Multiple sequence alignment - TraesCS5B01G553800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G553800 chr5B 100.000 2745 0 0 1 2745 703782182 703784926 0.000000e+00 5070.0
1 TraesCS5B01G553800 chr5B 93.643 1054 49 8 2 1047 699603859 699604902 0.000000e+00 1559.0
2 TraesCS5B01G553800 chr5B 94.995 959 43 2 1052 2010 699604987 699605940 0.000000e+00 1500.0
3 TraesCS5B01G553800 chr5B 94.157 445 21 4 2132 2575 699605958 699606398 0.000000e+00 673.0
4 TraesCS5B01G553800 chr5D 96.352 2577 78 5 2 2575 551401326 551403889 0.000000e+00 4224.0
5 TraesCS5B01G553800 chr5D 88.193 1821 159 31 37 1841 552081172 552079392 0.000000e+00 2121.0
6 TraesCS5B01G553800 chr5D 86.689 293 30 6 1213 1496 552081315 552081607 1.590000e-82 316.0
7 TraesCS5B01G553800 chr5D 98.246 171 3 0 2575 2745 551403986 551404156 1.600000e-77 300.0
8 TraesCS5B01G553800 chr5D 85.854 205 18 4 1762 1955 552081699 552081903 9.960000e-50 207.0
9 TraesCS5B01G553800 chr5D 93.651 126 5 3 1831 1955 552079352 552079229 4.670000e-43 185.0
10 TraesCS5B01G553800 chr4A 95.313 2411 89 11 7 2416 616709432 616707045 0.000000e+00 3805.0
11 TraesCS5B01G553800 chr4A 94.997 1499 62 9 1082 2575 616405312 616403822 0.000000e+00 2340.0
12 TraesCS5B01G553800 chr4A 95.338 1051 42 2 7 1050 616407590 616406540 0.000000e+00 1663.0
13 TraesCS5B01G553800 chr4A 89.089 1164 95 12 681 1841 616108236 616109370 0.000000e+00 1417.0
14 TraesCS5B01G553800 chr4A 96.992 133 4 0 2613 2745 616706813 616706681 9.890000e-55 224.0
15 TraesCS5B01G553800 chr4A 96.667 120 4 0 2415 2534 616706933 616706814 1.670000e-47 200.0
16 TraesCS5B01G553800 chr4A 75.550 409 92 6 90 494 616086662 616087066 7.760000e-46 195.0
17 TraesCS5B01G553800 chr4A 90.625 128 9 3 1829 1955 616109409 616109534 1.690000e-37 167.0
18 TraesCS5B01G553800 chr7B 73.230 777 161 34 113 882 151062669 151063405 3.530000e-59 239.0
19 TraesCS5B01G553800 chr7D 77.409 301 56 9 1449 1746 180984001 180983710 4.700000e-38 169.0
20 TraesCS5B01G553800 chr7D 81.982 111 17 3 2466 2575 619579683 619579575 1.050000e-14 91.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G553800 chr5B 703782182 703784926 2744 False 5070.000000 5070 100.0000 1 2745 1 chr5B.!!$F1 2744
1 TraesCS5B01G553800 chr5B 699603859 699606398 2539 False 1244.000000 1559 94.2650 2 2575 3 chr5B.!!$F2 2573
2 TraesCS5B01G553800 chr5D 551401326 551404156 2830 False 2262.000000 4224 97.2990 2 2745 2 chr5D.!!$F1 2743
3 TraesCS5B01G553800 chr5D 552079229 552081172 1943 True 1153.000000 2121 90.9220 37 1955 2 chr5D.!!$R1 1918
4 TraesCS5B01G553800 chr5D 552081315 552081903 588 False 261.500000 316 86.2715 1213 1955 2 chr5D.!!$F2 742
5 TraesCS5B01G553800 chr4A 616403822 616407590 3768 True 2001.500000 2340 95.1675 7 2575 2 chr4A.!!$R1 2568
6 TraesCS5B01G553800 chr4A 616706681 616709432 2751 True 1409.666667 3805 96.3240 7 2745 3 chr4A.!!$R2 2738
7 TraesCS5B01G553800 chr4A 616108236 616109534 1298 False 792.000000 1417 89.8570 681 1955 2 chr4A.!!$F2 1274
8 TraesCS5B01G553800 chr7B 151062669 151063405 736 False 239.000000 239 73.2300 113 882 1 chr7B.!!$F1 769

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
425 436 0.178944 TCGGACCCTCTCCAACTGAA 60.179 55.0 0.00 0.0 39.39 3.02 F
1252 2477 0.958876 TCTCGTCGAAGCTGCACCTA 60.959 55.0 1.02 0.0 0.00 3.08 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1558 2795 0.744414 CCACGGCTCGTTCCATGAAT 60.744 55.0 0.0 0.0 38.32 2.57 R
2705 4224 0.034089 CACCCAACCTGATTCCTCCC 60.034 60.0 0.0 0.0 0.00 4.30 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
317 325 2.736995 CATGGACGCGTTCACGGT 60.737 61.111 25.17 3.84 40.23 4.83
425 436 0.178944 TCGGACCCTCTCCAACTGAA 60.179 55.000 0.00 0.00 39.39 3.02
429 440 0.969894 ACCCTCTCCAACTGAACTCG 59.030 55.000 0.00 0.00 0.00 4.18
625 636 0.984230 CAGGCTAACCCTCCAGAACA 59.016 55.000 0.00 0.00 44.09 3.18
727 738 1.210234 TGGTTGATCATCACTCCGCAT 59.790 47.619 0.00 0.00 0.00 4.73
1252 2477 0.958876 TCTCGTCGAAGCTGCACCTA 60.959 55.000 1.02 0.00 0.00 3.08
1554 2791 7.384115 CGAAGACAAGGTGACAAACTATCTAAA 59.616 37.037 0.00 0.00 0.00 1.85
1558 2795 7.676947 ACAAGGTGACAAACTATCTAAAGCTA 58.323 34.615 0.00 0.00 0.00 3.32
1594 2831 2.003301 GTGGGCTTGAAGAGAATCGAC 58.997 52.381 0.00 0.00 42.67 4.20
1956 3257 9.325198 GAATTTTACTTTGGAAACCTGAAATGT 57.675 29.630 0.00 0.00 0.00 2.71
2306 3612 0.394762 ATAGGTCTGGTCGCACGGTA 60.395 55.000 0.00 0.00 0.00 4.02
2397 3706 2.787601 ATCAATCATGATTGTGCGGC 57.212 45.000 35.74 0.00 43.89 6.53
2450 3872 8.408043 AAAAGAAATCAATGATACCTCACACA 57.592 30.769 0.00 0.00 33.22 3.72
2483 3905 5.728471 ACTATGAGTCAGTCAAATGTCCAG 58.272 41.667 0.00 0.00 39.19 3.86
2534 3956 7.831193 TCCTTGATAAAATCCAGAAAAGGAGAG 59.169 37.037 0.00 0.00 41.90 3.20
2557 3979 0.329596 GTTGCCTCTGTCCATCCCTT 59.670 55.000 0.00 0.00 0.00 3.95
2637 4156 4.305539 TCAGCTTTTCCATCCTCATCAA 57.694 40.909 0.00 0.00 0.00 2.57
2705 4224 1.217244 GGGTGTAGCCGTGTAGGTG 59.783 63.158 0.00 0.00 43.70 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 2.675772 GTCTCGTCCCGTCCTGGT 60.676 66.667 0.00 0.00 35.15 4.00
298 306 2.726691 CCGTGAACGCGTCCATGAC 61.727 63.158 20.04 3.93 38.18 3.06
625 636 2.794981 CGTCATCGTCTCCAAACGCTAT 60.795 50.000 0.00 0.00 42.31 2.97
727 738 1.778334 CACGGTGTGTCGATCTTGAA 58.222 50.000 0.00 0.00 0.00 2.69
1252 2477 7.017319 AGCTTACTGTAAAATTCAGTAGGGT 57.983 36.000 11.46 11.46 45.17 4.34
1366 2603 5.761003 CATGCACACAGAAGATAAACACAA 58.239 37.500 0.00 0.00 0.00 3.33
1554 2791 1.539065 CGGCTCGTTCCATGAATAGCT 60.539 52.381 0.00 0.00 35.34 3.32
1558 2795 0.744414 CCACGGCTCGTTCCATGAAT 60.744 55.000 0.00 0.00 38.32 2.57
1885 3185 7.177568 TCCAATACAGTAGGCATTTTAAAGCAA 59.822 33.333 2.32 0.00 0.00 3.91
1956 3257 4.129380 CTCCACATTCATTAGGATGCGAA 58.871 43.478 0.00 0.00 33.14 4.70
2249 3555 5.966935 TCTCTAGACTCCAAGATTTCCCATT 59.033 40.000 0.00 0.00 0.00 3.16
2306 3612 3.906846 CCCATTCTCCTTATGCTACTCCT 59.093 47.826 0.00 0.00 0.00 3.69
2343 3649 8.729805 AATCTTGGCTGTTGTTTTATTTTTGA 57.270 26.923 0.00 0.00 0.00 2.69
2397 3706 8.978564 TGGTACATATTTGCAAATTACACTTG 57.021 30.769 28.45 17.51 0.00 3.16
2450 3872 6.007076 TGACTGACTCATAGTTCTGAAGACT 58.993 40.000 0.00 0.00 0.00 3.24
2483 3905 3.926616 TCACAACTAGGCTTTGAGTAGC 58.073 45.455 5.95 0.00 40.48 3.58
2534 3956 2.019984 GGATGGACAGAGGCAACATTC 58.980 52.381 0.00 0.00 41.41 2.67
2557 3979 4.022935 CAGGTACAGCAGCAAAATCAGAAA 60.023 41.667 0.00 0.00 0.00 2.52
2705 4224 0.034089 CACCCAACCTGATTCCTCCC 60.034 60.000 0.00 0.00 0.00 4.30


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.