Multiple sequence alignment - TraesCS5B01G551600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G551600 chr5B 100.000 4913 0 0 1 4913 702761007 702756095 0.000000e+00 9073.0
1 TraesCS5B01G551600 chr5B 98.944 4922 43 1 1 4913 702628776 702623855 0.000000e+00 8793.0
2 TraesCS5B01G551600 chr5B 98.082 3493 52 6 1433 4913 702646494 702643005 0.000000e+00 6065.0
3 TraesCS5B01G551600 chr5B 98.002 2803 39 6 2123 4913 702797450 702794653 0.000000e+00 4850.0
4 TraesCS5B01G551600 chr5B 96.817 2765 57 6 1 2743 702742833 702740078 0.000000e+00 4590.0
5 TraesCS5B01G551600 chr5B 96.531 2767 61 10 1 2743 702610232 702607477 0.000000e+00 4545.0
6 TraesCS5B01G551600 chr5B 96.196 2182 68 5 2741 4908 702739997 702737817 0.000000e+00 3555.0
7 TraesCS5B01G551600 chr5B 97.151 1439 22 5 17 1437 702802281 702800844 0.000000e+00 2412.0
8 TraesCS5B01G551600 chr5B 96.987 1427 36 3 2741 4161 702607396 702605971 0.000000e+00 2390.0
9 TraesCS5B01G551600 chr5B 97.048 1423 24 5 33 1437 702650368 702648946 0.000000e+00 2379.0
10 TraesCS5B01G551600 chr5B 94.488 762 41 1 4148 4908 702605611 702604850 0.000000e+00 1173.0
11 TraesCS5B01G551600 chr5B 97.451 667 14 2 1429 2095 702798113 702797450 0.000000e+00 1134.0
12 TraesCS5B01G551600 chr5B 92.950 383 26 1 4532 4913 643258523 643258905 1.540000e-154 556.0
13 TraesCS5B01G551600 chr4A 82.000 1100 150 24 3085 4164 629120645 629121716 0.000000e+00 891.0
14 TraesCS5B01G551600 chr4A 88.372 301 27 3 933 1230 629110404 629110699 6.050000e-94 355.0
15 TraesCS5B01G551600 chr4A 86.154 195 20 5 2624 2813 92741144 92740952 2.320000e-48 204.0
16 TraesCS5B01G551600 chrUn 81.204 1096 154 25 3085 4160 351726217 351727280 0.000000e+00 835.0
17 TraesCS5B01G551600 chrUn 81.113 1096 155 25 3085 4160 224674195 224675258 0.000000e+00 830.0
18 TraesCS5B01G551600 chrUn 81.113 1096 155 25 3085 4160 351703717 351704780 0.000000e+00 830.0
19 TraesCS5B01G551600 chrUn 83.480 793 92 22 962 1733 224672279 224673053 0.000000e+00 702.0
20 TraesCS5B01G551600 chrUn 83.480 793 92 22 962 1733 340348349 340347575 0.000000e+00 702.0
21 TraesCS5B01G551600 chrUn 83.207 792 97 19 962 1733 327006572 327007347 0.000000e+00 693.0
22 TraesCS5B01G551600 chrUn 96.735 245 7 1 2741 2984 476503335 476503091 1.650000e-109 407.0
23 TraesCS5B01G551600 chrUn 91.892 259 21 0 2241 2499 224673458 224673716 3.610000e-96 363.0
24 TraesCS5B01G551600 chrUn 91.892 259 21 0 2241 2499 340347170 340346912 3.610000e-96 363.0
25 TraesCS5B01G551600 chrUn 91.892 259 21 0 2241 2499 351702980 351703238 3.610000e-96 363.0
26 TraesCS5B01G551600 chrUn 91.892 259 21 0 2241 2499 351725480 351725738 3.610000e-96 363.0
27 TraesCS5B01G551600 chrUn 84.507 355 51 2 1347 1700 110463034 110463385 1.010000e-91 348.0
28 TraesCS5B01G551600 chrUn 84.746 354 33 14 3085 3434 340346433 340346097 7.880000e-88 335.0
29 TraesCS5B01G551600 chrUn 83.486 218 29 5 2871 3083 224673855 224674070 3.880000e-46 196.0
30 TraesCS5B01G551600 chrUn 83.486 218 29 5 2871 3083 340346773 340346558 3.880000e-46 196.0
31 TraesCS5B01G551600 chrUn 83.486 218 29 5 2871 3083 351703377 351703592 3.880000e-46 196.0
32 TraesCS5B01G551600 chr1D 93.282 387 25 1 4527 4913 228065886 228065501 1.980000e-158 569.0
33 TraesCS5B01G551600 chr2D 92.408 382 29 0 4532 4913 460730454 460730835 3.340000e-151 545.0
34 TraesCS5B01G551600 chr2B 91.624 394 30 3 4520 4913 742420727 742421117 4.330000e-150 542.0
35 TraesCS5B01G551600 chr2B 83.516 91 15 0 245 335 776965105 776965015 8.760000e-13 86.1
36 TraesCS5B01G551600 chr5A 83.445 598 70 19 1360 1957 640400306 640400874 3.370000e-146 529.0
37 TraesCS5B01G551600 chr5A 91.617 167 13 1 2629 2795 320214408 320214243 3.830000e-56 230.0
38 TraesCS5B01G551600 chr5D 81.982 333 49 7 10 332 6647780 6648111 6.270000e-69 272.0
39 TraesCS5B01G551600 chr5D 78.028 355 45 11 8 331 5351023 5351375 5.020000e-45 193.0
40 TraesCS5B01G551600 chr3D 90.341 176 14 3 2629 2802 87926165 87925991 1.380000e-55 228.0
41 TraesCS5B01G551600 chr7B 90.000 170 16 1 2629 2798 711234321 711234153 8.280000e-53 219.0
42 TraesCS5B01G551600 chr7B 88.095 126 12 3 2537 2659 372327664 372327789 3.960000e-31 147.0
43 TraesCS5B01G551600 chr3B 78.830 359 45 14 8 335 501789269 501789627 3.850000e-51 213.0
44 TraesCS5B01G551600 chr6B 87.500 184 18 5 2629 2810 633056403 633056583 1.790000e-49 207.0
45 TraesCS5B01G551600 chr4D 81.028 253 36 9 2551 2796 328542753 328542506 1.810000e-44 191.0
46 TraesCS5B01G551600 chr4D 85.156 128 11 6 2514 2633 402553150 402553277 1.860000e-24 124.0
47 TraesCS5B01G551600 chr1B 84.663 163 25 0 8 170 640453301 640453139 3.930000e-36 163.0
48 TraesCS5B01G551600 chr7A 90.909 99 9 0 237 335 92811156 92811254 3.090000e-27 134.0
49 TraesCS5B01G551600 chr3A 91.000 100 6 3 2537 2633 739801278 739801377 1.110000e-26 132.0
50 TraesCS5B01G551600 chr7D 82.609 115 17 3 4086 4199 603787888 603788000 1.130000e-16 99.0
51 TraesCS5B01G551600 chr7D 90.000 70 6 1 4092 4161 582540023 582540091 6.770000e-14 89.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G551600 chr5B 702756095 702761007 4912 True 9073.000000 9073 100.000000 1 4913 1 chr5B.!!$R2 4912
1 TraesCS5B01G551600 chr5B 702623855 702628776 4921 True 8793.000000 8793 98.944000 1 4913 1 chr5B.!!$R1 4912
2 TraesCS5B01G551600 chr5B 702643005 702650368 7363 True 4222.000000 6065 97.565000 33 4913 2 chr5B.!!$R4 4880
3 TraesCS5B01G551600 chr5B 702737817 702742833 5016 True 4072.500000 4590 96.506500 1 4908 2 chr5B.!!$R5 4907
4 TraesCS5B01G551600 chr5B 702794653 702802281 7628 True 2798.666667 4850 97.534667 17 4913 3 chr5B.!!$R6 4896
5 TraesCS5B01G551600 chr5B 702604850 702610232 5382 True 2702.666667 4545 96.002000 1 4908 3 chr5B.!!$R3 4907
6 TraesCS5B01G551600 chr4A 629120645 629121716 1071 False 891.000000 891 82.000000 3085 4164 1 chr4A.!!$F2 1079
7 TraesCS5B01G551600 chrUn 327006572 327007347 775 False 693.000000 693 83.207000 962 1733 1 chrUn.!!$F2 771
8 TraesCS5B01G551600 chrUn 351725480 351727280 1800 False 599.000000 835 86.548000 2241 4160 2 chrUn.!!$F5 1919
9 TraesCS5B01G551600 chrUn 224672279 224675258 2979 False 522.750000 830 84.992750 962 4160 4 chrUn.!!$F3 3198
10 TraesCS5B01G551600 chrUn 351702980 351704780 1800 False 463.000000 830 85.497000 2241 4160 3 chrUn.!!$F4 1919
11 TraesCS5B01G551600 chrUn 340346097 340348349 2252 True 399.000000 702 85.901000 962 3434 4 chrUn.!!$R2 2472
12 TraesCS5B01G551600 chr5A 640400306 640400874 568 False 529.000000 529 83.445000 1360 1957 1 chr5A.!!$F1 597

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
273 284 0.512952 GCACGGCTTCTGTAAGTGTG 59.487 55.000 0.00 0.0 40.84 3.82 F
2080 4941 1.069668 ACCACTGTGTCCCTTCGTTAC 59.930 52.381 7.08 0.0 0.00 2.50 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2184 5045 5.935206 GGATATTAGCTCTTTACTGAAGGCC 59.065 44.000 0.0 0.0 35.98 5.19 R
3971 7106 1.374125 CAAGCCATCGTCGTGTCCA 60.374 57.895 0.0 0.0 0.00 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
273 284 0.512952 GCACGGCTTCTGTAAGTGTG 59.487 55.000 0.00 0.00 40.84 3.82
306 317 3.081409 CCCCTCGACCCACGGAAT 61.081 66.667 0.00 0.00 42.82 3.01
410 421 2.679642 CAAATCCGCCAGGCCCAA 60.680 61.111 5.63 0.00 37.47 4.12
430 441 4.445162 CCAATGCTAGGGTTCGGGTTAATA 60.445 45.833 0.00 0.00 0.00 0.98
614 625 3.199946 CCCTAGGATCAAGGCAGTAACAA 59.800 47.826 11.48 0.00 32.34 2.83
1571 4370 1.518572 CGTCCGTAGATGCGCCTTT 60.519 57.895 4.18 0.00 0.00 3.11
2080 4941 1.069668 ACCACTGTGTCCCTTCGTTAC 59.930 52.381 7.08 0.00 0.00 2.50
2182 5043 6.238925 GGGCATGTATAAAATGACCCAACTAC 60.239 42.308 9.57 0.00 46.13 2.73
2184 5045 7.417612 GCATGTATAAAATGACCCAACTACTG 58.582 38.462 0.00 0.00 0.00 2.74
2859 5822 4.495422 ACTAATGCTTGTAGACCAACGAG 58.505 43.478 0.00 0.00 34.47 4.18
3677 6811 3.311966 GGCAGATTTTGTCAAGCTGTTC 58.688 45.455 11.42 4.35 32.65 3.18
3971 7106 8.051535 ACTTCTCAACCATGTTATGATTCAGAT 58.948 33.333 0.00 0.00 0.00 2.90
4413 7936 4.020307 GTGACCATCAACCATTTCCCATTT 60.020 41.667 0.00 0.00 0.00 2.32
4820 8344 2.646175 GCACTCACCGAGGCTACCA 61.646 63.158 0.00 0.00 33.35 3.25
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
273 284 2.265904 GGGTTTGCGGAGTGGAACC 61.266 63.158 0.00 0.0 40.58 3.62
327 338 1.384643 CCCCTTCTTCTCCCGGGAT 60.385 63.158 27.07 0.0 39.08 3.85
410 421 4.595781 TCATATTAACCCGAACCCTAGCAT 59.404 41.667 0.00 0.0 0.00 3.79
430 441 9.451002 CAAGAGATATATGATGCCTTTCTTCAT 57.549 33.333 0.00 0.0 41.03 2.57
2080 4941 9.390795 CTCAAAATATATGAAGCCTGATTTTCG 57.609 33.333 0.00 0.0 0.00 3.46
2184 5045 5.935206 GGATATTAGCTCTTTACTGAAGGCC 59.065 44.000 0.00 0.0 35.98 5.19
2194 5055 7.548075 TCTTTTCGAAACGGATATTAGCTCTTT 59.452 33.333 10.79 0.0 0.00 2.52
2859 5822 4.640789 TTTCAGGATCTCGCTACTTCTC 57.359 45.455 0.00 0.0 0.00 2.87
3677 6811 7.011828 CAAAATATGGAGGGTAAGTGTTACG 57.988 40.000 0.00 0.0 37.00 3.18
3971 7106 1.374125 CAAGCCATCGTCGTGTCCA 60.374 57.895 0.00 0.0 0.00 4.02
4071 7221 7.717436 TCAACAAACAGAGTATGTAACATGGAA 59.283 33.333 0.00 0.0 43.00 3.53
4413 7936 6.039270 CAGATTCATAGATTGGCCGGTTTTTA 59.961 38.462 1.90 0.0 0.00 1.52
4820 8344 1.985662 TTAGGTGGATGACGGCGGT 60.986 57.895 13.24 0.0 0.00 5.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.