.00 0.00 3.71
1353 1380 5.046950 CGGTAATCCCCCAAGAAAATGAAAA 60.047 40.000 0.00 0.00 0.00 2.29
1360 1387 1.282738 GGTCGGTAATCCCCCAAGAAA 59.717 52.381 0.00 0.00 0.00 2.52
1369 1396 1.334243 CAGAGAGACGGTCGGTAATCC 59.666 57.143 1.89 0.00 0.00 3.01
1370 1397 1.268640 GCAGAGAGACGGTCGGTAATC 60.269 57.143 1.89 0.00 0.00 1.75
1371 1398 0.739561 GCAGAGAGACGGTCGGTAAT 59.260 55.000 1.89 0.00 0.00 1.89
1372 1399 1.310933 GGCAGAGAGACGGTCGGTAA 61.311 60.000 1.89 0.00 0.00 2.85
1373 1400 1.748122 GGCAGAGAGACGGTCGGTA 60.748 63.158 1.89 0.00 0.00 4.02
1374 1401 3.063084 GGCAGAGAGACGGTCGGT 61.063 66.667 1.89 0.00 0.00 4.69
1375 1402 3.062466 TGGCAGAGAGACGGTCGG 61.062 66.667 1.89 0.00 0.00 4.79
1376 1403 2.179517 GTGGCAGAGAGACGGTCG 59.820 66.667 1.89 0.00 0.00 4.79
1377 1404 2.574399 GGTGGCAGAGAGACGGTC 59.426 66.667 0.00 0.00 0.00 4.79
1378 1405 2.997897 GGGTGGCAGAGAGACGGT 60.998 66.667 0.00 0.00 0.00 4.83
1391 1418 2.789779 CGAATTTTAATCGCGGTGGGTG 60.790 50.000 6.13 0.00 33.07 4.61
1398 1425 2.817538 ACACCCGAATTTTAATCGCG 57.182 45.000 0.00 0.00 38.93 5.87
1402 1429 5.279758 CCCCAAGAAACACCCGAATTTTAAT 60.280 40.000 0.00 0.00 0.00 1.40
1420 1447 0.390860 CGGCTCTCATAGACCCCAAG 59.609 60.000 0.00 0.00 0.00 3.61
1438 1465 1.198408 CGGCCATGATCAATCAATCCG 59.802 52.381 2.24 12.93 40.69 4.18
1461 1509 2.566279 GGATCAGATCAGCTCAGGCATA 59.434 50.000 12.66 0.00 41.70 3.14
1493 1541 1.146358 CTAGAAACTACAGGCGGCGC 61.146 60.000 26.17 26.17 0.00 6.53
1497 1545 2.092211 CGCAAACTAGAAACTACAGGCG 59.908 50.000 0.00 0.00 34.66 5.52
1519 1567 2.894387 GTGGATCAGCAGAGCGGC 60.894 66.667 0.00 0.00 0.00 6.53
1520 1568 1.521010 CTGTGGATCAGCAGAGCGG 60.521 63.158 9.37 0.00 37.36 5.52
1521 1569 4.105727 CTGTGGATCAGCAGAGCG 57.894 61.111 9.37 0.00 37.36 5.03
1533 1581 1.081892 CGATCTGGTTCAAGCTGTGG 58.918 55.000 0.00 0.00 0.00 4.17
1534 1582 1.998315 CTCGATCTGGTTCAAGCTGTG 59.002 52.381 0.00 0.00 0.00 3.66
1538 1586 3.487574 CGTATTCTCGATCTGGTTCAAGC 59.512 47.826 0.00 0.00 0.00 4.01
1560 1608 5.591099 TGTTGAAGTCAAATCAAGAAAGCC 58.409 37.500 0.00 0.00 37.46 4.35
1567 1615 6.096141 TGCCTAAGTTGTTGAAGTCAAATCAA 59.904 34.615 0.00 0.00 37.63 2.57
1568 1616 5.592282 TGCCTAAGTTGTTGAAGTCAAATCA 59.408 36.000 0.00 0.00 37.63 2.57
1569 1617 6.072112 TGCCTAAGTTGTTGAAGTCAAATC 57.928 37.500 0.00 0.00 37.63 2.17
1570 1618 5.010012 CCTGCCTAAGTTGTTGAAGTCAAAT 59.990 40.000 0.00 0.00 37.63 2.32
1571 1619 4.338118 CCTGCCTAAGTTGTTGAAGTCAAA 59.662 41.667 0.00 0.00 37.63 2.69
1590 1638 3.498777 GTGAAAACCTGACTAACTCCTGC 59.501 47.826 0.00 0.00 0.00 4.85
1624 1674 9.315525 GTCCTCCTCTTATGTTGTTTATAAGTC 57.684 37.037 0.00 0.00 38.59 3.01
1625 1675 9.047947 AGTCCTCCTCTTATGTTGTTTATAAGT 57.952 33.333 0.00 0.00 38.59 2.24
1626 1676 9.892130 AAGTCCTCCTCTTATGTTGTTTATAAG 57.108 33.333 0.00 0.00 38.74 1.73
1627 1677 9.667107 CAAGTCCTCCTCTTATGTTGTTTATAA 57.333 33.333 0.00 0.00 0.00 0.98
1629 1679 7.690256 ACAAGTCCTCCTCTTATGTTGTTTAT 58.310 34.615 0.00 0.00 0.00 1.40
1654 1770 6.204688 CACAGAGCAACAGTAATAAACCTGAA 59.795 38.462 0.00 0.00 0.00 3.02
1673 1789 3.059120 CACTTGCTGTCACAATCACAGAG 60.059 47.826 4.00 0.00 43.54 3.35
1706 1822 3.492313 GTTCTTGCATAAGCTGGAAACG 58.508 45.455 0.00 0.00 42.74 3.60
1708 1824 3.407698 TCGTTCTTGCATAAGCTGGAAA 58.592 40.909 0.00 0.00 42.74 3.13
1728 1844 2.424601 TGCCAAGATATGCAAGCAACTC 59.575 45.455 0.00 0.00 33.87 3.01
1813 1929 3.343617 TCCAGTAAACTGCTGCAATACC 58.656 45.455 3.02 0.00 42.47 2.73
1869 1985 0.250553 TTTACTGGCAGGACGGGTTG 60.251 55.000 20.34 0.00 0.00 3.77
1872 1988 1.376812 GGTTTACTGGCAGGACGGG 60.377 63.158 20.34 0.00 0.00 5.28
1896 2012 9.095065 ACTGAGCTACTATGTTTTAATAAACCG 57.905 33.333 0.00 0.00 42.39 4.44
1903 2019 9.555727 AAACTCAACTGAGCTACTATGTTTTAA 57.444 29.630 6.63 0.00 45.79 1.52
1907 2023 7.897864 ACTAAACTCAACTGAGCTACTATGTT 58.102 34.615 6.63 0.00 45.79 2.71
1909 2025 8.651588 CAAACTAAACTCAACTGAGCTACTATG 58.348 37.037 6.63 0.00 45.79 2.23
1911 2027 7.723324 ACAAACTAAACTCAACTGAGCTACTA 58.277 34.615 6.63 0.00 45.79 1.82
1987 2179 5.701224 TCACAGAACAATTTTTAGAGGGGT 58.299 37.500 0.00 0.00 0.00 4.95
1990 2182 7.442364 TCACTCTCACAGAACAATTTTTAGAGG 59.558 37.037 0.00 0.00 33.80 3.69
2022 2214 0.387239 GAAACGAGCAACATGCCACC 60.387 55.000 0.00 0.00 46.52 4.61
2036 2228 3.165890 TCTTACACATACGCTCGAAACG 58.834 45.455 6.00 6.00 0.00 3.60
2091 2285 2.540383 TCCACTGCCTCAAGTACATCT 58.460 47.619 0.00 0.00 0.00 2.90
2095 2289 3.003480 GTGATTCCACTGCCTCAAGTAC 58.997 50.000 0.00 0.00 40.10 2.73
2105 2299 6.872547 CCACATAGATATCTGTGATTCCACTG 59.127 42.308 29.72 17.58 44.35 3.66
2117 2311 9.486123 ACTATATGCAAGACCACATAGATATCT 57.514 33.333 10.73 10.73 32.56 1.98
2125 2319 7.173907 GCTGAAATACTATATGCAAGACCACAT 59.826 37.037 0.00 0.00 0.00 3.21
2191 2385 2.351706 TTGGCAGGACGGTTTTAACT 57.648 45.000 0.00 0.00 0.00 2.24
2285 2480 0.508641 GTCAAGTACACACGCAGCAG 59.491 55.000 0.00 0.00 0.00 4.24
2320 2518 0.593128 AATCAAAGCACTGCACGGTC 59.407 50.000 3.30 0.00 0.00 4.79
2326 2524 1.670967 GGCCAAGAATCAAAGCACTGC 60.671 52.381 0.00 0.00 0.00 4.40
2340 2538 2.512515 GGCGCTACTCTGGCCAAG 60.513 66.667 7.01 10.13 46.13 3.61
2372 2570 2.426024 CAGGTGGCATTCAGGATCAAAG 59.574 50.000 0.00 0.00 0.00 2.77
2413 2611 4.083696 GGTTAAGATTCGAAAACGGCAGAA 60.084 41.667 0.00 0.00 0.00 3.02
2416 2614 3.139850 TGGTTAAGATTCGAAAACGGCA 58.860 40.909 0.00 0.00 0.00 5.69
2425 2623 5.066505 AGGCTAGCAATTTGGTTAAGATTCG 59.933 40.000 18.24 0.00 0.00 3.34
2447 2645 6.345096 AGGATTGTCCAAAATAACAACAGG 57.655 37.500 0.00 0.00 39.61 4.00
2472 2670 2.060383 CCTCATGACTGCCTCCCGA 61.060 63.158 0.00 0.00 0.00 5.14
2509 2707 6.138967 TCCAGAGATAGAATTCCATCACAGA 58.861 40.000 15.01 7.88 0.00 3.41
2518 2716 8.311109 GGAAGAGGTATTCCAGAGATAGAATTC 58.689 40.741 0.00 0.00 46.77 2.17
2553 2751 6.036191 CCGACTCCTTTCTATGTTCTTTAAGC 59.964 42.308 0.00 0.00 0.00 3.09
2620 2818 1.266989 AGCTTAAAACGAGCAACCTGC 59.733 47.619 0.00 0.00 45.46 4.85
2630 2828 7.795272 ACTTTGTTCGTACATAAGCTTAAAACG 59.205 33.333 22.52 22.52 33.44 3.60
2665 2863 7.959175 GACCTCAGTCTAAGAGAGTATCTAGA 58.041 42.308 0.00 0.00 42.80 2.43
2684 2882 0.328592 AGTGCCTCGAGTAGACCTCA 59.671 55.000 12.31 0.00 40.48 3.86
2711 2909 1.675116 CCAGAGCATGCAGATATCCGG 60.675 57.143 21.98 6.10 0.00 5.14
2712 2910 1.723220 CCAGAGCATGCAGATATCCG 58.277 55.000 21.98 0.00 0.00 4.18
2730 2928 3.721087 AGGGGTGCAATACTATATGCC 57.279 47.619 0.00 0.00 41.87 4.40
2746 2944 3.665443 TCCCTAGAATCCTGTAAAGGGG 58.335 50.000 0.00 0.00 43.32 4.79
2793 2991 1.211212 AGGGTTTATTGGTAGGACGGC 59.789 52.381 0.00 0.00 0.00 5.68
2830 3109 9.813080 GTCTACAAAATAAACTCAACTAAGCTG 57.187 33.333 0.00 0.00 0.00 4.24
2859 3138 3.192001 ACAGCTCACATGCCTAAACATTG 59.808 43.478 0.00 0.00 0.00 2.82
2860 3139 3.192001 CACAGCTCACATGCCTAAACATT 59.808 43.478 0.00 0.00 0.00 2.71
2861 3140 2.751259 CACAGCTCACATGCCTAAACAT 59.249 45.455 0.00 0.00 0.00 2.71
2862 3141 2.153645 CACAGCTCACATGCCTAAACA 58.846 47.619 0.00 0.00 0.00 2.83
2863 3142 1.135575 GCACAGCTCACATGCCTAAAC 60.136 52.381 0.00 0.00 33.06 2.01
2864 3143 1.167851 GCACAGCTCACATGCCTAAA 58.832 50.000 0.00 0.00 33.06 1.85
2865 3144 0.325933 AGCACAGCTCACATGCCTAA 59.674 50.000 0.00 0.00 40.33 2.69
2866 3145 0.392060 CAGCACAGCTCACATGCCTA 60.392 55.000 0.00 0.00 40.33 3.93
2867 3146 1.674651 CAGCACAGCTCACATGCCT 60.675 57.895 0.00 0.00 40.33 4.75
2868 3147 2.875485 CAGCACAGCTCACATGCC 59.125 61.111 0.00 0.00 40.33 4.40
2869 3148 2.137425 TTGCAGCACAGCTCACATGC 62.137 55.000 0.00 4.04 36.40 4.06
2870 3149 0.526211 ATTGCAGCACAGCTCACATG 59.474 50.000 0.00 0.00 36.40 3.21
2871 3150 1.067846 CAATTGCAGCACAGCTCACAT 60.068 47.619 0.00 0.00 36.40 3.21
2872 3151 0.312729 CAATTGCAGCACAGCTCACA 59.687 50.000 0.00 0.00 36.40 3.58
2873 3152 0.313043 ACAATTGCAGCACAGCTCAC 59.687 50.000 5.05 0.00 36.40 3.51
2874 3153 0.312729 CACAATTGCAGCACAGCTCA 59.687 50.000 5.05 0.00 36.40 4.26
2875 3154 0.313043 ACACAATTGCAGCACAGCTC 59.687 50.000 5.05 0.00 36.40 4.09
2876 3155 0.031585 CACACAATTGCAGCACAGCT 59.968 50.000 5.05 0.00 40.77 4.24
2877 3156 0.249155 ACACACAATTGCAGCACAGC 60.249 50.000 5.05 0.00 0.00 4.40
2878 3157 2.291465 AGTACACACAATTGCAGCACAG 59.709 45.455 5.05 0.00 0.00 3.66
2879 3158 2.296792 AGTACACACAATTGCAGCACA 58.703 42.857 5.05 0.00 0.00 4.57
2880 3159 3.745975 TCTAGTACACACAATTGCAGCAC 59.254 43.478 5.05 0.00 0.00 4.40
2881 3160 3.745975 GTCTAGTACACACAATTGCAGCA 59.254 43.478 5.05 0.00 0.00 4.41
2882 3161 3.125316 GGTCTAGTACACACAATTGCAGC 59.875 47.826 5.05 0.00 0.00 5.25
2883 3162 4.152402 GTGGTCTAGTACACACAATTGCAG 59.848 45.833 5.05 0.74 37.54 4.41
2884 3163 4.062293 GTGGTCTAGTACACACAATTGCA 58.938 43.478 5.05 0.00 37.54 4.08
2885 3164 4.315803 AGTGGTCTAGTACACACAATTGC 58.684 43.478 17.44 0.00 39.99 3.56
2886 3165 5.784177 AGAGTGGTCTAGTACACACAATTG 58.216 41.667 17.44 3.24 39.99 2.32
2887 3166 7.534723 TTAGAGTGGTCTAGTACACACAATT 57.465 36.000 17.44 1.78 39.99 2.32
2888 3167 7.534723 TTTAGAGTGGTCTAGTACACACAAT 57.465 36.000 17.44 6.67 39.99 2.71
2889 3168 6.964807 TTTAGAGTGGTCTAGTACACACAA 57.035 37.500 17.44 8.40 39.99 3.33
2890 3169 6.964807 TTTTAGAGTGGTCTAGTACACACA 57.035 37.500 17.44 4.11 39.99 3.72
2891 3170 8.828688 AATTTTTAGAGTGGTCTAGTACACAC 57.171 34.615 17.44 12.84 39.99 3.82
2892 3171 9.485206 GAAATTTTTAGAGTGGTCTAGTACACA 57.515 33.333 17.44 0.00 39.99 3.72
2893 3172 9.708092 AGAAATTTTTAGAGTGGTCTAGTACAC 57.292 33.333 10.30 10.30 36.61 2.90
2905 3184 9.929180 GGCCAGAAATAAAGAAATTTTTAGAGT 57.071 29.630 0.00 0.00 0.00 3.24
2906 3185 9.927668 TGGCCAGAAATAAAGAAATTTTTAGAG 57.072 29.630 0.00 0.00 0.00 2.43
2910 3189 8.849168 CCTTTGGCCAGAAATAAAGAAATTTTT 58.151 29.630 13.15 0.00 0.00 1.94
2911 3190 8.217111 TCCTTTGGCCAGAAATAAAGAAATTTT 58.783 29.630 13.15 0.00 0.00 1.82
2912 3191 7.744733 TCCTTTGGCCAGAAATAAAGAAATTT 58.255 30.769 13.15 0.00 0.00 1.82
2913 3192 7.315066 TCCTTTGGCCAGAAATAAAGAAATT 57.685 32.000 13.15 0.00 0.00 1.82
2914 3193 6.575056 GCTCCTTTGGCCAGAAATAAAGAAAT 60.575 38.462 13.15 0.00 0.00 2.17
2915 3194 5.279456 GCTCCTTTGGCCAGAAATAAAGAAA 60.279 40.000 13.15 0.00 0.00 2.52
2916 3195 4.220602 GCTCCTTTGGCCAGAAATAAAGAA 59.779 41.667 13.15 0.00 0.00 2.52
2917 3196 3.763897 GCTCCTTTGGCCAGAAATAAAGA 59.236 43.478 13.15 0.34 0.00 2.52
2918 3197 3.428045 CGCTCCTTTGGCCAGAAATAAAG 60.428 47.826 5.11 5.49 0.00 1.85
2919 3198 2.491693 CGCTCCTTTGGCCAGAAATAAA 59.508 45.455 5.11 0.00 0.00 1.40
2920 3199 2.091541 CGCTCCTTTGGCCAGAAATAA 58.908 47.619 5.11 0.00 0.00 1.40
2921 3200 1.750193 CGCTCCTTTGGCCAGAAATA 58.250 50.000 5.11 0.00 0.00 1.40
2922 3201 1.598701 GCGCTCCTTTGGCCAGAAAT 61.599 55.000 5.11 0.00 0.00 2.17
2923 3202 2.268076 GCGCTCCTTTGGCCAGAAA 61.268 57.895 5.11 0.00 0.00 2.52
2924 3203 2.672996 GCGCTCCTTTGGCCAGAA 60.673 61.111 5.11 2.70 0.00 3.02
2925 3204 4.722700 GGCGCTCCTTTGGCCAGA 62.723 66.667 5.11 0.00 46.13 3.86
2930 3209 4.697756 TCGGTGGCGCTCCTTTGG 62.698 66.667 7.64 0.00 0.00 3.28
2931 3210 3.423154 GTCGGTGGCGCTCCTTTG 61.423 66.667 7.64 0.00 0.00 2.77
2932 3211 4.699522 GGTCGGTGGCGCTCCTTT 62.700 66.667 7.64 0.00 0.00 3.11
2936 3215 4.699522 AAAGGGTCGGTGGCGCTC 62.700 66.667 7.64 0.23 0.00 5.03
2939 3218 2.046314 ATCAAAGGGTCGGTGGCG 60.046 61.111 0.00 0.00 0.00 5.69
2940 3219 1.749258 GGATCAAAGGGTCGGTGGC 60.749 63.158 0.00 0.00 0.00 5.01
2941 3220 0.392998 CAGGATCAAAGGGTCGGTGG 60.393 60.000 0.00 0.00 0.00 4.61
2942 3221 0.613260 TCAGGATCAAAGGGTCGGTG 59.387 55.000 0.00 0.00 0.00 4.94
2943 3222 1.358152 TTCAGGATCAAAGGGTCGGT 58.642 50.000 0.00 0.00 0.00 4.69
2944 3223 2.292267 CATTCAGGATCAAAGGGTCGG 58.708 52.381 0.00 0.00 0.00 4.79
2945 3224 1.672881 GCATTCAGGATCAAAGGGTCG 59.327 52.381 0.00 0.00 0.00 4.79
2946 3225 2.027385 GGCATTCAGGATCAAAGGGTC 58.973 52.381 0.00 0.00 0.00 4.46
2947 3226 1.358787 TGGCATTCAGGATCAAAGGGT 59.641 47.619 0.00 0.00 0.00 4.34
2948 3227 1.753073 GTGGCATTCAGGATCAAAGGG 59.247 52.381 0.00 0.00 0.00 3.95
2949 3228 1.753073 GGTGGCATTCAGGATCAAAGG 59.247 52.381 0.00 0.00 0.00 3.11
2950 3229 2.426024 CAGGTGGCATTCAGGATCAAAG 59.574 50.000 0.00 0.00 0.00 2.77
2951 3230 2.449464 CAGGTGGCATTCAGGATCAAA 58.551 47.619 0.00 0.00 0.00 2.69
2952 3231 1.956636 GCAGGTGGCATTCAGGATCAA 60.957 52.381 0.00 0.00 43.97 2.57
2953 3232 0.394762 GCAGGTGGCATTCAGGATCA 60.395 55.000 0.00 0.00 43.97 2.92
2954 3233 2.412605 GCAGGTGGCATTCAGGATC 58.587 57.895 0.00 0.00 43.97 3.36
2955 3234 4.672251 GCAGGTGGCATTCAGGAT 57.328 55.556 0.00 0.00 43.97 3.24
2971 3250 1.227999 TACACAGAAACTGCGGCAGC 61.228 55.000 28.80 13.50 45.41 5.25
2972 3251 0.512952 GTACACAGAAACTGCGGCAG 59.487 55.000 27.43 27.43 34.37 4.85
2973 3252 1.218875 CGTACACAGAAACTGCGGCA 61.219 55.000 1.29 1.29 34.37 5.69
2974 3253 1.491563 CGTACACAGAAACTGCGGC 59.508 57.895 0.00 0.00 34.37 6.53
2975 3254 1.218875 TGCGTACACAGAAACTGCGG 61.219 55.000 0.00 0.00 34.37 5.69
2976 3255 0.161658 CTGCGTACACAGAAACTGCG 59.838 55.000 4.85 0.00 40.25 5.18
2977 3256 0.110644 GCTGCGTACACAGAAACTGC 60.111 55.000 15.03 0.00 40.25 4.40
2978 3257 0.512952 GGCTGCGTACACAGAAACTG 59.487 55.000 15.03 0.00 40.25 3.16
2979 3258 0.944311 CGGCTGCGTACACAGAAACT 60.944 55.000 15.03 0.00 40.25 2.66
2980 3259 1.219522 ACGGCTGCGTACACAGAAAC 61.220 55.000 15.03 3.29 40.25 2.78
2981 3260 0.531090 AACGGCTGCGTACACAGAAA 60.531 50.000 15.03 0.00 40.25 2.52
2982 3261 0.531090 AAACGGCTGCGTACACAGAA 60.531 50.000 15.03 0.00 40.25 3.02
2983 3262 0.531090 AAAACGGCTGCGTACACAGA 60.531 50.000 15.03 0.00 40.25 3.41
2984 3263 0.110823 GAAAACGGCTGCGTACACAG 60.111 55.000 6.52 6.52 40.80 3.66
2985 3264 0.810426 TGAAAACGGCTGCGTACACA 60.810 50.000 0.00 0.00 0.00 3.72
2986 3265 0.305313 TTGAAAACGGCTGCGTACAC 59.695 50.000 0.00 0.00 0.00 2.90
2987 3266 1.015109 TTTGAAAACGGCTGCGTACA 58.985 45.000 0.00 0.00 0.00 2.90
2988 3267 1.391787 GTTTGAAAACGGCTGCGTAC 58.608 50.000 0.00 0.00 0.00 3.67
2989 3268 0.308376 GGTTTGAAAACGGCTGCGTA 59.692 50.000 0.00 0.00 39.77 4.42
2990 3269 1.065109 GGTTTGAAAACGGCTGCGT 59.935 52.632 0.00 0.00 39.77 5.24
2991 3270 0.660300 GAGGTTTGAAAACGGCTGCG 60.660 55.000 0.00 0.00 39.77 5.18
2992 3271 0.383949 TGAGGTTTGAAAACGGCTGC 59.616 50.000 0.00 0.00 39.77 5.25
2993 3272 2.099098 AGTTGAGGTTTGAAAACGGCTG 59.901 45.455 0.00 0.00 39.77 4.85
2994 3273 2.375146 AGTTGAGGTTTGAAAACGGCT 58.625 42.857 0.11 0.00 39.77 5.52
2995 3274 2.863401 AGTTGAGGTTTGAAAACGGC 57.137 45.000 0.11 0.00 39.77 5.68
2996 3275 6.292114 GCAATTTAGTTGAGGTTTGAAAACGG 60.292 38.462 0.11 0.00 40.37 4.44
2997 3276 6.475402 AGCAATTTAGTTGAGGTTTGAAAACG 59.525 34.615 0.11 0.00 40.37 3.60
2998 3277 7.770801 AGCAATTTAGTTGAGGTTTGAAAAC 57.229 32.000 0.00 0.00 40.37 2.43
2999 3278 8.691797 ACTAGCAATTTAGTTGAGGTTTGAAAA 58.308 29.630 0.00 0.00 40.37 2.29
3000 3279 8.232913 ACTAGCAATTTAGTTGAGGTTTGAAA 57.767 30.769 0.00 0.00 40.37 2.69
3001 3280 7.719633 AGACTAGCAATTTAGTTGAGGTTTGAA 59.280 33.333 0.00 0.00 40.37 2.69
3002 3281 7.224297 AGACTAGCAATTTAGTTGAGGTTTGA 58.776 34.615 0.00 0.00 40.37 2.69
3003 3282 7.440523 AGACTAGCAATTTAGTTGAGGTTTG 57.559 36.000 0.00 0.00 40.37 2.93
3004 3283 9.740710 AATAGACTAGCAATTTAGTTGAGGTTT 57.259 29.630 0.00 0.00 40.37 3.27
3005 3284 9.167311 CAATAGACTAGCAATTTAGTTGAGGTT 57.833 33.333 0.00 0.00 40.37 3.50
3006 3285 7.281100 GCAATAGACTAGCAATTTAGTTGAGGT 59.719 37.037 0.00 0.00 40.37 3.85
3007 3286 7.517417 CGCAATAGACTAGCAATTTAGTTGAGG 60.517 40.741 0.00 0.00 40.37 3.86
3008 3287 7.340699 CGCAATAGACTAGCAATTTAGTTGAG 58.659 38.462 0.00 0.00 40.37 3.02
3009 3288 6.257849 CCGCAATAGACTAGCAATTTAGTTGA 59.742 38.462 0.00 0.00 40.37 3.18
3010 3289 6.422223 CCGCAATAGACTAGCAATTTAGTTG 58.578 40.000 0.00 0.00 40.90 3.16
3011 3290 5.527582 CCCGCAATAGACTAGCAATTTAGTT 59.472 40.000 0.00 0.00 34.13 2.24
3012 3291 5.057149 CCCGCAATAGACTAGCAATTTAGT 58.943 41.667 0.00 0.00 36.61 2.24
3013 3292 5.057149 ACCCGCAATAGACTAGCAATTTAG 58.943 41.667 0.00 0.00 0.00 1.85
3014 3293 5.031066 ACCCGCAATAGACTAGCAATTTA 57.969 39.130 0.00 0.00 0.00 1.40
3015 3294 3.886123 ACCCGCAATAGACTAGCAATTT 58.114 40.909 0.00 0.00 0.00 1.82
3016 3295 3.560636 ACCCGCAATAGACTAGCAATT 57.439 42.857 0.00 0.00 0.00 2.32
3017 3296 3.560636 AACCCGCAATAGACTAGCAAT 57.439 42.857 0.00 0.00 0.00 3.56
3018 3297 3.006940 CAAACCCGCAATAGACTAGCAA 58.993 45.455 0.00 0.00 0.00 3.91
3019 3298 2.627945 CAAACCCGCAATAGACTAGCA 58.372 47.619 0.00 0.00 0.00 3.49
3020 3299 1.940613 CCAAACCCGCAATAGACTAGC 59.059 52.381 0.00 0.00 0.00 3.42
3021 3300 3.195661 GTCCAAACCCGCAATAGACTAG 58.804 50.000 0.00 0.00 0.00 2.57
3022 3301 2.568062 TGTCCAAACCCGCAATAGACTA 59.432 45.455 0.00 0.00 0.00 2.59
3023 3302 1.349688 TGTCCAAACCCGCAATAGACT 59.650 47.619 0.00 0.00 0.00 3.24
3024 3303 1.816074 TGTCCAAACCCGCAATAGAC 58.184 50.000 0.00 0.00 0.00 2.59
3025 3304 2.570415 TTGTCCAAACCCGCAATAGA 57.430 45.000 0.00 0.00 0.00 1.98
3026 3305 2.671070 GCTTTGTCCAAACCCGCAATAG 60.671 50.000 0.00 0.00 0.00 1.73
3027 3306 1.271102 GCTTTGTCCAAACCCGCAATA 59.729 47.619 0.00 0.00 0.00 1.90
3028 3307 0.033366 GCTTTGTCCAAACCCGCAAT 59.967 50.000 0.00 0.00 0.00 3.56
3029 3308 1.439644 GCTTTGTCCAAACCCGCAA 59.560 52.632 0.00 0.00 0.00 4.85
3030 3309 2.494530 GGCTTTGTCCAAACCCGCA 61.495 57.895 5.28 0.00 0.00 5.69
3031 3310 0.891904 TAGGCTTTGTCCAAACCCGC 60.892 55.000 0.00 0.00 32.61 6.13
3032 3311 0.879090 GTAGGCTTTGTCCAAACCCG 59.121 55.000 0.00 0.00 32.61 5.28
3033 3312 1.203013 AGGTAGGCTTTGTCCAAACCC 60.203 52.381 0.00 0.00 35.94 4.11
3034 3313 2.160205 GAGGTAGGCTTTGTCCAAACC 58.840 52.381 0.00 0.00 35.70 3.27
3035 3314 2.160205 GGAGGTAGGCTTTGTCCAAAC 58.840 52.381 0.00 0.00 0.00 2.93
3036 3315 1.074889 GGGAGGTAGGCTTTGTCCAAA 59.925 52.381 0.00 0.00 0.00 3.28
3037 3316 0.696501 GGGAGGTAGGCTTTGTCCAA 59.303 55.000 0.00 0.00 0.00 3.53
3038 3317 1.550130 CGGGAGGTAGGCTTTGTCCA 61.550 60.000 0.00 0.00 0.00 4.02
3039 3318 1.221021 CGGGAGGTAGGCTTTGTCC 59.779 63.158 0.00 0.00 0.00 4.02
3040 3319 4.934989 CGGGAGGTAGGCTTTGTC 57.065 61.111 0.00 0.00 0.00 3.18
3054 3333 2.266055 GTCTTCCTGACTGCCGGG 59.734 66.667 2.18 0.00 42.21 5.73
3055 3334 2.266055 GGTCTTCCTGACTGCCGG 59.734 66.667 0.00 0.00 44.74 6.13
3056 3335 1.079543 CTGGTCTTCCTGACTGCCG 60.080 63.158 0.00 0.00 44.74 5.69
3057 3336 1.298014 CCTGGTCTTCCTGACTGCC 59.702 63.158 0.00 0.00 44.74 4.85
3058 3337 1.205893 CTACCTGGTCTTCCTGACTGC 59.794 57.143 0.63 0.00 44.74 4.40
3059 3338 2.232452 CACTACCTGGTCTTCCTGACTG 59.768 54.545 0.63 0.00 44.74 3.51
3060 3339 2.530701 CACTACCTGGTCTTCCTGACT 58.469 52.381 0.63 0.00 44.74 3.41
3061 3340 1.066787 GCACTACCTGGTCTTCCTGAC 60.067 57.143 0.63 0.00 44.63 3.51
3062 3341 1.267121 GCACTACCTGGTCTTCCTGA 58.733 55.000 0.63 0.00 35.11 3.86
3063 3342 0.976641 TGCACTACCTGGTCTTCCTG 59.023 55.000 0.63 0.00 34.23 3.86
3064 3343 1.270907 CTGCACTACCTGGTCTTCCT 58.729 55.000 0.63 0.00 34.23 3.36
3065 3344 0.250513 CCTGCACTACCTGGTCTTCC 59.749 60.000 0.63 0.00 0.00 3.46
3066 3345 0.250513 CCCTGCACTACCTGGTCTTC 59.749 60.000 0.63 0.00 0.00 2.87
3067 3346 0.473886 ACCCTGCACTACCTGGTCTT 60.474 55.000 0.63 0.00 0.00 3.01
3068 3347 0.905337 GACCCTGCACTACCTGGTCT 60.905 60.000 0.63 0.00 41.77 3.85
3069 3348 1.192146 TGACCCTGCACTACCTGGTC 61.192 60.000 0.63 0.00 44.57 4.02
3070 3349 1.152118 TGACCCTGCACTACCTGGT 60.152 57.895 4.05 4.05 0.00 4.00
3071 3350 1.194781 AGTGACCCTGCACTACCTGG 61.195 60.000 0.00 0.00 46.67 4.45
3072 3351 0.036952 CAGTGACCCTGCACTACCTG 60.037 60.000 0.00 0.00 46.80 4.00
3073 3352 0.471971 ACAGTGACCCTGCACTACCT 60.472 55.000 0.00 0.00 46.80 3.08
3074 3353 0.320771 CACAGTGACCCTGCACTACC 60.321 60.000 0.00 0.00 46.80 3.18
3075 3354 0.679505 TCACAGTGACCCTGCACTAC 59.320 55.000 0.00 0.00 46.80 2.73
3076 3355 1.276138 CATCACAGTGACCCTGCACTA 59.724 52.381 5.05 0.00 46.80 2.74
3078 3357 0.035317 TCATCACAGTGACCCTGCAC 59.965 55.000 5.05 0.00 45.68 4.57
3079 3358 0.764271 TTCATCACAGTGACCCTGCA 59.236 50.000 5.05 0.00 45.68 4.41
3080 3359 2.119801 ATTCATCACAGTGACCCTGC 57.880 50.000 5.05 0.00 45.68 4.85
3082 3361 5.664908 AGATAGAATTCATCACAGTGACCCT 59.335 40.000 5.05 0.04 0.00 4.34
3083 3362 5.923204 AGATAGAATTCATCACAGTGACCC 58.077 41.667 5.05 0.00 0.00 4.46
3084 3363 6.700960 CAGAGATAGAATTCATCACAGTGACC 59.299 42.308 5.05 0.00 0.00 4.02
3085 3364 6.700960 CCAGAGATAGAATTCATCACAGTGAC 59.299 42.308 5.05 0.00 0.00 3.67
3086 3365 6.608808 TCCAGAGATAGAATTCATCACAGTGA 59.391 38.462 5.50 5.50 0.00 3.41
3087 3366 6.814043 TCCAGAGATAGAATTCATCACAGTG 58.186 40.000 8.44 0.00 0.00 3.66
3088 3367 7.429374 TTCCAGAGATAGAATTCATCACAGT 57.571 36.000 8.44 0.00 0.00 3.55
3089 3368 9.421806 GTATTCCAGAGATAGAATTCATCACAG 57.578 37.037 8.44 4.92 0.00 3.66
3090 3369 9.152327 AGTATTCCAGAGATAGAATTCATCACA 57.848 33.333 8.44 0.00 0.00 3.58
3091 3370 9.421806 CAGTATTCCAGAGATAGAATTCATCAC 57.578 37.037 8.44 7.52 0.00 3.06
3092 3371 8.093307 GCAGTATTCCAGAGATAGAATTCATCA 58.907 37.037 8.44 0.00 0.00 3.07
3093 3372 8.313292 AGCAGTATTCCAGAGATAGAATTCATC 58.687 37.037 8.44 8.69 0.00 2.92
3094 3373 8.204903 AGCAGTATTCCAGAGATAGAATTCAT 57.795 34.615 8.44 0.00 0.00 2.57
3095 3374 7.609097 AGCAGTATTCCAGAGATAGAATTCA 57.391 36.000 8.44 0.00 0.00 2.57
3096 3375 8.900983 AAAGCAGTATTCCAGAGATAGAATTC 57.099 34.615 0.00 0.00 0.00 2.17
3097 3376 8.713036 AGAAAGCAGTATTCCAGAGATAGAATT 58.287 33.333 0.00 0.00 0.00 2.17
3098 3377 8.261349 AGAAAGCAGTATTCCAGAGATAGAAT 57.739 34.615 0.00 0.00 0.00 2.40
3099 3378 7.667575 AGAAAGCAGTATTCCAGAGATAGAA 57.332 36.000 0.00 0.00 0.00 2.10
3100 3379 7.667575 AAGAAAGCAGTATTCCAGAGATAGA 57.332 36.000 0.00 0.00 0.00 1.98
3130 3409 9.921637 CTGACTCTTCTCTATGTTCTTTAAGTT 57.078 33.333 0.00 0.00 0.00 2.66
3131 3410 9.084533 ACTGACTCTTCTCTATGTTCTTTAAGT 57.915 33.333 0.00 0.00 0.00 2.24
3132 3411 9.567848 GACTGACTCTTCTCTATGTTCTTTAAG 57.432 37.037 0.00 0.00 0.00 1.85
3133 3412 9.078990 TGACTGACTCTTCTCTATGTTCTTTAA 57.921 33.333 0.00 0.00 0.00 1.52
3134 3413 8.637196 TGACTGACTCTTCTCTATGTTCTTTA 57.363 34.615 0.00 0.00 0.00 1.85
3135 3414 7.450014 TCTGACTGACTCTTCTCTATGTTCTTT 59.550 37.037 0.00 0.00 0.00 2.52
3136 3415 6.945435 TCTGACTGACTCTTCTCTATGTTCTT 59.055 38.462 0.00 0.00 0.00 2.52
3137 3416 6.480763 TCTGACTGACTCTTCTCTATGTTCT 58.519 40.000 0.00 0.00 0.00 3.01
3138 3417 6.751514 TCTGACTGACTCTTCTCTATGTTC 57.248 41.667 0.00 0.00 0.00 3.18
3139 3418 7.716799 AATCTGACTGACTCTTCTCTATGTT 57.283 36.000 0.00 0.00 0.00 2.71
3140 3419 7.716799 AAATCTGACTGACTCTTCTCTATGT 57.283 36.000 0.00 0.00 0.00 2.29
3144 3423 9.474313 AGTATTAAATCTGACTGACTCTTCTCT 57.526 33.333 0.00 0.00 0.00 3.10
3145 3424 9.730420 GAGTATTAAATCTGACTGACTCTTCTC 57.270 37.037 0.00 0.00 31.47 2.87
3146 3425 9.474313 AGAGTATTAAATCTGACTGACTCTTCT 57.526 33.333 0.00 0.00 39.41 2.85
3147 3426 9.515020 CAGAGTATTAAATCTGACTGACTCTTC 57.485 37.037 9.09 0.00 44.68 2.87
3148 3427 9.030452 ACAGAGTATTAAATCTGACTGACTCTT 57.970 33.333 17.68 0.00 44.68 2.85
3149 3428 8.588290 ACAGAGTATTAAATCTGACTGACTCT 57.412 34.615 17.68 0.00 44.68 3.24
3150 3429 8.462811 TGACAGAGTATTAAATCTGACTGACTC 58.537 37.037 17.68 8.00 44.68 3.36
3151 3430 8.354711 TGACAGAGTATTAAATCTGACTGACT 57.645 34.615 17.68 0.54 44.68 3.41
3152 3431 9.029243 CATGACAGAGTATTAAATCTGACTGAC 57.971 37.037 17.68 7.87 44.68 3.51
3153 3432 8.753133 ACATGACAGAGTATTAAATCTGACTGA 58.247 33.333 17.68 3.25 44.68 3.41
3154 3433 8.815189 CACATGACAGAGTATTAAATCTGACTG 58.185 37.037 17.68 13.84 44.68 3.51
3155 3434 8.753133 TCACATGACAGAGTATTAAATCTGACT 58.247 33.333 17.68 1.26 44.68 3.41
3156 3435 8.932945 TCACATGACAGAGTATTAAATCTGAC 57.067 34.615 17.68 13.47 44.68 3.51
3157 3436 8.753133 ACTCACATGACAGAGTATTAAATCTGA 58.247 33.333 17.68 2.64 44.68 3.27
3158 3437 8.815189 CACTCACATGACAGAGTATTAAATCTG 58.185 37.037 15.90 11.92 46.76 2.90
3159 3438 8.535335 ACACTCACATGACAGAGTATTAAATCT 58.465 33.333 15.90 0.00 42.87 2.40
3160 3439 8.598924 CACACTCACATGACAGAGTATTAAATC 58.401 37.037 15.90 0.00 42.87 2.17
3161 3440 8.314021 TCACACTCACATGACAGAGTATTAAAT 58.686 33.333 15.90 0.00 42.87 1.40
3162 3441 7.598869 GTCACACTCACATGACAGAGTATTAAA 59.401 37.037 15.90 3.37 42.87 1.52
3163 3442 7.090808 GTCACACTCACATGACAGAGTATTAA 58.909 38.462 15.90 4.60 42.87 1.40
3164 3443 6.621613 GTCACACTCACATGACAGAGTATTA 58.378 40.000 15.90 5.84 42.87 0.98
3165 3444 5.473931 GTCACACTCACATGACAGAGTATT 58.526 41.667 15.90 7.24 42.87 1.89
3166 3445 5.065704 GTCACACTCACATGACAGAGTAT 57.934 43.478 15.90 6.37 42.87 2.12
3167 3446 4.505313 GTCACACTCACATGACAGAGTA 57.495 45.455 15.90 3.47 42.87 2.59
3168 3447 3.377346 GTCACACTCACATGACAGAGT 57.623 47.619 0.00 7.05 45.46 3.24
3173 3452 1.869774 TGCTGTCACACTCACATGAC 58.130 50.000 0.00 0.00 44.56 3.06
3174 3453 2.158914 ACTTGCTGTCACACTCACATGA 60.159 45.455 0.00 0.00 0.00 3.07
3175 3454 2.032290 CACTTGCTGTCACACTCACATG 60.032 50.000 0.00 0.00 0.00 3.21
3176 3455 2.158914 TCACTTGCTGTCACACTCACAT 60.159 45.455 0.00 0.00 0.00 3.21
3177 3456 1.206849 TCACTTGCTGTCACACTCACA 59.793 47.619 0.00 0.00 0.00 3.58
3178 3457 1.939974 TCACTTGCTGTCACACTCAC 58.060 50.000 0.00 0.00 0.00 3.51
3179 3458 2.689553 TTCACTTGCTGTCACACTCA 57.310 45.000 0.00 0.00 0.00 3.41
3180 3459 2.289002 CCTTTCACTTGCTGTCACACTC 59.711 50.000 0.00 0.00 0.00 3.51
3181 3460 2.292267 CCTTTCACTTGCTGTCACACT 58.708 47.619 0.00 0.00 0.00 3.55
3182 3461 2.017049 ACCTTTCACTTGCTGTCACAC 58.983 47.619 0.00 0.00 0.00 3.82
3183 3462 2.418368 ACCTTTCACTTGCTGTCACA 57.582 45.000 0.00 0.00 0.00 3.58
3184 3463 2.796032 GCAACCTTTCACTTGCTGTCAC 60.796 50.000 0.00 0.00 39.79 3.67
3185 3464 1.405105 GCAACCTTTCACTTGCTGTCA 59.595 47.619 0.00 0.00 39.79 3.58
3186 3465 1.269257 GGCAACCTTTCACTTGCTGTC 60.269 52.381 2.66 0.00 42.11 3.51
3187 3466 0.746659 GGCAACCTTTCACTTGCTGT 59.253 50.000 2.66 0.00 42.11 4.40
3188 3467 1.035139 AGGCAACCTTTCACTTGCTG 58.965 50.000 2.66 0.00 42.11 4.41
3189 3468 1.035139 CAGGCAACCTTTCACTTGCT 58.965 50.000 2.66 0.00 42.11 3.91
3190 3469 0.746659 ACAGGCAACCTTTCACTTGC 59.253 50.000 0.00 0.00 41.79 4.01
3191 3470 3.119173 TGAAACAGGCAACCTTTCACTTG 60.119 43.478 0.00 0.00 38.30 3.16
3192 3471 3.096092 TGAAACAGGCAACCTTTCACTT 58.904 40.909 0.00 0.00 38.30 3.16
3193 3472 2.689983 CTGAAACAGGCAACCTTTCACT 59.310 45.455 0.00 0.00 38.30 3.41
3194 3473 2.223805 CCTGAAACAGGCAACCTTTCAC 60.224 50.000 4.84 0.00 45.13 3.18
3195 3474 2.031120 CCTGAAACAGGCAACCTTTCA 58.969 47.619 4.84 1.84 45.13 2.69
3196 3475 2.800881 CCTGAAACAGGCAACCTTTC 57.199 50.000 4.84 0.00 45.13 2.62
3234 3513 9.727627 CCTCTGTCTAAGAAATGCATTTTATTC 57.272 33.333 24.81 12.87 33.37 1.75
3235 3514 9.247861 ACCTCTGTCTAAGAAATGCATTTTATT 57.752 29.630 24.81 22.30 33.37 1.40
3236 3515 8.814038 ACCTCTGTCTAAGAAATGCATTTTAT 57.186 30.769 24.81 18.20 33.37 1.40
3237 3516 8.268850 GACCTCTGTCTAAGAAATGCATTTTA 57.731 34.615 24.81 13.62 38.53 1.52
3238 3517 7.150783 GACCTCTGTCTAAGAAATGCATTTT 57.849 36.000 24.81 13.20 38.53 1.82
3239 3518 6.749923 GACCTCTGTCTAAGAAATGCATTT 57.250 37.500 24.33 24.33 38.53 2.32
3251 3530 9.858384 TGAGTGCATCAAGTAGACCTCTGTCTA 62.858 44.444 0.00 0.00 41.85 2.59
3253 3532 3.194542 AGTGCATCAAGTAGACCTCTGTC 59.805 47.826 0.00 0.00 42.09 3.51
3254 3533 3.169099 AGTGCATCAAGTAGACCTCTGT 58.831 45.455 0.00 0.00 0.00 3.41
3255 3534 3.194329 TGAGTGCATCAAGTAGACCTCTG 59.806 47.826 0.00 0.00 34.02 3.35
3256 3535 3.435275 TGAGTGCATCAAGTAGACCTCT 58.565 45.455 0.00 0.00 34.02 3.69
3257 3536 3.876274 TGAGTGCATCAAGTAGACCTC 57.124 47.619 0.00 0.00 34.02 3.85
3266 3545 7.307573 CGCAGATCTATAATTTGAGTGCATCAA 60.308 37.037 0.00 7.27 46.31 2.57
3267 3546 6.146673 CGCAGATCTATAATTTGAGTGCATCA 59.853 38.462 0.00 0.00 35.62 3.07
3268 3547 6.146837 ACGCAGATCTATAATTTGAGTGCATC 59.853 38.462 0.00 0.00 0.00 3.91
3269 3548 5.994054 ACGCAGATCTATAATTTGAGTGCAT 59.006 36.000 0.00 0.00 0.00 3.96
3270 3549 5.359756 ACGCAGATCTATAATTTGAGTGCA 58.640 37.500 0.00 0.00 0.00 4.57
3271 3550 5.914085 ACGCAGATCTATAATTTGAGTGC 57.086 39.130 0.00 0.00 0.00 4.40
3272 3551 7.223582 AGACAACGCAGATCTATAATTTGAGTG 59.776 37.037 0.00 0.00 0.00 3.51
3273 3552 7.268586 AGACAACGCAGATCTATAATTTGAGT 58.731 34.615 0.00 0.00 0.00 3.41
3274 3553 7.706281 AGACAACGCAGATCTATAATTTGAG 57.294 36.000 0.00 0.00 0.00 3.02
3275 3554 7.465916 GCAAGACAACGCAGATCTATAATTTGA 60.466 37.037 0.00 0.00 0.00 2.69
3276 3555 6.630443 GCAAGACAACGCAGATCTATAATTTG 59.370 38.462 0.00 0.00 0.00 2.32
3277 3556 6.316140 TGCAAGACAACGCAGATCTATAATTT 59.684 34.615 0.00 0.00 33.34 1.82
3278 3557 5.817296 TGCAAGACAACGCAGATCTATAATT 59.183 36.000 0.00 0.00 33.34 1.40
3279 3558 5.359756 TGCAAGACAACGCAGATCTATAAT 58.640 37.500 0.00 0.00 33.34 1.28
3280 3559 4.754322 TGCAAGACAACGCAGATCTATAA 58.246 39.130 0.00 0.00 33.34 0.98
3281 3560 4.385358 TGCAAGACAACGCAGATCTATA 57.615 40.909 0.00 0.00 33.34 1.31
3282 3561 3.251479 TGCAAGACAACGCAGATCTAT 57.749 42.857 0.00 0.00 33.34 1.98
3283 3562 2.741759 TGCAAGACAACGCAGATCTA 57.258 45.000 0.00 0.00 33.34 1.98
3284 3563 2.105006 ATGCAAGACAACGCAGATCT 57.895 45.000 0.00 0.00 42.37 2.75
3285 3564 4.747108 ACTATATGCAAGACAACGCAGATC 59.253 41.667 0.00 0.00 42.37 2.75
3286 3565 4.697514 ACTATATGCAAGACAACGCAGAT 58.302 39.130 0.00 0.00 42.37 2.90
3287 3566 4.123497 ACTATATGCAAGACAACGCAGA 57.877 40.909 0.00 0.00 42.37 4.26
3288 3567 6.357980 CAATACTATATGCAAGACAACGCAG 58.642 40.000 0.00 0.00 42.37 5.18
3289 3568 5.277297 GCAATACTATATGCAAGACAACGCA 60.277 40.000 0.00 0.00 42.12 5.24
3290 3569 5.140177 GCAATACTATATGCAAGACAACGC 58.860 41.667 0.00 0.00 42.12 4.84
3300 3579 7.383102 AGTAAATGGCTGCAATACTATATGC 57.617 36.000 0.50 0.00 42.86 3.14
3301 3580 9.002600 TCAAGTAAATGGCTGCAATACTATATG 57.997 33.333 0.50 0.77 0.00 1.78
3302 3581 9.224267 CTCAAGTAAATGGCTGCAATACTATAT 57.776 33.333 0.50 0.00 0.00 0.86
3303 3582 8.210946 ACTCAAGTAAATGGCTGCAATACTATA 58.789 33.333 0.50 0.00 0.00 1.31
3304 3583 7.056635 ACTCAAGTAAATGGCTGCAATACTAT 58.943 34.615 0.50 0.00 0.00 2.12
3305 3584 6.414732 ACTCAAGTAAATGGCTGCAATACTA 58.585 36.000 0.50 0.00 0.00 1.82
3306 3585 5.256474 ACTCAAGTAAATGGCTGCAATACT 58.744 37.500 0.50 1.24 0.00 2.12
3307 3586 5.355350 AGACTCAAGTAAATGGCTGCAATAC 59.645 40.000 0.50 0.00 0.00 1.89
3308 3587 5.500234 AGACTCAAGTAAATGGCTGCAATA 58.500 37.500 0.50 0.00 0.00 1.90
3309 3588 4.338879 AGACTCAAGTAAATGGCTGCAAT 58.661 39.130 0.50 0.00 0.00 3.56
3310 3589 3.754965 AGACTCAAGTAAATGGCTGCAA 58.245 40.909 0.50 0.00 0.00 4.08
3311 3590 3.423539 AGACTCAAGTAAATGGCTGCA 57.576 42.857 0.50 0.00 0.00 4.41
3312 3591 3.119708 CCAAGACTCAAGTAAATGGCTGC 60.120 47.826 0.00 0.00 0.00 5.25
3313 3592 3.441572 CCCAAGACTCAAGTAAATGGCTG 59.558 47.826 3.86 0.00 0.00 4.85
3314 3593 3.330701 TCCCAAGACTCAAGTAAATGGCT 59.669 43.478 3.86 0.00 0.00 4.75
3315 3594 3.686016 TCCCAAGACTCAAGTAAATGGC 58.314 45.455 3.86 0.00 0.00 4.40
3316 3595 6.840780 AAATCCCAAGACTCAAGTAAATGG 57.159 37.500 0.00 0.00 0.00 3.16
3317 3596 7.814587 GGAAAAATCCCAAGACTCAAGTAAATG 59.185 37.037 0.00 0.00 0.00 2.32
3318 3597 7.730332 AGGAAAAATCCCAAGACTCAAGTAAAT 59.270 33.333 0.00 0.00 0.00 1.40
3319 3598 7.066781 AGGAAAAATCCCAAGACTCAAGTAAA 58.933 34.615 0.00 0.00 0.00 2.01
3320 3599 6.610830 AGGAAAAATCCCAAGACTCAAGTAA 58.389 36.000 0.00 0.00 0.00 2.24
3321 3600 6.200878 AGGAAAAATCCCAAGACTCAAGTA 57.799 37.500 0.00 0.00 0.00 2.24
3322 3601 5.066913 AGGAAAAATCCCAAGACTCAAGT 57.933 39.130 0.00 0.00 0.00 3.16
3323 3602 4.154918 CGAGGAAAAATCCCAAGACTCAAG 59.845 45.833 0.00 0.00 0.00 3.02
3324 3603 4.072131 CGAGGAAAAATCCCAAGACTCAA 58.928 43.478 0.00 0.00 0.00 3.02
3325 3604 3.072476 ACGAGGAAAAATCCCAAGACTCA 59.928 43.478 0.00 0.00 0.00 3.41
3326 3605 3.676093 ACGAGGAAAAATCCCAAGACTC 58.324 45.455 0.00 0.00 0.00 3.36
3327 3606 3.790089 ACGAGGAAAAATCCCAAGACT 57.210 42.857 0.00 0.00 0.00 3.24
3328 3607 4.392138 CACTACGAGGAAAAATCCCAAGAC 59.608 45.833 0.00 0.00 0.00 3.01
3329 3608 4.575885 CACTACGAGGAAAAATCCCAAGA 58.424 43.478 0.00 0.00 0.00 3.02
3330 3609 3.127030 GCACTACGAGGAAAAATCCCAAG 59.873 47.826 0.00 0.00 0.00 3.61
3331 3610 3.078837 GCACTACGAGGAAAAATCCCAA 58.921 45.455 0.00 0.00 0.00 4.12
3332 3611 2.039216 TGCACTACGAGGAAAAATCCCA 59.961 45.455 0.00 0.00 0.00 4.37
3333 3612 2.418976 GTGCACTACGAGGAAAAATCCC 59.581 50.000 10.32 0.00 0.00 3.85
3334 3613 3.741805 GTGCACTACGAGGAAAAATCC 57.258 47.619 10.32 0.00 0.00 3.01
3360 3639 3.243941 GGGTTTATTGGCAGGACGTTTTT 60.244 43.478 0.00 0.00 0.00 1.94
3361 3640 2.297880 GGGTTTATTGGCAGGACGTTTT 59.702 45.455 0.00 0.00 0.00 2.43
3362 3641 1.890489 GGGTTTATTGGCAGGACGTTT 59.110 47.619 0.00 0.00 0.00 3.60
3363 3642 1.074889 AGGGTTTATTGGCAGGACGTT 59.925 47.619 0.00 0.00 0.00 3.99
3364 3643 0.696501 AGGGTTTATTGGCAGGACGT 59.303 50.000 0.00 0.00 0.00 4.34
3365 3644 1.743394 GAAGGGTTTATTGGCAGGACG 59.257 52.381 0.00 0.00 0.00 4.79
3366 3645 3.087370 AGAAGGGTTTATTGGCAGGAC 57.913 47.619 0.00 0.00 0.00 3.85
3367 3646 3.430453 CAAGAAGGGTTTATTGGCAGGA 58.570 45.455 0.00 0.00 33.06 3.86
3368 3647 2.497273 CCAAGAAGGGTTTATTGGCAGG 59.503 50.000 1.27 0.00 45.58 4.85
3369 3648 3.874392 CCAAGAAGGGTTTATTGGCAG 57.126 47.619 1.27 0.00 45.58 4.85
3379 3658 6.075315 AGCTATGTTTTAAACCAAGAAGGGT 58.925 36.000 5.32 0.00 45.04 4.34
3380 3659 6.208599 TGAGCTATGTTTTAAACCAAGAAGGG 59.791 38.462 5.32 0.00 43.89 3.95
3381 3660 7.214467 TGAGCTATGTTTTAAACCAAGAAGG 57.786 36.000 5.32 0.00 45.67 3.46
3382 3661 9.696917 AAATGAGCTATGTTTTAAACCAAGAAG 57.303 29.630 5.32 0.00 0.00 2.85
3383 3662 9.474920 CAAATGAGCTATGTTTTAAACCAAGAA 57.525 29.630 5.32 0.00 0.00 2.52
3384 3663 8.855110 TCAAATGAGCTATGTTTTAAACCAAGA 58.145 29.630 5.32 0.00 0.00 3.02
3385 3664 9.132521 CTCAAATGAGCTATGTTTTAAACCAAG 57.867 33.333 5.32 4.09 35.13 3.61
3386 3665 8.637986 ACTCAAATGAGCTATGTTTTAAACCAA 58.362 29.630 10.28 0.00 45.79 3.67
3387 3666 8.177119 ACTCAAATGAGCTATGTTTTAAACCA 57.823 30.769 10.28 0.00 45.79 3.67
3388 3667 8.515414 AGACTCAAATGAGCTATGTTTTAAACC 58.485 33.333 10.28 0.00 45.79 3.27
3391 3670 9.944376 ACTAGACTCAAATGAGCTATGTTTTAA 57.056 29.630 10.28 0.00 45.79 1.52
3392 3671 9.944376 AACTAGACTCAAATGAGCTATGTTTTA 57.056 29.630 10.28 0.00 45.79 1.52
3393 3672 8.854614 AACTAGACTCAAATGAGCTATGTTTT 57.145 30.769 10.28 3.01 45.79 2.43
3394 3673 8.725148 CAAACTAGACTCAAATGAGCTATGTTT 58.275 33.333 10.28 16.55 45.79 2.83
3395 3674 7.880195 ACAAACTAGACTCAAATGAGCTATGTT 59.120 33.333 10.28 13.17 45.79 2.71
3396 3675 7.390027 ACAAACTAGACTCAAATGAGCTATGT 58.610 34.615 10.28 10.39 45.79 2.29
3397 3676 7.840342 ACAAACTAGACTCAAATGAGCTATG 57.160 36.000 10.28 9.90 45.79 2.23
3398 3677 8.972127 TCTACAAACTAGACTCAAATGAGCTAT 58.028 33.333 10.28 0.00 45.79 2.97
3399 3678 8.244802 GTCTACAAACTAGACTCAAATGAGCTA 58.755 37.037 10.28 10.99 45.79 3.32
3400 3679 7.093992 GTCTACAAACTAGACTCAAATGAGCT 58.906 38.462 10.28 10.49 45.79 4.09
3401 3680 6.868864 TGTCTACAAACTAGACTCAAATGAGC 59.131 38.462 10.28 3.93 45.79 4.26
3403 3682 8.585018 TGATGTCTACAAACTAGACTCAAATGA 58.415 33.333 0.00 0.00 43.15 2.57
3404 3683 8.763049 TGATGTCTACAAACTAGACTCAAATG 57.237 34.615 0.00 0.00 43.15 2.32
3405 3684 9.950496 ATTGATGTCTACAAACTAGACTCAAAT 57.050 29.630 17.05 9.31 43.15 2.32
3406 3685 9.208022 CATTGATGTCTACAAACTAGACTCAAA 57.792 33.333 17.05 8.08 43.15 2.69
3407 3686 8.367911 ACATTGATGTCTACAAACTAGACTCAA 58.632 33.333 16.24 16.24 43.15 3.02
3408 3687 7.896811 ACATTGATGTCTACAAACTAGACTCA 58.103 34.615 0.00 7.10 43.15 3.41
3409 3688 8.764524 AACATTGATGTCTACAAACTAGACTC 57.235 34.615 0.00 5.17 43.15 3.36
3412 3691 9.653287 CCTAAACATTGATGTCTACAAACTAGA 57.347 33.333 0.00 0.00 40.80 2.43
3413 3692 8.391106 GCCTAAACATTGATGTCTACAAACTAG 58.609 37.037 0.00 0.00 40.80 2.57
3414 3693 7.880713 TGCCTAAACATTGATGTCTACAAACTA 59.119 33.333 0.00 0.00 40.80 2.24
3415 3694 6.714810 TGCCTAAACATTGATGTCTACAAACT 59.285 34.615 0.00 0.00 40.80 2.66
3416 3695 6.908825 TGCCTAAACATTGATGTCTACAAAC 58.091 36.000 0.00 0.00 40.80 2.93
3417 3696 7.176515 ACATGCCTAAACATTGATGTCTACAAA 59.823 33.333 0.00 0.00 40.80 2.83
3418 3697 6.658816 ACATGCCTAAACATTGATGTCTACAA 59.341 34.615 0.00 0.00 40.80 2.41
3419 3698 6.093909 CACATGCCTAAACATTGATGTCTACA 59.906 38.462 0.00 0.00 40.80 2.74
3420 3699 6.316140 TCACATGCCTAAACATTGATGTCTAC 59.684 38.462 0.00 0.00 40.80 2.59
3421 3700 6.413892 TCACATGCCTAAACATTGATGTCTA 58.586 36.000 0.00 0.00 40.80 2.59
3422 3701 5.255687 TCACATGCCTAAACATTGATGTCT 58.744 37.500 0.00 0.00 40.80 3.41
3423 3702 5.565592 TCACATGCCTAAACATTGATGTC 57.434 39.130 0.00 0.00 40.80 3.06
3424 3703 4.142315 GCTCACATGCCTAAACATTGATGT 60.142 41.667 0.00 0.00 44.20 3.06
3425 3704 4.357142 GCTCACATGCCTAAACATTGATG 58.643 43.478 0.00 0.00 0.00 3.07
3426 3705 4.644103 GCTCACATGCCTAAACATTGAT 57.356 40.909 0.00 0.00 0.00 2.57
3538 4382 3.959478 GCATGTGGCATTCAGGATG 57.041 52.632 0.00 0.00 43.97 3.51
3560 4404 3.871006 CGGCTGAATATGCAGAAACTACA 59.129 43.478 15.48 0.00 38.14 2.74
3572 4416 9.227777 GGTTAATATTCCTAAACGGCTGAATAT 57.772 33.333 0.00 0.00 40.39 1.28
3574 4418 7.057894 TGGTTAATATTCCTAAACGGCTGAAT 58.942 34.615 0.00 0.00 0.00 2.57
3576 4420 5.991861 TGGTTAATATTCCTAAACGGCTGA 58.008 37.500 0.00 0.00 0.00 4.26
3582 4426 9.869757 ACAGCAATTTGGTTAATATTCCTAAAC 57.130 29.630 0.00 0.00 0.00 2.01
3607 4451 5.691754 GGATTGTCCAAATGAACAACAGAAC 59.308 40.000 0.00 0.00 36.28 3.01
3608 4452 5.598005 AGGATTGTCCAAATGAACAACAGAA 59.402 36.000 0.00 0.00 39.61 3.02
3643 4487 4.696479 AAGAGTTTCATCAGTGACCACT 57.304 40.909 0.00 0.00 43.61 4.00
3644 4488 6.402222 AGATAAGAGTTTCATCAGTGACCAC 58.598 40.000 0.00 0.00 33.11 4.16
3648 4514 6.665248 TCCAGAGATAAGAGTTTCATCAGTGA 59.335 38.462 0.00 0.00 0.00 3.41
3711 4577 6.971756 CACATGACAACAGTGTTAAACATGAA 59.028 34.615 31.88 11.69 37.98 2.57
3715 4581 5.645929 ACTCACATGACAACAGTGTTAAACA 59.354 36.000 8.49 9.44 38.41 2.83
3722 4588 3.001634 GTCACACTCACATGACAACAGTG 59.998 47.826 0.00 6.25 43.89 3.66
3803 4687 9.447040 GTTCTTCAAGTTAATAAGAAAGCGTTT 57.553 29.630 8.15 0.00 40.03 3.60
3804 4688 8.617809 TGTTCTTCAAGTTAATAAGAAAGCGTT 58.382 29.630 8.15 0.00 40.03 4.84
3805 4689 8.149973 TGTTCTTCAAGTTAATAAGAAAGCGT 57.850 30.769 8.15 0.00 40.03 5.07
3815 4699 9.507329 ACACTCACATATGTTCTTCAAGTTAAT 57.493 29.630 5.37 0.00 0.00 1.40
3816 4700 8.773645 CACACTCACATATGTTCTTCAAGTTAA 58.226 33.333 5.37 0.00 0.00 2.01
3817 4701 8.147704 TCACACTCACATATGTTCTTCAAGTTA 58.852 33.333 5.37 0.00 0.00 2.24
3818 4702 6.992123 TCACACTCACATATGTTCTTCAAGTT 59.008 34.615 5.37 0.00 0.00 2.66
3819 4703 6.425114 GTCACACTCACATATGTTCTTCAAGT 59.575 38.462 5.37 0.85 0.00 3.16
3820 4704 6.424812 TGTCACACTCACATATGTTCTTCAAG 59.575 38.462 5.37 0.26 0.00 3.02
3821 4705 6.287525 TGTCACACTCACATATGTTCTTCAA 58.712 36.000 5.37 0.00 0.00 2.69
3822 4706 5.852827 TGTCACACTCACATATGTTCTTCA 58.147 37.500 5.37 0.00 0.00 3.02
3823 4707 6.159293 TCTGTCACACTCACATATGTTCTTC 58.841 40.000 5.37 0.00 0.00 2.87
3824 4708 6.101650 TCTGTCACACTCACATATGTTCTT 57.898 37.500 5.37 0.00 0.00 2.52
3825 4709 5.337089 CCTCTGTCACACTCACATATGTTCT 60.337 44.000 5.37 0.00 0.00 3.01
3826 4710 4.867047 CCTCTGTCACACTCACATATGTTC 59.133 45.833 5.37 0.00 0.00 3.18
3827 4711 4.284490 ACCTCTGTCACACTCACATATGTT 59.716 41.667 5.37 0.00 0.00 2.71
3828 4712 3.834813 ACCTCTGTCACACTCACATATGT 59.165 43.478 1.41 1.41 0.00 2.29
3829 4713 4.159321 AGACCTCTGTCACACTCACATATG 59.841 45.833 0.00 0.00 44.33 1.78
3830 4714 4.348486 AGACCTCTGTCACACTCACATAT 58.652 43.478 0.00 0.00 44.33 1.78
3831 4715 3.767711 AGACCTCTGTCACACTCACATA 58.232 45.455 0.00 0.00 44.33 2.29
3832 4716 2.603021 AGACCTCTGTCACACTCACAT 58.397 47.619 0.00 0.00 44.33 3.21
3833 4717 2.073252 AGACCTCTGTCACACTCACA 57.927 50.000 0.00 0.00 44.33 3.58
3834 4718 3.150767 AGTAGACCTCTGTCACACTCAC 58.849 50.000 0.00 0.00 44.33 3.51
3835 4719 3.510531 AGTAGACCTCTGTCACACTCA 57.489 47.619 0.00 0.00 44.33 3.41
3836 4720 3.821600 TCAAGTAGACCTCTGTCACACTC 59.178 47.826 0.00 0.00 44.33 3.51
3837 4721 3.823873 CTCAAGTAGACCTCTGTCACACT 59.176 47.826 0.00 0.00 44.33 3.55
3838 4722 3.057174 CCTCAAGTAGACCTCTGTCACAC 60.057 52.174 0.00 0.00 44.33 3.82
3839 4723 3.157881 CCTCAAGTAGACCTCTGTCACA 58.842 50.000 0.00 0.00 44.33 3.58
3840 4724 2.494073 CCCTCAAGTAGACCTCTGTCAC 59.506 54.545 0.00 0.00 44.33 3.67
3841 4725 2.110188 ACCCTCAAGTAGACCTCTGTCA 59.890 50.000 0.00 0.00 44.33 3.58
3873 4757 1.560923 CAAGAGCGTGAAGGTATCCG 58.439 55.000 0.00 0.00 0.00 4.18
3931 4815 6.446318 GTTCAATTTCACATACAGCAAGGAA 58.554 36.000 0.00 0.00 0.00 3.36
3932 4816 5.048083 GGTTCAATTTCACATACAGCAAGGA 60.048 40.000 0.00 0.00 0.00 3.36
3933 4817 5.163513 GGTTCAATTTCACATACAGCAAGG 58.836 41.667 0.00 0.00 0.00 3.61
3934 4818 5.163513 GGGTTCAATTTCACATACAGCAAG 58.836 41.667 0.00 0.00 0.00 4.01
3935 4819 4.586421 TGGGTTCAATTTCACATACAGCAA 59.414 37.500 0.00 0.00 0.00 3.91
3936 4820 4.148079 TGGGTTCAATTTCACATACAGCA 58.852 39.130 0.00 0.00 0.00 4.41
3937 4821 4.782019 TGGGTTCAATTTCACATACAGC 57.218 40.909 0.00 0.00 0.00 4.40
3938 4822 5.653769 AGGATGGGTTCAATTTCACATACAG 59.346 40.000 3.38 0.00 31.27 2.74
4000 4884 6.645415 ACATTGGAGTCTACAAACTAAACTCG 59.355 38.462 0.45 0.00 37.76 4.18
4002 4886 8.747538 AAACATTGGAGTCTACAAACTAAACT 57.252 30.769 0.45 0.00 0.00 2.66
4017 4901 3.181493 GCTCACATGCCTAAACATTGGAG 60.181 47.826 0.00 0.00 33.69 3.86
4064 4966 3.127589 TCAAAGCACTCGATCGTTCAAA 58.872 40.909 15.94 0.00 0.00 2.69
4071 4973 3.486542 GCCAGAAATCAAAGCACTCGATC 60.487 47.826 0.00 0.00 0.00 3.69
4072 4974 2.421424 GCCAGAAATCAAAGCACTCGAT 59.579 45.455 0.00 0.00 0.00 3.59
4078 4980 2.037511 CCTTTGGCCAGAAATCAAAGCA 59.962 45.455 5.11 0.00 43.33 3.91
4119 5022 7.358263 AGGCTAGCCAGATCTATAAGCTTATA 58.642 38.462 34.70 21.97 38.92 0.98
4126 5029 4.683766 AGGAGGCTAGCCAGATCTATAA 57.316 45.455 34.70 0.00 38.92 0.98
4127 5030 4.570933 GGAAGGAGGCTAGCCAGATCTATA 60.571 50.000 34.70 0.00 38.92 1.31
4143 5047 6.364701 TGATGTATACAAAATGGGGAAGGAG 58.635 40.000 10.14 0.00 0.00 3.69
4147 5051 6.549364 GTCCATGATGTATACAAAATGGGGAA 59.451 38.462 30.86 19.31 40.48 3.97
4158 5062 8.812147 TTCACGAAATAGTCCATGATGTATAC 57.188 34.615 0.00 0.00 0.00 1.47
4160 5064 8.908786 ATTTCACGAAATAGTCCATGATGTAT 57.091 30.769 3.18 0.00 39.08 2.29
4171 5075 5.873164 AGTTAAGGCGATTTCACGAAATAGT 59.127 36.000 12.31 0.00 40.77 2.12
4179 5083 4.691216 ACTCAAGAGTTAAGGCGATTTCAC 59.309 41.667 0.00 0.00 38.83 3.18
4198 5102 8.040727 TCTAGCACAAGAAGCATATTTAACTCA 58.959 33.333 0.00 0.00 0.00 3.41
4199 5103 8.425577 TCTAGCACAAGAAGCATATTTAACTC 57.574 34.615 0.00 0.00 0.00 3.01
4254 5166 5.857822 AAGACTTAAAAGTATCACACGCC 57.142 39.130 0.00 0.00 39.88 5.68
4297 5209 9.891828 TGCTTACTATGTTTGTAAGTTCAAATG 57.108 29.630 13.03 0.00 44.99 2.32
4302 5214 8.850452 GCATTTGCTTACTATGTTTGTAAGTTC 58.150 33.333 13.03 1.73 44.99 3.01
4322 5234 5.618056 ATCATACCTATTCGCAGCATTTG 57.382 39.130 0.00 0.00 0.00 2.32
4337 5258 8.621286 CAAACTGGTTTTGGAGTATATCATACC 58.379 37.037 0.00 0.00 40.98 2.73
4353 5274 0.836606 CAAAGGGGCCAAACTGGTTT 59.163 50.000 4.39 0.00 40.46 3.27
4355 5276 1.048160 CACAAAGGGGCCAAACTGGT 61.048 55.000 4.39 0.00 40.46 4.00
4365 5286 3.085952 TCTTTAGATGCCACAAAGGGG 57.914 47.619 0.00 0.00 38.09 4.79
4387 5308 6.458615 GCAGCACCTAAGAAGTAGTACTCTAC 60.459 46.154 2.58 0.00 44.79 2.59
4388 5309 5.589452 GCAGCACCTAAGAAGTAGTACTCTA 59.411 44.000 2.58 0.00 0.00 2.43
4389 5310 4.399934 GCAGCACCTAAGAAGTAGTACTCT 59.600 45.833 2.58 0.12 0.00 3.24
4390 5311 4.440387 GGCAGCACCTAAGAAGTAGTACTC 60.440 50.000 2.58 0.00 34.51 2.59
4559 6138 2.015587 GCTTCATCCCAAGAGCAAGAG 58.984 52.381 0.00 0.00 0.00 2.85
4565 6144 4.267536 TCTTTCATGCTTCATCCCAAGAG 58.732 43.478 0.00 0.00 0.00 2.85
4566 6145 4.305539 TCTTTCATGCTTCATCCCAAGA 57.694 40.909 0.00 0.00 0.00 3.02
4575 6154 8.746922 TCATAAAACATGTTCTTTCATGCTTC 57.253 30.769 12.39 0.00 46.15 3.86
4576 6155 9.715121 ATTCATAAAACATGTTCTTTCATGCTT 57.285 25.926 12.39 1.61 46.15 3.91
4624 6203 8.661752 ATCTTCAGATATGATGACATACCTCA 57.338 34.615 7.97 0.00 41.03 3.86
4639 6218 6.983890 TGCGTTAACAAGCATATCTTCAGATA 59.016 34.615 6.39 0.00 40.85 1.98
4660 6239 4.475028 CATGTGATTGTAACATGTTGCGT 58.525 39.130 21.42 12.20 46.39 5.24
4683 6275 9.433153 CTACTTTCCGGTTAATTTCTAGAAGTT 57.567 33.333 16.37 16.37 0.00 2.66
4688 6280 7.605410 TTGCTACTTTCCGGTTAATTTCTAG 57.395 36.000 0.00 0.00 0.00 2.43
4698 6290 3.688694 TGTGTATTGCTACTTTCCGGT 57.311 42.857 0.00 0.00 0.00 5.28
4699 6291 5.583061 TGTATTGTGTATTGCTACTTTCCGG 59.417 40.000 0.00 0.00 0.00 5.14
4701 6293 7.414098 CCAGTGTATTGTGTATTGCTACTTTCC 60.414 40.741 0.00 0.00 0.00 3.13
4730 6322 6.039616 TGAAAAATAACAAGCACAGGAACAC 58.960 36.000 0.00 0.00 0.00 3.32
4738 6330 8.337532 AGAAAGCAAATGAAAAATAACAAGCAC 58.662 29.630 0.00 0.00 0.00 4.40
4753 6345 5.130292 AGTGATGGTTCAGAAAGCAAATG 57.870 39.130 0.00 0.00 45.31 2.32
4754 6346 5.302568 TGAAGTGATGGTTCAGAAAGCAAAT 59.697 36.000 0.00 0.00 45.31 2.32
4820 6413 2.370189 GCATAGACAGCCTACCTGGAAT 59.630 50.000 0.00 0.00 46.14 3.01
4831 6424 2.871022 CAGACAATCAGGCATAGACAGC 59.129 50.000 0.00 0.00 0.00 4.40
4838 6431 3.264193 TGGAACTACAGACAATCAGGCAT 59.736 43.478 0.00 0.00 0.00 4.40
4840 6433 3.334583 TGGAACTACAGACAATCAGGC 57.665 47.619 0.00 0.00 0.00 4.85
4847 6440 3.194116 GGAACGGTATGGAACTACAGACA 59.806 47.826 0.00 0.00 34.40 3.41
4865 6458 6.769822 ACATCCAGATAGACAATCAATGGAAC 59.230 38.462 0.00 0.00 40.48 3.62
4869 6462 6.060136 ACCACATCCAGATAGACAATCAATG 58.940 40.000 0.00 0.00 37.03 2.82
4870 6463 6.126681 TGACCACATCCAGATAGACAATCAAT 60.127 38.462 0.00 0.00 37.03 2.57
4871 6464 5.189539 TGACCACATCCAGATAGACAATCAA 59.810 40.000 0.00 0.00 37.03 2.57
4874 6467 4.471025 TGTGACCACATCCAGATAGACAAT 59.529 41.667 0.00 0.00 36.21 2.71
4879 6472 3.893326 TGTGTGACCACATCCAGATAG 57.107 47.619 6.10 0.00 46.45 2.08