Multiple sequence alignment - TraesCS5B01G552400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G552400 chr5B 100.000 5539 0 0 1 5539 703232553 703227015 0.000000e+00 10229.0
1 TraesCS5B01G552400 chr5B 100.000 381 0 0 5835 6215 703226719 703226339 0.000000e+00 704.0
2 TraesCS5B01G552400 chr5B 89.610 462 45 3 4838 5298 703196561 703196102 8.980000e-163 584.0
3 TraesCS5B01G552400 chr5B 79.659 762 130 12 4490 5249 703097483 703096745 5.520000e-145 525.0
4 TraesCS5B01G552400 chr5B 78.563 821 153 20 4487 5293 703169154 703168343 2.570000e-143 520.0
5 TraesCS5B01G552400 chr5B 79.095 751 140 16 4487 5228 703141756 703141014 9.300000e-138 501.0
6 TraesCS5B01G552400 chr5B 76.573 747 142 20 2 724 128857107 128856370 4.550000e-101 379.0
7 TraesCS5B01G552400 chr5B 77.232 224 29 11 915 1129 703169772 703169562 1.830000e-20 111.0
8 TraesCS5B01G552400 chr5B 93.878 49 3 0 543 591 261706591 261706543 2.400000e-09 75.0
9 TraesCS5B01G552400 chr5B 76.812 138 27 5 5161 5295 703227245 703227110 8.640000e-09 73.1
10 TraesCS5B01G552400 chr5B 76.812 138 27 5 5309 5444 703227393 703227259 8.640000e-09 73.1
11 TraesCS5B01G552400 chr5B 93.182 44 3 0 5308 5351 703141082 703141039 1.450000e-06 65.8
12 TraesCS5B01G552400 chr5B 93.182 44 3 0 5308 5351 703168480 703168437 1.450000e-06 65.8
13 TraesCS5B01G552400 chr4D 88.310 1882 179 28 2146 4003 306400715 306402579 0.000000e+00 2218.0
14 TraesCS5B01G552400 chr4D 86.688 1893 199 40 2146 4003 78583983 78582109 0.000000e+00 2050.0
15 TraesCS5B01G552400 chr4D 89.837 246 21 3 4219 4461 399916829 399916585 4.680000e-81 313.0
16 TraesCS5B01G552400 chr4D 90.404 198 17 2 4266 4461 399910272 399910075 6.180000e-65 259.0
17 TraesCS5B01G552400 chr4D 83.039 283 27 7 4186 4463 192891415 192891149 2.900000e-58 237.0
18 TraesCS5B01G552400 chr4D 82.437 279 29 11 4186 4463 276539623 276539882 6.270000e-55 226.0
19 TraesCS5B01G552400 chr4D 88.636 88 10 0 4389 4476 509131330 509131243 2.370000e-19 108.0
20 TraesCS5B01G552400 chr4D 80.000 120 22 2 4351 4469 8924329 8924211 3.090000e-13 87.9
21 TraesCS5B01G552400 chr3D 87.793 1876 196 25 2148 4003 141126783 141124921 0.000000e+00 2165.0
22 TraesCS5B01G552400 chr3D 95.477 398 17 1 1403 1799 573446423 573446820 8.790000e-178 634.0
23 TraesCS5B01G552400 chr3D 91.972 436 34 1 1404 1838 612826293 612825858 1.480000e-170 610.0
24 TraesCS5B01G552400 chr3D 74.422 735 131 36 4 717 531564421 531563723 4.780000e-66 263.0
25 TraesCS5B01G552400 chr3D 82.857 140 23 1 506 645 545179816 545179954 2.350000e-24 124.0
26 TraesCS5B01G552400 chr3B 87.573 1891 184 43 2148 4006 729924571 729926442 0.000000e+00 2143.0
27 TraesCS5B01G552400 chr3B 88.705 1753 177 17 2259 4003 811749756 811751495 0.000000e+00 2121.0
28 TraesCS5B01G552400 chr3B 88.192 1753 180 20 2259 4003 51098374 51096641 0.000000e+00 2065.0
29 TraesCS5B01G552400 chr1B 88.112 1817 189 22 2197 4003 671509985 671508186 0.000000e+00 2134.0
30 TraesCS5B01G552400 chr1B 91.610 441 32 4 1392 1830 60528755 60529192 6.890000e-169 604.0
31 TraesCS5B01G552400 chr1B 88.214 280 27 5 4185 4463 423584107 423584381 4.640000e-86 329.0
32 TraesCS5B01G552400 chr1B 75.781 256 47 7 480 724 638760328 638760077 1.420000e-21 115.0
33 TraesCS5B01G552400 chr7A 88.998 1727 164 18 2293 4004 438256455 438258170 0.000000e+00 2113.0
34 TraesCS5B01G552400 chr7A 92.343 431 30 3 1404 1832 47770109 47769680 1.480000e-170 610.0
35 TraesCS5B01G552400 chr7A 89.085 284 26 5 4182 4463 143342568 143342848 1.280000e-91 348.0
36 TraesCS5B01G552400 chr1D 87.132 1904 184 44 2146 4004 399938389 399940276 0.000000e+00 2102.0
37 TraesCS5B01G552400 chr1D 85.000 280 37 5 4185 4463 445207330 445207055 4.740000e-71 279.0
38 TraesCS5B01G552400 chr1D 81.600 125 21 2 4351 4474 9269693 9269570 1.100000e-17 102.0
39 TraesCS5B01G552400 chr1D 81.452 124 21 2 4349 4471 314758480 314758602 3.960000e-17 100.0
40 TraesCS5B01G552400 chr1D 80.800 125 22 2 4351 4474 2136699 2136822 5.130000e-16 97.1
41 TraesCS5B01G552400 chr5D 90.073 826 67 2 4474 5298 550638225 550637414 0.000000e+00 1057.0
42 TraesCS5B01G552400 chr5D 91.991 437 33 2 1404 1838 389235318 389235754 4.120000e-171 612.0
43 TraesCS5B01G552400 chr5D 81.684 677 54 23 759 1406 550639046 550638411 3.350000e-137 499.0
44 TraesCS5B01G552400 chr5D 80.831 313 40 13 902 1203 550580101 550579798 1.740000e-55 228.0
45 TraesCS5B01G552400 chr5D 78.641 206 23 12 976 1175 550612473 550612283 3.940000e-22 117.0
46 TraesCS5B01G552400 chr5D 74.894 235 47 7 5309 5537 550637552 550637324 5.130000e-16 97.1
47 TraesCS5B01G552400 chr5D 87.500 88 4 4 1050 1130 501116499 501116586 1.840000e-15 95.3
48 TraesCS5B01G552400 chr5D 100.000 36 0 0 2144 2179 4300799 4300764 4.020000e-07 67.6
49 TraesCS5B01G552400 chr2B 89.075 778 50 15 1404 2178 128594848 128594103 0.000000e+00 933.0
50 TraesCS5B01G552400 chr2B 87.973 291 31 4 4185 4474 200861387 200861100 2.150000e-89 340.0
51 TraesCS5B01G552400 chr2B 87.857 280 27 5 4185 4463 671161726 671161999 7.770000e-84 322.0
52 TraesCS5B01G552400 chr2B 73.989 742 151 23 3 717 158628168 158628894 4.780000e-66 263.0
53 TraesCS5B01G552400 chr2B 100.000 34 0 0 2146 2179 146776345 146776312 5.200000e-06 63.9
54 TraesCS5B01G552400 chr6B 95.489 399 14 3 1404 1799 18156382 18155985 8.790000e-178 634.0
55 TraesCS5B01G552400 chr6B 81.065 169 28 4 519 686 66792850 66792685 1.410000e-26 132.0
56 TraesCS5B01G552400 chr6B 81.250 160 24 3 311 467 643258505 643258349 2.350000e-24 124.0
57 TraesCS5B01G552400 chr7D 92.045 440 32 3 1395 1833 632763957 632764394 3.180000e-172 616.0
58 TraesCS5B01G552400 chr7D 82.963 135 20 2 2 133 544855687 544855821 1.090000e-22 119.0
59 TraesCS5B01G552400 chr7D 100.000 36 0 0 2144 2179 503009385 503009350 4.020000e-07 67.6
60 TraesCS5B01G552400 chr6A 92.575 431 29 3 1404 1833 613599989 613600417 3.180000e-172 616.0
61 TraesCS5B01G552400 chr6A 91.553 438 35 2 1403 1839 556286780 556287216 2.480000e-168 603.0
62 TraesCS5B01G552400 chr6A 75.464 754 149 24 2 726 208786058 208786804 9.980000e-88 335.0
63 TraesCS5B01G552400 chr3A 88.251 366 16 7 1825 2178 698343037 698342687 4.480000e-111 412.0
64 TraesCS5B01G552400 chr3A 76.510 745 142 20 2 719 70806673 70805935 5.880000e-100 375.0
65 TraesCS5B01G552400 chr3A 87.857 280 29 5 4185 4463 120267184 120267459 2.160000e-84 324.0
66 TraesCS5B01G552400 chr3A 87.500 80 7 2 2 78 30989353 30989274 8.580000e-14 89.8
67 TraesCS5B01G552400 chr2A 77.361 720 122 20 2 685 194180203 194179489 7.560000e-104 388.0
68 TraesCS5B01G552400 chr2A 89.324 281 25 5 4185 4463 401830174 401830451 1.280000e-91 348.0
69 TraesCS5B01G552400 chr2A 89.324 281 23 6 4185 4463 403801830 403802105 4.610000e-91 346.0
70 TraesCS5B01G552400 chr2A 75.888 676 123 23 2 651 207760763 207761424 6.050000e-80 309.0
71 TraesCS5B01G552400 chr7B 76.361 753 135 25 2 718 55468451 55469196 1.270000e-96 364.0
72 TraesCS5B01G552400 chr7B 88.968 281 24 6 4185 4463 424832361 424832636 2.150000e-89 340.0
73 TraesCS5B01G552400 chr7B 87.671 292 28 7 4185 4474 84455023 84455308 3.590000e-87 333.0
74 TraesCS5B01G552400 chr7B 76.324 642 113 31 2 626 202352958 202353577 2.180000e-79 307.0
75 TraesCS5B01G552400 chr7B 73.907 755 159 27 2 726 653979816 653979070 1.030000e-67 268.0
76 TraesCS5B01G552400 chr7B 79.200 125 19 6 2 121 741860346 741860224 5.160000e-11 80.5
77 TraesCS5B01G552400 chr2D 76.115 762 125 39 2 721 423615511 423614765 4.610000e-91 346.0
78 TraesCS5B01G552400 chr2D 89.634 164 14 1 2257 2420 647735073 647734913 8.170000e-49 206.0
79 TraesCS5B01G552400 chr4A 87.458 295 32 5 4183 4476 97576506 97576216 9.980000e-88 335.0
80 TraesCS5B01G552400 chr4A 86.824 296 34 4 4185 4477 67022688 67022395 6.010000e-85 326.0
81 TraesCS5B01G552400 chr4A 87.814 279 29 4 4186 4463 63717904 63718178 7.770000e-84 322.0
82 TraesCS5B01G552400 chr4A 85.099 302 39 5 4178 4476 105707463 105707165 2.820000e-78 303.0
83 TraesCS5B01G552400 chr4A 85.915 284 35 5 4181 4463 333193385 333193106 1.310000e-76 298.0
84 TraesCS5B01G552400 chr4A 81.633 294 33 12 902 1189 617042397 617042675 2.250000e-54 224.0
85 TraesCS5B01G552400 chr4A 83.824 136 16 4 1040 1175 617001193 617001322 2.350000e-24 124.0
86 TraesCS5B01G552400 chr1A 87.857 280 29 4 4185 4463 284322785 284322510 2.160000e-84 324.0
87 TraesCS5B01G552400 chr1A 86.879 282 34 3 4178 4458 502847359 502847638 4.680000e-81 313.0
88 TraesCS5B01G552400 chr1A 74.920 626 122 25 2 617 584877101 584877701 2.880000e-63 254.0
89 TraesCS5B01G552400 chr1A 85.714 231 27 3 4185 4414 586334796 586334571 8.050000e-59 239.0
90 TraesCS5B01G552400 chr1A 85.976 164 22 1 4300 4463 529672597 529672435 2.300000e-39 174.0
91 TraesCS5B01G552400 chr5A 74.114 734 165 17 1 717 491236756 491237481 4.740000e-71 279.0
92 TraesCS5B01G552400 chr4B 84.247 292 38 6 4185 4474 28233362 28233647 1.710000e-70 278.0
93 TraesCS5B01G552400 chr4B 77.419 310 55 12 296 593 627137610 627137304 2.980000e-38 171.0
94 TraesCS5B01G552400 chr4B 85.714 105 15 0 4370 4474 186963870 186963766 1.830000e-20 111.0
95 TraesCS5B01G552400 chr4B 84.906 106 16 0 4369 4474 603160911 603160806 2.370000e-19 108.0
96 TraesCS5B01G552400 chrUn 80.464 302 33 10 4181 4474 22614005 22614288 2.270000e-49 207.0
97 TraesCS5B01G552400 chrUn 81.600 125 21 2 4351 4474 39064967 39064844 1.100000e-17 102.0
98 TraesCS5B01G552400 chrUn 80.800 125 22 2 4351 4474 39043918 39043795 5.130000e-16 97.1
99 TraesCS5B01G552400 chrUn 87.059 85 10 1 4380 4463 36065569 36065653 1.840000e-15 95.3
100 TraesCS5B01G552400 chrUn 84.043 94 15 0 4370 4463 29761272 29761365 2.390000e-14 91.6
101 TraesCS5B01G552400 chr6D 82.569 109 17 2 4356 4463 450299180 450299073 1.840000e-15 95.3
102 TraesCS5B01G552400 chr6D 78.899 109 18 4 2 106 73785777 73785884 1.120000e-07 69.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G552400 chr5B 703226339 703232553 6214 True 5466.500000 10229 100.000000 1 6215 2 chr5B.!!$R7 6214
1 TraesCS5B01G552400 chr5B 703096745 703097483 738 True 525.000000 525 79.659000 4490 5249 1 chr5B.!!$R3 759
2 TraesCS5B01G552400 chr5B 128856370 128857107 737 True 379.000000 379 76.573000 2 724 1 chr5B.!!$R1 722
3 TraesCS5B01G552400 chr5B 703141014 703141756 742 True 283.400000 501 86.138500 4487 5351 2 chr5B.!!$R5 864
4 TraesCS5B01G552400 chr5B 703168343 703169772 1429 True 232.266667 520 82.992333 915 5351 3 chr5B.!!$R6 4436
5 TraesCS5B01G552400 chr4D 306400715 306402579 1864 False 2218.000000 2218 88.310000 2146 4003 1 chr4D.!!$F2 1857
6 TraesCS5B01G552400 chr4D 78582109 78583983 1874 True 2050.000000 2050 86.688000 2146 4003 1 chr4D.!!$R2 1857
7 TraesCS5B01G552400 chr3D 141124921 141126783 1862 True 2165.000000 2165 87.793000 2148 4003 1 chr3D.!!$R1 1855
8 TraesCS5B01G552400 chr3D 531563723 531564421 698 True 263.000000 263 74.422000 4 717 1 chr3D.!!$R2 713
9 TraesCS5B01G552400 chr3B 729924571 729926442 1871 False 2143.000000 2143 87.573000 2148 4006 1 chr3B.!!$F1 1858
10 TraesCS5B01G552400 chr3B 811749756 811751495 1739 False 2121.000000 2121 88.705000 2259 4003 1 chr3B.!!$F2 1744
11 TraesCS5B01G552400 chr3B 51096641 51098374 1733 True 2065.000000 2065 88.192000 2259 4003 1 chr3B.!!$R1 1744
12 TraesCS5B01G552400 chr1B 671508186 671509985 1799 True 2134.000000 2134 88.112000 2197 4003 1 chr1B.!!$R2 1806
13 TraesCS5B01G552400 chr7A 438256455 438258170 1715 False 2113.000000 2113 88.998000 2293 4004 1 chr7A.!!$F2 1711
14 TraesCS5B01G552400 chr1D 399938389 399940276 1887 False 2102.000000 2102 87.132000 2146 4004 1 chr1D.!!$F3 1858
15 TraesCS5B01G552400 chr5D 550637324 550639046 1722 True 551.033333 1057 82.217000 759 5537 3 chr5D.!!$R4 4778
16 TraesCS5B01G552400 chr2B 128594103 128594848 745 True 933.000000 933 89.075000 1404 2178 1 chr2B.!!$R1 774
17 TraesCS5B01G552400 chr2B 158628168 158628894 726 False 263.000000 263 73.989000 3 717 1 chr2B.!!$F1 714
18 TraesCS5B01G552400 chr6A 208786058 208786804 746 False 335.000000 335 75.464000 2 726 1 chr6A.!!$F1 724
19 TraesCS5B01G552400 chr3A 70805935 70806673 738 True 375.000000 375 76.510000 2 719 1 chr3A.!!$R2 717
20 TraesCS5B01G552400 chr2A 194179489 194180203 714 True 388.000000 388 77.361000 2 685 1 chr2A.!!$R1 683
21 TraesCS5B01G552400 chr2A 207760763 207761424 661 False 309.000000 309 75.888000 2 651 1 chr2A.!!$F1 649
22 TraesCS5B01G552400 chr7B 55468451 55469196 745 False 364.000000 364 76.361000 2 718 1 chr7B.!!$F1 716
23 TraesCS5B01G552400 chr7B 202352958 202353577 619 False 307.000000 307 76.324000 2 626 1 chr7B.!!$F3 624
24 TraesCS5B01G552400 chr7B 653979070 653979816 746 True 268.000000 268 73.907000 2 726 1 chr7B.!!$R1 724
25 TraesCS5B01G552400 chr2D 423614765 423615511 746 True 346.000000 346 76.115000 2 721 1 chr2D.!!$R1 719
26 TraesCS5B01G552400 chr1A 584877101 584877701 600 False 254.000000 254 74.920000 2 617 1 chr1A.!!$F2 615
27 TraesCS5B01G552400 chr5A 491236756 491237481 725 False 279.000000 279 74.114000 1 717 1 chr5A.!!$F1 716


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
748 785 0.034756 CAGATTGTGGTGACCCGTGA 59.965 55.0 0.00 0.00 0.00 4.35 F
1631 1747 0.032952 GGCGACTGGGTGCGATATTA 59.967 55.0 0.00 0.00 0.00 0.98 F
1751 1867 0.032678 CTTGGTCCTCGGATGATCGG 59.967 60.0 0.00 0.00 0.00 4.18 F
2055 2171 0.036388 TGTTGGACCAAGGCGAGATC 60.036 55.0 7.31 0.00 0.00 2.75 F
2150 2266 0.032678 CCGTATGCGAGCCAGAGATT 59.967 55.0 4.21 0.00 41.33 2.40 F
3085 3270 0.033504 CGGTGGTACTCTGCAGTTGT 59.966 55.0 14.67 15.77 33.62 3.32 F
3976 4171 0.032678 CTTGGTCCTCGGATGATCGG 59.967 60.0 0.00 0.00 0.00 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1732 1848 0.032678 CCGATCATCCGAGGACCAAG 59.967 60.0 0.0 0.0 0.00 3.61 R
2982 3164 0.034896 ATGTCACTCGCTTTTCCCGT 59.965 50.0 0.0 0.0 0.00 5.28 R
3083 3268 0.107410 GACCACACCACTCAACCACA 60.107 55.0 0.0 0.0 0.00 4.17 R
3108 3293 0.679002 CCGGTCGAGTCTCAAGGGTA 60.679 60.0 0.0 0.0 0.00 3.69 R
3519 3707 0.887387 GCACCGCTGGTACTCCAAAA 60.887 55.0 0.0 0.0 43.81 2.44 R
4914 5348 0.106708 TCACCGCTGCAAACTTCTCT 59.893 50.0 0.0 0.0 0.00 3.10 R
5334 5798 0.038526 CAACTTGCCGTCGTACTCCT 60.039 55.0 0.0 0.0 0.00 3.69 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
32 36 2.432628 CTTGGGACGAGCCGACAC 60.433 66.667 1.50 0.00 37.63 3.67
57 62 2.125065 AACACGGTTGCGGTGTCA 60.125 55.556 11.75 0.00 44.81 3.58
95 101 1.250840 GGTTGCCAGGGAATGTGACC 61.251 60.000 0.00 0.00 0.00 4.02
281 318 1.021390 CCACACGTCCTCCAATGAGC 61.021 60.000 0.00 0.00 37.29 4.26
291 328 0.179004 TCCAATGAGCCAACAACGGT 60.179 50.000 0.00 0.00 0.00 4.83
309 346 1.756950 TTGTCCTAGCGCCGGATCT 60.757 57.895 17.76 2.81 32.25 2.75
363 400 2.103340 GAAGGAGTCCGAGCGCTC 59.897 66.667 27.64 27.64 0.00 5.03
423 460 0.693767 AGGAAGGCCATCTCCTCCTG 60.694 60.000 13.83 0.00 34.58 3.86
429 466 3.174265 CATCTCCTCCTGGGGGCC 61.174 72.222 8.08 0.00 34.93 5.80
446 483 2.415010 CGAGTGGGATGAGCTCGG 59.585 66.667 9.64 0.00 45.60 4.63
447 484 2.818132 GAGTGGGATGAGCTCGGG 59.182 66.667 9.64 0.00 0.00 5.14
448 485 1.758514 GAGTGGGATGAGCTCGGGA 60.759 63.158 9.64 0.00 0.00 5.14
449 486 1.074926 AGTGGGATGAGCTCGGGAT 60.075 57.895 9.64 0.00 0.00 3.85
450 487 1.118356 AGTGGGATGAGCTCGGGATC 61.118 60.000 9.64 6.61 0.00 3.36
451 488 2.203082 TGGGATGAGCTCGGGATCG 61.203 63.158 9.64 0.00 37.82 3.69
452 489 1.903890 GGGATGAGCTCGGGATCGA 60.904 63.158 9.64 0.00 43.86 3.59
453 490 1.254284 GGGATGAGCTCGGGATCGAT 61.254 60.000 9.64 0.00 45.04 3.59
454 491 0.108898 GGATGAGCTCGGGATCGATG 60.109 60.000 9.64 0.00 45.04 3.84
455 492 0.108898 GATGAGCTCGGGATCGATGG 60.109 60.000 9.64 0.00 45.04 3.51
456 493 0.540597 ATGAGCTCGGGATCGATGGA 60.541 55.000 9.64 0.00 45.04 3.41
457 494 0.540597 TGAGCTCGGGATCGATGGAT 60.541 55.000 9.64 0.00 45.04 3.41
458 495 0.172352 GAGCTCGGGATCGATGGATC 59.828 60.000 0.54 9.09 46.85 3.36
459 496 0.251564 AGCTCGGGATCGATGGATCT 60.252 55.000 16.17 0.00 46.77 2.75
460 497 0.108898 GCTCGGGATCGATGGATCTG 60.109 60.000 16.17 10.02 46.77 2.90
461 498 1.539157 CTCGGGATCGATGGATCTGA 58.461 55.000 16.17 13.14 46.77 3.27
462 499 1.889170 CTCGGGATCGATGGATCTGAA 59.111 52.381 16.17 2.89 46.77 3.02
463 500 2.297315 CTCGGGATCGATGGATCTGAAA 59.703 50.000 16.17 1.38 46.77 2.69
464 501 2.297315 TCGGGATCGATGGATCTGAAAG 59.703 50.000 16.17 5.30 46.77 2.62
465 502 2.036475 CGGGATCGATGGATCTGAAAGT 59.964 50.000 16.17 0.00 46.77 2.66
466 503 3.397482 GGGATCGATGGATCTGAAAGTG 58.603 50.000 16.17 0.00 46.77 3.16
467 504 3.070159 GGGATCGATGGATCTGAAAGTGA 59.930 47.826 16.17 0.00 46.77 3.41
468 505 4.443457 GGGATCGATGGATCTGAAAGTGAA 60.443 45.833 16.17 0.00 46.77 3.18
469 506 4.749099 GGATCGATGGATCTGAAAGTGAAG 59.251 45.833 16.17 0.00 46.77 3.02
470 507 4.128925 TCGATGGATCTGAAAGTGAAGG 57.871 45.455 0.00 0.00 33.76 3.46
471 508 3.769300 TCGATGGATCTGAAAGTGAAGGA 59.231 43.478 0.00 0.00 33.76 3.36
472 509 4.118410 CGATGGATCTGAAAGTGAAGGAG 58.882 47.826 0.00 0.00 33.76 3.69
473 510 4.382470 CGATGGATCTGAAAGTGAAGGAGT 60.382 45.833 0.00 0.00 33.76 3.85
474 511 5.163509 CGATGGATCTGAAAGTGAAGGAGTA 60.164 44.000 0.00 0.00 33.76 2.59
475 512 5.667539 TGGATCTGAAAGTGAAGGAGTAG 57.332 43.478 0.00 0.00 33.76 2.57
476 513 4.467795 TGGATCTGAAAGTGAAGGAGTAGG 59.532 45.833 0.00 0.00 33.76 3.18
477 514 4.712337 GGATCTGAAAGTGAAGGAGTAGGA 59.288 45.833 0.00 0.00 33.76 2.94
478 515 5.394773 GGATCTGAAAGTGAAGGAGTAGGAC 60.395 48.000 0.00 0.00 33.76 3.85
479 516 3.833070 TCTGAAAGTGAAGGAGTAGGACC 59.167 47.826 0.00 0.00 33.76 4.46
480 517 2.904434 TGAAAGTGAAGGAGTAGGACCC 59.096 50.000 0.00 0.00 0.00 4.46
481 518 1.558233 AAGTGAAGGAGTAGGACCCG 58.442 55.000 0.00 0.00 0.00 5.28
482 519 0.971447 AGTGAAGGAGTAGGACCCGC 60.971 60.000 0.00 0.00 0.00 6.13
483 520 0.971447 GTGAAGGAGTAGGACCCGCT 60.971 60.000 0.00 0.00 0.00 5.52
484 521 0.970937 TGAAGGAGTAGGACCCGCTG 60.971 60.000 0.00 0.00 0.00 5.18
485 522 0.971447 GAAGGAGTAGGACCCGCTGT 60.971 60.000 0.00 0.00 0.00 4.40
486 523 0.971447 AAGGAGTAGGACCCGCTGTC 60.971 60.000 0.00 0.00 43.67 3.51
493 530 2.509336 GACCCGCTGTCCGTCATG 60.509 66.667 0.00 0.00 38.09 3.07
494 531 3.296709 GACCCGCTGTCCGTCATGT 62.297 63.158 0.00 0.00 38.09 3.21
495 532 2.509336 CCCGCTGTCCGTCATGTC 60.509 66.667 0.00 0.00 34.38 3.06
496 533 2.880879 CCGCTGTCCGTCATGTCG 60.881 66.667 5.32 5.32 34.38 4.35
522 559 2.879907 CGAAGGCGAGTTCGGGTA 59.120 61.111 10.74 0.00 44.53 3.69
523 560 1.226603 CGAAGGCGAGTTCGGGTAG 60.227 63.158 10.74 0.00 44.53 3.18
524 561 1.518792 GAAGGCGAGTTCGGGTAGC 60.519 63.158 3.50 0.00 40.23 3.58
525 562 3.352338 AAGGCGAGTTCGGGTAGCG 62.352 63.158 3.50 0.00 40.23 4.26
526 563 4.867599 GGCGAGTTCGGGTAGCGG 62.868 72.222 3.50 0.00 40.23 5.52
527 564 3.818787 GCGAGTTCGGGTAGCGGA 61.819 66.667 3.50 0.00 40.23 5.54
528 565 2.408022 CGAGTTCGGGTAGCGGAG 59.592 66.667 2.31 0.00 35.37 4.63
529 566 3.753070 CGAGTTCGGGTAGCGGAGC 62.753 68.421 8.03 8.03 46.02 4.70
542 579 3.894257 CGGAGCAGAGTGAAGTGAA 57.106 52.632 0.00 0.00 0.00 3.18
543 580 1.707632 CGGAGCAGAGTGAAGTGAAG 58.292 55.000 0.00 0.00 0.00 3.02
544 581 1.000283 CGGAGCAGAGTGAAGTGAAGT 60.000 52.381 0.00 0.00 0.00 3.01
545 582 2.411904 GGAGCAGAGTGAAGTGAAGTG 58.588 52.381 0.00 0.00 0.00 3.16
546 583 2.411904 GAGCAGAGTGAAGTGAAGTGG 58.588 52.381 0.00 0.00 0.00 4.00
547 584 0.871057 GCAGAGTGAAGTGAAGTGGC 59.129 55.000 0.00 0.00 0.00 5.01
548 585 1.542108 GCAGAGTGAAGTGAAGTGGCT 60.542 52.381 0.00 0.00 0.00 4.75
549 586 2.289072 GCAGAGTGAAGTGAAGTGGCTA 60.289 50.000 0.00 0.00 0.00 3.93
550 587 3.583806 CAGAGTGAAGTGAAGTGGCTAG 58.416 50.000 0.00 0.00 0.00 3.42
551 588 2.564947 AGAGTGAAGTGAAGTGGCTAGG 59.435 50.000 0.00 0.00 0.00 3.02
552 589 1.625818 AGTGAAGTGAAGTGGCTAGGG 59.374 52.381 0.00 0.00 0.00 3.53
553 590 1.348036 GTGAAGTGAAGTGGCTAGGGT 59.652 52.381 0.00 0.00 0.00 4.34
554 591 2.054799 TGAAGTGAAGTGGCTAGGGTT 58.945 47.619 0.00 0.00 0.00 4.11
555 592 2.441750 TGAAGTGAAGTGGCTAGGGTTT 59.558 45.455 0.00 0.00 0.00 3.27
556 593 3.117663 TGAAGTGAAGTGGCTAGGGTTTT 60.118 43.478 0.00 0.00 0.00 2.43
557 594 2.863809 AGTGAAGTGGCTAGGGTTTTG 58.136 47.619 0.00 0.00 0.00 2.44
558 595 2.174854 AGTGAAGTGGCTAGGGTTTTGT 59.825 45.455 0.00 0.00 0.00 2.83
559 596 2.552743 GTGAAGTGGCTAGGGTTTTGTC 59.447 50.000 0.00 0.00 0.00 3.18
560 597 2.160205 GAAGTGGCTAGGGTTTTGTCC 58.840 52.381 0.00 0.00 0.00 4.02
561 598 0.036306 AGTGGCTAGGGTTTTGTCCG 59.964 55.000 0.00 0.00 0.00 4.79
562 599 0.958876 GTGGCTAGGGTTTTGTCCGG 60.959 60.000 0.00 0.00 0.00 5.14
563 600 2.044555 GGCTAGGGTTTTGTCCGGC 61.045 63.158 0.00 0.00 0.00 6.13
564 601 1.302993 GCTAGGGTTTTGTCCGGCA 60.303 57.895 0.00 0.00 0.00 5.69
565 602 0.891904 GCTAGGGTTTTGTCCGGCAA 60.892 55.000 0.00 1.09 34.87 4.52
566 603 1.165270 CTAGGGTTTTGTCCGGCAAG 58.835 55.000 10.48 0.00 38.47 4.01
567 604 0.891904 TAGGGTTTTGTCCGGCAAGC 60.892 55.000 10.48 8.35 38.47 4.01
568 605 2.050442 GGTTTTGTCCGGCAAGCG 60.050 61.111 10.48 0.00 38.47 4.68
569 606 2.050442 GTTTTGTCCGGCAAGCGG 60.050 61.111 10.48 0.00 38.47 5.52
570 607 2.203224 TTTTGTCCGGCAAGCGGA 60.203 55.556 10.48 0.00 38.47 5.54
571 608 1.602323 TTTTGTCCGGCAAGCGGAT 60.602 52.632 5.86 0.00 38.47 4.18
572 609 1.861542 TTTTGTCCGGCAAGCGGATG 61.862 55.000 5.86 0.00 38.47 3.51
573 610 4.776322 TGTCCGGCAAGCGGATGG 62.776 66.667 5.86 0.00 37.88 3.51
579 616 4.467084 GCAAGCGGATGGGGACGA 62.467 66.667 0.00 0.00 0.00 4.20
580 617 2.267642 CAAGCGGATGGGGACGAA 59.732 61.111 0.00 0.00 0.00 3.85
581 618 1.153168 CAAGCGGATGGGGACGAAT 60.153 57.895 0.00 0.00 0.00 3.34
582 619 0.105964 CAAGCGGATGGGGACGAATA 59.894 55.000 0.00 0.00 0.00 1.75
583 620 1.056660 AAGCGGATGGGGACGAATAT 58.943 50.000 0.00 0.00 0.00 1.28
584 621 1.933021 AGCGGATGGGGACGAATATA 58.067 50.000 0.00 0.00 0.00 0.86
585 622 2.467880 AGCGGATGGGGACGAATATAT 58.532 47.619 0.00 0.00 0.00 0.86
586 623 2.168521 AGCGGATGGGGACGAATATATG 59.831 50.000 0.00 0.00 0.00 1.78
587 624 2.093658 GCGGATGGGGACGAATATATGT 60.094 50.000 0.00 0.00 0.00 2.29
588 625 3.521560 CGGATGGGGACGAATATATGTG 58.478 50.000 0.00 0.00 0.00 3.21
589 626 3.678806 CGGATGGGGACGAATATATGTGG 60.679 52.174 0.00 0.00 0.00 4.17
590 627 3.370527 GGATGGGGACGAATATATGTGGG 60.371 52.174 0.00 0.00 0.00 4.61
591 628 2.979177 TGGGGACGAATATATGTGGGA 58.021 47.619 0.00 0.00 0.00 4.37
592 629 3.526899 TGGGGACGAATATATGTGGGAT 58.473 45.455 0.00 0.00 0.00 3.85
593 630 3.913799 TGGGGACGAATATATGTGGGATT 59.086 43.478 0.00 0.00 0.00 3.01
594 631 4.261801 GGGGACGAATATATGTGGGATTG 58.738 47.826 0.00 0.00 0.00 2.67
595 632 4.261801 GGGACGAATATATGTGGGATTGG 58.738 47.826 0.00 0.00 0.00 3.16
596 633 4.261801 GGACGAATATATGTGGGATTGGG 58.738 47.826 0.00 0.00 0.00 4.12
597 634 4.263331 GGACGAATATATGTGGGATTGGGT 60.263 45.833 0.00 0.00 0.00 4.51
598 635 5.046159 GGACGAATATATGTGGGATTGGGTA 60.046 44.000 0.00 0.00 0.00 3.69
599 636 6.049955 ACGAATATATGTGGGATTGGGTAG 57.950 41.667 0.00 0.00 0.00 3.18
600 637 5.783360 ACGAATATATGTGGGATTGGGTAGA 59.217 40.000 0.00 0.00 0.00 2.59
601 638 6.271391 ACGAATATATGTGGGATTGGGTAGAA 59.729 38.462 0.00 0.00 0.00 2.10
602 639 6.594159 CGAATATATGTGGGATTGGGTAGAAC 59.406 42.308 0.00 0.00 0.00 3.01
603 640 7.401060 AATATATGTGGGATTGGGTAGAACA 57.599 36.000 0.00 0.00 0.00 3.18
604 641 5.725551 ATATGTGGGATTGGGTAGAACAA 57.274 39.130 0.00 0.00 0.00 2.83
605 642 3.149005 TGTGGGATTGGGTAGAACAAC 57.851 47.619 0.00 0.00 0.00 3.32
606 643 2.443632 TGTGGGATTGGGTAGAACAACA 59.556 45.455 0.00 0.00 0.00 3.33
607 644 3.075283 TGTGGGATTGGGTAGAACAACAT 59.925 43.478 0.00 0.00 0.00 2.71
608 645 3.443681 GTGGGATTGGGTAGAACAACATG 59.556 47.826 0.00 0.00 0.00 3.21
609 646 3.023832 GGGATTGGGTAGAACAACATGG 58.976 50.000 0.00 0.00 0.00 3.66
610 647 3.023832 GGATTGGGTAGAACAACATGGG 58.976 50.000 0.00 0.00 0.00 4.00
611 648 1.917872 TTGGGTAGAACAACATGGGC 58.082 50.000 0.00 0.00 0.00 5.36
612 649 0.039035 TGGGTAGAACAACATGGGCC 59.961 55.000 0.00 0.00 0.00 5.80
613 650 1.029947 GGGTAGAACAACATGGGCCG 61.030 60.000 0.00 0.00 0.00 6.13
614 651 1.029947 GGTAGAACAACATGGGCCGG 61.030 60.000 0.00 0.00 0.00 6.13
615 652 1.029947 GTAGAACAACATGGGCCGGG 61.030 60.000 2.18 0.00 0.00 5.73
616 653 1.493854 TAGAACAACATGGGCCGGGT 61.494 55.000 2.18 0.00 0.00 5.28
617 654 1.906333 GAACAACATGGGCCGGGTT 60.906 57.895 2.18 6.79 0.00 4.11
618 655 1.458588 AACAACATGGGCCGGGTTT 60.459 52.632 2.18 0.81 0.00 3.27
619 656 1.753368 AACAACATGGGCCGGGTTTG 61.753 55.000 2.18 7.51 0.00 2.93
620 657 1.905843 CAACATGGGCCGGGTTTGA 60.906 57.895 2.18 0.00 0.00 2.69
621 658 1.906333 AACATGGGCCGGGTTTGAC 60.906 57.895 2.18 0.00 0.00 3.18
622 659 3.439540 CATGGGCCGGGTTTGACG 61.440 66.667 2.18 0.00 0.00 4.35
623 660 3.961414 ATGGGCCGGGTTTGACGT 61.961 61.111 2.18 0.00 0.00 4.34
624 661 4.939368 TGGGCCGGGTTTGACGTG 62.939 66.667 2.18 0.00 0.00 4.49
650 687 4.008933 GCCCGAGCGCCTCCATAT 62.009 66.667 2.29 0.00 0.00 1.78
651 688 2.262915 CCCGAGCGCCTCCATATC 59.737 66.667 2.29 0.00 0.00 1.63
652 689 2.574018 CCCGAGCGCCTCCATATCA 61.574 63.158 2.29 0.00 0.00 2.15
653 690 1.080230 CCGAGCGCCTCCATATCAG 60.080 63.158 2.29 0.00 0.00 2.90
654 691 1.735920 CGAGCGCCTCCATATCAGC 60.736 63.158 2.29 0.00 0.00 4.26
655 692 1.375268 GAGCGCCTCCATATCAGCC 60.375 63.158 2.29 0.00 0.00 4.85
656 693 1.825281 GAGCGCCTCCATATCAGCCT 61.825 60.000 2.29 0.00 0.00 4.58
657 694 0.542938 AGCGCCTCCATATCAGCCTA 60.543 55.000 2.29 0.00 0.00 3.93
658 695 0.539051 GCGCCTCCATATCAGCCTAT 59.461 55.000 0.00 0.00 0.00 2.57
659 696 1.757118 GCGCCTCCATATCAGCCTATA 59.243 52.381 0.00 0.00 0.00 1.31
660 697 2.366916 GCGCCTCCATATCAGCCTATAT 59.633 50.000 0.00 0.00 0.00 0.86
661 698 3.574396 GCGCCTCCATATCAGCCTATATA 59.426 47.826 0.00 0.00 0.00 0.86
662 699 4.221703 GCGCCTCCATATCAGCCTATATAT 59.778 45.833 0.00 0.00 0.00 0.86
663 700 5.279708 GCGCCTCCATATCAGCCTATATATT 60.280 44.000 0.00 0.00 0.00 1.28
664 701 6.742644 GCGCCTCCATATCAGCCTATATATTT 60.743 42.308 0.00 0.00 0.00 1.40
665 702 6.648310 CGCCTCCATATCAGCCTATATATTTG 59.352 42.308 0.00 0.00 0.00 2.32
666 703 7.471959 CGCCTCCATATCAGCCTATATATTTGA 60.472 40.741 0.00 0.00 0.00 2.69
667 704 7.877097 GCCTCCATATCAGCCTATATATTTGAG 59.123 40.741 0.00 0.00 0.00 3.02
668 705 8.932610 CCTCCATATCAGCCTATATATTTGAGT 58.067 37.037 0.00 0.00 0.00 3.41
684 721 5.643379 TTTGAGTTGAATATGAAGGGTGC 57.357 39.130 0.00 0.00 0.00 5.01
685 722 3.620488 TGAGTTGAATATGAAGGGTGCC 58.380 45.455 0.00 0.00 0.00 5.01
686 723 3.010027 TGAGTTGAATATGAAGGGTGCCA 59.990 43.478 0.00 0.00 0.00 4.92
687 724 4.016444 GAGTTGAATATGAAGGGTGCCAA 58.984 43.478 0.00 0.00 0.00 4.52
688 725 4.613437 AGTTGAATATGAAGGGTGCCAAT 58.387 39.130 0.00 0.00 0.00 3.16
689 726 4.646492 AGTTGAATATGAAGGGTGCCAATC 59.354 41.667 0.00 0.00 0.00 2.67
690 727 4.248174 TGAATATGAAGGGTGCCAATCA 57.752 40.909 0.00 0.00 0.00 2.57
691 728 4.209538 TGAATATGAAGGGTGCCAATCAG 58.790 43.478 0.00 0.00 0.00 2.90
692 729 2.057137 TATGAAGGGTGCCAATCAGC 57.943 50.000 0.00 0.00 42.24 4.26
701 738 2.442643 CCAATCAGCCCGGGCATT 60.443 61.111 45.13 33.06 44.88 3.56
702 739 2.059786 CCAATCAGCCCGGGCATTT 61.060 57.895 45.13 30.86 44.88 2.32
703 740 0.754957 CCAATCAGCCCGGGCATTTA 60.755 55.000 45.13 27.49 44.88 1.40
704 741 1.110442 CAATCAGCCCGGGCATTTAA 58.890 50.000 45.13 25.62 44.88 1.52
705 742 1.067516 CAATCAGCCCGGGCATTTAAG 59.932 52.381 45.13 26.20 44.88 1.85
706 743 0.468029 ATCAGCCCGGGCATTTAAGG 60.468 55.000 45.13 24.27 44.88 2.69
707 744 2.442087 AGCCCGGGCATTTAAGGC 60.442 61.111 45.13 17.02 44.88 4.35
714 751 3.434258 GGCATTTAAGGCCCGTTTG 57.566 52.632 9.74 0.00 45.87 2.93
715 752 0.892063 GGCATTTAAGGCCCGTTTGA 59.108 50.000 9.74 0.00 45.87 2.69
716 753 1.135112 GGCATTTAAGGCCCGTTTGAG 60.135 52.381 9.74 0.00 45.87 3.02
717 754 1.816224 GCATTTAAGGCCCGTTTGAGA 59.184 47.619 0.00 0.00 0.00 3.27
718 755 2.415491 GCATTTAAGGCCCGTTTGAGAC 60.415 50.000 0.00 0.00 0.00 3.36
726 763 3.917870 CGTTTGAGACGCGTCTGT 58.082 55.556 43.61 23.88 45.86 3.41
727 764 1.482955 CGTTTGAGACGCGTCTGTG 59.517 57.895 43.61 23.79 45.86 3.66
728 765 1.201825 GTTTGAGACGCGTCTGTGC 59.798 57.895 43.61 29.36 40.61 4.57
729 766 1.954146 TTTGAGACGCGTCTGTGCC 60.954 57.895 43.61 29.01 40.61 5.01
730 767 2.636778 TTTGAGACGCGTCTGTGCCA 62.637 55.000 43.61 31.16 40.61 4.92
731 768 2.807045 GAGACGCGTCTGTGCCAG 60.807 66.667 43.61 0.00 40.61 4.85
732 769 3.268965 GAGACGCGTCTGTGCCAGA 62.269 63.158 43.61 1.25 40.61 3.86
733 770 2.125912 GACGCGTCTGTGCCAGAT 60.126 61.111 31.12 0.00 42.73 2.90
734 771 1.738099 GACGCGTCTGTGCCAGATT 60.738 57.895 31.12 0.00 42.73 2.40
735 772 1.959899 GACGCGTCTGTGCCAGATTG 61.960 60.000 31.12 5.86 42.73 2.67
736 773 2.029288 CGCGTCTGTGCCAGATTGT 61.029 57.895 0.00 0.00 42.73 2.71
737 774 1.499056 GCGTCTGTGCCAGATTGTG 59.501 57.895 7.95 1.94 42.73 3.33
745 782 4.301505 CCAGATTGTGGTGACCCG 57.698 61.111 0.00 0.00 42.17 5.28
746 783 1.374947 CCAGATTGTGGTGACCCGT 59.625 57.895 0.00 0.00 42.17 5.28
747 784 0.955428 CCAGATTGTGGTGACCCGTG 60.955 60.000 0.00 0.00 42.17 4.94
748 785 0.034756 CAGATTGTGGTGACCCGTGA 59.965 55.000 0.00 0.00 0.00 4.35
749 786 0.321671 AGATTGTGGTGACCCGTGAG 59.678 55.000 0.00 0.00 0.00 3.51
750 787 0.320374 GATTGTGGTGACCCGTGAGA 59.680 55.000 0.00 0.00 0.00 3.27
751 788 0.321671 ATTGTGGTGACCCGTGAGAG 59.678 55.000 0.00 0.00 0.00 3.20
752 789 0.757561 TTGTGGTGACCCGTGAGAGA 60.758 55.000 0.00 0.00 0.00 3.10
753 790 1.289380 GTGGTGACCCGTGAGAGAC 59.711 63.158 0.00 0.00 0.00 3.36
754 791 1.906824 TGGTGACCCGTGAGAGACC 60.907 63.158 0.00 0.00 0.00 3.85
755 792 2.647158 GGTGACCCGTGAGAGACCC 61.647 68.421 0.00 0.00 0.00 4.46
756 793 2.675423 TGACCCGTGAGAGACCCG 60.675 66.667 0.00 0.00 0.00 5.28
757 794 3.450115 GACCCGTGAGAGACCCGG 61.450 72.222 0.00 0.00 41.37 5.73
781 821 3.430929 GGACTCTGCCGAAGATACACATT 60.431 47.826 0.00 0.00 33.29 2.71
789 829 3.492656 CCGAAGATACACATTGGACGGAT 60.493 47.826 0.00 0.00 40.16 4.18
807 847 3.535561 GGATACATGTGTCCACTTCAGG 58.464 50.000 30.57 0.00 40.19 3.86
814 854 0.764369 TGTCCACTTCAGGTCCTGCT 60.764 55.000 14.64 0.00 0.00 4.24
822 862 3.699894 AGGTCCTGCTGGCAGACG 61.700 66.667 20.86 7.62 46.30 4.18
824 864 4.767255 GTCCTGCTGGCAGACGGG 62.767 72.222 20.86 22.20 46.30 5.28
842 882 1.469335 GGGACGGAACACCTCACTCA 61.469 60.000 0.00 0.00 0.00 3.41
867 907 3.431233 CACACTCACATGTCATCACAGTC 59.569 47.826 0.00 0.00 35.41 3.51
869 909 3.431233 CACTCACATGTCATCACAGTCAC 59.569 47.826 0.00 0.00 35.41 3.67
871 911 3.392882 TCACATGTCATCACAGTCACAC 58.607 45.455 0.00 0.00 35.41 3.82
876 916 2.969262 TGTCATCACAGTCACACCCTTA 59.031 45.455 0.00 0.00 0.00 2.69
884 924 9.342308 CATCACAGTCACACCCTTAATAATAAT 57.658 33.333 0.00 0.00 0.00 1.28
894 934 5.303333 ACCCTTAATAATAATTTGCACCGGG 59.697 40.000 6.32 0.00 0.00 5.73
896 936 6.210584 CCCTTAATAATAATTTGCACCGGGAT 59.789 38.462 6.32 0.00 0.00 3.85
897 937 7.312899 CCTTAATAATAATTTGCACCGGGATC 58.687 38.462 6.32 0.00 0.00 3.36
898 938 7.176690 CCTTAATAATAATTTGCACCGGGATCT 59.823 37.037 6.32 0.00 0.00 2.75
899 939 6.575162 AATAATAATTTGCACCGGGATCTC 57.425 37.500 6.32 0.00 0.00 2.75
900 940 3.864789 ATAATTTGCACCGGGATCTCT 57.135 42.857 6.32 0.00 0.00 3.10
901 941 1.755179 AATTTGCACCGGGATCTCTG 58.245 50.000 6.32 0.00 0.00 3.35
902 942 0.749454 ATTTGCACCGGGATCTCTGC 60.749 55.000 6.32 5.87 0.00 4.26
903 943 1.841302 TTTGCACCGGGATCTCTGCT 61.841 55.000 6.32 0.00 0.00 4.24
904 944 2.107953 GCACCGGGATCTCTGCTC 59.892 66.667 6.32 0.00 0.00 4.26
905 945 2.725312 GCACCGGGATCTCTGCTCA 61.725 63.158 6.32 0.00 0.00 4.26
935 975 3.711704 CCCTTCTCCAGCTATAAGAACCA 59.288 47.826 0.00 0.00 0.00 3.67
936 976 4.164221 CCCTTCTCCAGCTATAAGAACCAA 59.836 45.833 0.00 0.00 0.00 3.67
937 977 5.119694 CCTTCTCCAGCTATAAGAACCAAC 58.880 45.833 0.00 0.00 0.00 3.77
938 978 5.338381 CCTTCTCCAGCTATAAGAACCAACA 60.338 44.000 0.00 0.00 0.00 3.33
939 979 5.755409 TCTCCAGCTATAAGAACCAACAA 57.245 39.130 0.00 0.00 0.00 2.83
940 980 5.488341 TCTCCAGCTATAAGAACCAACAAC 58.512 41.667 0.00 0.00 0.00 3.32
941 981 4.585879 TCCAGCTATAAGAACCAACAACC 58.414 43.478 0.00 0.00 0.00 3.77
942 982 3.694566 CCAGCTATAAGAACCAACAACCC 59.305 47.826 0.00 0.00 0.00 4.11
943 983 3.694566 CAGCTATAAGAACCAACAACCCC 59.305 47.826 0.00 0.00 0.00 4.95
948 1000 3.802852 GAACCAACAACCCCGGCCT 62.803 63.158 0.00 0.00 0.00 5.19
952 1004 3.647771 AACAACCCCGGCCTCTCC 61.648 66.667 0.00 0.00 0.00 3.71
974 1031 1.941812 CCCAACTGACGCAGAACAC 59.058 57.895 12.77 0.00 35.18 3.32
1009 1072 2.858622 GCAGCAGCAATGGACTACA 58.141 52.632 0.00 0.00 41.58 2.74
1015 1078 2.932614 GCAGCAATGGACTACAGTACTG 59.067 50.000 21.44 21.44 0.00 2.74
1016 1079 3.368427 GCAGCAATGGACTACAGTACTGA 60.368 47.826 29.30 11.77 31.31 3.41
1017 1080 4.820897 CAGCAATGGACTACAGTACTGAA 58.179 43.478 29.30 7.59 31.31 3.02
1130 1193 4.028490 CCCCGCTGCCAAGGTACA 62.028 66.667 0.00 0.00 0.00 2.90
1131 1194 2.746277 CCCGCTGCCAAGGTACAC 60.746 66.667 0.00 0.00 0.00 2.90
1133 1196 2.746277 CGCTGCCAAGGTACACCC 60.746 66.667 0.00 0.00 36.42 4.61
1134 1197 2.361230 GCTGCCAAGGTACACCCC 60.361 66.667 0.00 0.00 36.42 4.95
1138 1201 0.253441 TGCCAAGGTACACCCCCTAT 60.253 55.000 0.00 0.00 36.42 2.57
1140 1203 1.137697 CCAAGGTACACCCCCTATCC 58.862 60.000 0.00 0.00 36.42 2.59
1142 1205 2.418669 CAAGGTACACCCCCTATCCAT 58.581 52.381 0.00 0.00 36.42 3.41
1143 1206 3.593942 CAAGGTACACCCCCTATCCATA 58.406 50.000 0.00 0.00 36.42 2.74
1144 1207 4.175962 CAAGGTACACCCCCTATCCATAT 58.824 47.826 0.00 0.00 36.42 1.78
1145 1208 3.803340 AGGTACACCCCCTATCCATATG 58.197 50.000 0.00 0.00 36.42 1.78
1146 1209 2.238898 GGTACACCCCCTATCCATATGC 59.761 54.545 0.00 0.00 0.00 3.14
1256 1369 1.494721 ACCACTTCAATCACACCACCT 59.505 47.619 0.00 0.00 0.00 4.00
1258 1371 2.294233 CCACTTCAATCACACCACCTTG 59.706 50.000 0.00 0.00 0.00 3.61
1279 1392 7.566879 ACCTTGGGATGCATGGTTAATTAATTA 59.433 33.333 2.46 3.71 0.00 1.40
1280 1393 8.428063 CCTTGGGATGCATGGTTAATTAATTAA 58.572 33.333 15.19 15.19 0.00 1.40
1299 1412 3.629142 AATTTCCTCCTAGGTGAACCG 57.371 47.619 12.54 0.00 42.08 4.44
1370 1483 4.365723 GTGTGCTACCGCTAGCTTAATTA 58.634 43.478 13.93 0.00 45.20 1.40
1371 1484 4.444720 GTGTGCTACCGCTAGCTTAATTAG 59.555 45.833 13.93 6.83 45.20 1.73
1372 1485 3.429207 GTGCTACCGCTAGCTTAATTAGC 59.571 47.826 13.93 15.70 45.20 3.09
1391 1507 6.569179 TTAGCAGAGTGGTTGGTTAATTTC 57.431 37.500 0.00 0.00 0.00 2.17
1399 1515 3.570550 TGGTTGGTTAATTTCCTTGTCGG 59.429 43.478 0.00 0.00 0.00 4.79
1400 1516 3.822167 GGTTGGTTAATTTCCTTGTCGGA 59.178 43.478 0.00 0.00 41.06 4.55
1401 1517 4.320714 GGTTGGTTAATTTCCTTGTCGGAC 60.321 45.833 0.00 0.00 42.97 4.79
1402 1518 4.088056 TGGTTAATTTCCTTGTCGGACA 57.912 40.909 6.76 6.76 42.97 4.02
1424 1540 7.277981 GGACATGTTAGAGTTGTGTCGAATATT 59.722 37.037 0.00 0.00 39.93 1.28
1453 1569 5.603813 ACAAGGTAGGTTACAGTTGGACTTA 59.396 40.000 0.00 0.00 31.85 2.24
1463 1579 9.662947 GGTTACAGTTGGACTTATAGTTGTATT 57.337 33.333 0.00 0.00 0.00 1.89
1483 1599 9.567776 TTGTATTGTGTTTACATAGGATATGGG 57.432 33.333 2.15 0.00 36.53 4.00
1514 1630 6.839454 TCCTAGTAGGACACTTGTATCCTAG 58.161 44.000 15.33 0.00 46.10 3.02
1524 1640 5.080337 CACTTGTATCCTAGGCCTCTCATA 58.920 45.833 9.68 0.19 0.00 2.15
1525 1641 5.719085 CACTTGTATCCTAGGCCTCTCATAT 59.281 44.000 9.68 0.00 0.00 1.78
1526 1642 6.892456 CACTTGTATCCTAGGCCTCTCATATA 59.108 42.308 9.68 0.00 0.00 0.86
1527 1643 7.563188 CACTTGTATCCTAGGCCTCTCATATAT 59.437 40.741 9.68 0.00 0.00 0.86
1528 1644 8.792734 ACTTGTATCCTAGGCCTCTCATATATA 58.207 37.037 9.68 0.00 0.00 0.86
1529 1645 9.295825 CTTGTATCCTAGGCCTCTCATATATAG 57.704 40.741 9.68 0.00 0.00 1.31
1530 1646 8.351493 TGTATCCTAGGCCTCTCATATATAGT 57.649 38.462 9.68 0.00 0.00 2.12
1531 1647 8.221251 TGTATCCTAGGCCTCTCATATATAGTG 58.779 40.741 9.68 0.00 0.00 2.74
1532 1648 6.910259 TCCTAGGCCTCTCATATATAGTGA 57.090 41.667 9.68 0.00 0.00 3.41
1533 1649 6.905736 TCCTAGGCCTCTCATATATAGTGAG 58.094 44.000 9.68 10.29 43.46 3.51
1534 1650 6.068010 CCTAGGCCTCTCATATATAGTGAGG 58.932 48.000 9.68 18.87 45.19 3.86
1535 1651 5.544441 AGGCCTCTCATATATAGTGAGGT 57.456 43.478 21.39 10.08 44.57 3.85
1536 1652 6.660147 AGGCCTCTCATATATAGTGAGGTA 57.340 41.667 21.39 6.76 44.57 3.08
1537 1653 6.668645 AGGCCTCTCATATATAGTGAGGTAG 58.331 44.000 21.39 12.53 44.57 3.18
1538 1654 6.448714 AGGCCTCTCATATATAGTGAGGTAGA 59.551 42.308 21.39 6.24 44.57 2.59
1539 1655 6.544564 GGCCTCTCATATATAGTGAGGTAGAC 59.455 46.154 21.39 12.37 44.57 2.59
1540 1656 7.113437 GCCTCTCATATATAGTGAGGTAGACA 58.887 42.308 21.39 5.39 44.57 3.41
1541 1657 7.066525 GCCTCTCATATATAGTGAGGTAGACAC 59.933 44.444 21.39 0.00 44.57 3.67
1542 1658 8.103935 CCTCTCATATATAGTGAGGTAGACACA 58.896 40.741 14.54 0.00 42.58 3.72
1543 1659 8.850007 TCTCATATATAGTGAGGTAGACACAC 57.150 38.462 14.54 0.00 42.58 3.82
1544 1660 7.603024 TCTCATATATAGTGAGGTAGACACACG 59.397 40.741 14.54 0.00 42.58 4.49
1545 1661 7.447594 TCATATATAGTGAGGTAGACACACGA 58.552 38.462 0.00 0.00 40.25 4.35
1546 1662 8.101419 TCATATATAGTGAGGTAGACACACGAT 58.899 37.037 0.00 0.00 40.25 3.73
1547 1663 4.902443 ATAGTGAGGTAGACACACGATG 57.098 45.455 0.00 0.00 40.25 3.84
1549 1665 3.682696 AGTGAGGTAGACACACGATGTA 58.317 45.455 0.00 0.00 43.56 2.29
1550 1666 4.077108 AGTGAGGTAGACACACGATGTAA 58.923 43.478 0.00 0.00 43.56 2.41
1551 1667 4.705507 AGTGAGGTAGACACACGATGTAAT 59.294 41.667 0.00 0.00 43.56 1.89
1552 1668 5.035443 GTGAGGTAGACACACGATGTAATC 58.965 45.833 0.00 0.00 43.56 1.75
1553 1669 4.948004 TGAGGTAGACACACGATGTAATCT 59.052 41.667 0.00 0.00 43.56 2.40
1554 1670 6.037940 GTGAGGTAGACACACGATGTAATCTA 59.962 42.308 0.00 0.00 43.56 1.98
1555 1671 6.771267 TGAGGTAGACACACGATGTAATCTAT 59.229 38.462 0.00 0.00 43.56 1.98
1556 1672 6.971602 AGGTAGACACACGATGTAATCTATG 58.028 40.000 0.00 0.00 43.56 2.23
1557 1673 5.629849 GGTAGACACACGATGTAATCTATGC 59.370 44.000 0.00 0.00 43.56 3.14
1558 1674 4.621991 AGACACACGATGTAATCTATGCC 58.378 43.478 0.00 0.00 43.56 4.40
1559 1675 4.099419 AGACACACGATGTAATCTATGCCA 59.901 41.667 0.00 0.00 43.56 4.92
1560 1676 4.765273 ACACACGATGTAATCTATGCCAA 58.235 39.130 0.00 0.00 42.58 4.52
1561 1677 4.570772 ACACACGATGTAATCTATGCCAAC 59.429 41.667 0.00 0.00 42.58 3.77
1562 1678 4.570369 CACACGATGTAATCTATGCCAACA 59.430 41.667 0.00 0.00 42.58 3.33
1563 1679 5.237127 CACACGATGTAATCTATGCCAACAT 59.763 40.000 0.00 0.00 42.58 2.71
1564 1680 6.423604 CACACGATGTAATCTATGCCAACATA 59.576 38.462 0.00 0.00 42.58 2.29
1565 1681 6.989759 ACACGATGTAATCTATGCCAACATAA 59.010 34.615 0.00 0.00 42.58 1.90
1566 1682 7.661437 ACACGATGTAATCTATGCCAACATAAT 59.339 33.333 0.00 0.00 42.58 1.28
1567 1683 9.150348 CACGATGTAATCTATGCCAACATAATA 57.850 33.333 0.00 0.00 42.58 0.98
1568 1684 9.371136 ACGATGTAATCTATGCCAACATAATAG 57.629 33.333 0.00 0.00 42.58 1.73
1569 1685 8.331022 CGATGTAATCTATGCCAACATAATAGC 58.669 37.037 0.00 0.00 42.58 2.97
1570 1686 9.166173 GATGTAATCTATGCCAACATAATAGCA 57.834 33.333 0.00 0.00 41.17 3.49
1572 1688 9.166173 TGTAATCTATGCCAACATAATAGCATC 57.834 33.333 0.00 0.00 44.48 3.91
1573 1689 6.915544 ATCTATGCCAACATAATAGCATCG 57.084 37.500 0.00 0.00 44.48 3.84
1574 1690 6.036577 TCTATGCCAACATAATAGCATCGA 57.963 37.500 0.00 0.00 44.48 3.59
1575 1691 6.463360 TCTATGCCAACATAATAGCATCGAA 58.537 36.000 0.00 0.00 44.48 3.71
1576 1692 6.934083 TCTATGCCAACATAATAGCATCGAAA 59.066 34.615 0.00 0.00 44.48 3.46
1577 1693 5.168526 TGCCAACATAATAGCATCGAAAC 57.831 39.130 0.00 0.00 0.00 2.78
1578 1694 4.211389 GCCAACATAATAGCATCGAAACG 58.789 43.478 0.00 0.00 0.00 3.60
1579 1695 4.211389 CCAACATAATAGCATCGAAACGC 58.789 43.478 0.00 0.00 0.00 4.84
1580 1696 4.260579 CCAACATAATAGCATCGAAACGCA 60.261 41.667 7.47 0.00 0.00 5.24
1581 1697 4.715520 ACATAATAGCATCGAAACGCAG 57.284 40.909 7.47 0.00 0.00 5.18
1582 1698 3.494626 ACATAATAGCATCGAAACGCAGG 59.505 43.478 7.47 0.00 0.00 4.85
1583 1699 1.299541 AATAGCATCGAAACGCAGGG 58.700 50.000 7.47 0.00 0.00 4.45
1584 1700 0.532862 ATAGCATCGAAACGCAGGGG 60.533 55.000 7.47 0.00 0.00 4.79
1585 1701 1.609635 TAGCATCGAAACGCAGGGGA 61.610 55.000 7.47 0.00 0.00 4.81
1586 1702 2.038269 GCATCGAAACGCAGGGGAA 61.038 57.895 0.00 0.00 0.00 3.97
1587 1703 1.982073 GCATCGAAACGCAGGGGAAG 61.982 60.000 0.00 0.00 0.00 3.46
1588 1704 1.745489 ATCGAAACGCAGGGGAAGC 60.745 57.895 0.00 0.00 0.00 3.86
1589 1705 3.431725 CGAAACGCAGGGGAAGCC 61.432 66.667 0.00 0.00 0.00 4.35
1590 1706 3.431725 GAAACGCAGGGGAAGCCG 61.432 66.667 0.00 0.00 0.00 5.52
1628 1744 3.845259 GGGCGACTGGGTGCGATA 61.845 66.667 0.00 0.00 0.00 2.92
1629 1745 2.421739 GGCGACTGGGTGCGATAT 59.578 61.111 0.00 0.00 0.00 1.63
1630 1746 1.227556 GGCGACTGGGTGCGATATT 60.228 57.895 0.00 0.00 0.00 1.28
1631 1747 0.032952 GGCGACTGGGTGCGATATTA 59.967 55.000 0.00 0.00 0.00 0.98
1632 1748 1.337823 GGCGACTGGGTGCGATATTAT 60.338 52.381 0.00 0.00 0.00 1.28
1633 1749 2.094390 GGCGACTGGGTGCGATATTATA 60.094 50.000 0.00 0.00 0.00 0.98
1634 1750 3.179830 GCGACTGGGTGCGATATTATAG 58.820 50.000 0.00 0.00 0.00 1.31
1635 1751 3.179830 CGACTGGGTGCGATATTATAGC 58.820 50.000 2.17 2.17 0.00 2.97
1636 1752 3.179830 GACTGGGTGCGATATTATAGCG 58.820 50.000 5.46 5.46 41.11 4.26
1637 1753 2.094182 ACTGGGTGCGATATTATAGCGG 60.094 50.000 11.80 0.00 38.15 5.52
1638 1754 1.897133 TGGGTGCGATATTATAGCGGT 59.103 47.619 11.80 0.00 38.15 5.68
1639 1755 2.268298 GGGTGCGATATTATAGCGGTG 58.732 52.381 11.80 0.00 38.15 4.94
1640 1756 2.353406 GGGTGCGATATTATAGCGGTGT 60.353 50.000 11.80 0.00 38.15 4.16
1641 1757 2.921754 GGTGCGATATTATAGCGGTGTC 59.078 50.000 11.80 0.00 38.15 3.67
1642 1758 3.571571 GTGCGATATTATAGCGGTGTCA 58.428 45.455 11.80 0.00 38.15 3.58
1643 1759 4.174009 GTGCGATATTATAGCGGTGTCAT 58.826 43.478 11.80 0.00 38.15 3.06
1644 1760 4.031765 GTGCGATATTATAGCGGTGTCATG 59.968 45.833 11.80 0.00 38.15 3.07
1645 1761 3.551890 GCGATATTATAGCGGTGTCATGG 59.448 47.826 11.80 0.00 38.15 3.66
1646 1762 4.112634 CGATATTATAGCGGTGTCATGGG 58.887 47.826 1.60 0.00 33.31 4.00
1647 1763 2.859165 ATTATAGCGGTGTCATGGGG 57.141 50.000 0.00 0.00 0.00 4.96
1648 1764 1.796017 TTATAGCGGTGTCATGGGGA 58.204 50.000 0.00 0.00 0.00 4.81
1649 1765 1.338107 TATAGCGGTGTCATGGGGAG 58.662 55.000 0.00 0.00 0.00 4.30
1650 1766 1.410850 ATAGCGGTGTCATGGGGAGG 61.411 60.000 0.00 0.00 0.00 4.30
1651 1767 2.523740 TAGCGGTGTCATGGGGAGGA 62.524 60.000 0.00 0.00 0.00 3.71
1652 1768 2.903357 CGGTGTCATGGGGAGGAG 59.097 66.667 0.00 0.00 0.00 3.69
1653 1769 2.592308 GGTGTCATGGGGAGGAGC 59.408 66.667 0.00 0.00 0.00 4.70
1654 1770 2.187946 GTGTCATGGGGAGGAGCG 59.812 66.667 0.00 0.00 0.00 5.03
1655 1771 3.785859 TGTCATGGGGAGGAGCGC 61.786 66.667 0.00 0.00 0.00 5.92
1660 1776 3.792325 ATGGGGAGGAGCGCCCATA 62.792 63.158 11.31 0.00 45.54 2.74
1661 1777 3.631046 GGGGAGGAGCGCCCATAG 61.631 72.222 15.92 0.00 45.54 2.23
1662 1778 2.844839 GGGAGGAGCGCCCATAGT 60.845 66.667 15.92 0.00 43.17 2.12
1663 1779 2.737830 GGAGGAGCGCCCATAGTC 59.262 66.667 15.92 0.69 37.41 2.59
1664 1780 2.134287 GGAGGAGCGCCCATAGTCA 61.134 63.158 15.92 0.00 37.41 3.41
1665 1781 1.476007 GGAGGAGCGCCCATAGTCAT 61.476 60.000 15.92 0.00 37.41 3.06
1666 1782 0.320247 GAGGAGCGCCCATAGTCATG 60.320 60.000 15.92 0.00 37.41 3.07
1667 1783 1.963338 GGAGCGCCCATAGTCATGC 60.963 63.158 2.29 0.00 34.14 4.06
1668 1784 1.963338 GAGCGCCCATAGTCATGCC 60.963 63.158 2.29 0.00 0.00 4.40
1669 1785 2.980233 GCGCCCATAGTCATGCCC 60.980 66.667 0.00 0.00 0.00 5.36
1670 1786 2.281761 CGCCCATAGTCATGCCCC 60.282 66.667 0.00 0.00 0.00 5.80
1671 1787 2.281761 GCCCATAGTCATGCCCCG 60.282 66.667 0.00 0.00 0.00 5.73
1672 1788 2.431683 CCCATAGTCATGCCCCGG 59.568 66.667 0.00 0.00 0.00 5.73
1673 1789 2.431683 CCATAGTCATGCCCCGGG 59.568 66.667 15.80 15.80 0.00 5.73
1674 1790 2.431683 CATAGTCATGCCCCGGGG 59.568 66.667 37.09 37.09 38.57 5.73
1675 1791 2.146724 CATAGTCATGCCCCGGGGA 61.147 63.158 44.86 27.89 37.50 4.81
1676 1792 1.151810 ATAGTCATGCCCCGGGGAT 60.152 57.895 44.86 28.83 37.50 3.85
1680 1796 2.431683 CATGCCCCGGGGATGTAG 59.568 66.667 44.86 22.59 44.72 2.74
1681 1797 3.570212 ATGCCCCGGGGATGTAGC 61.570 66.667 44.86 26.52 37.50 3.58
1684 1800 2.854032 CCCCGGGGATGTAGCCAT 60.854 66.667 38.41 0.00 37.50 4.40
1685 1801 1.537889 CCCCGGGGATGTAGCCATA 60.538 63.158 38.41 0.00 37.50 2.74
1686 1802 0.914417 CCCCGGGGATGTAGCCATAT 60.914 60.000 38.41 0.00 37.50 1.78
1687 1803 0.541863 CCCGGGGATGTAGCCATATC 59.458 60.000 14.71 0.00 0.00 1.63
1688 1804 0.175760 CCGGGGATGTAGCCATATCG 59.824 60.000 0.00 0.00 0.00 2.92
1689 1805 0.175760 CGGGGATGTAGCCATATCGG 59.824 60.000 0.00 0.00 38.11 4.18
1690 1806 1.276622 GGGGATGTAGCCATATCGGT 58.723 55.000 0.00 0.00 36.97 4.69
1691 1807 1.066143 GGGGATGTAGCCATATCGGTG 60.066 57.143 0.00 0.00 36.97 4.94
1692 1808 1.899814 GGGATGTAGCCATATCGGTGA 59.100 52.381 0.00 0.00 36.97 4.02
1693 1809 2.301870 GGGATGTAGCCATATCGGTGAA 59.698 50.000 0.00 0.00 36.97 3.18
1694 1810 3.326747 GGATGTAGCCATATCGGTGAAC 58.673 50.000 0.00 0.00 36.97 3.18
1695 1811 2.902705 TGTAGCCATATCGGTGAACC 57.097 50.000 0.00 0.00 36.97 3.62
1696 1812 2.394632 TGTAGCCATATCGGTGAACCT 58.605 47.619 0.00 0.00 36.97 3.50
1697 1813 2.364324 TGTAGCCATATCGGTGAACCTC 59.636 50.000 0.00 0.00 36.97 3.85
1698 1814 0.389391 AGCCATATCGGTGAACCTCG 59.611 55.000 0.00 0.00 36.97 4.63
1699 1815 0.104304 GCCATATCGGTGAACCTCGT 59.896 55.000 0.00 0.00 36.97 4.18
1700 1816 1.472728 GCCATATCGGTGAACCTCGTT 60.473 52.381 0.00 0.00 36.97 3.85
1701 1817 2.223876 GCCATATCGGTGAACCTCGTTA 60.224 50.000 0.00 0.00 36.97 3.18
1702 1818 3.738899 GCCATATCGGTGAACCTCGTTAA 60.739 47.826 0.00 0.00 36.97 2.01
1703 1819 3.800506 CCATATCGGTGAACCTCGTTAAC 59.199 47.826 0.00 0.00 0.00 2.01
1704 1820 4.426416 CATATCGGTGAACCTCGTTAACA 58.574 43.478 6.39 0.00 28.88 2.41
1705 1821 2.886862 TCGGTGAACCTCGTTAACAA 57.113 45.000 6.39 0.00 28.88 2.83
1706 1822 3.176552 TCGGTGAACCTCGTTAACAAA 57.823 42.857 6.39 0.00 28.88 2.83
1707 1823 3.731089 TCGGTGAACCTCGTTAACAAAT 58.269 40.909 6.39 0.00 28.88 2.32
1708 1824 3.742369 TCGGTGAACCTCGTTAACAAATC 59.258 43.478 6.39 0.00 28.88 2.17
1709 1825 3.744426 CGGTGAACCTCGTTAACAAATCT 59.256 43.478 6.39 0.00 28.88 2.40
1710 1826 4.212636 CGGTGAACCTCGTTAACAAATCTT 59.787 41.667 6.39 0.00 28.88 2.40
1711 1827 5.449304 GGTGAACCTCGTTAACAAATCTTG 58.551 41.667 6.39 0.00 28.88 3.02
1712 1828 5.449304 GTGAACCTCGTTAACAAATCTTGG 58.551 41.667 6.39 0.00 34.12 3.61
1713 1829 5.008316 GTGAACCTCGTTAACAAATCTTGGT 59.992 40.000 6.39 0.15 34.12 3.67
1714 1830 5.008217 TGAACCTCGTTAACAAATCTTGGTG 59.992 40.000 6.39 0.00 34.12 4.17
1715 1831 4.457466 ACCTCGTTAACAAATCTTGGTGT 58.543 39.130 6.39 0.00 34.12 4.16
1716 1832 4.514066 ACCTCGTTAACAAATCTTGGTGTC 59.486 41.667 6.39 0.00 34.12 3.67
1717 1833 4.377022 CCTCGTTAACAAATCTTGGTGTCG 60.377 45.833 6.39 0.00 34.12 4.35
1718 1834 4.121317 TCGTTAACAAATCTTGGTGTCGT 58.879 39.130 6.39 0.00 32.62 4.34
1719 1835 4.025563 TCGTTAACAAATCTTGGTGTCGTG 60.026 41.667 6.39 0.00 32.62 4.35
1720 1836 2.774439 AACAAATCTTGGTGTCGTGC 57.226 45.000 0.00 0.00 34.12 5.34
1721 1837 1.967319 ACAAATCTTGGTGTCGTGCT 58.033 45.000 0.00 0.00 34.12 4.40
1722 1838 1.873591 ACAAATCTTGGTGTCGTGCTC 59.126 47.619 0.00 0.00 34.12 4.26
1723 1839 1.136252 CAAATCTTGGTGTCGTGCTCG 60.136 52.381 0.81 0.81 38.55 5.03
1724 1840 0.033504 AATCTTGGTGTCGTGCTCGT 59.966 50.000 8.17 0.00 38.33 4.18
1725 1841 0.667487 ATCTTGGTGTCGTGCTCGTG 60.667 55.000 8.17 0.00 38.33 4.35
1726 1842 1.591594 CTTGGTGTCGTGCTCGTGT 60.592 57.895 8.17 0.00 38.33 4.49
1727 1843 1.821241 CTTGGTGTCGTGCTCGTGTG 61.821 60.000 8.17 0.00 38.33 3.82
1728 1844 2.027024 GGTGTCGTGCTCGTGTGA 59.973 61.111 8.17 0.00 38.33 3.58
1729 1845 1.372997 GGTGTCGTGCTCGTGTGAT 60.373 57.895 8.17 0.00 38.33 3.06
1730 1846 0.944311 GGTGTCGTGCTCGTGTGATT 60.944 55.000 8.17 0.00 38.33 2.57
1731 1847 0.161658 GTGTCGTGCTCGTGTGATTG 59.838 55.000 8.17 0.00 38.33 2.67
1732 1848 1.130613 GTCGTGCTCGTGTGATTGC 59.869 57.895 8.17 0.00 38.33 3.56
1733 1849 1.006220 TCGTGCTCGTGTGATTGCT 60.006 52.632 8.17 0.00 38.33 3.91
1734 1850 0.599991 TCGTGCTCGTGTGATTGCTT 60.600 50.000 8.17 0.00 38.33 3.91
1735 1851 0.451628 CGTGCTCGTGTGATTGCTTG 60.452 55.000 0.00 0.00 0.00 4.01
1736 1852 0.110056 GTGCTCGTGTGATTGCTTGG 60.110 55.000 0.00 0.00 0.00 3.61
1737 1853 0.534877 TGCTCGTGTGATTGCTTGGT 60.535 50.000 0.00 0.00 0.00 3.67
1738 1854 0.166814 GCTCGTGTGATTGCTTGGTC 59.833 55.000 0.00 0.00 0.00 4.02
1739 1855 0.798776 CTCGTGTGATTGCTTGGTCC 59.201 55.000 0.00 0.00 0.00 4.46
1740 1856 0.396435 TCGTGTGATTGCTTGGTCCT 59.604 50.000 0.00 0.00 0.00 3.85
1741 1857 0.798776 CGTGTGATTGCTTGGTCCTC 59.201 55.000 0.00 0.00 0.00 3.71
1742 1858 0.798776 GTGTGATTGCTTGGTCCTCG 59.201 55.000 0.00 0.00 0.00 4.63
1743 1859 0.321564 TGTGATTGCTTGGTCCTCGG 60.322 55.000 0.00 0.00 0.00 4.63
1744 1860 0.036388 GTGATTGCTTGGTCCTCGGA 60.036 55.000 0.00 0.00 0.00 4.55
1745 1861 0.911769 TGATTGCTTGGTCCTCGGAT 59.088 50.000 0.00 0.00 0.00 4.18
1746 1862 1.303309 GATTGCTTGGTCCTCGGATG 58.697 55.000 0.00 0.00 0.00 3.51
1747 1863 0.911769 ATTGCTTGGTCCTCGGATGA 59.088 50.000 0.00 0.00 0.00 2.92
1748 1864 0.911769 TTGCTTGGTCCTCGGATGAT 59.088 50.000 0.00 0.00 0.00 2.45
1749 1865 0.465705 TGCTTGGTCCTCGGATGATC 59.534 55.000 0.00 0.00 0.00 2.92
1750 1866 0.598680 GCTTGGTCCTCGGATGATCG 60.599 60.000 0.00 0.00 0.00 3.69
1751 1867 0.032678 CTTGGTCCTCGGATGATCGG 59.967 60.000 0.00 0.00 0.00 4.18
1752 1868 2.028125 TTGGTCCTCGGATGATCGGC 62.028 60.000 0.00 0.00 0.00 5.54
1753 1869 2.049985 GTCCTCGGATGATCGGCG 60.050 66.667 0.00 0.00 0.00 6.46
1754 1870 3.295273 TCCTCGGATGATCGGCGG 61.295 66.667 7.21 2.92 0.00 6.13
1755 1871 3.606662 CCTCGGATGATCGGCGGT 61.607 66.667 7.21 0.00 0.00 5.68
1756 1872 2.265904 CCTCGGATGATCGGCGGTA 61.266 63.158 7.21 0.00 0.00 4.02
1757 1873 1.595993 CCTCGGATGATCGGCGGTAT 61.596 60.000 7.21 0.00 0.00 2.73
1758 1874 0.456824 CTCGGATGATCGGCGGTATG 60.457 60.000 7.21 0.00 0.00 2.39
1759 1875 2.094659 CGGATGATCGGCGGTATGC 61.095 63.158 7.21 3.75 45.38 3.14
1768 1884 4.456806 GCGGTATGCCTCGGATTT 57.543 55.556 0.00 0.00 37.76 2.17
1769 1885 3.599412 GCGGTATGCCTCGGATTTA 57.401 52.632 0.00 0.00 37.76 1.40
1770 1886 2.094762 GCGGTATGCCTCGGATTTAT 57.905 50.000 0.00 0.00 37.76 1.40
1771 1887 2.423577 GCGGTATGCCTCGGATTTATT 58.576 47.619 0.00 0.00 37.76 1.40
1772 1888 2.415512 GCGGTATGCCTCGGATTTATTC 59.584 50.000 0.00 0.00 37.76 1.75
1773 1889 3.864921 GCGGTATGCCTCGGATTTATTCT 60.865 47.826 0.00 0.00 37.76 2.40
1774 1890 4.619863 GCGGTATGCCTCGGATTTATTCTA 60.620 45.833 0.00 0.00 37.76 2.10
1775 1891 5.475719 CGGTATGCCTCGGATTTATTCTAA 58.524 41.667 0.00 0.00 0.00 2.10
1776 1892 5.347907 CGGTATGCCTCGGATTTATTCTAAC 59.652 44.000 0.00 0.00 0.00 2.34
1777 1893 6.228258 GGTATGCCTCGGATTTATTCTAACA 58.772 40.000 0.00 0.00 0.00 2.41
1778 1894 6.708949 GGTATGCCTCGGATTTATTCTAACAA 59.291 38.462 0.00 0.00 0.00 2.83
1779 1895 6.867662 ATGCCTCGGATTTATTCTAACAAG 57.132 37.500 0.00 0.00 0.00 3.16
1780 1896 5.741011 TGCCTCGGATTTATTCTAACAAGT 58.259 37.500 0.00 0.00 0.00 3.16
1781 1897 5.584649 TGCCTCGGATTTATTCTAACAAGTG 59.415 40.000 0.00 0.00 0.00 3.16
1782 1898 5.007724 GCCTCGGATTTATTCTAACAAGTGG 59.992 44.000 0.00 0.00 0.00 4.00
1783 1899 6.113411 CCTCGGATTTATTCTAACAAGTGGT 58.887 40.000 0.00 0.00 0.00 4.16
1784 1900 7.270047 CCTCGGATTTATTCTAACAAGTGGTA 58.730 38.462 0.00 0.00 0.00 3.25
1785 1901 7.931948 CCTCGGATTTATTCTAACAAGTGGTAT 59.068 37.037 0.00 0.00 0.00 2.73
1786 1902 8.882415 TCGGATTTATTCTAACAAGTGGTATC 57.118 34.615 0.00 0.00 0.00 2.24
1787 1903 8.479689 TCGGATTTATTCTAACAAGTGGTATCA 58.520 33.333 0.00 0.00 0.00 2.15
1788 1904 9.273016 CGGATTTATTCTAACAAGTGGTATCAT 57.727 33.333 0.00 0.00 0.00 2.45
1792 1908 8.662781 TTATTCTAACAAGTGGTATCATGAGC 57.337 34.615 0.09 0.00 0.00 4.26
1793 1909 5.675684 TCTAACAAGTGGTATCATGAGCA 57.324 39.130 0.09 0.00 0.00 4.26
1794 1910 6.048732 TCTAACAAGTGGTATCATGAGCAA 57.951 37.500 0.09 0.00 0.00 3.91
1795 1911 6.108687 TCTAACAAGTGGTATCATGAGCAAG 58.891 40.000 0.09 0.00 0.00 4.01
1796 1912 3.614092 ACAAGTGGTATCATGAGCAAGG 58.386 45.455 0.09 0.00 0.00 3.61
1797 1913 3.009473 ACAAGTGGTATCATGAGCAAGGT 59.991 43.478 0.09 0.00 0.00 3.50
1798 1914 4.012374 CAAGTGGTATCATGAGCAAGGTT 58.988 43.478 0.09 0.00 0.00 3.50
1799 1915 5.185454 CAAGTGGTATCATGAGCAAGGTTA 58.815 41.667 0.09 0.00 0.00 2.85
1800 1916 4.770795 AGTGGTATCATGAGCAAGGTTAC 58.229 43.478 0.09 0.00 0.00 2.50
1801 1917 3.555956 GTGGTATCATGAGCAAGGTTACG 59.444 47.826 0.09 0.00 0.00 3.18
1802 1918 3.449377 TGGTATCATGAGCAAGGTTACGA 59.551 43.478 0.09 0.00 0.00 3.43
1803 1919 4.051922 GGTATCATGAGCAAGGTTACGAG 58.948 47.826 0.09 0.00 0.00 4.18
1804 1920 4.202121 GGTATCATGAGCAAGGTTACGAGA 60.202 45.833 0.09 0.00 0.00 4.04
1805 1921 3.953712 TCATGAGCAAGGTTACGAGAA 57.046 42.857 0.00 0.00 0.00 2.87
1806 1922 3.849911 TCATGAGCAAGGTTACGAGAAG 58.150 45.455 0.00 0.00 0.00 2.85
1807 1923 3.509967 TCATGAGCAAGGTTACGAGAAGA 59.490 43.478 0.00 0.00 0.00 2.87
1808 1924 3.299340 TGAGCAAGGTTACGAGAAGAC 57.701 47.619 0.00 0.00 0.00 3.01
1809 1925 2.029290 TGAGCAAGGTTACGAGAAGACC 60.029 50.000 0.00 0.00 0.00 3.85
1810 1926 1.968493 AGCAAGGTTACGAGAAGACCA 59.032 47.619 0.00 0.00 35.89 4.02
1811 1927 2.567615 AGCAAGGTTACGAGAAGACCAT 59.432 45.455 0.00 0.00 35.89 3.55
1812 1928 2.673368 GCAAGGTTACGAGAAGACCATG 59.327 50.000 0.00 0.00 35.76 3.66
1813 1929 3.262420 CAAGGTTACGAGAAGACCATGG 58.738 50.000 11.19 11.19 35.89 3.66
1814 1930 2.816411 AGGTTACGAGAAGACCATGGA 58.184 47.619 21.47 0.00 35.89 3.41
1815 1931 3.375699 AGGTTACGAGAAGACCATGGAT 58.624 45.455 21.47 3.12 35.89 3.41
1816 1932 3.385111 AGGTTACGAGAAGACCATGGATC 59.615 47.826 21.47 13.42 35.89 3.36
1817 1933 3.372954 GTTACGAGAAGACCATGGATCG 58.627 50.000 21.47 19.80 36.32 3.69
1818 1934 1.475403 ACGAGAAGACCATGGATCGT 58.525 50.000 21.47 20.41 38.46 3.73
1819 1935 1.825474 ACGAGAAGACCATGGATCGTT 59.175 47.619 21.47 5.52 40.16 3.85
1820 1936 2.196749 CGAGAAGACCATGGATCGTTG 58.803 52.381 21.47 5.45 0.00 4.10
1821 1937 2.159240 CGAGAAGACCATGGATCGTTGA 60.159 50.000 21.47 0.00 0.00 3.18
1822 1938 3.491619 CGAGAAGACCATGGATCGTTGAT 60.492 47.826 21.47 0.00 0.00 2.57
1823 1939 4.054671 GAGAAGACCATGGATCGTTGATC 58.945 47.826 21.47 2.22 38.25 2.92
1824 1940 3.708631 AGAAGACCATGGATCGTTGATCT 59.291 43.478 21.47 4.94 38.91 2.75
1825 1941 4.895889 AGAAGACCATGGATCGTTGATCTA 59.104 41.667 21.47 1.24 38.91 1.98
1826 1942 4.862902 AGACCATGGATCGTTGATCTAG 57.137 45.455 21.47 0.00 38.91 2.43
1827 1943 4.474394 AGACCATGGATCGTTGATCTAGA 58.526 43.478 21.47 0.00 38.91 2.43
1828 1944 4.522405 AGACCATGGATCGTTGATCTAGAG 59.478 45.833 21.47 0.09 38.91 2.43
1829 1945 3.576118 ACCATGGATCGTTGATCTAGAGG 59.424 47.826 21.47 9.05 38.91 3.69
1830 1946 3.829026 CCATGGATCGTTGATCTAGAGGA 59.171 47.826 5.56 0.00 38.91 3.71
1831 1947 4.281941 CCATGGATCGTTGATCTAGAGGAA 59.718 45.833 5.56 0.00 38.91 3.36
1832 1948 5.468592 CATGGATCGTTGATCTAGAGGAAG 58.531 45.833 0.00 0.00 38.91 3.46
1833 1949 3.319405 TGGATCGTTGATCTAGAGGAAGC 59.681 47.826 0.00 0.00 38.91 3.86
1834 1950 3.319405 GGATCGTTGATCTAGAGGAAGCA 59.681 47.826 0.00 0.00 38.91 3.91
1835 1951 4.021544 GGATCGTTGATCTAGAGGAAGCAT 60.022 45.833 0.00 0.00 38.91 3.79
1836 1952 4.576216 TCGTTGATCTAGAGGAAGCATC 57.424 45.455 0.00 0.00 0.00 3.91
1837 1953 3.003793 TCGTTGATCTAGAGGAAGCATCG 59.996 47.826 0.00 3.22 32.24 3.84
1838 1954 3.648009 GTTGATCTAGAGGAAGCATCGG 58.352 50.000 0.00 0.00 0.00 4.18
1839 1955 2.950781 TGATCTAGAGGAAGCATCGGT 58.049 47.619 0.00 0.00 0.00 4.69
1840 1956 2.625314 TGATCTAGAGGAAGCATCGGTG 59.375 50.000 0.00 0.00 0.00 4.94
1841 1957 2.437085 TCTAGAGGAAGCATCGGTGA 57.563 50.000 0.00 0.00 0.00 4.02
1842 1958 2.025155 TCTAGAGGAAGCATCGGTGAC 58.975 52.381 0.00 0.00 0.00 3.67
1843 1959 1.751351 CTAGAGGAAGCATCGGTGACA 59.249 52.381 0.00 0.00 0.00 3.58
1844 1960 0.534412 AGAGGAAGCATCGGTGACAG 59.466 55.000 0.00 0.00 0.00 3.51
1845 1961 1.078848 AGGAAGCATCGGTGACAGC 60.079 57.895 0.00 0.00 0.00 4.40
1846 1962 2.456119 GGAAGCATCGGTGACAGCG 61.456 63.158 20.57 20.57 40.97 5.18
1847 1963 3.088500 GAAGCATCGGTGACAGCGC 62.089 63.158 21.69 0.00 39.21 5.92
1848 1964 3.881952 AAGCATCGGTGACAGCGCA 62.882 57.895 21.69 11.30 39.21 6.09
1849 1965 3.197790 GCATCGGTGACAGCGCAT 61.198 61.111 21.69 12.98 39.21 4.73
1850 1966 2.753966 GCATCGGTGACAGCGCATT 61.754 57.895 21.69 6.66 39.21 3.56
1851 1967 1.796151 CATCGGTGACAGCGCATTT 59.204 52.632 21.69 4.22 39.21 2.32
1852 1968 0.168788 CATCGGTGACAGCGCATTTT 59.831 50.000 21.69 1.83 39.21 1.82
1853 1969 0.881118 ATCGGTGACAGCGCATTTTT 59.119 45.000 21.69 0.14 39.21 1.94
1872 1988 2.971660 TTTCGGCGATACCTGATTGA 57.028 45.000 11.76 0.00 35.61 2.57
1873 1989 3.469008 TTTCGGCGATACCTGATTGAT 57.531 42.857 11.76 0.00 35.61 2.57
1874 1990 2.724977 TCGGCGATACCTGATTGATC 57.275 50.000 4.99 0.00 35.61 2.92
1875 1991 2.239400 TCGGCGATACCTGATTGATCT 58.761 47.619 4.99 0.00 35.61 2.75
1876 1992 2.029918 TCGGCGATACCTGATTGATCTG 60.030 50.000 4.99 0.00 35.61 2.90
1877 1993 2.029918 CGGCGATACCTGATTGATCTGA 60.030 50.000 0.00 0.00 35.61 3.27
1878 1994 3.367806 CGGCGATACCTGATTGATCTGAT 60.368 47.826 0.00 0.00 35.61 2.90
1879 1995 4.180057 GGCGATACCTGATTGATCTGATC 58.820 47.826 10.72 10.72 34.51 2.92
1880 1996 3.856521 GCGATACCTGATTGATCTGATCG 59.143 47.826 12.65 13.03 38.32 3.69
1881 1997 4.419280 CGATACCTGATTGATCTGATCGG 58.581 47.826 12.65 9.52 33.18 4.18
1883 1999 2.469274 CCTGATTGATCTGATCGGGG 57.531 55.000 20.98 13.79 43.43 5.73
1884 2000 1.002888 CCTGATTGATCTGATCGGGGG 59.997 57.143 20.98 12.12 43.43 5.40
1885 2001 0.397941 TGATTGATCTGATCGGGGGC 59.602 55.000 12.65 1.95 0.00 5.80
1886 2002 0.671781 GATTGATCTGATCGGGGGCG 60.672 60.000 12.65 0.00 0.00 6.13
1887 2003 2.738213 ATTGATCTGATCGGGGGCGC 62.738 60.000 12.65 0.00 0.00 6.53
1891 2007 4.944372 CTGATCGGGGGCGCGTAC 62.944 72.222 8.43 0.21 0.00 3.67
1893 2009 4.295119 GATCGGGGGCGCGTACAT 62.295 66.667 8.43 0.00 0.00 2.29
1894 2010 4.602259 ATCGGGGGCGCGTACATG 62.602 66.667 8.43 0.00 0.00 3.21
1914 2030 4.687215 GGAGGCAGCGACTGTGCA 62.687 66.667 8.32 0.00 43.12 4.57
1915 2031 2.666190 GAGGCAGCGACTGTGCAA 60.666 61.111 8.32 0.00 43.12 4.08
1916 2032 2.667536 AGGCAGCGACTGTGCAAG 60.668 61.111 8.32 0.00 43.12 4.01
1917 2033 4.395583 GGCAGCGACTGTGCAAGC 62.396 66.667 8.32 7.62 43.12 4.01
1918 2034 3.653009 GCAGCGACTGTGCAAGCA 61.653 61.111 8.32 0.00 40.86 3.91
1919 2035 2.554775 CAGCGACTGTGCAAGCAG 59.445 61.111 2.91 2.91 41.92 4.24
1920 2036 3.352222 AGCGACTGTGCAAGCAGC 61.352 61.111 4.32 6.26 45.96 5.25
1937 2053 4.680237 CGGCTGGTGCAGGTCGAA 62.680 66.667 2.69 0.00 41.91 3.71
1938 2054 2.045926 GGCTGGTGCAGGTCGAAT 60.046 61.111 0.00 0.00 41.91 3.34
1939 2055 1.675641 GGCTGGTGCAGGTCGAATT 60.676 57.895 0.00 0.00 41.91 2.17
1940 2056 1.503542 GCTGGTGCAGGTCGAATTG 59.496 57.895 0.00 0.00 39.41 2.32
1941 2057 0.955428 GCTGGTGCAGGTCGAATTGA 60.955 55.000 0.00 0.00 39.41 2.57
1942 2058 1.742761 CTGGTGCAGGTCGAATTGAT 58.257 50.000 0.00 0.00 0.00 2.57
1943 2059 1.399440 CTGGTGCAGGTCGAATTGATG 59.601 52.381 0.00 0.00 0.00 3.07
1944 2060 0.734889 GGTGCAGGTCGAATTGATGG 59.265 55.000 0.00 0.00 0.00 3.51
1945 2061 0.734889 GTGCAGGTCGAATTGATGGG 59.265 55.000 0.00 0.00 0.00 4.00
1946 2062 1.031571 TGCAGGTCGAATTGATGGGC 61.032 55.000 1.86 0.00 0.00 5.36
1947 2063 1.728490 GCAGGTCGAATTGATGGGCC 61.728 60.000 0.00 0.00 0.00 5.80
1948 2064 0.394216 CAGGTCGAATTGATGGGCCA 60.394 55.000 9.61 9.61 0.00 5.36
1949 2065 0.107017 AGGTCGAATTGATGGGCCAG 60.107 55.000 13.78 0.00 0.00 4.85
1950 2066 1.103398 GGTCGAATTGATGGGCCAGG 61.103 60.000 13.78 0.00 0.00 4.45
1951 2067 1.453745 TCGAATTGATGGGCCAGGC 60.454 57.895 13.78 1.26 0.00 4.85
1952 2068 1.753848 CGAATTGATGGGCCAGGCA 60.754 57.895 15.19 10.31 0.00 4.75
1953 2069 1.731433 CGAATTGATGGGCCAGGCAG 61.731 60.000 15.19 0.00 0.00 4.85
1954 2070 1.382146 AATTGATGGGCCAGGCAGG 60.382 57.895 15.19 0.00 41.84 4.85
1980 2096 4.742201 CTCGACCGTGTGGGCTGG 62.742 72.222 0.00 0.00 43.41 4.85
2004 2120 4.157120 CCGGTCGGGGCTAGTTGG 62.157 72.222 0.74 0.00 0.00 3.77
2005 2121 3.387947 CGGTCGGGGCTAGTTGGT 61.388 66.667 0.00 0.00 0.00 3.67
2006 2122 2.582978 GGTCGGGGCTAGTTGGTC 59.417 66.667 0.00 0.00 0.00 4.02
2007 2123 1.988406 GGTCGGGGCTAGTTGGTCT 60.988 63.158 0.00 0.00 0.00 3.85
2008 2124 0.685458 GGTCGGGGCTAGTTGGTCTA 60.685 60.000 0.00 0.00 0.00 2.59
2009 2125 0.745468 GTCGGGGCTAGTTGGTCTAG 59.255 60.000 0.00 0.00 46.39 2.43
2016 2132 2.593346 CTAGTTGGTCTAGCCTGCTG 57.407 55.000 0.97 0.00 39.49 4.41
2017 2133 1.137872 CTAGTTGGTCTAGCCTGCTGG 59.862 57.143 5.03 5.03 39.49 4.85
2018 2134 1.078143 GTTGGTCTAGCCTGCTGGG 60.078 63.158 12.06 1.66 38.35 4.45
2020 2136 1.841302 TTGGTCTAGCCTGCTGGGTG 61.841 60.000 23.06 13.28 44.81 4.61
2021 2137 2.124942 GTCTAGCCTGCTGGGTGC 60.125 66.667 23.06 10.16 44.81 5.01
2033 2149 4.729918 GGGTGCAGCTGACCCCAG 62.730 72.222 29.79 2.30 46.76 4.45
2041 2157 2.034687 CTGACCCCAGCCTGTTGG 59.965 66.667 0.00 0.00 38.00 3.77
2042 2158 2.449518 TGACCCCAGCCTGTTGGA 60.450 61.111 1.11 0.00 40.87 3.53
2043 2159 2.034221 GACCCCAGCCTGTTGGAC 59.966 66.667 1.11 0.00 40.87 4.02
2044 2160 3.569200 GACCCCAGCCTGTTGGACC 62.569 68.421 1.11 0.00 40.87 4.46
2045 2161 3.579302 CCCCAGCCTGTTGGACCA 61.579 66.667 1.11 0.00 40.87 4.02
2046 2162 2.520458 CCCAGCCTGTTGGACCAA 59.480 61.111 1.69 1.69 40.87 3.67
2047 2163 1.604593 CCCAGCCTGTTGGACCAAG 60.605 63.158 7.31 0.00 40.87 3.61
2048 2164 1.604593 CCAGCCTGTTGGACCAAGG 60.605 63.158 7.31 7.57 40.87 3.61
2049 2165 2.116125 AGCCTGTTGGACCAAGGC 59.884 61.111 24.48 24.48 45.30 4.35
2050 2166 3.365265 GCCTGTTGGACCAAGGCG 61.365 66.667 19.25 5.84 35.86 5.52
2051 2167 2.429930 CCTGTTGGACCAAGGCGA 59.570 61.111 7.31 0.00 34.57 5.54
2052 2168 1.672356 CCTGTTGGACCAAGGCGAG 60.672 63.158 7.31 1.56 34.57 5.03
2053 2169 1.371183 CTGTTGGACCAAGGCGAGA 59.629 57.895 7.31 0.00 0.00 4.04
2054 2170 0.036010 CTGTTGGACCAAGGCGAGAT 60.036 55.000 7.31 0.00 0.00 2.75
2055 2171 0.036388 TGTTGGACCAAGGCGAGATC 60.036 55.000 7.31 0.00 0.00 2.75
2056 2172 0.036388 GTTGGACCAAGGCGAGATCA 60.036 55.000 7.31 0.00 0.00 2.92
2057 2173 0.911769 TTGGACCAAGGCGAGATCAT 59.088 50.000 1.69 0.00 0.00 2.45
2058 2174 0.465705 TGGACCAAGGCGAGATCATC 59.534 55.000 0.00 0.00 0.00 2.92
2079 2195 2.281070 CGGAGCTGTGCACTTGGT 60.281 61.111 19.41 15.87 0.00 3.67
2080 2196 2.610694 CGGAGCTGTGCACTTGGTG 61.611 63.158 19.41 4.38 36.51 4.17
2081 2197 1.526917 GGAGCTGTGCACTTGGTGT 60.527 57.895 19.41 0.00 35.75 4.16
2089 2205 3.333414 CACTTGGTGTGCTGGACG 58.667 61.111 0.00 0.00 40.06 4.79
2090 2206 2.111043 ACTTGGTGTGCTGGACGG 59.889 61.111 0.00 0.00 0.00 4.79
2091 2207 2.111043 CTTGGTGTGCTGGACGGT 59.889 61.111 0.00 0.00 0.00 4.83
2092 2208 2.203139 TTGGTGTGCTGGACGGTG 60.203 61.111 0.00 0.00 0.00 4.94
2093 2209 3.765894 TTGGTGTGCTGGACGGTGG 62.766 63.158 0.00 0.00 0.00 4.61
2097 2213 4.722700 GTGCTGGACGGTGGCCAT 62.723 66.667 9.72 0.00 34.33 4.40
2098 2214 4.720902 TGCTGGACGGTGGCCATG 62.721 66.667 9.72 7.70 34.33 3.66
2099 2215 4.408821 GCTGGACGGTGGCCATGA 62.409 66.667 9.72 0.00 34.33 3.07
2100 2216 2.350895 CTGGACGGTGGCCATGAA 59.649 61.111 9.72 0.00 34.33 2.57
2101 2217 2.033448 TGGACGGTGGCCATGAAC 59.967 61.111 9.72 1.10 0.00 3.18
2102 2218 3.124921 GGACGGTGGCCATGAACG 61.125 66.667 9.72 14.52 0.00 3.95
2103 2219 3.124921 GACGGTGGCCATGAACGG 61.125 66.667 9.72 2.44 0.00 4.44
2104 2220 4.715523 ACGGTGGCCATGAACGGG 62.716 66.667 9.72 0.00 0.00 5.28
2105 2221 4.402528 CGGTGGCCATGAACGGGA 62.403 66.667 9.72 0.00 0.00 5.14
2106 2222 2.275418 GGTGGCCATGAACGGGAT 59.725 61.111 9.72 0.00 0.00 3.85
2107 2223 1.529796 GGTGGCCATGAACGGGATA 59.470 57.895 9.72 0.00 0.00 2.59
2108 2224 0.110486 GGTGGCCATGAACGGGATAT 59.890 55.000 9.72 0.00 0.00 1.63
2109 2225 1.523758 GTGGCCATGAACGGGATATC 58.476 55.000 9.72 0.00 0.00 1.63
2110 2226 0.400213 TGGCCATGAACGGGATATCC 59.600 55.000 13.87 13.87 0.00 2.59
2127 2243 1.366366 CCGAAGCGGTATACCCAGG 59.634 63.158 16.47 8.55 42.73 4.45
2128 2244 1.111116 CCGAAGCGGTATACCCAGGA 61.111 60.000 16.47 0.00 42.73 3.86
2129 2245 0.748450 CGAAGCGGTATACCCAGGAA 59.252 55.000 16.47 0.00 0.00 3.36
2130 2246 1.269621 CGAAGCGGTATACCCAGGAAG 60.270 57.143 16.47 2.16 0.00 3.46
2131 2247 0.468648 AAGCGGTATACCCAGGAAGC 59.531 55.000 16.47 12.14 0.00 3.86
2132 2248 1.070957 GCGGTATACCCAGGAAGCC 59.929 63.158 16.47 0.00 0.00 4.35
2133 2249 1.366366 CGGTATACCCAGGAAGCCG 59.634 63.158 16.47 0.00 0.00 5.52
2134 2250 1.397390 CGGTATACCCAGGAAGCCGT 61.397 60.000 16.47 0.00 33.87 5.68
2135 2251 1.708341 GGTATACCCAGGAAGCCGTA 58.292 55.000 11.17 0.00 0.00 4.02
2136 2252 2.254508 GGTATACCCAGGAAGCCGTAT 58.745 52.381 11.17 0.00 0.00 3.06
2137 2253 2.028385 GGTATACCCAGGAAGCCGTATG 60.028 54.545 11.17 0.00 0.00 2.39
2138 2254 0.396811 ATACCCAGGAAGCCGTATGC 59.603 55.000 0.00 0.00 41.71 3.14
2147 2263 2.659897 GCCGTATGCGAGCCAGAG 60.660 66.667 4.21 0.00 41.33 3.35
2148 2264 3.120105 CCGTATGCGAGCCAGAGA 58.880 61.111 4.21 0.00 41.33 3.10
2149 2265 1.662608 CCGTATGCGAGCCAGAGAT 59.337 57.895 4.21 0.00 41.33 2.75
2150 2266 0.032678 CCGTATGCGAGCCAGAGATT 59.967 55.000 4.21 0.00 41.33 2.40
2151 2267 1.539065 CCGTATGCGAGCCAGAGATTT 60.539 52.381 4.21 0.00 41.33 2.17
2161 2277 4.550422 GAGCCAGAGATTTGTTTGGAAAC 58.450 43.478 0.00 0.00 39.33 2.78
2190 2314 2.045926 AGTCCTCATTGGCACGGC 60.046 61.111 0.00 0.00 35.26 5.68
2210 2343 3.276857 GCAAGAGGCAGATCAAATCAGA 58.723 45.455 0.00 0.00 43.97 3.27
2254 2392 1.450531 CCATCGGAATTGGCAGAGGC 61.451 60.000 0.00 0.00 40.13 4.70
2286 2429 7.938140 AAGCAATTACTAGCATTGGAAGTTA 57.062 32.000 14.25 0.00 32.98 2.24
2463 2626 1.202604 GGTGGAGAAGTTCACGGAACA 60.203 52.381 15.94 0.00 44.11 3.18
2474 2637 1.673920 TCACGGAACAGAAAACCTTGC 59.326 47.619 0.00 0.00 0.00 4.01
2489 2653 1.745087 CCTTGCGTTATGGCAGACAAT 59.255 47.619 0.00 0.00 44.94 2.71
2502 2666 4.016444 GGCAGACAATGGGTGAAAGATTA 58.984 43.478 0.00 0.00 0.00 1.75
2512 2676 3.191371 GGGTGAAAGATTAGTTGGCACAG 59.809 47.826 0.00 0.00 42.39 3.66
2529 2693 0.323178 CAGCAGGGATGCTTGAAGGT 60.323 55.000 0.00 0.00 43.52 3.50
2552 2716 1.364626 GCGGGAAGTCATGTCAGCTG 61.365 60.000 7.63 7.63 0.00 4.24
2560 2724 3.039743 AGTCATGTCAGCTGAGATGGAT 58.960 45.455 38.67 28.84 43.56 3.41
2577 2741 8.168058 TGAGATGGATTTATCATGTGATGGATT 58.832 33.333 5.78 0.00 36.05 3.01
2589 2754 6.774170 TCATGTGATGGATTAGAATTCTTGGG 59.226 38.462 14.36 0.00 0.00 4.12
2604 2769 4.934797 TCTTGGGAGATGATTTGGAAGT 57.065 40.909 0.00 0.00 0.00 3.01
2696 2864 1.202604 GGTTGGAACAGAAGACGGTGA 60.203 52.381 0.00 0.00 42.39 4.02
2749 2917 1.476891 GCTGATGGTGACCGACTTCTA 59.523 52.381 0.00 0.00 0.00 2.10
2750 2918 2.094182 GCTGATGGTGACCGACTTCTAA 60.094 50.000 0.00 0.00 0.00 2.10
2773 2944 2.970324 GGAAACACGCGGCACAGA 60.970 61.111 12.47 0.00 0.00 3.41
2808 2981 0.106769 TGGCTTCAACAAGACTGGCA 60.107 50.000 0.00 0.00 38.67 4.92
2850 3023 3.508402 TGTATACACGGAGCTTGAAGTCA 59.492 43.478 0.08 0.00 0.00 3.41
2944 3126 1.903877 CTCGGTGCTGATTGAGGGGT 61.904 60.000 0.00 0.00 0.00 4.95
2982 3164 4.462834 TCAGAGAGTCGAAGCCTATTTCAA 59.537 41.667 0.00 0.00 0.00 2.69
3023 3208 1.376037 GTTCGGACTGGAGCCCAAG 60.376 63.158 0.00 0.00 30.80 3.61
3040 3225 1.207089 CAAGGGTCTGATGGAAGCGTA 59.793 52.381 0.00 0.00 0.00 4.42
3083 3268 1.204941 GATCGGTGGTACTCTGCAGTT 59.795 52.381 14.67 4.66 33.62 3.16
3085 3270 0.033504 CGGTGGTACTCTGCAGTTGT 59.966 55.000 14.67 15.77 33.62 3.32
3102 3287 0.107410 TGTGGTTGAGTGGTGTGGTC 60.107 55.000 0.00 0.00 0.00 4.02
3108 3293 1.367840 GAGTGGTGTGGTCTTCGCT 59.632 57.895 0.00 0.00 0.00 4.93
3231 3418 4.040339 TCATACATGTGGTGAGACAACTGT 59.960 41.667 9.11 0.00 0.00 3.55
3418 3606 6.630413 GCATTGGACTGATACTCTGGAAGTTA 60.630 42.308 0.00 0.00 39.55 2.24
3519 3707 2.171448 GCAGGTGGAGTCATATGGAGTT 59.829 50.000 2.13 0.00 0.00 3.01
3529 3717 6.539103 GGAGTCATATGGAGTTTTTGGAGTAC 59.461 42.308 2.13 0.00 0.00 2.73
3597 3789 1.999735 GACGCATGGACGAATTCAAGA 59.000 47.619 6.22 0.00 36.70 3.02
3776 3970 2.433239 GGGGGTAGACACACGATGTAAT 59.567 50.000 0.00 0.00 43.56 1.89
3785 3979 4.119862 ACACACGATGTAATCTATGCCAC 58.880 43.478 0.00 0.00 42.58 5.01
3787 3981 3.388024 ACACGATGTAATCTATGCCACCT 59.612 43.478 0.00 0.00 42.58 4.00
3799 3993 0.906066 TGCCACCTTAATAGCACCGA 59.094 50.000 0.00 0.00 0.00 4.69
3809 4004 1.895020 ATAGCACCGAAACGCAGGGA 61.895 55.000 0.00 0.00 0.00 4.20
3866 4061 3.006110 GGGTGCGGTATTATAGCAGTGTA 59.994 47.826 2.31 0.00 41.93 2.90
3888 4083 2.444256 GGGAGGAGCGCCCATAGTT 61.444 63.158 15.92 0.00 43.17 2.24
3890 4085 0.977395 GGAGGAGCGCCCATAGTTAT 59.023 55.000 15.92 0.00 37.41 1.89
3927 4122 3.921021 GCCATATCGATGAACCTCGTTAG 59.079 47.826 8.54 0.00 39.62 2.34
3948 4143 2.663119 GCAAATTTTGATGTCGTGCTCC 59.337 45.455 13.26 0.00 0.00 4.70
3976 4171 0.032678 CTTGGTCCTCGGATGATCGG 59.967 60.000 0.00 0.00 0.00 4.18
4028 4223 1.749153 GTACGCGAGCTCTTCTCATC 58.251 55.000 15.93 0.00 41.98 2.92
4056 4258 2.126346 GGACGTACGGGTGGTTCG 60.126 66.667 21.06 0.00 43.97 3.95
4102 4311 3.584848 ACCCTACCTAGATTGATGCATCC 59.415 47.826 23.67 8.72 0.00 3.51
4109 4318 0.947244 GATTGATGCATCCCCGTGAC 59.053 55.000 23.67 5.05 0.00 3.67
4124 4333 2.910482 CCGTGACAAAAAGCAATCATCG 59.090 45.455 0.00 0.00 0.00 3.84
4170 4389 2.489329 GTGGATGATGACCCAGTTGTTG 59.511 50.000 0.00 0.00 32.28 3.33
4175 4394 3.678289 TGATGACCCAGTTGTTGATCTG 58.322 45.455 0.00 0.00 0.00 2.90
4180 4399 1.270550 CCCAGTTGTTGATCTGTTGCC 59.729 52.381 0.00 0.00 0.00 4.52
4184 4403 3.253921 CAGTTGTTGATCTGTTGCCATCA 59.746 43.478 0.00 0.00 0.00 3.07
4185 4404 3.504906 AGTTGTTGATCTGTTGCCATCAG 59.495 43.478 0.00 0.00 30.68 2.90
4186 4405 2.439409 TGTTGATCTGTTGCCATCAGG 58.561 47.619 3.07 0.00 34.15 3.86
4198 4417 1.688772 CCATCAGGCCTCTTCCAATG 58.311 55.000 0.00 0.00 0.00 2.82
4199 4418 1.030457 CATCAGGCCTCTTCCAATGC 58.970 55.000 0.00 0.00 0.00 3.56
4200 4419 0.924823 ATCAGGCCTCTTCCAATGCT 59.075 50.000 0.00 0.00 0.00 3.79
4201 4420 0.254178 TCAGGCCTCTTCCAATGCTC 59.746 55.000 0.00 0.00 0.00 4.26
4202 4421 0.750911 CAGGCCTCTTCCAATGCTCC 60.751 60.000 0.00 0.00 0.00 4.70
4203 4422 1.210204 AGGCCTCTTCCAATGCTCCA 61.210 55.000 0.00 0.00 0.00 3.86
4204 4423 1.034292 GGCCTCTTCCAATGCTCCAC 61.034 60.000 0.00 0.00 0.00 4.02
4205 4424 1.034292 GCCTCTTCCAATGCTCCACC 61.034 60.000 0.00 0.00 0.00 4.61
4206 4425 0.622665 CCTCTTCCAATGCTCCACCT 59.377 55.000 0.00 0.00 0.00 4.00
4207 4426 1.005215 CCTCTTCCAATGCTCCACCTT 59.995 52.381 0.00 0.00 0.00 3.50
4208 4427 2.089980 CTCTTCCAATGCTCCACCTTG 58.910 52.381 0.00 0.00 0.00 3.61
4209 4428 1.425066 TCTTCCAATGCTCCACCTTGT 59.575 47.619 0.00 0.00 0.00 3.16
4210 4429 2.642311 TCTTCCAATGCTCCACCTTGTA 59.358 45.455 0.00 0.00 0.00 2.41
4211 4430 2.489938 TCCAATGCTCCACCTTGTAC 57.510 50.000 0.00 0.00 0.00 2.90
4212 4431 1.702401 TCCAATGCTCCACCTTGTACA 59.298 47.619 0.00 0.00 0.00 2.90
4213 4432 2.107378 TCCAATGCTCCACCTTGTACAA 59.893 45.455 8.28 8.28 0.00 2.41
4214 4433 2.890311 CCAATGCTCCACCTTGTACAAA 59.110 45.455 10.03 0.00 0.00 2.83
4215 4434 3.511146 CCAATGCTCCACCTTGTACAAAT 59.489 43.478 10.03 0.00 0.00 2.32
4216 4435 4.487948 CAATGCTCCACCTTGTACAAATG 58.512 43.478 10.03 10.65 0.00 2.32
4217 4436 3.222173 TGCTCCACCTTGTACAAATGT 57.778 42.857 10.03 7.15 0.00 2.71
4218 4437 3.561143 TGCTCCACCTTGTACAAATGTT 58.439 40.909 10.03 0.00 0.00 2.71
4219 4438 4.720046 TGCTCCACCTTGTACAAATGTTA 58.280 39.130 10.03 1.71 0.00 2.41
4220 4439 5.133941 TGCTCCACCTTGTACAAATGTTAA 58.866 37.500 10.03 0.51 0.00 2.01
4221 4440 5.772672 TGCTCCACCTTGTACAAATGTTAAT 59.227 36.000 10.03 0.00 0.00 1.40
4222 4441 6.092748 GCTCCACCTTGTACAAATGTTAATG 58.907 40.000 10.03 0.99 0.00 1.90
4223 4442 6.294508 GCTCCACCTTGTACAAATGTTAATGT 60.295 38.462 10.03 0.00 0.00 2.71
4224 4443 7.589958 TCCACCTTGTACAAATGTTAATGTT 57.410 32.000 10.03 0.00 0.00 2.71
4225 4444 7.429633 TCCACCTTGTACAAATGTTAATGTTG 58.570 34.615 10.03 0.00 0.00 3.33
4226 4445 6.145371 CCACCTTGTACAAATGTTAATGTTGC 59.855 38.462 10.03 0.00 0.00 4.17
4227 4446 6.145371 CACCTTGTACAAATGTTAATGTTGCC 59.855 38.462 10.03 0.00 0.00 4.52
4228 4447 6.183360 ACCTTGTACAAATGTTAATGTTGCCA 60.183 34.615 10.03 0.00 0.00 4.92
4229 4448 6.703607 CCTTGTACAAATGTTAATGTTGCCAA 59.296 34.615 10.03 0.00 0.00 4.52
4230 4449 7.307101 CCTTGTACAAATGTTAATGTTGCCAAC 60.307 37.037 10.03 0.00 0.00 3.77
4231 4450 6.810911 TGTACAAATGTTAATGTTGCCAACT 58.189 32.000 9.30 0.00 0.00 3.16
4232 4451 7.941919 TGTACAAATGTTAATGTTGCCAACTA 58.058 30.769 9.30 0.00 0.00 2.24
4233 4452 8.414003 TGTACAAATGTTAATGTTGCCAACTAA 58.586 29.630 9.30 0.00 0.00 2.24
4234 4453 7.945033 ACAAATGTTAATGTTGCCAACTAAG 57.055 32.000 9.30 0.00 0.00 2.18
4235 4454 6.423604 ACAAATGTTAATGTTGCCAACTAAGC 59.576 34.615 9.30 0.00 0.00 3.09
4236 4455 5.720371 ATGTTAATGTTGCCAACTAAGCA 57.280 34.783 9.30 3.19 38.81 3.91
4259 4478 4.612264 AAAAATCTGATGTGGCTTTGCT 57.388 36.364 0.00 0.00 0.00 3.91
4260 4479 5.726980 AAAAATCTGATGTGGCTTTGCTA 57.273 34.783 0.00 0.00 0.00 3.49
4261 4480 4.978083 AAATCTGATGTGGCTTTGCTAG 57.022 40.909 0.00 0.00 0.00 3.42
4262 4481 3.641434 ATCTGATGTGGCTTTGCTAGT 57.359 42.857 0.00 0.00 0.00 2.57
4263 4482 3.423539 TCTGATGTGGCTTTGCTAGTT 57.576 42.857 0.00 0.00 0.00 2.24
4264 4483 4.551702 TCTGATGTGGCTTTGCTAGTTA 57.448 40.909 0.00 0.00 0.00 2.24
4265 4484 4.905429 TCTGATGTGGCTTTGCTAGTTAA 58.095 39.130 0.00 0.00 0.00 2.01
4266 4485 4.937620 TCTGATGTGGCTTTGCTAGTTAAG 59.062 41.667 0.00 0.00 0.00 1.85
4267 4486 4.905429 TGATGTGGCTTTGCTAGTTAAGA 58.095 39.130 9.35 0.00 0.00 2.10
4268 4487 5.312895 TGATGTGGCTTTGCTAGTTAAGAA 58.687 37.500 9.35 0.00 0.00 2.52
4269 4488 5.412594 TGATGTGGCTTTGCTAGTTAAGAAG 59.587 40.000 9.35 1.00 0.00 2.85
4270 4489 4.968259 TGTGGCTTTGCTAGTTAAGAAGA 58.032 39.130 9.35 0.00 0.00 2.87
4271 4490 4.997395 TGTGGCTTTGCTAGTTAAGAAGAG 59.003 41.667 9.35 0.00 0.00 2.85
4272 4491 5.221641 TGTGGCTTTGCTAGTTAAGAAGAGA 60.222 40.000 9.35 0.00 0.00 3.10
4273 4492 5.350091 GTGGCTTTGCTAGTTAAGAAGAGAG 59.650 44.000 9.35 0.00 0.00 3.20
4274 4493 5.246203 TGGCTTTGCTAGTTAAGAAGAGAGA 59.754 40.000 9.35 0.00 0.00 3.10
4275 4494 5.810074 GGCTTTGCTAGTTAAGAAGAGAGAG 59.190 44.000 9.35 0.00 0.00 3.20
4276 4495 6.350612 GGCTTTGCTAGTTAAGAAGAGAGAGA 60.351 42.308 9.35 0.00 0.00 3.10
4277 4496 6.751888 GCTTTGCTAGTTAAGAAGAGAGAGAG 59.248 42.308 9.35 0.00 0.00 3.20
4278 4497 7.362574 GCTTTGCTAGTTAAGAAGAGAGAGAGA 60.363 40.741 9.35 0.00 0.00 3.10
4279 4498 7.624360 TTGCTAGTTAAGAAGAGAGAGAGAG 57.376 40.000 0.00 0.00 0.00 3.20
4280 4499 6.717289 TGCTAGTTAAGAAGAGAGAGAGAGT 58.283 40.000 0.00 0.00 0.00 3.24
4281 4500 6.597672 TGCTAGTTAAGAAGAGAGAGAGAGTG 59.402 42.308 0.00 0.00 0.00 3.51
4282 4501 6.038271 GCTAGTTAAGAAGAGAGAGAGAGTGG 59.962 46.154 0.00 0.00 0.00 4.00
4283 4502 5.887754 AGTTAAGAAGAGAGAGAGAGTGGT 58.112 41.667 0.00 0.00 0.00 4.16
4284 4503 7.023171 AGTTAAGAAGAGAGAGAGAGTGGTA 57.977 40.000 0.00 0.00 0.00 3.25
4285 4504 7.639378 AGTTAAGAAGAGAGAGAGAGTGGTAT 58.361 38.462 0.00 0.00 0.00 2.73
4286 4505 7.556275 AGTTAAGAAGAGAGAGAGAGTGGTATG 59.444 40.741 0.00 0.00 0.00 2.39
4287 4506 4.792068 AGAAGAGAGAGAGAGTGGTATGG 58.208 47.826 0.00 0.00 0.00 2.74
4288 4507 2.944129 AGAGAGAGAGAGTGGTATGGC 58.056 52.381 0.00 0.00 0.00 4.40
4289 4508 1.606668 GAGAGAGAGAGTGGTATGGCG 59.393 57.143 0.00 0.00 0.00 5.69
4290 4509 1.213182 AGAGAGAGAGTGGTATGGCGA 59.787 52.381 0.00 0.00 0.00 5.54
4291 4510 1.335496 GAGAGAGAGTGGTATGGCGAC 59.665 57.143 0.00 0.00 0.00 5.19
4292 4511 0.386113 GAGAGAGTGGTATGGCGACC 59.614 60.000 1.53 1.53 40.21 4.79
4293 4512 1.043673 AGAGAGTGGTATGGCGACCC 61.044 60.000 5.98 0.00 38.89 4.46
4303 4522 2.941210 TGGCGACCCATGAAGAAAC 58.059 52.632 0.00 0.00 35.79 2.78
4304 4523 0.953471 TGGCGACCCATGAAGAAACG 60.953 55.000 0.00 0.00 35.79 3.60
4305 4524 1.644786 GGCGACCCATGAAGAAACGG 61.645 60.000 0.00 0.00 0.00 4.44
4306 4525 0.953960 GCGACCCATGAAGAAACGGT 60.954 55.000 0.00 0.00 0.00 4.83
4307 4526 0.796312 CGACCCATGAAGAAACGGTG 59.204 55.000 0.00 0.00 0.00 4.94
4308 4527 0.521735 GACCCATGAAGAAACGGTGC 59.478 55.000 0.00 0.00 0.00 5.01
4309 4528 0.110486 ACCCATGAAGAAACGGTGCT 59.890 50.000 0.00 0.00 0.00 4.40
4310 4529 1.349688 ACCCATGAAGAAACGGTGCTA 59.650 47.619 0.00 0.00 0.00 3.49
4311 4530 2.224670 ACCCATGAAGAAACGGTGCTAA 60.225 45.455 0.00 0.00 0.00 3.09
4312 4531 2.420022 CCCATGAAGAAACGGTGCTAAG 59.580 50.000 0.00 0.00 0.00 2.18
4313 4532 2.159517 CCATGAAGAAACGGTGCTAAGC 60.160 50.000 0.00 0.00 0.00 3.09
4314 4533 2.543777 TGAAGAAACGGTGCTAAGCT 57.456 45.000 0.00 0.00 0.00 3.74
4315 4534 2.413837 TGAAGAAACGGTGCTAAGCTC 58.586 47.619 0.00 0.00 0.00 4.09
4316 4535 1.390463 GAAGAAACGGTGCTAAGCTCG 59.610 52.381 0.00 0.00 33.90 5.03
4317 4536 0.317479 AGAAACGGTGCTAAGCTCGT 59.683 50.000 0.00 0.00 39.57 4.18
4318 4537 1.542915 AGAAACGGTGCTAAGCTCGTA 59.457 47.619 0.00 0.00 37.87 3.43
4319 4538 2.165845 AGAAACGGTGCTAAGCTCGTAT 59.834 45.455 0.00 0.00 37.87 3.06
4320 4539 3.379372 AGAAACGGTGCTAAGCTCGTATA 59.621 43.478 0.00 0.00 37.87 1.47
4321 4540 2.770699 ACGGTGCTAAGCTCGTATAC 57.229 50.000 0.00 0.00 37.36 1.47
4322 4541 1.336125 ACGGTGCTAAGCTCGTATACC 59.664 52.381 0.00 0.00 37.36 2.73
4323 4542 1.607628 CGGTGCTAAGCTCGTATACCT 59.392 52.381 0.00 0.00 0.00 3.08
4324 4543 2.810274 CGGTGCTAAGCTCGTATACCTA 59.190 50.000 0.00 0.00 0.00 3.08
4325 4544 3.120269 CGGTGCTAAGCTCGTATACCTAG 60.120 52.174 0.00 0.00 0.00 3.02
4326 4545 3.190953 GGTGCTAAGCTCGTATACCTAGG 59.809 52.174 7.41 7.41 0.00 3.02
4327 4546 3.819902 GTGCTAAGCTCGTATACCTAGGT 59.180 47.826 20.57 20.57 0.00 3.08
4328 4547 3.819337 TGCTAAGCTCGTATACCTAGGTG 59.181 47.826 25.33 7.70 0.00 4.00
4329 4548 3.190953 GCTAAGCTCGTATACCTAGGTGG 59.809 52.174 25.33 10.82 42.93 4.61
4330 4549 3.589951 AAGCTCGTATACCTAGGTGGA 57.410 47.619 25.33 14.33 39.71 4.02
4331 4550 3.589951 AGCTCGTATACCTAGGTGGAA 57.410 47.619 25.33 4.79 39.71 3.53
4332 4551 3.488363 AGCTCGTATACCTAGGTGGAAG 58.512 50.000 25.33 13.69 39.71 3.46
4333 4552 2.030096 GCTCGTATACCTAGGTGGAAGC 60.030 54.545 25.33 19.60 39.71 3.86
4334 4553 2.224606 TCGTATACCTAGGTGGAAGCG 58.775 52.381 25.33 19.15 40.95 4.68
4335 4554 1.335689 CGTATACCTAGGTGGAAGCGC 60.336 57.143 25.33 0.00 40.95 5.92
4336 4555 1.684983 GTATACCTAGGTGGAAGCGCA 59.315 52.381 25.33 1.40 40.95 6.09
4337 4556 1.200519 ATACCTAGGTGGAAGCGCAA 58.799 50.000 25.33 0.57 40.95 4.85
4338 4557 1.200519 TACCTAGGTGGAAGCGCAAT 58.799 50.000 25.33 0.00 40.95 3.56
4339 4558 0.328258 ACCTAGGTGGAAGCGCAATT 59.672 50.000 15.42 0.00 40.95 2.32
4340 4559 1.017387 CCTAGGTGGAAGCGCAATTC 58.983 55.000 11.47 5.35 40.95 2.17
4345 4564 3.890674 GGAAGCGCAATTCCGAGT 58.109 55.556 11.47 0.00 39.47 4.18
4346 4565 1.716172 GGAAGCGCAATTCCGAGTC 59.284 57.895 11.47 0.00 39.47 3.36
4347 4566 0.741221 GGAAGCGCAATTCCGAGTCT 60.741 55.000 11.47 0.00 39.47 3.24
4348 4567 1.470979 GGAAGCGCAATTCCGAGTCTA 60.471 52.381 11.47 0.00 39.47 2.59
4349 4568 1.588861 GAAGCGCAATTCCGAGTCTAC 59.411 52.381 11.47 0.00 0.00 2.59
4350 4569 0.530744 AGCGCAATTCCGAGTCTACA 59.469 50.000 11.47 0.00 0.00 2.74
4351 4570 1.067142 AGCGCAATTCCGAGTCTACAA 60.067 47.619 11.47 0.00 0.00 2.41
4352 4571 1.060698 GCGCAATTCCGAGTCTACAAC 59.939 52.381 0.30 0.00 0.00 3.32
4353 4572 2.607187 CGCAATTCCGAGTCTACAACT 58.393 47.619 0.00 0.00 42.42 3.16
4354 4573 3.766151 CGCAATTCCGAGTCTACAACTA 58.234 45.455 0.00 0.00 38.74 2.24
4355 4574 4.171005 CGCAATTCCGAGTCTACAACTAA 58.829 43.478 0.00 0.00 38.74 2.24
4356 4575 4.804139 CGCAATTCCGAGTCTACAACTAAT 59.196 41.667 0.00 0.00 38.74 1.73
4357 4576 5.291128 CGCAATTCCGAGTCTACAACTAATT 59.709 40.000 0.00 0.00 38.74 1.40
4358 4577 6.474427 CGCAATTCCGAGTCTACAACTAATTA 59.526 38.462 0.00 0.00 38.74 1.40
4359 4578 7.009815 CGCAATTCCGAGTCTACAACTAATTAA 59.990 37.037 0.00 0.00 38.74 1.40
4360 4579 8.662141 GCAATTCCGAGTCTACAACTAATTAAA 58.338 33.333 0.00 0.00 38.74 1.52
4363 4582 9.886132 ATTCCGAGTCTACAACTAATTAAATGT 57.114 29.630 7.66 7.66 38.74 2.71
4380 4599 8.588290 ATTAAATGTATGAAGCTTAACACCCA 57.412 30.769 0.00 0.00 0.00 4.51
4381 4600 6.909550 AAATGTATGAAGCTTAACACCCAA 57.090 33.333 0.00 0.00 0.00 4.12
4382 4601 6.909550 AATGTATGAAGCTTAACACCCAAA 57.090 33.333 0.00 0.00 0.00 3.28
4383 4602 6.909550 ATGTATGAAGCTTAACACCCAAAA 57.090 33.333 0.00 0.00 0.00 2.44
4384 4603 6.325919 TGTATGAAGCTTAACACCCAAAAG 57.674 37.500 0.00 0.00 0.00 2.27
4385 4604 3.726291 TGAAGCTTAACACCCAAAAGC 57.274 42.857 0.00 0.00 44.70 3.51
4390 4609 3.575630 GCTTAACACCCAAAAGCTTAGC 58.424 45.455 0.00 0.00 41.85 3.09
4391 4610 3.005367 GCTTAACACCCAAAAGCTTAGCA 59.995 43.478 7.07 0.00 41.85 3.49
4392 4611 4.546570 CTTAACACCCAAAAGCTTAGCAC 58.453 43.478 7.07 0.00 0.00 4.40
4393 4612 1.328279 ACACCCAAAAGCTTAGCACC 58.672 50.000 7.07 0.00 0.00 5.01
4394 4613 1.133482 ACACCCAAAAGCTTAGCACCT 60.133 47.619 7.07 0.00 0.00 4.00
4395 4614 2.107552 ACACCCAAAAGCTTAGCACCTA 59.892 45.455 7.07 0.00 0.00 3.08
4396 4615 3.245264 ACACCCAAAAGCTTAGCACCTAT 60.245 43.478 7.07 0.00 0.00 2.57
4397 4616 3.129287 CACCCAAAAGCTTAGCACCTATG 59.871 47.826 7.07 0.00 0.00 2.23
4413 4632 6.949352 CACCTATGCATTAAGGATTTGAGT 57.051 37.500 20.28 0.00 36.66 3.41
4414 4633 7.338800 CACCTATGCATTAAGGATTTGAGTT 57.661 36.000 20.28 0.00 36.66 3.01
4415 4634 7.198390 CACCTATGCATTAAGGATTTGAGTTG 58.802 38.462 20.28 3.86 36.66 3.16
4416 4635 7.067372 CACCTATGCATTAAGGATTTGAGTTGA 59.933 37.037 20.28 0.00 36.66 3.18
4417 4636 7.781693 ACCTATGCATTAAGGATTTGAGTTGAT 59.218 33.333 20.28 0.00 36.66 2.57
4418 4637 9.288576 CCTATGCATTAAGGATTTGAGTTGATA 57.711 33.333 9.61 0.00 34.58 2.15
4421 4640 8.806429 TGCATTAAGGATTTGAGTTGATAAGA 57.194 30.769 0.00 0.00 0.00 2.10
4422 4641 8.677300 TGCATTAAGGATTTGAGTTGATAAGAC 58.323 33.333 0.00 0.00 0.00 3.01
4423 4642 8.677300 GCATTAAGGATTTGAGTTGATAAGACA 58.323 33.333 0.00 0.00 0.00 3.41
4452 4671 7.782897 ATATACTTAGCACCTCATCTAAGCA 57.217 36.000 8.44 0.00 43.27 3.91
4453 4672 4.130286 ACTTAGCACCTCATCTAAGCAC 57.870 45.455 8.44 0.00 43.27 4.40
4454 4673 3.118592 ACTTAGCACCTCATCTAAGCACC 60.119 47.826 8.44 0.00 43.27 5.01
4455 4674 1.577736 AGCACCTCATCTAAGCACCT 58.422 50.000 0.00 0.00 0.00 4.00
4456 4675 1.912043 AGCACCTCATCTAAGCACCTT 59.088 47.619 0.00 0.00 0.00 3.50
4457 4676 2.307098 AGCACCTCATCTAAGCACCTTT 59.693 45.455 0.00 0.00 0.00 3.11
4458 4677 2.421424 GCACCTCATCTAAGCACCTTTG 59.579 50.000 0.00 0.00 0.00 2.77
4478 4697 8.462016 ACCTTTGCATTAAAAGATGTCTCATAC 58.538 33.333 0.00 0.00 39.12 2.39
4484 4713 4.606457 AAAAGATGTCTCATACGCTTGC 57.394 40.909 0.00 0.00 0.00 4.01
4506 4736 1.988107 TGCAGGAGGAGGATGACTTTT 59.012 47.619 0.00 0.00 0.00 2.27
4517 4819 0.666274 ATGACTTTTCGCTGCGACGA 60.666 50.000 25.94 13.69 41.04 4.20
4578 4891 1.561542 CCATGCTCCTCCAGTACCTTT 59.438 52.381 0.00 0.00 0.00 3.11
4618 4931 2.281345 CCATGGCTCCATCTCGGC 60.281 66.667 0.00 0.00 33.90 5.54
4640 4953 2.202623 GAGGTGCGCGACGAGATT 60.203 61.111 12.10 0.00 0.00 2.40
4649 4962 1.009829 GCGACGAGATTGCAAAGGAT 58.990 50.000 1.71 0.00 37.69 3.24
4712 5025 1.001706 GCGTATCTCTATGGTGCACGA 60.002 52.381 11.45 7.55 0.00 4.35
4758 5186 1.067846 ACGAGTTCAAGCGCTATGTCA 60.068 47.619 12.05 0.58 0.00 3.58
4772 5200 4.262207 CGCTATGTCACCTATGTCCTTGAT 60.262 45.833 0.00 0.00 0.00 2.57
4832 5265 5.588246 TCAAGTTAGTGCACAACATTTCTGA 59.412 36.000 21.04 14.64 0.00 3.27
4835 5268 7.369803 AGTTAGTGCACAACATTTCTGATAG 57.630 36.000 21.04 0.00 0.00 2.08
4856 5290 2.544069 GCTAGCTAGTCACGGTTGATCC 60.544 54.545 21.62 0.00 33.11 3.36
4953 5387 0.419865 TAGACATGAAGGGGTGGGGA 59.580 55.000 0.00 0.00 0.00 4.81
5010 5444 2.057137 TGGAAATCATGCAGGGCTAC 57.943 50.000 0.00 0.00 0.00 3.58
5067 5501 0.747644 TGCCCTACATGTTCATGGCG 60.748 55.000 2.30 7.04 41.77 5.69
5103 5537 1.080366 CCCGTTCATTGACGACCGA 60.080 57.895 9.29 0.00 45.47 4.69
5109 5543 1.080366 CATTGACGACCGAACCCGA 60.080 57.895 0.00 0.00 38.22 5.14
5128 5562 4.380023 CCCGAAAGAAGTTTGTGTTTGTCA 60.380 41.667 0.00 0.00 0.00 3.58
5259 5723 5.773680 GTCCAAATCCATCTGATGATTGGAT 59.226 40.000 31.60 21.67 42.97 3.41
5260 5724 5.773176 TCCAAATCCATCTGATGATTGGATG 59.227 40.000 28.75 17.67 39.79 3.51
5261 5725 5.773176 CCAAATCCATCTGATGATTGGATGA 59.227 40.000 27.53 14.58 38.91 2.92
5262 5726 6.437477 CCAAATCCATCTGATGATTGGATGAT 59.563 38.462 27.53 15.75 38.91 2.45
5263 5727 7.363007 CCAAATCCATCTGATGATTGGATGATC 60.363 40.741 27.53 0.00 38.91 2.92
5264 5728 5.836024 TCCATCTGATGATTGGATGATCA 57.164 39.130 18.92 0.00 39.12 2.92
5265 5729 6.388619 TCCATCTGATGATTGGATGATCAT 57.611 37.500 18.92 8.25 46.59 2.45
5266 5730 6.180472 TCCATCTGATGATTGGATGATCATG 58.820 40.000 18.92 0.00 44.57 3.07
5267 5731 6.012858 TCCATCTGATGATTGGATGATCATGA 60.013 38.462 18.92 0.00 44.57 3.07
5268 5732 6.830838 CCATCTGATGATTGGATGATCATGAT 59.169 38.462 18.92 8.25 44.57 2.45
5269 5733 7.012799 CCATCTGATGATTGGATGATCATGATC 59.987 40.741 25.91 25.91 44.57 2.92
5282 5746 6.990908 TGATCATGATCACTACCTGAAGAT 57.009 37.500 30.27 0.00 42.42 2.40
5283 5747 6.756221 TGATCATGATCACTACCTGAAGATG 58.244 40.000 30.27 0.00 42.42 2.90
5284 5748 4.953667 TCATGATCACTACCTGAAGATGC 58.046 43.478 0.00 0.00 30.60 3.91
5285 5749 4.406649 TCATGATCACTACCTGAAGATGCA 59.593 41.667 0.00 0.00 30.60 3.96
5286 5750 4.824479 TGATCACTACCTGAAGATGCAA 57.176 40.909 0.00 0.00 30.60 4.08
5287 5751 5.363562 TGATCACTACCTGAAGATGCAAT 57.636 39.130 0.00 0.00 30.60 3.56
5288 5752 5.748402 TGATCACTACCTGAAGATGCAATT 58.252 37.500 0.00 0.00 30.60 2.32
5289 5753 6.888105 TGATCACTACCTGAAGATGCAATTA 58.112 36.000 0.00 0.00 30.60 1.40
5290 5754 7.337938 TGATCACTACCTGAAGATGCAATTAA 58.662 34.615 0.00 0.00 30.60 1.40
5291 5755 7.496920 TGATCACTACCTGAAGATGCAATTAAG 59.503 37.037 0.00 0.00 30.60 1.85
5292 5756 6.115446 TCACTACCTGAAGATGCAATTAAGG 58.885 40.000 14.32 14.32 0.00 2.69
5293 5757 5.297776 CACTACCTGAAGATGCAATTAAGGG 59.702 44.000 18.36 8.42 0.00 3.95
5294 5758 4.322057 ACCTGAAGATGCAATTAAGGGT 57.678 40.909 18.36 8.95 0.00 4.34
5295 5759 4.273318 ACCTGAAGATGCAATTAAGGGTC 58.727 43.478 18.36 0.00 0.00 4.46
5296 5760 3.633986 CCTGAAGATGCAATTAAGGGTCC 59.366 47.826 9.67 0.00 0.00 4.46
5297 5761 4.272489 CTGAAGATGCAATTAAGGGTCCA 58.728 43.478 0.00 0.00 0.00 4.02
5298 5762 4.016444 TGAAGATGCAATTAAGGGTCCAC 58.984 43.478 0.00 0.00 0.00 4.02
5299 5763 3.737559 AGATGCAATTAAGGGTCCACA 57.262 42.857 0.00 0.00 0.00 4.17
5300 5764 3.356290 AGATGCAATTAAGGGTCCACAC 58.644 45.455 0.00 0.00 0.00 3.82
5301 5765 2.969821 TGCAATTAAGGGTCCACACT 57.030 45.000 0.00 0.00 0.00 3.55
5302 5766 2.790433 TGCAATTAAGGGTCCACACTC 58.210 47.619 0.00 0.00 0.00 3.51
5303 5767 2.092323 GCAATTAAGGGTCCACACTCC 58.908 52.381 0.00 0.00 0.00 3.85
5304 5768 2.356135 CAATTAAGGGTCCACACTCCG 58.644 52.381 0.00 0.00 0.00 4.63
5305 5769 1.946984 ATTAAGGGTCCACACTCCGA 58.053 50.000 0.00 0.00 0.00 4.55
5306 5770 0.971386 TTAAGGGTCCACACTCCGAC 59.029 55.000 0.00 0.00 0.00 4.79
5307 5771 0.178955 TAAGGGTCCACACTCCGACA 60.179 55.000 0.00 0.00 0.00 4.35
5308 5772 1.755393 AAGGGTCCACACTCCGACAC 61.755 60.000 0.00 0.00 32.29 3.67
5309 5773 2.049433 GGTCCACACTCCGACACG 60.049 66.667 0.00 0.00 0.00 4.49
5310 5774 2.733593 GTCCACACTCCGACACGC 60.734 66.667 0.00 0.00 0.00 5.34
5311 5775 3.986006 TCCACACTCCGACACGCC 61.986 66.667 0.00 0.00 0.00 5.68
5312 5776 4.293648 CCACACTCCGACACGCCA 62.294 66.667 0.00 0.00 0.00 5.69
5313 5777 2.048222 CACACTCCGACACGCCAT 60.048 61.111 0.00 0.00 0.00 4.40
5314 5778 2.094659 CACACTCCGACACGCCATC 61.095 63.158 0.00 0.00 0.00 3.51
5315 5779 2.880879 CACTCCGACACGCCATCG 60.881 66.667 0.00 0.00 42.43 3.84
5316 5780 3.060000 ACTCCGACACGCCATCGA 61.060 61.111 5.24 0.00 42.25 3.59
5317 5781 2.579787 CTCCGACACGCCATCGAC 60.580 66.667 5.24 0.00 42.25 4.20
5318 5782 4.470170 TCCGACACGCCATCGACG 62.470 66.667 5.24 0.00 42.25 5.12
5319 5783 4.470170 CCGACACGCCATCGACGA 62.470 66.667 0.00 0.00 42.25 4.20
5320 5784 2.944557 CGACACGCCATCGACGAG 60.945 66.667 3.01 0.00 42.25 4.18
5321 5785 2.178521 GACACGCCATCGACGAGT 59.821 61.111 3.01 0.00 39.41 4.18
5322 5786 1.868251 GACACGCCATCGACGAGTC 60.868 63.158 3.01 8.28 42.24 3.36
5323 5787 2.579787 CACGCCATCGACGAGTCC 60.580 66.667 3.01 0.00 39.41 3.85
5324 5788 3.823330 ACGCCATCGACGAGTCCC 61.823 66.667 3.01 0.00 39.41 4.46
5325 5789 3.822192 CGCCATCGACGAGTCCCA 61.822 66.667 3.01 0.00 38.10 4.37
5326 5790 2.105128 GCCATCGACGAGTCCCAG 59.895 66.667 3.01 0.00 0.00 4.45
5327 5791 2.105128 CCATCGACGAGTCCCAGC 59.895 66.667 3.01 0.00 0.00 4.85
5328 5792 2.418910 CCATCGACGAGTCCCAGCT 61.419 63.158 3.01 0.00 0.00 4.24
5329 5793 1.064946 CATCGACGAGTCCCAGCTC 59.935 63.158 3.01 0.00 0.00 4.09
5330 5794 2.122167 ATCGACGAGTCCCAGCTCC 61.122 63.158 3.01 0.00 32.11 4.70
5331 5795 3.827898 CGACGAGTCCCAGCTCCC 61.828 72.222 0.00 0.00 32.11 4.30
5332 5796 3.462678 GACGAGTCCCAGCTCCCC 61.463 72.222 0.00 0.00 32.11 4.81
5335 5799 3.151022 GAGTCCCAGCTCCCCGAG 61.151 72.222 0.00 0.00 0.00 4.63
5336 5800 4.787280 AGTCCCAGCTCCCCGAGG 62.787 72.222 0.00 0.00 0.00 4.63
5337 5801 4.779733 GTCCCAGCTCCCCGAGGA 62.780 72.222 0.00 0.00 41.08 3.71
5345 5809 2.124983 TCCCCGAGGAGTACGACG 60.125 66.667 0.00 0.00 37.19 5.12
5346 5810 3.207669 CCCCGAGGAGTACGACGG 61.208 72.222 13.16 13.16 41.17 4.79
5347 5811 3.885521 CCCGAGGAGTACGACGGC 61.886 72.222 14.17 0.00 40.56 5.68
5348 5812 3.129502 CCGAGGAGTACGACGGCA 61.130 66.667 0.00 0.00 37.19 5.69
5349 5813 2.693762 CCGAGGAGTACGACGGCAA 61.694 63.158 0.00 0.00 37.19 4.52
5350 5814 1.226323 CGAGGAGTACGACGGCAAG 60.226 63.158 0.00 0.00 0.00 4.01
5351 5815 1.881602 GAGGAGTACGACGGCAAGT 59.118 57.895 0.00 0.00 0.00 3.16
5352 5816 0.243095 GAGGAGTACGACGGCAAGTT 59.757 55.000 0.00 0.00 0.00 2.66
5353 5817 0.038526 AGGAGTACGACGGCAAGTTG 60.039 55.000 0.00 0.00 40.15 3.16
5354 5818 0.038892 GGAGTACGACGGCAAGTTGA 60.039 55.000 7.16 0.00 37.67 3.18
5355 5819 1.058404 GAGTACGACGGCAAGTTGAC 58.942 55.000 7.16 1.74 37.67 3.18
5356 5820 0.386476 AGTACGACGGCAAGTTGACA 59.614 50.000 9.92 0.00 37.67 3.58
5357 5821 0.505655 GTACGACGGCAAGTTGACAC 59.494 55.000 9.92 1.07 37.67 3.67
5358 5822 0.386476 TACGACGGCAAGTTGACACT 59.614 50.000 9.92 0.00 37.67 3.55
5359 5823 0.874607 ACGACGGCAAGTTGACACTC 60.875 55.000 9.92 1.34 37.67 3.51
5360 5824 0.597637 CGACGGCAAGTTGACACTCT 60.598 55.000 9.92 0.00 36.30 3.24
5361 5825 1.335597 CGACGGCAAGTTGACACTCTA 60.336 52.381 9.92 0.00 36.30 2.43
5362 5826 2.329379 GACGGCAAGTTGACACTCTAG 58.671 52.381 9.92 0.00 30.45 2.43
5363 5827 1.000955 ACGGCAAGTTGACACTCTAGG 59.999 52.381 9.92 0.00 30.45 3.02
5364 5828 1.673033 CGGCAAGTTGACACTCTAGGG 60.673 57.143 9.92 0.00 30.45 3.53
5365 5829 1.623811 GGCAAGTTGACACTCTAGGGA 59.376 52.381 7.16 0.00 30.45 4.20
5366 5830 2.237392 GGCAAGTTGACACTCTAGGGAT 59.763 50.000 7.16 0.00 30.45 3.85
5367 5831 3.451178 GGCAAGTTGACACTCTAGGGATA 59.549 47.826 7.16 0.00 30.45 2.59
5368 5832 4.101741 GGCAAGTTGACACTCTAGGGATAT 59.898 45.833 7.16 0.00 30.45 1.63
5369 5833 5.293560 GCAAGTTGACACTCTAGGGATATC 58.706 45.833 7.16 0.00 30.45 1.63
5370 5834 5.163405 GCAAGTTGACACTCTAGGGATATCA 60.163 44.000 7.16 0.00 30.45 2.15
5371 5835 6.630413 GCAAGTTGACACTCTAGGGATATCAA 60.630 42.308 7.16 0.00 30.45 2.57
5372 5836 7.331026 CAAGTTGACACTCTAGGGATATCAAA 58.669 38.462 4.83 0.00 30.45 2.69
5373 5837 7.118496 AGTTGACACTCTAGGGATATCAAAG 57.882 40.000 4.83 0.00 0.00 2.77
5374 5838 6.670027 AGTTGACACTCTAGGGATATCAAAGT 59.330 38.462 4.83 0.00 0.00 2.66
5375 5839 7.181125 AGTTGACACTCTAGGGATATCAAAGTT 59.819 37.037 4.83 0.00 0.00 2.66
5376 5840 7.113658 TGACACTCTAGGGATATCAAAGTTC 57.886 40.000 4.83 2.78 0.00 3.01
5377 5841 6.667848 TGACACTCTAGGGATATCAAAGTTCA 59.332 38.462 4.83 4.77 0.00 3.18
5378 5842 6.879400 ACACTCTAGGGATATCAAAGTTCAC 58.121 40.000 4.83 0.00 0.00 3.18
5379 5843 5.980116 CACTCTAGGGATATCAAAGTTCACG 59.020 44.000 4.83 0.00 0.00 4.35
5380 5844 5.892119 ACTCTAGGGATATCAAAGTTCACGA 59.108 40.000 4.83 0.00 0.00 4.35
5381 5845 6.551601 ACTCTAGGGATATCAAAGTTCACGAT 59.448 38.462 4.83 0.00 0.00 3.73
5382 5846 6.982852 TCTAGGGATATCAAAGTTCACGATC 58.017 40.000 4.83 0.00 0.00 3.69
5383 5847 4.621991 AGGGATATCAAAGTTCACGATCG 58.378 43.478 14.88 14.88 0.00 3.69
5384 5848 4.099573 AGGGATATCAAAGTTCACGATCGT 59.900 41.667 16.60 16.60 0.00 3.73
5385 5849 4.444720 GGGATATCAAAGTTCACGATCGTC 59.555 45.833 19.84 7.63 0.00 4.20
5386 5850 5.282510 GGATATCAAAGTTCACGATCGTCT 58.717 41.667 19.84 10.14 0.00 4.18
5387 5851 6.436261 GGATATCAAAGTTCACGATCGTCTA 58.564 40.000 19.84 6.77 0.00 2.59
5388 5852 6.916387 GGATATCAAAGTTCACGATCGTCTAA 59.084 38.462 19.84 13.00 0.00 2.10
5389 5853 7.113684 GGATATCAAAGTTCACGATCGTCTAAG 59.886 40.741 19.84 7.44 0.00 2.18
5390 5854 5.117355 TCAAAGTTCACGATCGTCTAAGT 57.883 39.130 19.84 15.21 0.00 2.24
5391 5855 5.152097 TCAAAGTTCACGATCGTCTAAGTC 58.848 41.667 19.84 5.22 0.00 3.01
5392 5856 4.761235 AAGTTCACGATCGTCTAAGTCA 57.239 40.909 19.84 0.00 0.00 3.41
5393 5857 4.966965 AGTTCACGATCGTCTAAGTCAT 57.033 40.909 19.84 0.17 0.00 3.06
5394 5858 5.312120 AGTTCACGATCGTCTAAGTCATT 57.688 39.130 19.84 0.00 0.00 2.57
5395 5859 5.710984 AGTTCACGATCGTCTAAGTCATTT 58.289 37.500 19.84 0.00 0.00 2.32
5396 5860 6.849502 AGTTCACGATCGTCTAAGTCATTTA 58.150 36.000 19.84 0.00 0.00 1.40
5397 5861 6.967767 AGTTCACGATCGTCTAAGTCATTTAG 59.032 38.462 19.84 2.19 40.16 1.85
5398 5862 6.673154 TCACGATCGTCTAAGTCATTTAGA 57.327 37.500 19.84 4.83 44.24 2.10
5425 5889 1.892209 TCGATGGCGATCACTAGCTA 58.108 50.000 9.52 0.00 42.51 3.32
5433 5897 4.522789 TGGCGATCACTAGCTAACATATGA 59.477 41.667 10.38 0.00 0.00 2.15
5445 5909 9.561069 CTAGCTAACATATGAAATTAAGGGTGT 57.439 33.333 10.38 0.00 0.00 4.16
5446 5910 8.225603 AGCTAACATATGAAATTAAGGGTGTG 57.774 34.615 10.38 0.00 0.00 3.82
5447 5911 6.918022 GCTAACATATGAAATTAAGGGTGTGC 59.082 38.462 10.38 0.00 0.00 4.57
5449 5913 4.338118 ACATATGAAATTAAGGGTGTGCCG 59.662 41.667 10.38 0.00 34.97 5.69
5450 5914 1.540267 TGAAATTAAGGGTGTGCCGG 58.460 50.000 0.00 0.00 34.97 6.13
5455 5919 0.250553 TTAAGGGTGTGCCGGAACTG 60.251 55.000 15.35 0.00 34.97 3.16
5462 5930 2.594303 TGCCGGAACTGCCAAGTG 60.594 61.111 5.05 0.00 37.94 3.16
5470 5938 2.814336 GGAACTGCCAAGTGAACCTAAG 59.186 50.000 0.00 0.00 36.51 2.18
5472 5940 4.327680 GAACTGCCAAGTGAACCTAAGAT 58.672 43.478 0.00 0.00 36.51 2.40
5473 5941 3.944087 ACTGCCAAGTGAACCTAAGATC 58.056 45.455 0.00 0.00 34.48 2.75
5487 5955 6.380079 ACCTAAGATCAGTGACAATCCTTT 57.620 37.500 0.00 0.00 0.00 3.11
5488 5956 6.784031 ACCTAAGATCAGTGACAATCCTTTT 58.216 36.000 0.00 0.00 0.00 2.27
5494 5962 6.716628 AGATCAGTGACAATCCTTTTAAAGCA 59.283 34.615 0.00 0.00 0.00 3.91
5496 5964 5.241506 TCAGTGACAATCCTTTTAAAGCAGG 59.758 40.000 0.00 0.10 0.00 4.85
5497 5965 4.524328 AGTGACAATCCTTTTAAAGCAGGG 59.476 41.667 6.17 0.58 0.00 4.45
5500 5968 4.488770 ACAATCCTTTTAAAGCAGGGGAA 58.511 39.130 6.17 0.00 0.00 3.97
5503 5971 2.158579 TCCTTTTAAAGCAGGGGAACGT 60.159 45.455 6.17 0.00 0.00 3.99
5506 5974 2.943036 TTAAAGCAGGGGAACGTCTT 57.057 45.000 0.00 0.00 0.00 3.01
5507 5975 2.178912 TAAAGCAGGGGAACGTCTTG 57.821 50.000 0.00 0.00 0.00 3.02
5513 5981 2.668550 GGGAACGTCTTGCCGCTT 60.669 61.111 0.00 0.00 0.00 4.68
5514 5982 1.375013 GGGAACGTCTTGCCGCTTA 60.375 57.895 0.00 0.00 0.00 3.09
5520 5988 3.075866 ACGTCTTGCCGCTTATACTAC 57.924 47.619 0.00 0.00 0.00 2.73
5529 5997 5.526115 TGCCGCTTATACTACACATAAGTC 58.474 41.667 0.00 0.00 37.97 3.01
5860 6328 9.462606 AGAAGTTACTTCCCTTTATATGTTTGG 57.537 33.333 20.05 0.00 40.98 3.28
5861 6329 9.457436 GAAGTTACTTCCCTTTATATGTTTGGA 57.543 33.333 13.69 0.00 34.71 3.53
5862 6330 9.990868 AAGTTACTTCCCTTTATATGTTTGGAT 57.009 29.630 0.00 0.00 0.00 3.41
5863 6331 9.990868 AGTTACTTCCCTTTATATGTTTGGATT 57.009 29.630 0.00 0.00 0.00 3.01
5867 6335 9.408648 ACTTCCCTTTATATGTTTGGATTAGTG 57.591 33.333 0.00 0.00 0.00 2.74
5868 6336 9.627123 CTTCCCTTTATATGTTTGGATTAGTGA 57.373 33.333 0.00 0.00 0.00 3.41
5869 6337 9.983024 TTCCCTTTATATGTTTGGATTAGTGAA 57.017 29.630 0.00 0.00 0.00 3.18
5876 6344 6.778834 ATGTTTGGATTAGTGAATCATGCA 57.221 33.333 0.00 0.00 42.95 3.96
5877 6345 6.778834 TGTTTGGATTAGTGAATCATGCAT 57.221 33.333 0.00 0.00 42.95 3.96
5878 6346 6.566141 TGTTTGGATTAGTGAATCATGCATG 58.434 36.000 21.07 21.07 42.95 4.06
5879 6347 6.377712 TGTTTGGATTAGTGAATCATGCATGA 59.622 34.615 30.47 30.47 42.95 3.07
5880 6348 7.093858 TGTTTGGATTAGTGAATCATGCATGAA 60.094 33.333 31.79 14.34 42.95 2.57
5881 6349 7.591421 TTGGATTAGTGAATCATGCATGAAT 57.409 32.000 31.79 24.76 42.95 2.57
5882 6350 7.591421 TGGATTAGTGAATCATGCATGAATT 57.409 32.000 31.79 23.96 42.95 2.17
5883 6351 8.694581 TGGATTAGTGAATCATGCATGAATTA 57.305 30.769 31.79 18.69 42.95 1.40
5884 6352 9.134055 TGGATTAGTGAATCATGCATGAATTAA 57.866 29.630 31.79 21.35 42.95 1.40
5890 6358 9.346005 AGTGAATCATGCATGAATTAATGTAGA 57.654 29.630 31.79 6.12 40.69 2.59
5893 6361 9.569167 GAATCATGCATGAATTAATGTAGATGG 57.431 33.333 31.79 0.00 40.69 3.51
5894 6362 8.873186 ATCATGCATGAATTAATGTAGATGGA 57.127 30.769 31.79 4.37 40.69 3.41
5895 6363 8.873186 TCATGCATGAATTAATGTAGATGGAT 57.127 30.769 26.87 0.00 33.08 3.41
5896 6364 9.304335 TCATGCATGAATTAATGTAGATGGATT 57.696 29.630 26.87 0.00 33.08 3.01
5897 6365 9.923143 CATGCATGAATTAATGTAGATGGATTT 57.077 29.630 22.59 0.00 0.00 2.17
5899 6367 9.134055 TGCATGAATTAATGTAGATGGATTTCA 57.866 29.630 4.66 0.00 0.00 2.69
5934 6402 9.959749 TTACATTGGTAGAAAATCACAAGAAAC 57.040 29.630 0.00 0.00 0.00 2.78
5935 6403 8.006298 ACATTGGTAGAAAATCACAAGAAACA 57.994 30.769 0.00 0.00 0.00 2.83
5936 6404 8.474025 ACATTGGTAGAAAATCACAAGAAACAA 58.526 29.630 0.00 0.00 0.00 2.83
5937 6405 9.311916 CATTGGTAGAAAATCACAAGAAACAAA 57.688 29.630 0.00 0.00 0.00 2.83
5938 6406 9.883142 ATTGGTAGAAAATCACAAGAAACAAAA 57.117 25.926 0.00 0.00 0.00 2.44
5939 6407 9.712305 TTGGTAGAAAATCACAAGAAACAAAAA 57.288 25.926 0.00 0.00 0.00 1.94
5940 6408 9.883142 TGGTAGAAAATCACAAGAAACAAAAAT 57.117 25.926 0.00 0.00 0.00 1.82
5981 6449 9.677567 TGAGTACACTTTCATTTGAAAATAAGC 57.322 29.630 7.13 0.00 42.72 3.09
5982 6450 9.677567 GAGTACACTTTCATTTGAAAATAAGCA 57.322 29.630 7.13 0.00 42.72 3.91
6070 6538 9.741647 GTATTACACTGGTAGTATAAGTGAACC 57.258 37.037 17.47 0.00 43.22 3.62
6071 6539 5.672421 ACACTGGTAGTATAAGTGAACCC 57.328 43.478 17.47 0.00 43.22 4.11
6072 6540 5.088730 ACACTGGTAGTATAAGTGAACCCA 58.911 41.667 17.47 0.00 43.22 4.51
6073 6541 5.544948 ACACTGGTAGTATAAGTGAACCCAA 59.455 40.000 17.47 0.00 43.22 4.12
6074 6542 6.106673 CACTGGTAGTATAAGTGAACCCAAG 58.893 44.000 8.73 0.00 43.22 3.61
6075 6543 5.093849 TGGTAGTATAAGTGAACCCAAGC 57.906 43.478 0.00 0.00 0.00 4.01
6076 6544 4.532916 TGGTAGTATAAGTGAACCCAAGCA 59.467 41.667 0.00 0.00 0.00 3.91
6077 6545 5.013287 TGGTAGTATAAGTGAACCCAAGCAA 59.987 40.000 0.00 0.00 0.00 3.91
6078 6546 5.941647 GGTAGTATAAGTGAACCCAAGCAAA 59.058 40.000 0.00 0.00 0.00 3.68
6079 6547 6.602009 GGTAGTATAAGTGAACCCAAGCAAAT 59.398 38.462 0.00 0.00 0.00 2.32
6080 6548 7.771826 GGTAGTATAAGTGAACCCAAGCAAATA 59.228 37.037 0.00 0.00 0.00 1.40
6081 6549 9.169592 GTAGTATAAGTGAACCCAAGCAAATAA 57.830 33.333 0.00 0.00 0.00 1.40
6082 6550 8.823220 AGTATAAGTGAACCCAAGCAAATAAT 57.177 30.769 0.00 0.00 0.00 1.28
6083 6551 9.914834 AGTATAAGTGAACCCAAGCAAATAATA 57.085 29.630 0.00 0.00 0.00 0.98
6104 6572 4.989279 AATATTTGTGAGACATGCACCC 57.011 40.909 0.00 0.00 35.43 4.61
6105 6573 2.291209 ATTTGTGAGACATGCACCCA 57.709 45.000 0.00 0.00 35.43 4.51
6106 6574 2.291209 TTTGTGAGACATGCACCCAT 57.709 45.000 0.00 0.00 35.43 4.00
6107 6575 1.825090 TTGTGAGACATGCACCCATC 58.175 50.000 0.00 0.00 35.43 3.51
6108 6576 0.391528 TGTGAGACATGCACCCATCG 60.392 55.000 0.00 0.00 35.43 3.84
6109 6577 0.108186 GTGAGACATGCACCCATCGA 60.108 55.000 0.00 0.00 0.00 3.59
6110 6578 0.832626 TGAGACATGCACCCATCGAT 59.167 50.000 0.00 0.00 0.00 3.59
6111 6579 2.038659 TGAGACATGCACCCATCGATA 58.961 47.619 0.00 0.00 0.00 2.92
6112 6580 2.433970 TGAGACATGCACCCATCGATAA 59.566 45.455 0.00 0.00 0.00 1.75
6113 6581 3.118445 TGAGACATGCACCCATCGATAAA 60.118 43.478 0.00 0.00 0.00 1.40
6114 6582 3.470709 AGACATGCACCCATCGATAAAG 58.529 45.455 0.00 0.00 0.00 1.85
6115 6583 3.134623 AGACATGCACCCATCGATAAAGA 59.865 43.478 0.00 0.00 0.00 2.52
6116 6584 4.067896 GACATGCACCCATCGATAAAGAT 58.932 43.478 0.00 0.00 0.00 2.40
6117 6585 4.067896 ACATGCACCCATCGATAAAGATC 58.932 43.478 0.00 0.00 0.00 2.75
6118 6586 3.836365 TGCACCCATCGATAAAGATCA 57.164 42.857 0.00 0.00 31.78 2.92
6119 6587 4.356405 TGCACCCATCGATAAAGATCAT 57.644 40.909 0.00 0.00 31.78 2.45
6120 6588 5.482163 TGCACCCATCGATAAAGATCATA 57.518 39.130 0.00 0.00 31.78 2.15
6121 6589 5.482006 TGCACCCATCGATAAAGATCATAG 58.518 41.667 0.00 0.00 31.78 2.23
6122 6590 4.331168 GCACCCATCGATAAAGATCATAGC 59.669 45.833 0.00 0.00 31.78 2.97
6123 6591 5.482006 CACCCATCGATAAAGATCATAGCA 58.518 41.667 0.00 0.00 31.78 3.49
6124 6592 5.349817 CACCCATCGATAAAGATCATAGCAC 59.650 44.000 0.00 0.00 31.78 4.40
6125 6593 5.012046 ACCCATCGATAAAGATCATAGCACA 59.988 40.000 0.00 0.00 31.78 4.57
6126 6594 5.349817 CCCATCGATAAAGATCATAGCACAC 59.650 44.000 0.00 0.00 31.78 3.82
6127 6595 6.162079 CCATCGATAAAGATCATAGCACACT 58.838 40.000 0.00 0.00 31.78 3.55
6128 6596 7.315890 CCATCGATAAAGATCATAGCACACTA 58.684 38.462 0.00 0.00 31.78 2.74
6129 6597 7.978414 CCATCGATAAAGATCATAGCACACTAT 59.022 37.037 0.00 0.00 39.82 2.12
6176 6644 7.875316 ATCGAGAAGACAATTATTATGGTCG 57.125 36.000 0.00 0.00 39.34 4.79
6177 6645 5.690409 TCGAGAAGACAATTATTATGGTCGC 59.310 40.000 0.00 0.00 39.34 5.19
6178 6646 5.692204 CGAGAAGACAATTATTATGGTCGCT 59.308 40.000 0.00 0.00 39.34 4.93
6179 6647 6.861572 CGAGAAGACAATTATTATGGTCGCTA 59.138 38.462 0.00 0.00 39.34 4.26
6180 6648 7.381408 CGAGAAGACAATTATTATGGTCGCTAA 59.619 37.037 0.00 0.00 39.34 3.09
6181 6649 8.366671 AGAAGACAATTATTATGGTCGCTAAC 57.633 34.615 0.00 0.00 39.34 2.34
6182 6650 7.985184 AGAAGACAATTATTATGGTCGCTAACA 59.015 33.333 0.00 0.00 39.34 2.41
6183 6651 7.478520 AGACAATTATTATGGTCGCTAACAC 57.521 36.000 0.00 0.00 39.34 3.32
6184 6652 7.272978 AGACAATTATTATGGTCGCTAACACT 58.727 34.615 0.00 0.00 39.34 3.55
6185 6653 7.769044 AGACAATTATTATGGTCGCTAACACTT 59.231 33.333 0.00 0.00 39.34 3.16
6186 6654 7.693952 ACAATTATTATGGTCGCTAACACTTG 58.306 34.615 0.00 0.00 0.00 3.16
6187 6655 5.728351 TTATTATGGTCGCTAACACTTGC 57.272 39.130 0.00 0.00 0.00 4.01
6188 6656 2.753055 TATGGTCGCTAACACTTGCA 57.247 45.000 0.00 0.00 0.00 4.08
6189 6657 2.113860 ATGGTCGCTAACACTTGCAT 57.886 45.000 0.00 0.00 0.00 3.96
6190 6658 1.155889 TGGTCGCTAACACTTGCATG 58.844 50.000 0.00 0.00 0.00 4.06
6191 6659 1.270571 TGGTCGCTAACACTTGCATGA 60.271 47.619 6.60 0.00 0.00 3.07
6192 6660 1.394917 GGTCGCTAACACTTGCATGAG 59.605 52.381 6.60 0.66 0.00 2.90
6193 6661 2.337583 GTCGCTAACACTTGCATGAGA 58.662 47.619 6.60 0.00 0.00 3.27
6194 6662 2.736721 GTCGCTAACACTTGCATGAGAA 59.263 45.455 6.60 0.00 0.00 2.87
6195 6663 3.186409 GTCGCTAACACTTGCATGAGAAA 59.814 43.478 6.60 0.00 0.00 2.52
6196 6664 4.002982 TCGCTAACACTTGCATGAGAAAT 58.997 39.130 6.60 0.00 0.00 2.17
6197 6665 4.093514 CGCTAACACTTGCATGAGAAATG 58.906 43.478 6.60 0.00 0.00 2.32
6198 6666 4.142838 CGCTAACACTTGCATGAGAAATGA 60.143 41.667 6.60 0.00 0.00 2.57
6199 6667 5.448225 CGCTAACACTTGCATGAGAAATGAT 60.448 40.000 6.60 0.00 0.00 2.45
6200 6668 5.742453 GCTAACACTTGCATGAGAAATGATG 59.258 40.000 6.60 0.00 0.00 3.07
6201 6669 5.717078 AACACTTGCATGAGAAATGATGT 57.283 34.783 6.60 0.00 0.00 3.06
6202 6670 5.717078 ACACTTGCATGAGAAATGATGTT 57.283 34.783 6.60 0.00 0.00 2.71
6203 6671 6.092955 ACACTTGCATGAGAAATGATGTTT 57.907 33.333 6.60 0.00 0.00 2.83
6204 6672 6.154445 ACACTTGCATGAGAAATGATGTTTC 58.846 36.000 6.60 0.00 0.00 2.78
6205 6673 6.153756 CACTTGCATGAGAAATGATGTTTCA 58.846 36.000 6.60 0.00 36.00 2.69
6206 6674 6.811665 CACTTGCATGAGAAATGATGTTTCAT 59.188 34.615 6.60 0.00 44.62 2.57
6207 6675 7.971722 CACTTGCATGAGAAATGATGTTTCATA 59.028 33.333 6.60 0.00 41.83 2.15
6208 6676 8.188799 ACTTGCATGAGAAATGATGTTTCATAG 58.811 33.333 6.60 0.00 41.83 2.23
6209 6677 7.868906 TGCATGAGAAATGATGTTTCATAGA 57.131 32.000 0.00 0.00 41.83 1.98
6210 6678 7.700505 TGCATGAGAAATGATGTTTCATAGAC 58.299 34.615 0.00 0.00 41.83 2.59
6211 6679 7.337436 TGCATGAGAAATGATGTTTCATAGACA 59.663 33.333 0.00 0.00 41.83 3.41
6212 6680 8.186163 GCATGAGAAATGATGTTTCATAGACAA 58.814 33.333 0.00 0.00 41.83 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
32 36 3.115556 CAACCGTGTTGTGGTGGG 58.884 61.111 8.17 0.00 40.35 4.61
78 83 1.076549 GGGTCACATTCCCTGGCAA 59.923 57.895 0.00 0.00 41.58 4.52
99 105 4.039357 CAGTGGACGTCGGCGAGT 62.039 66.667 20.03 11.01 42.00 4.18
215 252 1.376609 GATGCGCAATCCCTCCGTTT 61.377 55.000 17.11 0.00 0.00 3.60
249 286 1.145377 GTGTGGTCCGTCTGGTGTT 59.855 57.895 0.00 0.00 36.30 3.32
291 328 0.466739 TAGATCCGGCGCTAGGACAA 60.467 55.000 23.29 11.58 41.10 3.18
294 331 0.965866 CCATAGATCCGGCGCTAGGA 60.966 60.000 23.11 23.11 42.69 2.94
309 346 0.106918 GTCCGTCCAAATGGCCCATA 60.107 55.000 0.00 0.00 34.44 2.74
402 439 1.295292 AGGAGGAGATGGCCTTCCTTA 59.705 52.381 20.37 0.00 38.73 2.69
408 445 2.040043 CCCAGGAGGAGATGGCCT 60.040 66.667 3.32 0.00 42.17 5.19
431 468 1.074926 ATCCCGAGCTCATCCCACT 60.075 57.895 15.40 0.00 0.00 4.00
445 482 3.070159 TCACTTTCAGATCCATCGATCCC 59.930 47.826 0.00 0.00 45.32 3.85
446 483 4.327982 TCACTTTCAGATCCATCGATCC 57.672 45.455 0.00 0.00 45.32 3.36
447 484 4.749099 CCTTCACTTTCAGATCCATCGATC 59.251 45.833 0.00 0.00 44.65 3.69
448 485 4.406972 TCCTTCACTTTCAGATCCATCGAT 59.593 41.667 0.00 0.00 0.00 3.59
449 486 3.769300 TCCTTCACTTTCAGATCCATCGA 59.231 43.478 0.00 0.00 0.00 3.59
450 487 4.118410 CTCCTTCACTTTCAGATCCATCG 58.882 47.826 0.00 0.00 0.00 3.84
451 488 5.096443 ACTCCTTCACTTTCAGATCCATC 57.904 43.478 0.00 0.00 0.00 3.51
452 489 5.130145 CCTACTCCTTCACTTTCAGATCCAT 59.870 44.000 0.00 0.00 0.00 3.41
453 490 4.467795 CCTACTCCTTCACTTTCAGATCCA 59.532 45.833 0.00 0.00 0.00 3.41
454 491 4.712337 TCCTACTCCTTCACTTTCAGATCC 59.288 45.833 0.00 0.00 0.00 3.36
455 492 5.394773 GGTCCTACTCCTTCACTTTCAGATC 60.395 48.000 0.00 0.00 0.00 2.75
456 493 4.468153 GGTCCTACTCCTTCACTTTCAGAT 59.532 45.833 0.00 0.00 0.00 2.90
457 494 3.833070 GGTCCTACTCCTTCACTTTCAGA 59.167 47.826 0.00 0.00 0.00 3.27
458 495 3.055747 GGGTCCTACTCCTTCACTTTCAG 60.056 52.174 0.00 0.00 0.00 3.02
459 496 2.904434 GGGTCCTACTCCTTCACTTTCA 59.096 50.000 0.00 0.00 0.00 2.69
460 497 2.094130 CGGGTCCTACTCCTTCACTTTC 60.094 54.545 0.00 0.00 0.00 2.62
461 498 1.900486 CGGGTCCTACTCCTTCACTTT 59.100 52.381 0.00 0.00 0.00 2.66
462 499 1.558233 CGGGTCCTACTCCTTCACTT 58.442 55.000 0.00 0.00 0.00 3.16
463 500 0.971447 GCGGGTCCTACTCCTTCACT 60.971 60.000 0.00 0.00 0.00 3.41
464 501 0.971447 AGCGGGTCCTACTCCTTCAC 60.971 60.000 0.00 0.00 0.00 3.18
465 502 0.970937 CAGCGGGTCCTACTCCTTCA 60.971 60.000 0.00 0.00 0.00 3.02
466 503 0.971447 ACAGCGGGTCCTACTCCTTC 60.971 60.000 0.00 0.00 0.00 3.46
467 504 0.971447 GACAGCGGGTCCTACTCCTT 60.971 60.000 0.59 0.00 40.83 3.36
468 505 1.380112 GACAGCGGGTCCTACTCCT 60.380 63.158 0.59 0.00 40.83 3.69
469 506 3.208335 GACAGCGGGTCCTACTCC 58.792 66.667 0.59 0.00 40.83 3.85
476 513 2.509336 CATGACGGACAGCGGGTC 60.509 66.667 3.28 3.28 46.20 4.46
477 514 3.296709 GACATGACGGACAGCGGGT 62.297 63.158 0.00 0.00 0.00 5.28
478 515 2.509336 GACATGACGGACAGCGGG 60.509 66.667 0.00 0.00 0.00 6.13
479 516 2.880879 CGACATGACGGACAGCGG 60.881 66.667 9.78 0.00 0.00 5.52
487 524 1.517257 GCCAGTCTCCGACATGACG 60.517 63.158 10.68 10.68 38.16 4.35
488 525 1.517257 CGCCAGTCTCCGACATGAC 60.517 63.158 0.00 0.00 34.60 3.06
489 526 1.248101 TTCGCCAGTCTCCGACATGA 61.248 55.000 0.00 0.00 34.60 3.07
490 527 0.803768 CTTCGCCAGTCTCCGACATG 60.804 60.000 0.00 0.00 34.60 3.21
491 528 1.513158 CTTCGCCAGTCTCCGACAT 59.487 57.895 0.00 0.00 34.60 3.06
492 529 2.636412 CCTTCGCCAGTCTCCGACA 61.636 63.158 0.00 0.00 34.60 4.35
493 530 2.182030 CCTTCGCCAGTCTCCGAC 59.818 66.667 0.00 0.00 32.60 4.79
494 531 3.760035 GCCTTCGCCAGTCTCCGA 61.760 66.667 0.00 0.00 0.00 4.55
496 533 3.708220 CTCGCCTTCGCCAGTCTCC 62.708 68.421 0.00 0.00 35.26 3.71
497 534 2.202676 CTCGCCTTCGCCAGTCTC 60.203 66.667 0.00 0.00 35.26 3.36
498 535 2.493907 GAACTCGCCTTCGCCAGTCT 62.494 60.000 0.00 0.00 35.26 3.24
499 536 2.048127 AACTCGCCTTCGCCAGTC 60.048 61.111 0.00 0.00 35.26 3.51
500 537 2.048127 GAACTCGCCTTCGCCAGT 60.048 61.111 0.00 0.00 35.26 4.00
501 538 3.181967 CGAACTCGCCTTCGCCAG 61.182 66.667 2.02 0.00 36.88 4.85
502 539 4.735132 CCGAACTCGCCTTCGCCA 62.735 66.667 8.35 0.00 41.44 5.69
504 541 3.346631 TACCCGAACTCGCCTTCGC 62.347 63.158 8.35 0.00 41.44 4.70
505 542 1.226603 CTACCCGAACTCGCCTTCG 60.227 63.158 7.18 7.18 42.25 3.79
506 543 1.518792 GCTACCCGAACTCGCCTTC 60.519 63.158 0.00 0.00 38.18 3.46
507 544 2.577593 GCTACCCGAACTCGCCTT 59.422 61.111 0.00 0.00 38.18 4.35
508 545 3.823330 CGCTACCCGAACTCGCCT 61.823 66.667 0.00 0.00 40.02 5.52
509 546 4.867599 CCGCTACCCGAACTCGCC 62.868 72.222 0.00 0.00 40.02 5.54
510 547 3.753070 CTCCGCTACCCGAACTCGC 62.753 68.421 0.00 0.00 40.02 5.03
511 548 2.408022 CTCCGCTACCCGAACTCG 59.592 66.667 0.00 0.00 40.02 4.18
512 549 2.104530 GCTCCGCTACCCGAACTC 59.895 66.667 0.00 0.00 40.02 3.01
513 550 2.678934 TGCTCCGCTACCCGAACT 60.679 61.111 0.00 0.00 40.02 3.01
514 551 2.202756 CTGCTCCGCTACCCGAAC 60.203 66.667 0.00 0.00 40.02 3.95
515 552 2.361992 TCTGCTCCGCTACCCGAA 60.362 61.111 0.00 0.00 40.02 4.30
516 553 2.829003 CTCTGCTCCGCTACCCGA 60.829 66.667 0.00 0.00 40.02 5.14
517 554 3.141488 ACTCTGCTCCGCTACCCG 61.141 66.667 0.00 0.00 0.00 5.28
518 555 1.605058 TTCACTCTGCTCCGCTACCC 61.605 60.000 0.00 0.00 0.00 3.69
519 556 0.179124 CTTCACTCTGCTCCGCTACC 60.179 60.000 0.00 0.00 0.00 3.18
520 557 0.528470 ACTTCACTCTGCTCCGCTAC 59.472 55.000 0.00 0.00 0.00 3.58
521 558 0.528017 CACTTCACTCTGCTCCGCTA 59.472 55.000 0.00 0.00 0.00 4.26
522 559 1.181741 TCACTTCACTCTGCTCCGCT 61.182 55.000 0.00 0.00 0.00 5.52
523 560 0.319900 TTCACTTCACTCTGCTCCGC 60.320 55.000 0.00 0.00 0.00 5.54
524 561 1.000283 ACTTCACTTCACTCTGCTCCG 60.000 52.381 0.00 0.00 0.00 4.63
525 562 2.411904 CACTTCACTTCACTCTGCTCC 58.588 52.381 0.00 0.00 0.00 4.70
526 563 2.411904 CCACTTCACTTCACTCTGCTC 58.588 52.381 0.00 0.00 0.00 4.26
527 564 1.542108 GCCACTTCACTTCACTCTGCT 60.542 52.381 0.00 0.00 0.00 4.24
528 565 0.871057 GCCACTTCACTTCACTCTGC 59.129 55.000 0.00 0.00 0.00 4.26
529 566 2.540265 AGCCACTTCACTTCACTCTG 57.460 50.000 0.00 0.00 0.00 3.35
530 567 2.564947 CCTAGCCACTTCACTTCACTCT 59.435 50.000 0.00 0.00 0.00 3.24
531 568 2.354203 CCCTAGCCACTTCACTTCACTC 60.354 54.545 0.00 0.00 0.00 3.51
532 569 1.625818 CCCTAGCCACTTCACTTCACT 59.374 52.381 0.00 0.00 0.00 3.41
533 570 1.348036 ACCCTAGCCACTTCACTTCAC 59.652 52.381 0.00 0.00 0.00 3.18
534 571 1.729586 ACCCTAGCCACTTCACTTCA 58.270 50.000 0.00 0.00 0.00 3.02
535 572 2.861147 AACCCTAGCCACTTCACTTC 57.139 50.000 0.00 0.00 0.00 3.01
536 573 3.222603 CAAAACCCTAGCCACTTCACTT 58.777 45.455 0.00 0.00 0.00 3.16
537 574 2.174854 ACAAAACCCTAGCCACTTCACT 59.825 45.455 0.00 0.00 0.00 3.41
538 575 2.552743 GACAAAACCCTAGCCACTTCAC 59.447 50.000 0.00 0.00 0.00 3.18
539 576 2.488347 GGACAAAACCCTAGCCACTTCA 60.488 50.000 0.00 0.00 0.00 3.02
540 577 2.160205 GGACAAAACCCTAGCCACTTC 58.840 52.381 0.00 0.00 0.00 3.01
541 578 1.544759 CGGACAAAACCCTAGCCACTT 60.545 52.381 0.00 0.00 0.00 3.16
542 579 0.036306 CGGACAAAACCCTAGCCACT 59.964 55.000 0.00 0.00 0.00 4.00
543 580 0.958876 CCGGACAAAACCCTAGCCAC 60.959 60.000 0.00 0.00 0.00 5.01
544 581 1.377229 CCGGACAAAACCCTAGCCA 59.623 57.895 0.00 0.00 0.00 4.75
545 582 2.044555 GCCGGACAAAACCCTAGCC 61.045 63.158 5.05 0.00 0.00 3.93
546 583 0.891904 TTGCCGGACAAAACCCTAGC 60.892 55.000 5.05 0.00 34.56 3.42
547 584 1.165270 CTTGCCGGACAAAACCCTAG 58.835 55.000 5.05 0.00 37.96 3.02
548 585 0.891904 GCTTGCCGGACAAAACCCTA 60.892 55.000 5.05 0.00 37.96 3.53
549 586 2.200337 GCTTGCCGGACAAAACCCT 61.200 57.895 5.05 0.00 37.96 4.34
550 587 2.338620 GCTTGCCGGACAAAACCC 59.661 61.111 5.05 0.00 37.96 4.11
551 588 2.050442 CGCTTGCCGGACAAAACC 60.050 61.111 5.05 0.07 37.96 3.27
562 599 3.840102 TATTCGTCCCCATCCGCTTGC 62.840 57.143 0.00 0.00 0.00 4.01
563 600 0.105964 TATTCGTCCCCATCCGCTTG 59.894 55.000 0.00 0.00 0.00 4.01
564 601 1.056660 ATATTCGTCCCCATCCGCTT 58.943 50.000 0.00 0.00 0.00 4.68
565 602 1.933021 TATATTCGTCCCCATCCGCT 58.067 50.000 0.00 0.00 0.00 5.52
566 603 2.093658 ACATATATTCGTCCCCATCCGC 60.094 50.000 0.00 0.00 0.00 5.54
567 604 3.521560 CACATATATTCGTCCCCATCCG 58.478 50.000 0.00 0.00 0.00 4.18
568 605 3.370527 CCCACATATATTCGTCCCCATCC 60.371 52.174 0.00 0.00 0.00 3.51
569 606 3.517901 TCCCACATATATTCGTCCCCATC 59.482 47.826 0.00 0.00 0.00 3.51
570 607 3.526899 TCCCACATATATTCGTCCCCAT 58.473 45.455 0.00 0.00 0.00 4.00
571 608 2.979177 TCCCACATATATTCGTCCCCA 58.021 47.619 0.00 0.00 0.00 4.96
572 609 4.261801 CAATCCCACATATATTCGTCCCC 58.738 47.826 0.00 0.00 0.00 4.81
573 610 4.261801 CCAATCCCACATATATTCGTCCC 58.738 47.826 0.00 0.00 0.00 4.46
574 611 4.261801 CCCAATCCCACATATATTCGTCC 58.738 47.826 0.00 0.00 0.00 4.79
575 612 4.906618 ACCCAATCCCACATATATTCGTC 58.093 43.478 0.00 0.00 0.00 4.20
576 613 4.993705 ACCCAATCCCACATATATTCGT 57.006 40.909 0.00 0.00 0.00 3.85
577 614 6.294361 TCTACCCAATCCCACATATATTCG 57.706 41.667 0.00 0.00 0.00 3.34
578 615 7.458397 TGTTCTACCCAATCCCACATATATTC 58.542 38.462 0.00 0.00 0.00 1.75
579 616 7.401060 TGTTCTACCCAATCCCACATATATT 57.599 36.000 0.00 0.00 0.00 1.28
580 617 7.147213 TGTTGTTCTACCCAATCCCACATATAT 60.147 37.037 0.00 0.00 0.00 0.86
581 618 6.158871 TGTTGTTCTACCCAATCCCACATATA 59.841 38.462 0.00 0.00 0.00 0.86
582 619 5.044476 TGTTGTTCTACCCAATCCCACATAT 60.044 40.000 0.00 0.00 0.00 1.78
583 620 4.289934 TGTTGTTCTACCCAATCCCACATA 59.710 41.667 0.00 0.00 0.00 2.29
584 621 3.075283 TGTTGTTCTACCCAATCCCACAT 59.925 43.478 0.00 0.00 0.00 3.21
585 622 2.443632 TGTTGTTCTACCCAATCCCACA 59.556 45.455 0.00 0.00 0.00 4.17
586 623 3.149005 TGTTGTTCTACCCAATCCCAC 57.851 47.619 0.00 0.00 0.00 4.61
587 624 3.563261 CCATGTTGTTCTACCCAATCCCA 60.563 47.826 0.00 0.00 0.00 4.37
588 625 3.023832 CCATGTTGTTCTACCCAATCCC 58.976 50.000 0.00 0.00 0.00 3.85
589 626 3.023832 CCCATGTTGTTCTACCCAATCC 58.976 50.000 0.00 0.00 0.00 3.01
590 627 2.427095 GCCCATGTTGTTCTACCCAATC 59.573 50.000 0.00 0.00 0.00 2.67
591 628 2.456577 GCCCATGTTGTTCTACCCAAT 58.543 47.619 0.00 0.00 0.00 3.16
592 629 1.549037 GGCCCATGTTGTTCTACCCAA 60.549 52.381 0.00 0.00 0.00 4.12
593 630 0.039035 GGCCCATGTTGTTCTACCCA 59.961 55.000 0.00 0.00 0.00 4.51
594 631 1.029947 CGGCCCATGTTGTTCTACCC 61.030 60.000 0.00 0.00 0.00 3.69
595 632 1.029947 CCGGCCCATGTTGTTCTACC 61.030 60.000 0.00 0.00 0.00 3.18
596 633 1.029947 CCCGGCCCATGTTGTTCTAC 61.030 60.000 0.00 0.00 0.00 2.59
597 634 1.301623 CCCGGCCCATGTTGTTCTA 59.698 57.895 0.00 0.00 0.00 2.10
598 635 2.035626 CCCGGCCCATGTTGTTCT 59.964 61.111 0.00 0.00 0.00 3.01
599 636 1.468506 AAACCCGGCCCATGTTGTTC 61.469 55.000 0.00 0.00 0.00 3.18
600 637 1.458588 AAACCCGGCCCATGTTGTT 60.459 52.632 0.00 0.00 0.00 2.83
601 638 2.200092 AAACCCGGCCCATGTTGT 59.800 55.556 0.00 0.00 0.00 3.32
602 639 1.905843 TCAAACCCGGCCCATGTTG 60.906 57.895 0.00 0.00 0.00 3.33
603 640 1.906333 GTCAAACCCGGCCCATGTT 60.906 57.895 0.00 0.00 0.00 2.71
604 641 2.282887 GTCAAACCCGGCCCATGT 60.283 61.111 0.00 0.00 0.00 3.21
605 642 3.439540 CGTCAAACCCGGCCCATG 61.440 66.667 0.00 0.00 0.00 3.66
606 643 3.961414 ACGTCAAACCCGGCCCAT 61.961 61.111 0.00 0.00 0.00 4.00
607 644 4.939368 CACGTCAAACCCGGCCCA 62.939 66.667 0.00 0.00 0.00 5.36
633 670 3.941657 GATATGGAGGCGCTCGGGC 62.942 68.421 7.64 0.00 42.69 6.13
634 671 2.262915 GATATGGAGGCGCTCGGG 59.737 66.667 7.64 0.00 0.00 5.14
635 672 1.080230 CTGATATGGAGGCGCTCGG 60.080 63.158 7.64 0.00 0.00 4.63
636 673 1.735920 GCTGATATGGAGGCGCTCG 60.736 63.158 7.64 0.00 0.00 5.03
637 674 1.375268 GGCTGATATGGAGGCGCTC 60.375 63.158 7.64 2.45 0.00 5.03
638 675 0.542938 TAGGCTGATATGGAGGCGCT 60.543 55.000 7.64 0.00 40.84 5.92
639 676 0.539051 ATAGGCTGATATGGAGGCGC 59.461 55.000 0.00 0.00 40.84 6.53
640 677 5.991933 ATATATAGGCTGATATGGAGGCG 57.008 43.478 0.00 0.00 40.84 5.52
641 678 7.739825 TCAAATATATAGGCTGATATGGAGGC 58.260 38.462 0.00 0.00 36.26 4.70
642 679 8.932610 ACTCAAATATATAGGCTGATATGGAGG 58.067 37.037 21.48 12.72 31.19 4.30
658 695 9.066892 GCACCCTTCATATTCAACTCAAATATA 57.933 33.333 0.00 0.00 30.13 0.86
659 696 7.014615 GGCACCCTTCATATTCAACTCAAATAT 59.985 37.037 0.00 0.00 31.08 1.28
660 697 6.321181 GGCACCCTTCATATTCAACTCAAATA 59.679 38.462 0.00 0.00 0.00 1.40
661 698 5.127682 GGCACCCTTCATATTCAACTCAAAT 59.872 40.000 0.00 0.00 0.00 2.32
662 699 4.462483 GGCACCCTTCATATTCAACTCAAA 59.538 41.667 0.00 0.00 0.00 2.69
663 700 4.016444 GGCACCCTTCATATTCAACTCAA 58.984 43.478 0.00 0.00 0.00 3.02
664 701 3.010027 TGGCACCCTTCATATTCAACTCA 59.990 43.478 0.00 0.00 0.00 3.41
665 702 3.620488 TGGCACCCTTCATATTCAACTC 58.380 45.455 0.00 0.00 0.00 3.01
666 703 3.737559 TGGCACCCTTCATATTCAACT 57.262 42.857 0.00 0.00 0.00 3.16
667 704 4.402155 TGATTGGCACCCTTCATATTCAAC 59.598 41.667 0.00 0.00 0.00 3.18
668 705 4.608269 TGATTGGCACCCTTCATATTCAA 58.392 39.130 0.00 0.00 0.00 2.69
669 706 4.209538 CTGATTGGCACCCTTCATATTCA 58.790 43.478 0.00 0.00 0.00 2.57
670 707 3.005155 GCTGATTGGCACCCTTCATATTC 59.995 47.826 0.00 0.00 0.00 1.75
671 708 2.961062 GCTGATTGGCACCCTTCATATT 59.039 45.455 0.00 0.00 0.00 1.28
672 709 2.590821 GCTGATTGGCACCCTTCATAT 58.409 47.619 0.00 0.00 0.00 1.78
673 710 1.410083 GGCTGATTGGCACCCTTCATA 60.410 52.381 0.00 0.00 41.37 2.15
674 711 0.685458 GGCTGATTGGCACCCTTCAT 60.685 55.000 0.00 0.00 41.37 2.57
675 712 1.304381 GGCTGATTGGCACCCTTCA 60.304 57.895 0.00 0.00 41.37 3.02
676 713 2.054453 GGGCTGATTGGCACCCTTC 61.054 63.158 2.96 0.00 43.83 3.46
677 714 2.037847 GGGCTGATTGGCACCCTT 59.962 61.111 2.96 0.00 43.83 3.95
678 715 4.431131 CGGGCTGATTGGCACCCT 62.431 66.667 8.34 0.00 43.83 4.34
684 721 0.754957 TAAATGCCCGGGCTGATTGG 60.755 55.000 43.34 6.35 42.51 3.16
685 722 1.067516 CTTAAATGCCCGGGCTGATTG 59.932 52.381 43.34 25.14 42.51 2.67
686 723 1.402787 CTTAAATGCCCGGGCTGATT 58.597 50.000 43.34 33.60 42.51 2.57
687 724 0.468029 CCTTAAATGCCCGGGCTGAT 60.468 55.000 43.34 28.62 42.51 2.90
688 725 1.077068 CCTTAAATGCCCGGGCTGA 60.077 57.895 43.34 27.61 42.51 4.26
689 726 2.785425 GCCTTAAATGCCCGGGCTG 61.785 63.158 43.34 24.85 42.51 4.85
690 727 2.442087 GCCTTAAATGCCCGGGCT 60.442 61.111 43.34 27.93 42.51 5.19
691 728 3.536917 GGCCTTAAATGCCCGGGC 61.537 66.667 39.40 39.40 43.33 6.13
697 734 1.816224 TCTCAAACGGGCCTTAAATGC 59.184 47.619 0.84 0.00 0.00 3.56
698 735 3.487563 GTCTCAAACGGGCCTTAAATG 57.512 47.619 0.84 0.00 0.00 2.32
710 747 1.201825 GCACAGACGCGTCTCAAAC 59.798 57.895 37.41 22.75 37.98 2.93
711 748 1.954146 GGCACAGACGCGTCTCAAA 60.954 57.895 37.41 0.00 37.98 2.69
712 749 2.355837 GGCACAGACGCGTCTCAA 60.356 61.111 37.41 0.00 37.98 3.02
713 750 3.601685 TGGCACAGACGCGTCTCA 61.602 61.111 37.41 28.18 37.98 3.27
724 761 0.537143 GGTCACCACAATCTGGCACA 60.537 55.000 0.00 0.00 45.32 4.57
725 762 1.244019 GGGTCACCACAATCTGGCAC 61.244 60.000 0.00 0.00 45.32 5.01
726 763 1.074775 GGGTCACCACAATCTGGCA 59.925 57.895 0.00 0.00 45.32 4.92
727 764 2.040544 CGGGTCACCACAATCTGGC 61.041 63.158 0.00 0.00 45.32 4.85
729 766 0.034756 TCACGGGTCACCACAATCTG 59.965 55.000 0.00 0.00 36.13 2.90
730 767 0.321671 CTCACGGGTCACCACAATCT 59.678 55.000 0.00 0.00 36.13 2.40
731 768 0.320374 TCTCACGGGTCACCACAATC 59.680 55.000 0.00 0.00 36.13 2.67
732 769 0.321671 CTCTCACGGGTCACCACAAT 59.678 55.000 0.00 0.00 36.13 2.71
733 770 0.757561 TCTCTCACGGGTCACCACAA 60.758 55.000 0.00 0.00 36.13 3.33
734 771 1.152631 TCTCTCACGGGTCACCACA 60.153 57.895 0.00 0.00 36.13 4.17
735 772 1.289380 GTCTCTCACGGGTCACCAC 59.711 63.158 0.00 0.00 36.13 4.16
736 773 1.906824 GGTCTCTCACGGGTCACCA 60.907 63.158 0.00 0.00 36.13 4.17
737 774 2.647158 GGGTCTCTCACGGGTCACC 61.647 68.421 0.00 0.00 0.00 4.02
738 775 2.971452 GGGTCTCTCACGGGTCAC 59.029 66.667 0.00 0.00 0.00 3.67
739 776 2.675423 CGGGTCTCTCACGGGTCA 60.675 66.667 0.00 0.00 39.57 4.02
744 781 2.675423 TCCACCGGGTCTCTCACG 60.675 66.667 6.32 0.00 43.35 4.35
745 782 1.596895 GAGTCCACCGGGTCTCTCAC 61.597 65.000 6.32 0.00 43.46 3.51
746 783 1.304217 GAGTCCACCGGGTCTCTCA 60.304 63.158 6.32 0.00 43.46 3.27
747 784 3.605895 GAGTCCACCGGGTCTCTC 58.394 66.667 6.32 4.79 43.46 3.20
749 786 3.007973 GCAGAGTCCACCGGGTCTC 62.008 68.421 6.32 7.84 46.06 3.36
750 787 2.997897 GCAGAGTCCACCGGGTCT 60.998 66.667 6.32 0.00 35.11 3.85
751 788 4.083862 GGCAGAGTCCACCGGGTC 62.084 72.222 6.32 0.00 34.93 4.46
754 791 3.649277 CTTCGGCAGAGTCCACCGG 62.649 68.421 18.44 0.00 46.87 5.28
756 793 1.112113 TATCTTCGGCAGAGTCCACC 58.888 55.000 0.00 0.00 33.87 4.61
757 794 1.476891 TGTATCTTCGGCAGAGTCCAC 59.523 52.381 0.00 0.00 33.87 4.02
789 829 2.301870 GGACCTGAAGTGGACACATGTA 59.698 50.000 0.00 0.00 0.00 2.29
807 847 4.767255 CCCGTCTGCCAGCAGGAC 62.767 72.222 19.04 14.00 43.75 3.85
822 862 2.168666 GAGTGAGGTGTTCCGTCCCC 62.169 65.000 0.00 0.00 39.05 4.81
824 864 0.319641 GTGAGTGAGGTGTTCCGTCC 60.320 60.000 0.00 0.00 39.05 4.79
831 871 1.683917 GAGTGTGAGTGAGTGAGGTGT 59.316 52.381 0.00 0.00 0.00 4.16
842 882 3.070015 TGTGATGACATGTGAGTGTGAGT 59.930 43.478 1.15 0.00 31.16 3.41
867 907 6.695278 CGGTGCAAATTATTATTAAGGGTGTG 59.305 38.462 0.00 0.00 0.00 3.82
869 909 6.212955 CCGGTGCAAATTATTATTAAGGGTG 58.787 40.000 0.00 0.00 0.00 4.61
871 911 5.536916 TCCCGGTGCAAATTATTATTAAGGG 59.463 40.000 0.00 0.00 0.00 3.95
876 916 6.207417 CAGAGATCCCGGTGCAAATTATTATT 59.793 38.462 0.00 0.00 0.00 1.40
884 924 1.377202 GCAGAGATCCCGGTGCAAA 60.377 57.895 7.54 0.00 35.91 3.68
894 934 0.107945 GTGTGGGGTGAGCAGAGATC 60.108 60.000 0.00 0.00 0.00 2.75
896 936 2.217038 GGTGTGGGGTGAGCAGAGA 61.217 63.158 0.00 0.00 0.00 3.10
897 937 2.348998 GGTGTGGGGTGAGCAGAG 59.651 66.667 0.00 0.00 0.00 3.35
898 938 3.249189 GGGTGTGGGGTGAGCAGA 61.249 66.667 0.00 0.00 0.00 4.26
899 939 2.754664 GAAGGGTGTGGGGTGAGCAG 62.755 65.000 0.00 0.00 0.00 4.24
900 940 2.776526 AAGGGTGTGGGGTGAGCA 60.777 61.111 0.00 0.00 0.00 4.26
901 941 2.034221 GAAGGGTGTGGGGTGAGC 59.966 66.667 0.00 0.00 0.00 4.26
902 942 1.679898 GAGAAGGGTGTGGGGTGAG 59.320 63.158 0.00 0.00 0.00 3.51
903 943 1.846124 GGAGAAGGGTGTGGGGTGA 60.846 63.158 0.00 0.00 0.00 4.02
904 944 2.129555 CTGGAGAAGGGTGTGGGGTG 62.130 65.000 0.00 0.00 0.00 4.61
905 945 1.847968 CTGGAGAAGGGTGTGGGGT 60.848 63.158 0.00 0.00 0.00 4.95
935 975 3.647771 GGAGAGGCCGGGGTTGTT 61.648 66.667 2.18 0.00 0.00 2.83
948 1000 2.583441 CGTCAGTTGGGCAGGGAGA 61.583 63.158 0.00 0.00 0.00 3.71
974 1031 3.853330 CAACGGTGGCGCTCGATG 61.853 66.667 20.64 16.13 0.00 3.84
998 1055 6.867550 TCATCTTCAGTACTGTAGTCCATTG 58.132 40.000 23.82 15.88 31.14 2.82
999 1056 6.406400 GCTCATCTTCAGTACTGTAGTCCATT 60.406 42.308 23.82 7.34 31.14 3.16
1005 1068 4.158579 TGGTGCTCATCTTCAGTACTGTAG 59.841 45.833 21.99 21.06 0.00 2.74
1007 1070 2.899900 TGGTGCTCATCTTCAGTACTGT 59.100 45.455 21.99 0.00 0.00 3.55
1009 1072 3.324846 TGTTGGTGCTCATCTTCAGTACT 59.675 43.478 0.00 0.00 0.00 2.73
1015 1078 0.798776 CCGTGTTGGTGCTCATCTTC 59.201 55.000 0.00 0.00 0.00 2.87
1016 1079 1.237285 GCCGTGTTGGTGCTCATCTT 61.237 55.000 0.00 0.00 41.21 2.40
1017 1080 1.672356 GCCGTGTTGGTGCTCATCT 60.672 57.895 0.00 0.00 41.21 2.90
1042 1105 3.179265 GTCGTCACCGTCGCCATG 61.179 66.667 0.00 0.00 35.01 3.66
1043 1106 4.771356 CGTCGTCACCGTCGCCAT 62.771 66.667 0.00 0.00 38.62 4.40
1119 1182 0.253441 ATAGGGGGTGTACCTTGGCA 60.253 55.000 0.44 0.00 39.54 4.92
1130 1193 2.208872 GGATGCATATGGATAGGGGGT 58.791 52.381 9.98 0.00 0.00 4.95
1131 1194 2.207988 TGGATGCATATGGATAGGGGG 58.792 52.381 9.98 0.00 0.00 5.40
1133 1196 3.135348 ACGATGGATGCATATGGATAGGG 59.865 47.826 9.98 1.39 0.00 3.53
1134 1197 4.100653 AGACGATGGATGCATATGGATAGG 59.899 45.833 9.98 1.05 0.00 2.57
1138 1201 2.234661 GGAGACGATGGATGCATATGGA 59.765 50.000 0.00 1.06 0.00 3.41
1140 1203 3.606595 AGGAGACGATGGATGCATATG 57.393 47.619 0.00 0.00 0.00 1.78
1142 1205 2.965147 TCAAGGAGACGATGGATGCATA 59.035 45.455 0.00 0.00 0.00 3.14
1143 1206 1.764723 TCAAGGAGACGATGGATGCAT 59.235 47.619 0.00 0.00 0.00 3.96
1144 1207 1.194218 TCAAGGAGACGATGGATGCA 58.806 50.000 0.00 0.00 0.00 3.96
1145 1208 2.540265 ATCAAGGAGACGATGGATGC 57.460 50.000 0.00 0.00 0.00 3.91
1146 1209 3.070734 AGGAATCAAGGAGACGATGGATG 59.929 47.826 0.00 0.00 0.00 3.51
1203 1305 5.208294 TGTGGACTAGGGAGAGAATTAGT 57.792 43.478 0.00 0.00 0.00 2.24
1279 1392 2.238898 CCGGTTCACCTAGGAGGAAATT 59.761 50.000 17.98 0.00 37.67 1.82
1280 1393 1.838077 CCGGTTCACCTAGGAGGAAAT 59.162 52.381 17.98 0.00 37.67 2.17
1281 1394 1.203212 TCCGGTTCACCTAGGAGGAAA 60.203 52.381 17.98 0.67 37.67 3.13
1283 1396 0.635009 ATCCGGTTCACCTAGGAGGA 59.365 55.000 17.98 13.51 37.67 3.71
1285 1398 1.776662 TCATCCGGTTCACCTAGGAG 58.223 55.000 17.98 8.08 36.08 3.69
1286 1399 2.317040 GATCATCCGGTTCACCTAGGA 58.683 52.381 17.98 0.00 37.17 2.94
1287 1400 1.344763 GGATCATCCGGTTCACCTAGG 59.655 57.143 7.41 7.41 0.00 3.02
1370 1483 3.826729 GGAAATTAACCAACCACTCTGCT 59.173 43.478 0.00 0.00 0.00 4.24
1371 1484 3.826729 AGGAAATTAACCAACCACTCTGC 59.173 43.478 4.75 0.00 0.00 4.26
1372 1485 5.301805 ACAAGGAAATTAACCAACCACTCTG 59.698 40.000 4.75 0.00 0.00 3.35
1391 1507 3.594603 ACTCTAACATGTCCGACAAGG 57.405 47.619 5.07 3.76 42.97 3.61
1399 1515 7.757097 ATATTCGACACAACTCTAACATGTC 57.243 36.000 0.00 0.00 37.02 3.06
1400 1516 7.602644 ACAATATTCGACACAACTCTAACATGT 59.397 33.333 0.00 0.00 0.00 3.21
1401 1517 7.899841 CACAATATTCGACACAACTCTAACATG 59.100 37.037 0.00 0.00 0.00 3.21
1402 1518 7.602644 ACACAATATTCGACACAACTCTAACAT 59.397 33.333 0.00 0.00 0.00 2.71
1424 1540 5.453621 CCAACTGTAACCTACCTTGTACACA 60.454 44.000 0.00 0.00 0.00 3.72
1463 1579 5.221561 CGACCCCATATCCTATGTAAACACA 60.222 44.000 0.00 0.00 0.00 3.72
1479 1595 1.411216 CCTACTAGGACACGACCCCAT 60.411 57.143 0.00 0.00 37.67 4.00
1503 1619 9.295825 CTATATATGAGAGGCCTAGGATACAAG 57.704 40.741 14.75 0.00 41.41 3.16
1524 1640 6.062749 ACATCGTGTGTCTACCTCACTATAT 58.937 40.000 0.00 0.00 35.77 0.86
1525 1641 5.434408 ACATCGTGTGTCTACCTCACTATA 58.566 41.667 0.00 0.00 35.77 1.31
1526 1642 4.270834 ACATCGTGTGTCTACCTCACTAT 58.729 43.478 0.00 0.00 35.77 2.12
1527 1643 3.682696 ACATCGTGTGTCTACCTCACTA 58.317 45.455 0.00 0.00 35.77 2.74
1528 1644 2.515854 ACATCGTGTGTCTACCTCACT 58.484 47.619 0.00 0.00 35.77 3.41
1529 1645 4.430137 TTACATCGTGTGTCTACCTCAC 57.570 45.455 0.00 0.00 42.29 3.51
1530 1646 4.948004 AGATTACATCGTGTGTCTACCTCA 59.052 41.667 0.00 0.00 42.29 3.86
1531 1647 5.502153 AGATTACATCGTGTGTCTACCTC 57.498 43.478 0.00 0.00 42.29 3.85
1532 1648 6.515200 GCATAGATTACATCGTGTGTCTACCT 60.515 42.308 12.51 0.00 42.29 3.08
1533 1649 5.629849 GCATAGATTACATCGTGTGTCTACC 59.370 44.000 12.51 7.42 42.29 3.18
1534 1650 5.629849 GGCATAGATTACATCGTGTGTCTAC 59.370 44.000 12.51 0.00 42.29 2.59
1535 1651 5.300792 TGGCATAGATTACATCGTGTGTCTA 59.699 40.000 12.58 12.58 42.29 2.59
1536 1652 4.099419 TGGCATAGATTACATCGTGTGTCT 59.901 41.667 0.00 6.38 42.29 3.41
1537 1653 4.368315 TGGCATAGATTACATCGTGTGTC 58.632 43.478 0.00 0.21 42.29 3.67
1538 1654 4.400529 TGGCATAGATTACATCGTGTGT 57.599 40.909 1.58 1.87 44.95 3.72
1539 1655 4.570369 TGTTGGCATAGATTACATCGTGTG 59.430 41.667 0.00 0.00 0.00 3.82
1540 1656 4.765273 TGTTGGCATAGATTACATCGTGT 58.235 39.130 0.00 0.00 0.00 4.49
1541 1657 5.929697 ATGTTGGCATAGATTACATCGTG 57.070 39.130 0.00 0.00 32.73 4.35
1542 1658 9.371136 CTATTATGTTGGCATAGATTACATCGT 57.629 33.333 3.66 0.00 38.64 3.73
1543 1659 8.331022 GCTATTATGTTGGCATAGATTACATCG 58.669 37.037 3.66 0.00 38.64 3.84
1544 1660 9.166173 TGCTATTATGTTGGCATAGATTACATC 57.834 33.333 3.66 0.00 38.64 3.06
1545 1661 9.690913 ATGCTATTATGTTGGCATAGATTACAT 57.309 29.630 5.64 5.64 42.55 2.29
1546 1662 9.166173 GATGCTATTATGTTGGCATAGATTACA 57.834 33.333 0.00 0.00 44.06 2.41
1547 1663 8.331022 CGATGCTATTATGTTGGCATAGATTAC 58.669 37.037 0.00 0.00 44.06 1.89
1548 1664 8.257306 TCGATGCTATTATGTTGGCATAGATTA 58.743 33.333 0.00 0.00 44.06 1.75
1549 1665 7.105588 TCGATGCTATTATGTTGGCATAGATT 58.894 34.615 0.00 0.00 44.06 2.40
1550 1666 6.643388 TCGATGCTATTATGTTGGCATAGAT 58.357 36.000 0.00 0.00 44.06 1.98
1551 1667 6.036577 TCGATGCTATTATGTTGGCATAGA 57.963 37.500 0.00 0.00 44.06 1.98
1552 1668 6.726258 TTCGATGCTATTATGTTGGCATAG 57.274 37.500 0.00 0.00 44.06 2.23
1553 1669 6.347321 CGTTTCGATGCTATTATGTTGGCATA 60.347 38.462 0.00 0.00 44.06 3.14
1554 1670 5.560760 CGTTTCGATGCTATTATGTTGGCAT 60.561 40.000 0.00 0.00 46.24 4.40
1555 1671 4.260579 CGTTTCGATGCTATTATGTTGGCA 60.261 41.667 0.00 0.00 39.06 4.92
1556 1672 4.211389 CGTTTCGATGCTATTATGTTGGC 58.789 43.478 0.00 0.00 0.00 4.52
1557 1673 4.211389 GCGTTTCGATGCTATTATGTTGG 58.789 43.478 0.00 0.00 0.00 3.77
1558 1674 4.832019 TGCGTTTCGATGCTATTATGTTG 58.168 39.130 6.41 0.00 0.00 3.33
1559 1675 4.024893 CCTGCGTTTCGATGCTATTATGTT 60.025 41.667 6.41 0.00 0.00 2.71
1560 1676 3.494626 CCTGCGTTTCGATGCTATTATGT 59.505 43.478 6.41 0.00 0.00 2.29
1561 1677 3.120546 CCCTGCGTTTCGATGCTATTATG 60.121 47.826 6.41 0.00 0.00 1.90
1562 1678 3.067106 CCCTGCGTTTCGATGCTATTAT 58.933 45.455 6.41 0.00 0.00 1.28
1563 1679 2.479837 CCCTGCGTTTCGATGCTATTA 58.520 47.619 6.41 0.00 0.00 0.98
1564 1680 1.299541 CCCTGCGTTTCGATGCTATT 58.700 50.000 6.41 0.00 0.00 1.73
1565 1681 0.532862 CCCCTGCGTTTCGATGCTAT 60.533 55.000 6.41 0.00 0.00 2.97
1566 1682 1.153449 CCCCTGCGTTTCGATGCTA 60.153 57.895 6.41 0.00 0.00 3.49
1567 1683 2.436646 CCCCTGCGTTTCGATGCT 60.437 61.111 6.41 0.00 0.00 3.79
1568 1684 1.982073 CTTCCCCTGCGTTTCGATGC 61.982 60.000 0.00 0.00 0.00 3.91
1569 1685 1.982073 GCTTCCCCTGCGTTTCGATG 61.982 60.000 0.00 0.00 0.00 3.84
1570 1686 1.745489 GCTTCCCCTGCGTTTCGAT 60.745 57.895 0.00 0.00 0.00 3.59
1571 1687 2.358247 GCTTCCCCTGCGTTTCGA 60.358 61.111 0.00 0.00 0.00 3.71
1572 1688 3.431725 GGCTTCCCCTGCGTTTCG 61.432 66.667 0.00 0.00 0.00 3.46
1573 1689 3.431725 CGGCTTCCCCTGCGTTTC 61.432 66.667 0.00 0.00 0.00 2.78
1602 1718 4.742201 CAGTCGCCCTGGACACCG 62.742 72.222 0.00 0.00 39.42 4.94
1611 1727 2.660258 AATATCGCACCCAGTCGCCC 62.660 60.000 0.00 0.00 0.00 6.13
1612 1728 0.032952 TAATATCGCACCCAGTCGCC 59.967 55.000 0.00 0.00 0.00 5.54
1613 1729 2.080286 ATAATATCGCACCCAGTCGC 57.920 50.000 0.00 0.00 0.00 5.19
1614 1730 3.179830 GCTATAATATCGCACCCAGTCG 58.820 50.000 0.00 0.00 0.00 4.18
1615 1731 3.179830 CGCTATAATATCGCACCCAGTC 58.820 50.000 0.00 0.00 0.00 3.51
1616 1732 2.094182 CCGCTATAATATCGCACCCAGT 60.094 50.000 0.00 0.00 0.00 4.00
1617 1733 2.094182 ACCGCTATAATATCGCACCCAG 60.094 50.000 0.00 0.00 0.00 4.45
1618 1734 1.897133 ACCGCTATAATATCGCACCCA 59.103 47.619 0.00 0.00 0.00 4.51
1619 1735 2.268298 CACCGCTATAATATCGCACCC 58.732 52.381 0.00 0.00 0.00 4.61
1620 1736 2.921754 GACACCGCTATAATATCGCACC 59.078 50.000 0.00 0.00 0.00 5.01
1621 1737 3.571571 TGACACCGCTATAATATCGCAC 58.428 45.455 0.00 0.00 0.00 5.34
1622 1738 3.926821 TGACACCGCTATAATATCGCA 57.073 42.857 0.00 0.00 0.00 5.10
1623 1739 3.551890 CCATGACACCGCTATAATATCGC 59.448 47.826 0.00 0.00 0.00 4.58
1624 1740 4.112634 CCCATGACACCGCTATAATATCG 58.887 47.826 0.00 0.00 0.00 2.92
1625 1741 4.161565 TCCCCATGACACCGCTATAATATC 59.838 45.833 0.00 0.00 0.00 1.63
1626 1742 4.101114 TCCCCATGACACCGCTATAATAT 58.899 43.478 0.00 0.00 0.00 1.28
1627 1743 3.512496 TCCCCATGACACCGCTATAATA 58.488 45.455 0.00 0.00 0.00 0.98
1628 1744 2.303022 CTCCCCATGACACCGCTATAAT 59.697 50.000 0.00 0.00 0.00 1.28
1629 1745 1.691976 CTCCCCATGACACCGCTATAA 59.308 52.381 0.00 0.00 0.00 0.98
1630 1746 1.338107 CTCCCCATGACACCGCTATA 58.662 55.000 0.00 0.00 0.00 1.31
1631 1747 1.410850 CCTCCCCATGACACCGCTAT 61.411 60.000 0.00 0.00 0.00 2.97
1632 1748 2.063979 CCTCCCCATGACACCGCTA 61.064 63.158 0.00 0.00 0.00 4.26
1633 1749 3.402681 CCTCCCCATGACACCGCT 61.403 66.667 0.00 0.00 0.00 5.52
1634 1750 3.391665 CTCCTCCCCATGACACCGC 62.392 68.421 0.00 0.00 0.00 5.68
1635 1751 2.903357 CTCCTCCCCATGACACCG 59.097 66.667 0.00 0.00 0.00 4.94
1636 1752 2.592308 GCTCCTCCCCATGACACC 59.408 66.667 0.00 0.00 0.00 4.16
1637 1753 2.187946 CGCTCCTCCCCATGACAC 59.812 66.667 0.00 0.00 0.00 3.67
1638 1754 3.785859 GCGCTCCTCCCCATGACA 61.786 66.667 0.00 0.00 0.00 3.58
1639 1755 4.554036 GGCGCTCCTCCCCATGAC 62.554 72.222 7.64 0.00 0.00 3.06
1644 1760 3.631046 CTATGGGCGCTCCTCCCC 61.631 72.222 3.94 0.00 43.24 4.81
1645 1761 2.844839 ACTATGGGCGCTCCTCCC 60.845 66.667 3.94 0.00 44.17 4.30
1646 1762 1.476007 ATGACTATGGGCGCTCCTCC 61.476 60.000 3.94 0.00 36.20 4.30
1647 1763 0.320247 CATGACTATGGGCGCTCCTC 60.320 60.000 3.94 0.00 36.20 3.71
1648 1764 1.750930 CATGACTATGGGCGCTCCT 59.249 57.895 3.94 0.00 36.20 3.69
1649 1765 1.963338 GCATGACTATGGGCGCTCC 60.963 63.158 3.94 6.36 34.79 4.70
1650 1766 1.963338 GGCATGACTATGGGCGCTC 60.963 63.158 7.64 2.47 34.79 5.03
1651 1767 2.111878 GGCATGACTATGGGCGCT 59.888 61.111 7.64 0.00 34.79 5.92
1652 1768 2.980233 GGGCATGACTATGGGCGC 60.980 66.667 0.00 0.00 34.79 6.53
1653 1769 2.281761 GGGGCATGACTATGGGCG 60.282 66.667 0.00 0.00 34.79 6.13
1654 1770 2.281761 CGGGGCATGACTATGGGC 60.282 66.667 0.00 0.00 34.79 5.36
1655 1771 2.431683 CCGGGGCATGACTATGGG 59.568 66.667 0.00 0.00 34.79 4.00
1656 1772 2.431683 CCCGGGGCATGACTATGG 59.568 66.667 14.71 0.00 34.79 2.74
1657 1773 1.492133 ATCCCCGGGGCATGACTATG 61.492 60.000 36.68 7.25 37.36 2.23
1658 1774 1.151810 ATCCCCGGGGCATGACTAT 60.152 57.895 36.68 18.72 34.68 2.12
1659 1775 2.146724 CATCCCCGGGGCATGACTA 61.147 63.158 36.68 16.98 34.68 2.59
1660 1776 2.907482 TACATCCCCGGGGCATGACT 62.907 60.000 37.85 26.56 34.68 3.41
1661 1777 2.397413 CTACATCCCCGGGGCATGAC 62.397 65.000 37.85 0.00 34.68 3.06
1662 1778 2.040359 TACATCCCCGGGGCATGA 60.040 61.111 37.85 25.09 34.68 3.07
1663 1779 2.431683 CTACATCCCCGGGGCATG 59.568 66.667 36.68 34.51 34.68 4.06
1664 1780 3.570212 GCTACATCCCCGGGGCAT 61.570 66.667 36.68 25.05 34.68 4.40
1667 1783 0.914417 ATATGGCTACATCCCCGGGG 60.914 60.000 35.80 35.80 38.53 5.73
1668 1784 0.541863 GATATGGCTACATCCCCGGG 59.458 60.000 15.80 15.80 38.53 5.73
1669 1785 0.175760 CGATATGGCTACATCCCCGG 59.824 60.000 0.00 0.00 38.53 5.73
1670 1786 0.175760 CCGATATGGCTACATCCCCG 59.824 60.000 0.00 0.00 38.53 5.73
1671 1787 1.066143 CACCGATATGGCTACATCCCC 60.066 57.143 0.00 0.00 43.94 4.81
1672 1788 1.899814 TCACCGATATGGCTACATCCC 59.100 52.381 0.00 0.00 43.94 3.85
1673 1789 3.326747 GTTCACCGATATGGCTACATCC 58.673 50.000 0.00 0.00 43.94 3.51
1674 1790 3.006967 AGGTTCACCGATATGGCTACATC 59.993 47.826 0.00 0.00 43.94 3.06
1675 1791 2.972713 AGGTTCACCGATATGGCTACAT 59.027 45.455 0.00 0.00 43.94 2.29
1676 1792 2.364324 GAGGTTCACCGATATGGCTACA 59.636 50.000 0.00 0.00 43.94 2.74
1677 1793 2.607282 CGAGGTTCACCGATATGGCTAC 60.607 54.545 0.00 0.00 43.94 3.58
1678 1794 1.611977 CGAGGTTCACCGATATGGCTA 59.388 52.381 0.00 0.00 43.94 3.93
1679 1795 0.389391 CGAGGTTCACCGATATGGCT 59.611 55.000 0.00 0.00 43.94 4.75
1680 1796 0.104304 ACGAGGTTCACCGATATGGC 59.896 55.000 0.00 0.00 43.94 4.40
1681 1797 2.596904 AACGAGGTTCACCGATATGG 57.403 50.000 0.00 0.00 46.41 2.74
1682 1798 4.426416 TGTTAACGAGGTTCACCGATATG 58.574 43.478 0.26 0.00 42.08 1.78
1683 1799 4.724074 TGTTAACGAGGTTCACCGATAT 57.276 40.909 0.26 0.00 42.08 1.63
1684 1800 4.517952 TTGTTAACGAGGTTCACCGATA 57.482 40.909 0.26 0.00 42.08 2.92
1685 1801 3.389925 TTGTTAACGAGGTTCACCGAT 57.610 42.857 0.26 0.00 42.08 4.18
1686 1802 2.886862 TTGTTAACGAGGTTCACCGA 57.113 45.000 0.26 0.00 42.08 4.69
1687 1803 3.744426 AGATTTGTTAACGAGGTTCACCG 59.256 43.478 0.26 0.00 42.08 4.94
1688 1804 5.449304 CAAGATTTGTTAACGAGGTTCACC 58.551 41.667 0.26 0.00 0.00 4.02
1689 1805 5.008316 ACCAAGATTTGTTAACGAGGTTCAC 59.992 40.000 0.26 0.00 0.00 3.18
1690 1806 5.008217 CACCAAGATTTGTTAACGAGGTTCA 59.992 40.000 0.26 0.00 0.00 3.18
1691 1807 5.008316 ACACCAAGATTTGTTAACGAGGTTC 59.992 40.000 0.26 0.00 0.00 3.62
1692 1808 4.885325 ACACCAAGATTTGTTAACGAGGTT 59.115 37.500 0.26 0.00 0.00 3.50
1693 1809 4.457466 ACACCAAGATTTGTTAACGAGGT 58.543 39.130 0.26 0.00 0.00 3.85
1694 1810 4.377022 CGACACCAAGATTTGTTAACGAGG 60.377 45.833 0.26 0.00 0.00 4.63
1695 1811 4.210537 ACGACACCAAGATTTGTTAACGAG 59.789 41.667 0.26 0.00 0.00 4.18
1696 1812 4.025563 CACGACACCAAGATTTGTTAACGA 60.026 41.667 0.26 0.00 0.00 3.85
1697 1813 4.208355 CACGACACCAAGATTTGTTAACG 58.792 43.478 0.26 0.00 0.00 3.18
1698 1814 3.972502 GCACGACACCAAGATTTGTTAAC 59.027 43.478 0.00 0.00 0.00 2.01
1699 1815 3.880490 AGCACGACACCAAGATTTGTTAA 59.120 39.130 0.00 0.00 0.00 2.01
1700 1816 3.472652 AGCACGACACCAAGATTTGTTA 58.527 40.909 0.00 0.00 0.00 2.41
1701 1817 2.290641 GAGCACGACACCAAGATTTGTT 59.709 45.455 0.00 0.00 0.00 2.83
1702 1818 1.873591 GAGCACGACACCAAGATTTGT 59.126 47.619 0.00 0.00 0.00 2.83
1703 1819 1.136252 CGAGCACGACACCAAGATTTG 60.136 52.381 0.00 0.00 42.66 2.32
1704 1820 1.148310 CGAGCACGACACCAAGATTT 58.852 50.000 0.00 0.00 42.66 2.17
1705 1821 0.033504 ACGAGCACGACACCAAGATT 59.966 50.000 11.40 0.00 42.66 2.40
1706 1822 0.667487 CACGAGCACGACACCAAGAT 60.667 55.000 11.40 0.00 42.66 2.40
1707 1823 1.299850 CACGAGCACGACACCAAGA 60.300 57.895 11.40 0.00 42.66 3.02
1708 1824 1.591594 ACACGAGCACGACACCAAG 60.592 57.895 11.40 0.00 42.66 3.61
1709 1825 1.880796 CACACGAGCACGACACCAA 60.881 57.895 11.40 0.00 42.66 3.67
1710 1826 2.082629 ATCACACGAGCACGACACCA 62.083 55.000 11.40 0.00 42.66 4.17
1711 1827 0.944311 AATCACACGAGCACGACACC 60.944 55.000 11.40 0.00 42.66 4.16
1712 1828 0.161658 CAATCACACGAGCACGACAC 59.838 55.000 11.40 0.00 42.66 3.67
1713 1829 1.556591 GCAATCACACGAGCACGACA 61.557 55.000 11.40 0.00 42.66 4.35
1714 1830 1.130613 GCAATCACACGAGCACGAC 59.869 57.895 11.40 0.00 42.66 4.34
1715 1831 0.599991 AAGCAATCACACGAGCACGA 60.600 50.000 11.40 0.00 42.66 4.35
1716 1832 0.451628 CAAGCAATCACACGAGCACG 60.452 55.000 0.76 0.76 45.75 5.34
1717 1833 0.110056 CCAAGCAATCACACGAGCAC 60.110 55.000 0.00 0.00 0.00 4.40
1718 1834 0.534877 ACCAAGCAATCACACGAGCA 60.535 50.000 0.00 0.00 0.00 4.26
1719 1835 0.166814 GACCAAGCAATCACACGAGC 59.833 55.000 0.00 0.00 0.00 5.03
1720 1836 0.798776 GGACCAAGCAATCACACGAG 59.201 55.000 0.00 0.00 0.00 4.18
1721 1837 0.396435 AGGACCAAGCAATCACACGA 59.604 50.000 0.00 0.00 0.00 4.35
1722 1838 0.798776 GAGGACCAAGCAATCACACG 59.201 55.000 0.00 0.00 0.00 4.49
1723 1839 0.798776 CGAGGACCAAGCAATCACAC 59.201 55.000 0.00 0.00 0.00 3.82
1724 1840 0.321564 CCGAGGACCAAGCAATCACA 60.322 55.000 0.00 0.00 0.00 3.58
1725 1841 0.036388 TCCGAGGACCAAGCAATCAC 60.036 55.000 0.00 0.00 0.00 3.06
1726 1842 0.911769 ATCCGAGGACCAAGCAATCA 59.088 50.000 0.00 0.00 0.00 2.57
1727 1843 1.134401 TCATCCGAGGACCAAGCAATC 60.134 52.381 0.00 0.00 0.00 2.67
1728 1844 0.911769 TCATCCGAGGACCAAGCAAT 59.088 50.000 0.00 0.00 0.00 3.56
1729 1845 0.911769 ATCATCCGAGGACCAAGCAA 59.088 50.000 0.00 0.00 0.00 3.91
1730 1846 0.465705 GATCATCCGAGGACCAAGCA 59.534 55.000 0.00 0.00 0.00 3.91
1731 1847 0.598680 CGATCATCCGAGGACCAAGC 60.599 60.000 0.00 0.00 0.00 4.01
1732 1848 0.032678 CCGATCATCCGAGGACCAAG 59.967 60.000 0.00 0.00 0.00 3.61
1733 1849 2.028125 GCCGATCATCCGAGGACCAA 62.028 60.000 0.00 0.00 0.00 3.67
1734 1850 2.498941 GCCGATCATCCGAGGACCA 61.499 63.158 0.00 0.00 0.00 4.02
1735 1851 2.340443 GCCGATCATCCGAGGACC 59.660 66.667 0.00 0.00 0.00 4.46
1736 1852 2.049985 CGCCGATCATCCGAGGAC 60.050 66.667 0.00 0.00 0.00 3.85
1737 1853 2.685804 TACCGCCGATCATCCGAGGA 62.686 60.000 2.84 0.00 33.62 3.71
1738 1854 1.595993 ATACCGCCGATCATCCGAGG 61.596 60.000 0.00 0.00 34.84 4.63
1739 1855 0.456824 CATACCGCCGATCATCCGAG 60.457 60.000 0.00 0.00 0.00 4.63
1740 1856 1.584495 CATACCGCCGATCATCCGA 59.416 57.895 0.00 0.00 0.00 4.55
1741 1857 2.094659 GCATACCGCCGATCATCCG 61.095 63.158 0.00 0.00 32.94 4.18
1742 1858 3.876300 GCATACCGCCGATCATCC 58.124 61.111 0.00 0.00 32.94 3.51
1751 1867 2.094762 ATAAATCCGAGGCATACCGC 57.905 50.000 0.00 0.00 42.76 5.68
1752 1868 3.926616 AGAATAAATCCGAGGCATACCG 58.073 45.455 0.00 0.00 42.76 4.02
1753 1869 6.228258 TGTTAGAATAAATCCGAGGCATACC 58.772 40.000 0.00 0.00 0.00 2.73
1754 1870 7.441458 ACTTGTTAGAATAAATCCGAGGCATAC 59.559 37.037 0.00 0.00 0.00 2.39
1755 1871 7.441157 CACTTGTTAGAATAAATCCGAGGCATA 59.559 37.037 0.00 0.00 0.00 3.14
1756 1872 6.260936 CACTTGTTAGAATAAATCCGAGGCAT 59.739 38.462 0.00 0.00 0.00 4.40
1757 1873 5.584649 CACTTGTTAGAATAAATCCGAGGCA 59.415 40.000 0.00 0.00 0.00 4.75
1758 1874 5.007724 CCACTTGTTAGAATAAATCCGAGGC 59.992 44.000 0.00 0.00 0.00 4.70
1759 1875 6.113411 ACCACTTGTTAGAATAAATCCGAGG 58.887 40.000 0.00 0.00 0.00 4.63
1760 1876 8.888579 ATACCACTTGTTAGAATAAATCCGAG 57.111 34.615 0.00 0.00 0.00 4.63
1761 1877 8.479689 TGATACCACTTGTTAGAATAAATCCGA 58.520 33.333 0.00 0.00 0.00 4.55
1762 1878 8.657074 TGATACCACTTGTTAGAATAAATCCG 57.343 34.615 0.00 0.00 0.00 4.18
1766 1882 9.109393 GCTCATGATACCACTTGTTAGAATAAA 57.891 33.333 0.00 0.00 0.00 1.40
1767 1883 8.264347 TGCTCATGATACCACTTGTTAGAATAA 58.736 33.333 0.00 0.00 0.00 1.40
1768 1884 7.791029 TGCTCATGATACCACTTGTTAGAATA 58.209 34.615 0.00 0.00 0.00 1.75
1769 1885 6.653020 TGCTCATGATACCACTTGTTAGAAT 58.347 36.000 0.00 0.00 0.00 2.40
1770 1886 6.048732 TGCTCATGATACCACTTGTTAGAA 57.951 37.500 0.00 0.00 0.00 2.10
1771 1887 5.675684 TGCTCATGATACCACTTGTTAGA 57.324 39.130 0.00 0.00 0.00 2.10
1772 1888 5.295292 CCTTGCTCATGATACCACTTGTTAG 59.705 44.000 0.00 0.00 0.00 2.34
1773 1889 5.185454 CCTTGCTCATGATACCACTTGTTA 58.815 41.667 0.00 0.00 0.00 2.41
1774 1890 4.012374 CCTTGCTCATGATACCACTTGTT 58.988 43.478 0.00 0.00 0.00 2.83
1775 1891 3.009473 ACCTTGCTCATGATACCACTTGT 59.991 43.478 0.00 0.00 0.00 3.16
1776 1892 3.614092 ACCTTGCTCATGATACCACTTG 58.386 45.455 0.00 0.00 0.00 3.16
1777 1893 4.307032 AACCTTGCTCATGATACCACTT 57.693 40.909 0.00 0.00 0.00 3.16
1778 1894 4.680708 CGTAACCTTGCTCATGATACCACT 60.681 45.833 0.00 0.00 0.00 4.00
1779 1895 3.555956 CGTAACCTTGCTCATGATACCAC 59.444 47.826 0.00 0.00 0.00 4.16
1780 1896 3.449377 TCGTAACCTTGCTCATGATACCA 59.551 43.478 0.00 0.00 0.00 3.25
1781 1897 4.051922 CTCGTAACCTTGCTCATGATACC 58.948 47.826 0.00 0.00 0.00 2.73
1782 1898 4.933330 TCTCGTAACCTTGCTCATGATAC 58.067 43.478 0.00 0.00 0.00 2.24
1783 1899 5.359860 TCTTCTCGTAACCTTGCTCATGATA 59.640 40.000 0.00 0.00 0.00 2.15
1784 1900 4.160439 TCTTCTCGTAACCTTGCTCATGAT 59.840 41.667 0.00 0.00 0.00 2.45
1785 1901 3.509967 TCTTCTCGTAACCTTGCTCATGA 59.490 43.478 0.00 0.00 0.00 3.07
1786 1902 3.614616 GTCTTCTCGTAACCTTGCTCATG 59.385 47.826 0.00 0.00 0.00 3.07
1787 1903 3.368531 GGTCTTCTCGTAACCTTGCTCAT 60.369 47.826 0.00 0.00 0.00 2.90
1788 1904 2.029290 GGTCTTCTCGTAACCTTGCTCA 60.029 50.000 0.00 0.00 0.00 4.26
1789 1905 2.029290 TGGTCTTCTCGTAACCTTGCTC 60.029 50.000 0.00 0.00 34.05 4.26
1790 1906 1.968493 TGGTCTTCTCGTAACCTTGCT 59.032 47.619 0.00 0.00 34.05 3.91
1791 1907 2.450609 TGGTCTTCTCGTAACCTTGC 57.549 50.000 0.00 0.00 34.05 4.01
1792 1908 3.056107 TCCATGGTCTTCTCGTAACCTTG 60.056 47.826 12.58 0.00 37.74 3.61
1793 1909 3.170717 TCCATGGTCTTCTCGTAACCTT 58.829 45.455 12.58 0.00 34.05 3.50
1794 1910 2.816411 TCCATGGTCTTCTCGTAACCT 58.184 47.619 12.58 0.00 34.05 3.50
1795 1911 3.718815 GATCCATGGTCTTCTCGTAACC 58.281 50.000 12.58 0.00 0.00 2.85
1796 1912 3.181489 ACGATCCATGGTCTTCTCGTAAC 60.181 47.826 12.58 0.00 37.56 2.50
1797 1913 3.021695 ACGATCCATGGTCTTCTCGTAA 58.978 45.455 12.58 0.00 37.56 3.18
1798 1914 2.651455 ACGATCCATGGTCTTCTCGTA 58.349 47.619 12.58 0.00 37.56 3.43
1799 1915 1.475403 ACGATCCATGGTCTTCTCGT 58.525 50.000 12.58 15.49 34.80 4.18
1800 1916 2.159240 TCAACGATCCATGGTCTTCTCG 60.159 50.000 12.58 14.90 0.00 4.04
1801 1917 3.526931 TCAACGATCCATGGTCTTCTC 57.473 47.619 12.58 1.71 0.00 2.87
1802 1918 3.708631 AGATCAACGATCCATGGTCTTCT 59.291 43.478 12.58 1.78 39.66 2.85
1803 1919 4.065321 AGATCAACGATCCATGGTCTTC 57.935 45.455 12.58 6.82 39.66 2.87
1804 1920 4.895889 TCTAGATCAACGATCCATGGTCTT 59.104 41.667 12.58 0.00 39.66 3.01
1805 1921 4.474394 TCTAGATCAACGATCCATGGTCT 58.526 43.478 12.58 11.65 39.66 3.85
1806 1922 4.321601 CCTCTAGATCAACGATCCATGGTC 60.322 50.000 12.58 7.90 39.66 4.02
1807 1923 3.576118 CCTCTAGATCAACGATCCATGGT 59.424 47.826 12.58 0.00 39.66 3.55
1808 1924 3.829026 TCCTCTAGATCAACGATCCATGG 59.171 47.826 4.97 4.97 39.66 3.66
1809 1925 5.459536 TTCCTCTAGATCAACGATCCATG 57.540 43.478 0.00 0.00 39.66 3.66
1810 1926 4.021544 GCTTCCTCTAGATCAACGATCCAT 60.022 45.833 0.00 0.00 39.66 3.41
1811 1927 3.319405 GCTTCCTCTAGATCAACGATCCA 59.681 47.826 0.00 0.00 39.66 3.41
1812 1928 3.319405 TGCTTCCTCTAGATCAACGATCC 59.681 47.826 0.00 0.00 39.66 3.36
1813 1929 4.576216 TGCTTCCTCTAGATCAACGATC 57.424 45.455 0.00 0.00 39.17 3.69
1814 1930 4.320861 CGATGCTTCCTCTAGATCAACGAT 60.321 45.833 0.00 0.00 30.52 3.73
1815 1931 3.003793 CGATGCTTCCTCTAGATCAACGA 59.996 47.826 0.00 0.00 30.52 3.85
1816 1932 3.304257 CGATGCTTCCTCTAGATCAACG 58.696 50.000 0.00 0.00 0.00 4.10
1817 1933 3.068873 ACCGATGCTTCCTCTAGATCAAC 59.931 47.826 0.00 0.00 0.00 3.18
1818 1934 3.068732 CACCGATGCTTCCTCTAGATCAA 59.931 47.826 0.00 0.00 0.00 2.57
1819 1935 2.625314 CACCGATGCTTCCTCTAGATCA 59.375 50.000 0.00 0.00 0.00 2.92
1820 1936 2.887783 TCACCGATGCTTCCTCTAGATC 59.112 50.000 0.00 0.00 0.00 2.75
1821 1937 2.625790 GTCACCGATGCTTCCTCTAGAT 59.374 50.000 0.00 0.00 0.00 1.98
1822 1938 2.025155 GTCACCGATGCTTCCTCTAGA 58.975 52.381 0.00 0.00 0.00 2.43
1823 1939 1.751351 TGTCACCGATGCTTCCTCTAG 59.249 52.381 0.00 0.00 0.00 2.43
1824 1940 1.751351 CTGTCACCGATGCTTCCTCTA 59.249 52.381 0.00 0.00 0.00 2.43
1825 1941 0.534412 CTGTCACCGATGCTTCCTCT 59.466 55.000 0.00 0.00 0.00 3.69
1826 1942 1.086634 GCTGTCACCGATGCTTCCTC 61.087 60.000 0.00 0.00 0.00 3.71
1827 1943 1.078848 GCTGTCACCGATGCTTCCT 60.079 57.895 0.00 0.00 0.00 3.36
1828 1944 2.456119 CGCTGTCACCGATGCTTCC 61.456 63.158 0.00 0.00 0.00 3.46
1829 1945 3.084579 CGCTGTCACCGATGCTTC 58.915 61.111 0.00 0.00 0.00 3.86
1830 1946 3.121030 GCGCTGTCACCGATGCTT 61.121 61.111 0.00 0.00 0.00 3.91
1831 1947 3.670637 ATGCGCTGTCACCGATGCT 62.671 57.895 9.73 0.00 0.00 3.79
1832 1948 2.257286 AAATGCGCTGTCACCGATGC 62.257 55.000 9.73 0.00 0.00 3.91
1833 1949 0.168788 AAAATGCGCTGTCACCGATG 59.831 50.000 9.73 0.00 0.00 3.84
1834 1950 0.881118 AAAAATGCGCTGTCACCGAT 59.119 45.000 9.73 0.00 0.00 4.18
1835 1951 2.326222 AAAAATGCGCTGTCACCGA 58.674 47.368 9.73 0.00 0.00 4.69
1836 1952 4.942090 AAAAATGCGCTGTCACCG 57.058 50.000 9.73 0.00 0.00 4.94
1851 1967 3.601435 TCAATCAGGTATCGCCGAAAAA 58.399 40.909 0.00 0.00 43.70 1.94
1852 1968 3.254470 TCAATCAGGTATCGCCGAAAA 57.746 42.857 0.00 0.00 43.70 2.29
1853 1969 2.971660 TCAATCAGGTATCGCCGAAA 57.028 45.000 0.00 0.00 43.70 3.46
1854 1970 2.628178 AGATCAATCAGGTATCGCCGAA 59.372 45.455 0.00 0.00 43.70 4.30
1855 1971 2.029918 CAGATCAATCAGGTATCGCCGA 60.030 50.000 0.00 0.00 43.70 5.54
1856 1972 2.029918 TCAGATCAATCAGGTATCGCCG 60.030 50.000 0.00 0.00 43.70 6.46
1857 1973 3.667497 TCAGATCAATCAGGTATCGCC 57.333 47.619 0.00 0.00 37.58 5.54
1858 1974 3.856521 CGATCAGATCAATCAGGTATCGC 59.143 47.826 11.12 0.00 0.00 4.58
1859 1975 4.419280 CCGATCAGATCAATCAGGTATCG 58.581 47.826 11.12 0.00 35.85 2.92
1860 1976 4.382470 CCCCGATCAGATCAATCAGGTATC 60.382 50.000 11.12 0.00 0.00 2.24
1861 1977 3.517100 CCCCGATCAGATCAATCAGGTAT 59.483 47.826 11.12 0.00 0.00 2.73
1862 1978 2.899900 CCCCGATCAGATCAATCAGGTA 59.100 50.000 11.12 0.00 0.00 3.08
1863 1979 1.696336 CCCCGATCAGATCAATCAGGT 59.304 52.381 11.12 0.00 0.00 4.00
1864 1980 1.002888 CCCCCGATCAGATCAATCAGG 59.997 57.143 11.12 3.08 0.00 3.86
1865 1981 1.610102 GCCCCCGATCAGATCAATCAG 60.610 57.143 11.12 0.00 0.00 2.90
1866 1982 0.397941 GCCCCCGATCAGATCAATCA 59.602 55.000 11.12 0.00 0.00 2.57
1867 1983 0.671781 CGCCCCCGATCAGATCAATC 60.672 60.000 11.12 0.00 36.29 2.67
1868 1984 1.372683 CGCCCCCGATCAGATCAAT 59.627 57.895 11.12 0.00 36.29 2.57
1869 1985 2.821685 CGCCCCCGATCAGATCAA 59.178 61.111 11.12 0.00 36.29 2.57
1870 1986 3.928779 GCGCCCCCGATCAGATCA 61.929 66.667 11.12 0.00 36.29 2.92
1874 1990 4.944372 GTACGCGCCCCCGATCAG 62.944 72.222 5.73 0.00 36.29 2.90
1876 1992 4.295119 ATGTACGCGCCCCCGATC 62.295 66.667 5.73 0.00 36.29 3.69
1877 1993 4.602259 CATGTACGCGCCCCCGAT 62.602 66.667 5.73 0.00 36.29 4.18
1886 2002 4.830765 TGCCTCCGCCATGTACGC 62.831 66.667 0.09 0.00 0.00 4.42
1887 2003 2.586079 CTGCCTCCGCCATGTACG 60.586 66.667 0.00 0.00 0.00 3.67
1888 2004 2.897350 GCTGCCTCCGCCATGTAC 60.897 66.667 0.00 0.00 0.00 2.90
1889 2005 4.529219 CGCTGCCTCCGCCATGTA 62.529 66.667 0.00 0.00 0.00 2.29
1897 2013 4.687215 TGCACAGTCGCTGCCTCC 62.687 66.667 6.74 0.00 34.37 4.30
1898 2014 2.666190 TTGCACAGTCGCTGCCTC 60.666 61.111 6.74 0.00 34.37 4.70
1899 2015 2.667536 CTTGCACAGTCGCTGCCT 60.668 61.111 6.74 0.00 34.37 4.75
1900 2016 4.395583 GCTTGCACAGTCGCTGCC 62.396 66.667 6.74 0.52 34.37 4.85
1901 2017 3.590443 CTGCTTGCACAGTCGCTGC 62.590 63.158 6.74 0.00 34.37 5.25
1902 2018 2.554775 CTGCTTGCACAGTCGCTG 59.445 61.111 5.47 5.47 37.52 5.18
1903 2019 3.352222 GCTGCTTGCACAGTCGCT 61.352 61.111 6.23 0.00 42.31 4.93
1904 2020 4.731503 CGCTGCTTGCACAGTCGC 62.732 66.667 6.23 4.58 43.06 5.19
1905 2021 4.081030 CCGCTGCTTGCACAGTCG 62.081 66.667 6.23 9.28 43.06 4.18
1906 2022 4.395583 GCCGCTGCTTGCACAGTC 62.396 66.667 6.23 0.00 43.06 3.51
1920 2036 3.958147 ATTCGACCTGCACCAGCCG 62.958 63.158 0.00 0.00 41.13 5.52
1921 2037 1.675641 AATTCGACCTGCACCAGCC 60.676 57.895 0.00 0.00 41.13 4.85
1922 2038 0.955428 TCAATTCGACCTGCACCAGC 60.955 55.000 0.00 0.00 42.57 4.85
1923 2039 1.399440 CATCAATTCGACCTGCACCAG 59.601 52.381 0.00 0.00 0.00 4.00
1924 2040 1.452110 CATCAATTCGACCTGCACCA 58.548 50.000 0.00 0.00 0.00 4.17
1925 2041 0.734889 CCATCAATTCGACCTGCACC 59.265 55.000 0.00 0.00 0.00 5.01
1926 2042 0.734889 CCCATCAATTCGACCTGCAC 59.265 55.000 0.00 0.00 0.00 4.57
1927 2043 1.031571 GCCCATCAATTCGACCTGCA 61.032 55.000 0.00 0.00 0.00 4.41
1928 2044 1.728490 GGCCCATCAATTCGACCTGC 61.728 60.000 0.00 0.00 0.00 4.85
1929 2045 0.394216 TGGCCCATCAATTCGACCTG 60.394 55.000 0.00 0.00 0.00 4.00
1930 2046 0.107017 CTGGCCCATCAATTCGACCT 60.107 55.000 0.00 0.00 0.00 3.85
1931 2047 1.103398 CCTGGCCCATCAATTCGACC 61.103 60.000 0.00 0.00 0.00 4.79
1932 2048 1.728490 GCCTGGCCCATCAATTCGAC 61.728 60.000 7.66 0.00 0.00 4.20
1933 2049 1.453745 GCCTGGCCCATCAATTCGA 60.454 57.895 7.66 0.00 0.00 3.71
1934 2050 1.731433 CTGCCTGGCCCATCAATTCG 61.731 60.000 17.53 0.00 0.00 3.34
1935 2051 1.397390 CCTGCCTGGCCCATCAATTC 61.397 60.000 17.53 0.00 0.00 2.17
1936 2052 1.382146 CCTGCCTGGCCCATCAATT 60.382 57.895 17.53 0.00 0.00 2.32
1937 2053 2.281091 CCTGCCTGGCCCATCAAT 59.719 61.111 17.53 0.00 0.00 2.57
1963 2079 4.742201 CCAGCCCACACGGTCGAG 62.742 72.222 0.00 0.00 0.00 4.04
1987 2103 4.157120 CCAACTAGCCCCGACCGG 62.157 72.222 0.00 0.00 0.00 5.28
1988 2104 3.366739 GACCAACTAGCCCCGACCG 62.367 68.421 0.00 0.00 0.00 4.79
1989 2105 0.685458 TAGACCAACTAGCCCCGACC 60.685 60.000 0.00 0.00 0.00 4.79
1990 2106 0.745468 CTAGACCAACTAGCCCCGAC 59.255 60.000 0.00 0.00 41.45 4.79
1991 2107 3.202548 CTAGACCAACTAGCCCCGA 57.797 57.895 0.00 0.00 41.45 5.14
1998 2114 1.195115 CCAGCAGGCTAGACCAACTA 58.805 55.000 0.00 0.00 43.14 2.24
1999 2115 1.557269 CCCAGCAGGCTAGACCAACT 61.557 60.000 0.00 0.00 43.14 3.16
2000 2116 1.078143 CCCAGCAGGCTAGACCAAC 60.078 63.158 0.00 0.00 43.14 3.77
2001 2117 1.538876 ACCCAGCAGGCTAGACCAA 60.539 57.895 0.00 0.00 43.14 3.67
2002 2118 2.122729 ACCCAGCAGGCTAGACCA 59.877 61.111 0.00 0.00 43.14 4.02
2003 2119 2.586792 CACCCAGCAGGCTAGACC 59.413 66.667 0.00 0.00 40.58 3.85
2004 2120 2.124942 GCACCCAGCAGGCTAGAC 60.125 66.667 0.00 0.00 44.79 2.59
2024 2140 2.034687 CCAACAGGCTGGGGTCAG 59.965 66.667 20.34 1.53 43.64 3.51
2025 2141 2.449518 TCCAACAGGCTGGGGTCA 60.450 61.111 20.34 2.23 37.06 4.02
2026 2142 2.034221 GTCCAACAGGCTGGGGTC 59.966 66.667 20.34 13.42 37.06 4.46
2027 2143 3.580319 GGTCCAACAGGCTGGGGT 61.580 66.667 20.34 0.05 37.06 4.95
2028 2144 3.145473 TTGGTCCAACAGGCTGGGG 62.145 63.158 20.34 19.18 37.06 4.96
2029 2145 1.604593 CTTGGTCCAACAGGCTGGG 60.605 63.158 20.34 11.50 37.06 4.45
2030 2146 1.604593 CCTTGGTCCAACAGGCTGG 60.605 63.158 20.34 1.55 37.87 4.85
2031 2147 2.270986 GCCTTGGTCCAACAGGCTG 61.271 63.158 22.69 14.16 41.99 4.85
2032 2148 2.116125 GCCTTGGTCCAACAGGCT 59.884 61.111 22.69 0.00 41.99 4.58
2033 2149 3.365265 CGCCTTGGTCCAACAGGC 61.365 66.667 20.79 20.79 41.84 4.85
2034 2150 1.672356 CTCGCCTTGGTCCAACAGG 60.672 63.158 0.00 2.36 0.00 4.00
2035 2151 0.036010 ATCTCGCCTTGGTCCAACAG 60.036 55.000 0.00 0.00 0.00 3.16
2036 2152 0.036388 GATCTCGCCTTGGTCCAACA 60.036 55.000 0.00 0.00 0.00 3.33
2037 2153 0.036388 TGATCTCGCCTTGGTCCAAC 60.036 55.000 0.00 0.00 0.00 3.77
2038 2154 0.911769 ATGATCTCGCCTTGGTCCAA 59.088 50.000 3.76 3.76 0.00 3.53
2039 2155 0.465705 GATGATCTCGCCTTGGTCCA 59.534 55.000 0.00 0.00 0.00 4.02
2040 2156 0.598680 CGATGATCTCGCCTTGGTCC 60.599 60.000 0.00 0.00 41.14 4.46
2041 2157 2.892305 CGATGATCTCGCCTTGGTC 58.108 57.895 0.00 0.00 41.14 4.02
2050 2166 0.387112 CAGCTCCGCTCGATGATCTC 60.387 60.000 0.00 0.00 36.40 2.75
2051 2167 1.106351 ACAGCTCCGCTCGATGATCT 61.106 55.000 0.00 0.00 36.40 2.75
2052 2168 0.938637 CACAGCTCCGCTCGATGATC 60.939 60.000 0.00 0.00 36.40 2.92
2053 2169 1.067084 CACAGCTCCGCTCGATGAT 59.933 57.895 0.00 0.00 36.40 2.45
2054 2170 2.491621 CACAGCTCCGCTCGATGA 59.508 61.111 0.00 0.00 36.40 2.92
2055 2171 3.260483 GCACAGCTCCGCTCGATG 61.260 66.667 0.00 0.00 36.40 3.84
2056 2172 3.763356 TGCACAGCTCCGCTCGAT 61.763 61.111 5.53 0.00 36.40 3.59
2057 2173 4.724602 GTGCACAGCTCCGCTCGA 62.725 66.667 13.17 0.00 36.40 4.04
2058 2174 4.731612 AGTGCACAGCTCCGCTCG 62.732 66.667 21.04 0.00 36.40 5.03
2059 2175 2.358003 AAGTGCACAGCTCCGCTC 60.358 61.111 21.04 2.15 36.40 5.03
2060 2176 2.667536 CAAGTGCACAGCTCCGCT 60.668 61.111 21.04 0.00 40.77 5.52
2061 2177 3.730761 CCAAGTGCACAGCTCCGC 61.731 66.667 21.04 0.00 0.00 5.54
2062 2178 2.281070 ACCAAGTGCACAGCTCCG 60.281 61.111 21.04 2.27 0.00 4.63
2063 2179 1.526917 ACACCAAGTGCACAGCTCC 60.527 57.895 21.04 0.00 36.98 4.70
2064 2180 1.650912 CACACCAAGTGCACAGCTC 59.349 57.895 21.04 0.00 42.15 4.09
2065 2181 3.831883 CACACCAAGTGCACAGCT 58.168 55.556 21.04 0.00 42.15 4.24
2073 2189 2.111043 CCGTCCAGCACACCAAGT 59.889 61.111 0.00 0.00 0.00 3.16
2074 2190 2.111043 ACCGTCCAGCACACCAAG 59.889 61.111 0.00 0.00 0.00 3.61
2075 2191 2.203139 CACCGTCCAGCACACCAA 60.203 61.111 0.00 0.00 0.00 3.67
2076 2192 4.248842 CCACCGTCCAGCACACCA 62.249 66.667 0.00 0.00 0.00 4.17
2080 2196 4.722700 ATGGCCACCGTCCAGCAC 62.723 66.667 8.16 0.00 36.98 4.40
2081 2197 4.720902 CATGGCCACCGTCCAGCA 62.721 66.667 8.16 0.00 36.98 4.41
2082 2198 3.918253 TTCATGGCCACCGTCCAGC 62.918 63.158 8.16 0.00 36.98 4.85
2083 2199 2.040544 GTTCATGGCCACCGTCCAG 61.041 63.158 8.16 0.00 36.98 3.86
2084 2200 2.033448 GTTCATGGCCACCGTCCA 59.967 61.111 8.16 0.00 38.09 4.02
2085 2201 3.124921 CGTTCATGGCCACCGTCC 61.125 66.667 8.16 0.00 0.00 4.79
2086 2202 3.124921 CCGTTCATGGCCACCGTC 61.125 66.667 8.16 0.00 0.00 4.79
2087 2203 4.715523 CCCGTTCATGGCCACCGT 62.716 66.667 8.16 0.00 0.00 4.83
2088 2204 2.318519 TATCCCGTTCATGGCCACCG 62.319 60.000 8.16 8.39 0.00 4.94
2089 2205 0.110486 ATATCCCGTTCATGGCCACC 59.890 55.000 8.16 0.00 0.00 4.61
2090 2206 1.523758 GATATCCCGTTCATGGCCAC 58.476 55.000 8.16 0.00 0.00 5.01
2091 2207 0.400213 GGATATCCCGTTCATGGCCA 59.600 55.000 8.56 8.56 0.00 5.36
2092 2208 3.249687 GGATATCCCGTTCATGGCC 57.750 57.895 11.02 0.00 0.00 5.36
2110 2226 0.748450 TTCCTGGGTATACCGCTTCG 59.252 55.000 15.80 1.76 44.64 3.79
2111 2227 1.540580 GCTTCCTGGGTATACCGCTTC 60.541 57.143 15.80 2.46 44.64 3.86
2112 2228 0.468648 GCTTCCTGGGTATACCGCTT 59.531 55.000 15.80 0.00 44.64 4.68
2113 2229 1.408453 GGCTTCCTGGGTATACCGCT 61.408 60.000 15.80 0.00 44.64 5.52
2114 2230 1.070957 GGCTTCCTGGGTATACCGC 59.929 63.158 15.80 11.66 44.64 5.68
2115 2231 1.366366 CGGCTTCCTGGGTATACCG 59.634 63.158 15.80 2.86 44.64 4.02
2116 2232 1.708341 TACGGCTTCCTGGGTATACC 58.292 55.000 13.99 13.99 40.81 2.73
2117 2233 2.612221 GCATACGGCTTCCTGGGTATAC 60.612 54.545 0.00 0.00 40.25 1.47
2118 2234 1.621814 GCATACGGCTTCCTGGGTATA 59.378 52.381 0.00 0.00 40.25 1.47
2119 2235 0.396811 GCATACGGCTTCCTGGGTAT 59.603 55.000 0.00 0.00 40.25 2.73
2120 2236 1.827394 GCATACGGCTTCCTGGGTA 59.173 57.895 0.00 0.00 40.25 3.69
2121 2237 2.590092 GCATACGGCTTCCTGGGT 59.410 61.111 0.00 0.00 40.25 4.51
2122 2238 2.588877 CGCATACGGCTTCCTGGG 60.589 66.667 0.00 0.00 41.67 4.45
2123 2239 1.592669 CTCGCATACGGCTTCCTGG 60.593 63.158 0.00 0.00 41.67 4.45
2124 2240 2.240500 GCTCGCATACGGCTTCCTG 61.241 63.158 0.00 0.00 41.67 3.86
2125 2241 2.107141 GCTCGCATACGGCTTCCT 59.893 61.111 0.00 0.00 41.67 3.36
2126 2242 2.967615 GGCTCGCATACGGCTTCC 60.968 66.667 0.00 0.00 41.67 3.46
2127 2243 2.202878 TGGCTCGCATACGGCTTC 60.203 61.111 0.00 0.00 41.67 3.86
2128 2244 2.202932 CTGGCTCGCATACGGCTT 60.203 61.111 0.00 0.00 41.67 4.35
2129 2245 3.144120 CTCTGGCTCGCATACGGCT 62.144 63.158 0.00 0.00 41.67 5.52
2130 2246 2.427540 ATCTCTGGCTCGCATACGGC 62.428 60.000 0.00 0.00 40.63 5.68
2131 2247 0.032678 AATCTCTGGCTCGCATACGG 59.967 55.000 0.00 0.00 40.63 4.02
2132 2248 1.524355 CAAATCTCTGGCTCGCATACG 59.476 52.381 0.00 0.00 42.01 3.06
2133 2249 2.555199 ACAAATCTCTGGCTCGCATAC 58.445 47.619 0.00 0.00 0.00 2.39
2134 2250 2.988010 ACAAATCTCTGGCTCGCATA 57.012 45.000 0.00 0.00 0.00 3.14
2135 2251 2.119801 AACAAATCTCTGGCTCGCAT 57.880 45.000 0.00 0.00 0.00 4.73
2136 2252 1.536766 CAAACAAATCTCTGGCTCGCA 59.463 47.619 0.00 0.00 0.00 5.10
2137 2253 1.135575 CCAAACAAATCTCTGGCTCGC 60.136 52.381 0.00 0.00 0.00 5.03
2138 2254 2.426522 TCCAAACAAATCTCTGGCTCG 58.573 47.619 0.00 0.00 0.00 5.03
2139 2255 4.037923 TGTTTCCAAACAAATCTCTGGCTC 59.962 41.667 2.29 0.00 45.17 4.70
2140 2256 3.960102 TGTTTCCAAACAAATCTCTGGCT 59.040 39.130 2.29 0.00 45.17 4.75
2141 2257 4.320608 TGTTTCCAAACAAATCTCTGGC 57.679 40.909 2.29 0.00 45.17 4.85
2151 2267 3.510360 TCGGTCCTTTTTGTTTCCAAACA 59.490 39.130 0.55 0.55 46.35 2.83
2181 2305 4.577677 TGCCTCTTGCCGTGCCAA 62.578 61.111 0.00 0.00 40.16 4.52
2190 2314 3.878103 CCTCTGATTTGATCTGCCTCTTG 59.122 47.826 0.00 0.00 0.00 3.02
2210 2343 3.393800 CATACGCGATGGATTCTTTCCT 58.606 45.455 15.93 0.00 45.68 3.36
2225 2360 1.442769 ATTCCGATGGATGCATACGC 58.557 50.000 4.01 0.00 39.24 4.42
2226 2361 2.160219 CCAATTCCGATGGATGCATACG 59.840 50.000 4.01 5.93 40.56 3.06
2254 2392 3.171277 GCTAGTAATTGCTTTGCCAACG 58.829 45.455 0.00 0.00 0.00 4.10
2286 2429 1.070758 CGTGTATTAGCTCCCAGGCAT 59.929 52.381 0.00 0.00 34.17 4.40
2463 2626 2.228822 CTGCCATAACGCAAGGTTTTCT 59.771 45.455 0.00 0.00 46.39 2.52
2474 2637 1.401552 CACCCATTGTCTGCCATAACG 59.598 52.381 0.00 0.00 0.00 3.18
2489 2653 3.153919 GTGCCAACTAATCTTTCACCCA 58.846 45.455 0.00 0.00 0.00 4.51
2502 2666 1.303888 CATCCCTGCTGTGCCAACT 60.304 57.895 0.00 0.00 0.00 3.16
2529 2693 0.107643 TGACATGACTTCCCGCAACA 59.892 50.000 0.00 0.00 0.00 3.33
2552 2716 8.577048 AATCCATCACATGATAAATCCATCTC 57.423 34.615 0.00 0.00 32.63 2.75
2577 2741 7.211897 TCCAAATCATCTCCCAAGAATTCTA 57.788 36.000 8.75 0.00 34.49 2.10
2585 2750 4.623886 CGAGACTTCCAAATCATCTCCCAA 60.624 45.833 0.00 0.00 33.66 4.12
2589 2754 3.801594 GCTCGAGACTTCCAAATCATCTC 59.198 47.826 18.75 0.00 33.85 2.75
2604 2769 1.153958 CTGCATGACACGCTCGAGA 60.154 57.895 18.75 0.00 0.00 4.04
2696 2864 2.202878 CGTTGTCGCCGATCCCAT 60.203 61.111 0.00 0.00 0.00 4.00
2773 2944 3.953775 CACACAAGCCCTCGGGGT 61.954 66.667 0.00 0.00 46.51 4.95
2808 2981 1.354368 ACCACCTTGAATCAATCCCGT 59.646 47.619 0.00 0.00 0.00 5.28
2944 3126 1.400846 CTCTGAGCTCTTACGCCGTAA 59.599 52.381 16.19 9.62 0.00 3.18
2982 3164 0.034896 ATGTCACTCGCTTTTCCCGT 59.965 50.000 0.00 0.00 0.00 5.28
3023 3208 2.396590 TTTACGCTTCCATCAGACCC 57.603 50.000 0.00 0.00 0.00 4.46
3040 3225 0.316204 ACCGACCGATGACGAGTTTT 59.684 50.000 0.00 0.00 42.66 2.43
3083 3268 0.107410 GACCACACCACTCAACCACA 60.107 55.000 0.00 0.00 0.00 4.17
3085 3270 0.916086 AAGACCACACCACTCAACCA 59.084 50.000 0.00 0.00 0.00 3.67
3102 3287 1.202200 CGAGTCTCAAGGGTAGCGAAG 60.202 57.143 0.00 0.00 0.00 3.79
3108 3293 0.679002 CCGGTCGAGTCTCAAGGGTA 60.679 60.000 0.00 0.00 0.00 3.69
3148 3333 1.372997 CACGCCTCGCCGCTATTAT 60.373 57.895 0.00 0.00 0.00 1.28
3169 3354 1.078214 CTCCATGTCCCGTGCATGT 60.078 57.895 4.96 0.00 41.38 3.21
3170 3355 1.091771 GTCTCCATGTCCCGTGCATG 61.092 60.000 0.00 0.00 42.29 4.06
3206 3393 4.284490 AGTTGTCTCACCACATGTATGACT 59.716 41.667 0.00 0.00 0.00 3.41
3231 3418 3.981071 AGTCATCCCGAGTCAAATTCA 57.019 42.857 0.00 0.00 0.00 2.57
3418 3606 5.511545 CCTTGTTACTCTAGTTTGTGCTCCT 60.512 44.000 0.00 0.00 0.00 3.69
3519 3707 0.887387 GCACCGCTGGTACTCCAAAA 60.887 55.000 0.00 0.00 43.81 2.44
3597 3789 3.480470 CTTGGCGAATATTCTCCACCAT 58.520 45.455 23.66 0.00 41.41 3.55
3705 3899 1.293062 TCCTACTAGGACACGACCCT 58.707 55.000 0.03 0.00 40.06 4.34
3776 3970 3.244078 CGGTGCTATTAAGGTGGCATAGA 60.244 47.826 0.00 0.00 37.90 1.98
3785 3979 2.004017 TGCGTTTCGGTGCTATTAAGG 58.996 47.619 0.00 0.00 0.00 2.69
3787 3981 2.004017 CCTGCGTTTCGGTGCTATTAA 58.996 47.619 0.00 0.00 0.00 1.40
3799 3993 2.983592 CCGGCTTTCCCTGCGTTT 60.984 61.111 0.00 0.00 0.00 3.60
3888 4083 2.221299 GCTACATCCCCGGGGCATA 61.221 63.158 36.68 23.65 34.68 3.14
3927 4122 2.663119 GGAGCACGACATCAAAATTTGC 59.337 45.455 0.00 0.00 0.00 3.68
3948 4143 1.081892 CGAGGACCAAGCAATCACAG 58.918 55.000 0.00 0.00 0.00 3.66
3976 4171 5.438761 AGAATAAATTTGAGGCATACCGC 57.561 39.130 0.00 0.00 42.76 5.68
4028 4223 1.722677 GTACGTCCTCTCCTCGCAG 59.277 63.158 0.00 0.00 0.00 5.18
4056 4258 2.879026 GGGACTGACAAAAAGGACTGAC 59.121 50.000 0.00 0.00 0.00 3.51
4102 4311 2.791383 TGATTGCTTTTTGTCACGGG 57.209 45.000 0.00 0.00 0.00 5.28
4109 4318 9.941664 AGATTCTATAACGATGATTGCTTTTTG 57.058 29.630 0.00 0.00 0.00 2.44
4124 4333 5.297547 TGATTGGACGGCAGATTCTATAAC 58.702 41.667 0.00 0.00 0.00 1.89
4180 4399 1.030457 GCATTGGAAGAGGCCTGATG 58.970 55.000 12.00 5.74 0.00 3.07
4184 4403 1.210204 TGGAGCATTGGAAGAGGCCT 61.210 55.000 3.86 3.86 0.00 5.19
4185 4404 1.034292 GTGGAGCATTGGAAGAGGCC 61.034 60.000 0.00 0.00 0.00 5.19
4186 4405 1.034292 GGTGGAGCATTGGAAGAGGC 61.034 60.000 0.00 0.00 0.00 4.70
4187 4406 0.622665 AGGTGGAGCATTGGAAGAGG 59.377 55.000 0.00 0.00 0.00 3.69
4188 4407 2.089980 CAAGGTGGAGCATTGGAAGAG 58.910 52.381 0.00 0.00 35.45 2.85
4189 4408 1.425066 ACAAGGTGGAGCATTGGAAGA 59.575 47.619 0.00 0.00 42.57 2.87
4190 4409 1.915141 ACAAGGTGGAGCATTGGAAG 58.085 50.000 0.00 0.00 42.57 3.46
4191 4410 2.107378 TGTACAAGGTGGAGCATTGGAA 59.893 45.455 0.00 0.00 42.57 3.53
4192 4411 1.702401 TGTACAAGGTGGAGCATTGGA 59.298 47.619 0.00 0.00 42.57 3.53
4193 4412 2.198827 TGTACAAGGTGGAGCATTGG 57.801 50.000 0.00 0.00 42.57 3.16
4194 4413 4.022068 ACATTTGTACAAGGTGGAGCATTG 60.022 41.667 20.42 4.26 43.74 2.82
4195 4414 4.151883 ACATTTGTACAAGGTGGAGCATT 58.848 39.130 20.42 3.30 0.00 3.56
4196 4415 3.766545 ACATTTGTACAAGGTGGAGCAT 58.233 40.909 20.42 4.28 0.00 3.79
4197 4416 3.222173 ACATTTGTACAAGGTGGAGCA 57.778 42.857 20.42 2.30 0.00 4.26
4198 4417 5.699097 TTAACATTTGTACAAGGTGGAGC 57.301 39.130 20.42 0.00 0.00 4.70
4199 4418 7.214467 ACATTAACATTTGTACAAGGTGGAG 57.786 36.000 20.42 12.01 0.00 3.86
4200 4419 7.429633 CAACATTAACATTTGTACAAGGTGGA 58.570 34.615 20.42 11.55 0.00 4.02
4201 4420 6.145371 GCAACATTAACATTTGTACAAGGTGG 59.855 38.462 20.42 10.52 0.00 4.61
4202 4421 6.145371 GGCAACATTAACATTTGTACAAGGTG 59.855 38.462 16.86 16.86 0.00 4.00
4203 4422 6.183360 TGGCAACATTAACATTTGTACAAGGT 60.183 34.615 8.56 8.62 46.17 3.50
4204 4423 6.219473 TGGCAACATTAACATTTGTACAAGG 58.781 36.000 8.56 7.98 46.17 3.61
4238 4457 4.612264 AGCAAAGCCACATCAGATTTTT 57.388 36.364 0.00 0.00 0.00 1.94
4239 4458 4.768968 ACTAGCAAAGCCACATCAGATTTT 59.231 37.500 0.00 0.00 0.00 1.82
4240 4459 4.338879 ACTAGCAAAGCCACATCAGATTT 58.661 39.130 0.00 0.00 0.00 2.17
4241 4460 3.960571 ACTAGCAAAGCCACATCAGATT 58.039 40.909 0.00 0.00 0.00 2.40
4242 4461 3.641434 ACTAGCAAAGCCACATCAGAT 57.359 42.857 0.00 0.00 0.00 2.90
4243 4462 3.423539 AACTAGCAAAGCCACATCAGA 57.576 42.857 0.00 0.00 0.00 3.27
4244 4463 4.937620 TCTTAACTAGCAAAGCCACATCAG 59.062 41.667 0.00 0.00 0.00 2.90
4245 4464 4.905429 TCTTAACTAGCAAAGCCACATCA 58.095 39.130 0.00 0.00 0.00 3.07
4246 4465 5.643777 TCTTCTTAACTAGCAAAGCCACATC 59.356 40.000 0.00 0.00 0.00 3.06
4247 4466 5.560724 TCTTCTTAACTAGCAAAGCCACAT 58.439 37.500 0.00 0.00 0.00 3.21
4248 4467 4.968259 TCTTCTTAACTAGCAAAGCCACA 58.032 39.130 0.00 0.00 0.00 4.17
4249 4468 5.238583 TCTCTTCTTAACTAGCAAAGCCAC 58.761 41.667 0.00 0.00 0.00 5.01
4250 4469 5.246203 TCTCTCTTCTTAACTAGCAAAGCCA 59.754 40.000 0.00 0.00 0.00 4.75
4251 4470 5.725362 TCTCTCTTCTTAACTAGCAAAGCC 58.275 41.667 0.00 0.00 0.00 4.35
4252 4471 6.626302 TCTCTCTCTTCTTAACTAGCAAAGC 58.374 40.000 0.00 0.00 0.00 3.51
4253 4472 8.050778 TCTCTCTCTCTTCTTAACTAGCAAAG 57.949 38.462 0.00 0.00 0.00 2.77
4254 4473 7.668052 ACTCTCTCTCTCTTCTTAACTAGCAAA 59.332 37.037 0.00 0.00 0.00 3.68
4255 4474 7.120579 CACTCTCTCTCTCTTCTTAACTAGCAA 59.879 40.741 0.00 0.00 0.00 3.91
4256 4475 6.597672 CACTCTCTCTCTCTTCTTAACTAGCA 59.402 42.308 0.00 0.00 0.00 3.49
4257 4476 6.038271 CCACTCTCTCTCTCTTCTTAACTAGC 59.962 46.154 0.00 0.00 0.00 3.42
4258 4477 7.110155 ACCACTCTCTCTCTCTTCTTAACTAG 58.890 42.308 0.00 0.00 0.00 2.57
4259 4478 7.023171 ACCACTCTCTCTCTCTTCTTAACTA 57.977 40.000 0.00 0.00 0.00 2.24
4260 4479 5.887754 ACCACTCTCTCTCTCTTCTTAACT 58.112 41.667 0.00 0.00 0.00 2.24
4261 4480 7.201785 CCATACCACTCTCTCTCTCTTCTTAAC 60.202 44.444 0.00 0.00 0.00 2.01
4262 4481 6.831353 CCATACCACTCTCTCTCTCTTCTTAA 59.169 42.308 0.00 0.00 0.00 1.85
4263 4482 6.361433 CCATACCACTCTCTCTCTCTTCTTA 58.639 44.000 0.00 0.00 0.00 2.10
4264 4483 5.200483 CCATACCACTCTCTCTCTCTTCTT 58.800 45.833 0.00 0.00 0.00 2.52
4265 4484 4.792068 CCATACCACTCTCTCTCTCTTCT 58.208 47.826 0.00 0.00 0.00 2.85
4266 4485 3.317993 GCCATACCACTCTCTCTCTCTTC 59.682 52.174 0.00 0.00 0.00 2.87
4267 4486 3.295973 GCCATACCACTCTCTCTCTCTT 58.704 50.000 0.00 0.00 0.00 2.85
4268 4487 2.748132 CGCCATACCACTCTCTCTCTCT 60.748 54.545 0.00 0.00 0.00 3.10
4269 4488 1.606668 CGCCATACCACTCTCTCTCTC 59.393 57.143 0.00 0.00 0.00 3.20
4270 4489 1.213182 TCGCCATACCACTCTCTCTCT 59.787 52.381 0.00 0.00 0.00 3.10
4271 4490 1.335496 GTCGCCATACCACTCTCTCTC 59.665 57.143 0.00 0.00 0.00 3.20
4272 4491 1.394618 GTCGCCATACCACTCTCTCT 58.605 55.000 0.00 0.00 0.00 3.10
4273 4492 0.386113 GGTCGCCATACCACTCTCTC 59.614 60.000 0.00 0.00 39.50 3.20
4274 4493 1.043673 GGGTCGCCATACCACTCTCT 61.044 60.000 0.00 0.00 41.67 3.10
4275 4494 1.327690 TGGGTCGCCATACCACTCTC 61.328 60.000 0.00 0.00 41.67 3.20
4276 4495 0.691078 ATGGGTCGCCATACCACTCT 60.691 55.000 0.00 0.00 41.67 3.24
4277 4496 0.532862 CATGGGTCGCCATACCACTC 60.533 60.000 0.00 0.00 41.67 3.51
4278 4497 0.980754 TCATGGGTCGCCATACCACT 60.981 55.000 0.00 0.00 41.67 4.00
4279 4498 0.107410 TTCATGGGTCGCCATACCAC 60.107 55.000 0.00 0.00 41.67 4.16
4280 4499 0.180171 CTTCATGGGTCGCCATACCA 59.820 55.000 0.00 0.00 41.67 3.25
4281 4500 0.468226 TCTTCATGGGTCGCCATACC 59.532 55.000 0.00 0.00 38.94 2.73
4282 4501 2.325583 TTCTTCATGGGTCGCCATAC 57.674 50.000 0.00 0.00 0.00 2.39
4283 4502 2.639065 GTTTCTTCATGGGTCGCCATA 58.361 47.619 0.00 0.00 0.00 2.74
4284 4503 1.463674 GTTTCTTCATGGGTCGCCAT 58.536 50.000 0.00 0.00 0.00 4.40
4285 4504 0.953471 CGTTTCTTCATGGGTCGCCA 60.953 55.000 0.00 0.00 0.00 5.69
4286 4505 1.644786 CCGTTTCTTCATGGGTCGCC 61.645 60.000 0.00 0.00 0.00 5.54
4287 4506 0.953960 ACCGTTTCTTCATGGGTCGC 60.954 55.000 0.00 0.00 0.00 5.19
4288 4507 0.796312 CACCGTTTCTTCATGGGTCG 59.204 55.000 0.00 0.00 0.00 4.79
4289 4508 0.521735 GCACCGTTTCTTCATGGGTC 59.478 55.000 0.00 0.00 0.00 4.46
4290 4509 0.110486 AGCACCGTTTCTTCATGGGT 59.890 50.000 0.00 0.00 0.00 4.51
4291 4510 2.107950 TAGCACCGTTTCTTCATGGG 57.892 50.000 0.00 0.00 0.00 4.00
4292 4511 2.159517 GCTTAGCACCGTTTCTTCATGG 60.160 50.000 0.00 0.00 0.00 3.66
4293 4512 2.744202 AGCTTAGCACCGTTTCTTCATG 59.256 45.455 7.07 0.00 0.00 3.07
4294 4513 3.003480 GAGCTTAGCACCGTTTCTTCAT 58.997 45.455 7.07 0.00 0.00 2.57
4295 4514 2.413837 GAGCTTAGCACCGTTTCTTCA 58.586 47.619 7.07 0.00 0.00 3.02
4296 4515 1.390463 CGAGCTTAGCACCGTTTCTTC 59.610 52.381 7.07 0.00 0.00 2.87
4297 4516 1.270147 ACGAGCTTAGCACCGTTTCTT 60.270 47.619 16.24 0.00 36.94 2.52
4298 4517 0.317479 ACGAGCTTAGCACCGTTTCT 59.683 50.000 16.24 0.00 36.94 2.52
4299 4518 1.986698 TACGAGCTTAGCACCGTTTC 58.013 50.000 23.90 4.67 39.67 2.78
4300 4519 2.667473 ATACGAGCTTAGCACCGTTT 57.333 45.000 23.90 16.15 39.67 3.60
4301 4520 2.223665 GGTATACGAGCTTAGCACCGTT 60.224 50.000 23.90 15.93 39.67 4.44
4302 4521 1.336125 GGTATACGAGCTTAGCACCGT 59.664 52.381 22.79 22.79 41.20 4.83
4303 4522 1.607628 AGGTATACGAGCTTAGCACCG 59.392 52.381 7.07 11.99 29.01 4.94
4304 4523 3.190953 CCTAGGTATACGAGCTTAGCACC 59.809 52.174 7.07 3.88 37.09 5.01
4305 4524 3.819902 ACCTAGGTATACGAGCTTAGCAC 59.180 47.826 14.41 0.00 37.09 4.40
4306 4525 3.819337 CACCTAGGTATACGAGCTTAGCA 59.181 47.826 15.80 0.00 37.09 3.49
4307 4526 3.190953 CCACCTAGGTATACGAGCTTAGC 59.809 52.174 15.80 0.00 37.09 3.09
4308 4527 4.649692 TCCACCTAGGTATACGAGCTTAG 58.350 47.826 15.80 0.00 37.09 2.18
4309 4528 4.712051 TCCACCTAGGTATACGAGCTTA 57.288 45.455 15.80 0.00 37.09 3.09
4310 4529 3.589951 TCCACCTAGGTATACGAGCTT 57.410 47.619 15.80 0.00 37.09 3.74
4311 4530 3.488363 CTTCCACCTAGGTATACGAGCT 58.512 50.000 15.80 0.00 39.82 4.09
4312 4531 2.030096 GCTTCCACCTAGGTATACGAGC 60.030 54.545 15.80 15.25 39.02 5.03
4313 4532 2.225963 CGCTTCCACCTAGGTATACGAG 59.774 54.545 15.80 9.51 39.02 4.18
4314 4533 2.224606 CGCTTCCACCTAGGTATACGA 58.775 52.381 15.80 5.09 39.02 3.43
4315 4534 1.335689 GCGCTTCCACCTAGGTATACG 60.336 57.143 15.80 14.81 39.02 3.06
4316 4535 1.684983 TGCGCTTCCACCTAGGTATAC 59.315 52.381 15.80 1.82 39.02 1.47
4317 4536 2.076207 TGCGCTTCCACCTAGGTATA 57.924 50.000 15.80 2.22 39.02 1.47
4318 4537 1.200519 TTGCGCTTCCACCTAGGTAT 58.799 50.000 15.80 0.00 39.02 2.73
4319 4538 1.200519 ATTGCGCTTCCACCTAGGTA 58.799 50.000 15.80 0.00 39.02 3.08
4320 4539 0.328258 AATTGCGCTTCCACCTAGGT 59.672 50.000 9.21 9.21 39.02 3.08
4321 4540 1.017387 GAATTGCGCTTCCACCTAGG 58.983 55.000 9.73 7.41 39.47 3.02
4322 4541 1.017387 GGAATTGCGCTTCCACCTAG 58.983 55.000 20.32 0.00 43.56 3.02
4323 4542 0.742990 CGGAATTGCGCTTCCACCTA 60.743 55.000 23.54 0.00 44.18 3.08
4324 4543 2.040544 CGGAATTGCGCTTCCACCT 61.041 57.895 23.54 0.00 44.18 4.00
4325 4544 1.982073 CTCGGAATTGCGCTTCCACC 61.982 60.000 23.54 13.21 44.18 4.61
4326 4545 1.298859 ACTCGGAATTGCGCTTCCAC 61.299 55.000 23.54 5.71 44.18 4.02
4327 4546 1.003839 ACTCGGAATTGCGCTTCCA 60.004 52.632 23.54 12.49 44.18 3.53
4328 4547 0.741221 AGACTCGGAATTGCGCTTCC 60.741 55.000 15.17 16.42 41.16 3.46
4329 4548 1.588861 GTAGACTCGGAATTGCGCTTC 59.411 52.381 15.17 12.51 0.00 3.86
4330 4549 1.067142 TGTAGACTCGGAATTGCGCTT 60.067 47.619 15.17 3.22 0.00 4.68
4331 4550 0.530744 TGTAGACTCGGAATTGCGCT 59.469 50.000 15.17 8.73 0.00 5.92
4332 4551 1.060698 GTTGTAGACTCGGAATTGCGC 59.939 52.381 15.17 0.00 0.00 6.09
4333 4552 2.607187 AGTTGTAGACTCGGAATTGCG 58.393 47.619 13.75 13.75 31.20 4.85
4334 4553 6.663944 AATTAGTTGTAGACTCGGAATTGC 57.336 37.500 0.00 0.00 39.86 3.56
4337 4556 9.886132 ACATTTAATTAGTTGTAGACTCGGAAT 57.114 29.630 1.67 0.00 39.86 3.01
4354 4573 9.030452 TGGGTGTTAAGCTTCATACATTTAATT 57.970 29.630 0.00 0.00 0.00 1.40
4355 4574 8.588290 TGGGTGTTAAGCTTCATACATTTAAT 57.412 30.769 0.00 0.00 0.00 1.40
4356 4575 8.410673 TTGGGTGTTAAGCTTCATACATTTAA 57.589 30.769 0.00 1.13 0.00 1.52
4357 4576 8.410673 TTTGGGTGTTAAGCTTCATACATTTA 57.589 30.769 0.00 0.00 0.00 1.40
4358 4577 6.909550 TTGGGTGTTAAGCTTCATACATTT 57.090 33.333 0.00 0.00 0.00 2.32
4359 4578 6.909550 TTTGGGTGTTAAGCTTCATACATT 57.090 33.333 0.00 0.00 0.00 2.71
4360 4579 6.572314 GCTTTTGGGTGTTAAGCTTCATACAT 60.572 38.462 0.00 0.00 40.75 2.29
4361 4580 5.278758 GCTTTTGGGTGTTAAGCTTCATACA 60.279 40.000 0.00 3.38 40.75 2.29
4362 4581 5.161358 GCTTTTGGGTGTTAAGCTTCATAC 58.839 41.667 0.00 0.00 40.75 2.39
4363 4582 5.385509 GCTTTTGGGTGTTAAGCTTCATA 57.614 39.130 0.00 0.00 40.75 2.15
4364 4583 4.257267 GCTTTTGGGTGTTAAGCTTCAT 57.743 40.909 0.00 0.00 40.75 2.57
4365 4584 3.726291 GCTTTTGGGTGTTAAGCTTCA 57.274 42.857 0.00 0.00 40.75 3.02
4369 4588 3.005367 TGCTAAGCTTTTGGGTGTTAAGC 59.995 43.478 3.20 3.73 43.47 3.09
4370 4589 4.546570 GTGCTAAGCTTTTGGGTGTTAAG 58.453 43.478 3.20 0.00 0.00 1.85
4371 4590 3.319689 GGTGCTAAGCTTTTGGGTGTTAA 59.680 43.478 3.20 0.00 0.00 2.01
4372 4591 2.888414 GGTGCTAAGCTTTTGGGTGTTA 59.112 45.455 3.20 0.00 0.00 2.41
4373 4592 1.686587 GGTGCTAAGCTTTTGGGTGTT 59.313 47.619 3.20 0.00 0.00 3.32
4374 4593 1.133482 AGGTGCTAAGCTTTTGGGTGT 60.133 47.619 3.20 0.00 0.00 4.16
4375 4594 1.620822 AGGTGCTAAGCTTTTGGGTG 58.379 50.000 3.20 0.00 0.00 4.61
4376 4595 3.356290 CATAGGTGCTAAGCTTTTGGGT 58.644 45.455 3.20 0.00 35.29 4.51
4390 4609 6.949352 ACTCAAATCCTTAATGCATAGGTG 57.051 37.500 14.01 6.79 33.15 4.00
4391 4610 7.118723 TCAACTCAAATCCTTAATGCATAGGT 58.881 34.615 14.01 1.23 33.15 3.08
4392 4611 7.572523 TCAACTCAAATCCTTAATGCATAGG 57.427 36.000 8.99 8.99 0.00 2.57
4395 4614 9.412460 TCTTATCAACTCAAATCCTTAATGCAT 57.588 29.630 0.00 0.00 0.00 3.96
4396 4615 8.677300 GTCTTATCAACTCAAATCCTTAATGCA 58.323 33.333 0.00 0.00 0.00 3.96
4397 4616 8.677300 TGTCTTATCAACTCAAATCCTTAATGC 58.323 33.333 0.00 0.00 0.00 3.56
4426 4645 9.309224 TGCTTAGATGAGGTGCTAAGTATATTA 57.691 33.333 0.00 0.00 43.36 0.98
4427 4646 8.091449 GTGCTTAGATGAGGTGCTAAGTATATT 58.909 37.037 0.00 0.00 43.36 1.28
4428 4647 7.310113 GGTGCTTAGATGAGGTGCTAAGTATAT 60.310 40.741 0.00 0.00 43.36 0.86
4429 4648 6.015350 GGTGCTTAGATGAGGTGCTAAGTATA 60.015 42.308 0.00 0.00 43.36 1.47
4430 4649 5.221541 GGTGCTTAGATGAGGTGCTAAGTAT 60.222 44.000 0.00 0.00 43.36 2.12
4431 4650 4.099573 GGTGCTTAGATGAGGTGCTAAGTA 59.900 45.833 0.00 0.00 43.36 2.24
4432 4651 3.118592 GGTGCTTAGATGAGGTGCTAAGT 60.119 47.826 0.00 0.00 43.36 2.24
4433 4652 3.133721 AGGTGCTTAGATGAGGTGCTAAG 59.866 47.826 0.00 0.00 43.95 2.18
4434 4653 3.107601 AGGTGCTTAGATGAGGTGCTAA 58.892 45.455 0.00 0.00 0.00 3.09
4435 4654 2.752030 AGGTGCTTAGATGAGGTGCTA 58.248 47.619 0.00 0.00 0.00 3.49
4436 4655 1.577736 AGGTGCTTAGATGAGGTGCT 58.422 50.000 0.00 0.00 0.00 4.40
4437 4656 2.409948 AAGGTGCTTAGATGAGGTGC 57.590 50.000 0.00 0.00 0.00 5.01
4450 4669 5.473039 AGACATCTTTTAATGCAAAGGTGC 58.527 37.500 8.69 3.24 45.35 5.01
4451 4670 6.680810 TGAGACATCTTTTAATGCAAAGGTG 58.319 36.000 7.44 7.44 46.41 4.00
4452 4671 6.899393 TGAGACATCTTTTAATGCAAAGGT 57.101 33.333 0.00 0.00 34.90 3.50
4453 4672 7.641411 CGTATGAGACATCTTTTAATGCAAAGG 59.359 37.037 0.00 0.00 34.90 3.11
4454 4673 7.164826 GCGTATGAGACATCTTTTAATGCAAAG 59.835 37.037 0.00 0.00 35.39 2.77
4455 4674 6.966632 GCGTATGAGACATCTTTTAATGCAAA 59.033 34.615 0.00 0.00 0.00 3.68
4456 4675 6.316140 AGCGTATGAGACATCTTTTAATGCAA 59.684 34.615 0.00 0.00 0.00 4.08
4457 4676 5.817296 AGCGTATGAGACATCTTTTAATGCA 59.183 36.000 0.00 0.00 0.00 3.96
4458 4677 6.292389 AGCGTATGAGACATCTTTTAATGC 57.708 37.500 0.00 0.00 0.00 3.56
4459 4678 6.630443 GCAAGCGTATGAGACATCTTTTAATG 59.370 38.462 0.00 0.00 0.00 1.90
4460 4679 6.540189 AGCAAGCGTATGAGACATCTTTTAAT 59.460 34.615 0.00 0.00 0.00 1.40
4461 4680 5.874810 AGCAAGCGTATGAGACATCTTTTAA 59.125 36.000 0.00 0.00 0.00 1.52
4462 4681 5.419542 AGCAAGCGTATGAGACATCTTTTA 58.580 37.500 0.00 0.00 0.00 1.52
4463 4682 4.256920 AGCAAGCGTATGAGACATCTTTT 58.743 39.130 0.00 0.00 0.00 2.27
4464 4683 3.866651 AGCAAGCGTATGAGACATCTTT 58.133 40.909 0.00 0.00 0.00 2.52
4465 4684 3.533606 AGCAAGCGTATGAGACATCTT 57.466 42.857 0.00 0.00 0.00 2.40
4466 4685 3.193263 CAAGCAAGCGTATGAGACATCT 58.807 45.455 0.00 0.00 0.00 2.90
4467 4686 2.286067 GCAAGCAAGCGTATGAGACATC 60.286 50.000 0.00 0.00 0.00 3.06
4468 4687 1.667724 GCAAGCAAGCGTATGAGACAT 59.332 47.619 0.00 0.00 0.00 3.06
4469 4688 1.078709 GCAAGCAAGCGTATGAGACA 58.921 50.000 0.00 0.00 0.00 3.41
4470 4689 1.061711 CTGCAAGCAAGCGTATGAGAC 59.938 52.381 0.00 0.00 37.31 3.36
4471 4690 1.362768 CTGCAAGCAAGCGTATGAGA 58.637 50.000 0.00 0.00 37.31 3.27
4472 4691 0.376152 CCTGCAAGCAAGCGTATGAG 59.624 55.000 0.00 0.00 37.31 2.90
4478 4697 2.359107 TCCTCCTGCAAGCAAGCG 60.359 61.111 0.00 0.00 37.31 4.68
4484 4713 1.202330 AGTCATCCTCCTCCTGCAAG 58.798 55.000 0.00 0.00 0.00 4.01
4506 4736 2.202610 CAGGAATCGTCGCAGCGA 60.203 61.111 15.11 15.11 45.32 4.93
4559 4872 2.420687 GGAAAGGTACTGGAGGAGCATG 60.421 54.545 0.00 0.00 40.86 4.06
4578 4891 2.281484 GGCAACACGCTTCCAGGA 60.281 61.111 0.00 0.00 41.91 3.86
4640 4953 0.901827 TGCGGACTCTATCCTTTGCA 59.098 50.000 0.00 0.00 46.69 4.08
4649 4962 3.094062 GCCCTGCATGCGGACTCTA 62.094 63.158 28.32 0.00 0.00 2.43
4758 5186 7.397192 AGTGCAAATTTTATCAAGGACATAGGT 59.603 33.333 0.00 0.00 0.00 3.08
4772 5200 9.555727 GTGGAGATATACCTAGTGCAAATTTTA 57.444 33.333 0.00 0.00 0.00 1.52
4778 5206 5.012046 CCATGTGGAGATATACCTAGTGCAA 59.988 44.000 0.00 0.00 37.39 4.08
4793 5224 1.283029 ACTTGATGGGTCCATGTGGAG 59.717 52.381 7.29 2.83 46.49 3.86
4832 5265 3.552875 TCAACCGTGACTAGCTAGCTAT 58.447 45.455 24.36 14.44 0.00 2.97
4835 5268 2.544069 GGATCAACCGTGACTAGCTAGC 60.544 54.545 20.91 6.62 36.31 3.42
4856 5290 4.181578 CCCCAACAGTTAGTTACTCGATG 58.818 47.826 0.00 0.00 38.74 3.84
4914 5348 0.106708 TCACCGCTGCAAACTTCTCT 59.893 50.000 0.00 0.00 0.00 3.10
4926 5360 1.414181 CCCTTCATGTCTATCACCGCT 59.586 52.381 0.00 0.00 0.00 5.52
4953 5387 2.807967 CCGGATGTCACAATTCGCATAT 59.192 45.455 0.00 0.00 0.00 1.78
5010 5444 4.530857 CCAAGGCGCTCCGGGTAG 62.531 72.222 7.64 0.00 37.47 3.18
5067 5501 1.680338 GGTACACCATCTTCCATGCC 58.320 55.000 0.00 0.00 35.64 4.40
5103 5537 4.021807 ACAAACACAAACTTCTTTCGGGTT 60.022 37.500 0.00 0.00 0.00 4.11
5128 5562 4.164988 CCTGGATTTGAGGTCCTTATCAGT 59.835 45.833 0.00 0.00 36.68 3.41
5259 5723 6.740681 GCATCTTCAGGTAGTGATCATGATCA 60.741 42.308 30.27 30.27 44.83 2.92
5260 5724 5.638657 GCATCTTCAGGTAGTGATCATGATC 59.361 44.000 25.91 25.91 34.17 2.92
5261 5725 5.071384 TGCATCTTCAGGTAGTGATCATGAT 59.929 40.000 8.25 8.25 34.17 2.45
5262 5726 4.406649 TGCATCTTCAGGTAGTGATCATGA 59.593 41.667 0.00 0.00 34.17 3.07
5263 5727 4.700700 TGCATCTTCAGGTAGTGATCATG 58.299 43.478 0.00 0.00 34.17 3.07
5264 5728 5.363562 TTGCATCTTCAGGTAGTGATCAT 57.636 39.130 0.00 0.00 34.17 2.45
5265 5729 4.824479 TTGCATCTTCAGGTAGTGATCA 57.176 40.909 0.00 0.00 34.17 2.92
5266 5730 7.041508 CCTTAATTGCATCTTCAGGTAGTGATC 60.042 40.741 0.00 0.00 34.17 2.92
5267 5731 6.769822 CCTTAATTGCATCTTCAGGTAGTGAT 59.230 38.462 0.00 0.00 34.17 3.06
5268 5732 6.115446 CCTTAATTGCATCTTCAGGTAGTGA 58.885 40.000 0.00 0.00 0.00 3.41
5269 5733 5.297776 CCCTTAATTGCATCTTCAGGTAGTG 59.702 44.000 8.26 0.00 0.00 2.74
5270 5734 5.044846 ACCCTTAATTGCATCTTCAGGTAGT 60.045 40.000 8.26 0.30 0.00 2.73
5271 5735 5.440610 ACCCTTAATTGCATCTTCAGGTAG 58.559 41.667 8.26 0.00 0.00 3.18
5272 5736 5.437060 GACCCTTAATTGCATCTTCAGGTA 58.563 41.667 8.26 0.00 0.00 3.08
5273 5737 4.273318 GACCCTTAATTGCATCTTCAGGT 58.727 43.478 8.26 3.20 0.00 4.00
5274 5738 3.633986 GGACCCTTAATTGCATCTTCAGG 59.366 47.826 0.00 0.00 0.00 3.86
5275 5739 4.096984 GTGGACCCTTAATTGCATCTTCAG 59.903 45.833 0.00 0.00 0.00 3.02
5276 5740 4.016444 GTGGACCCTTAATTGCATCTTCA 58.984 43.478 0.00 0.00 0.00 3.02
5277 5741 4.016444 TGTGGACCCTTAATTGCATCTTC 58.984 43.478 0.00 0.00 0.00 2.87
5278 5742 3.763897 GTGTGGACCCTTAATTGCATCTT 59.236 43.478 0.00 0.00 0.00 2.40
5279 5743 3.010584 AGTGTGGACCCTTAATTGCATCT 59.989 43.478 0.00 0.00 0.00 2.90
5280 5744 3.356290 AGTGTGGACCCTTAATTGCATC 58.644 45.455 0.00 0.00 0.00 3.91</