Multiple sequence alignment - TraesCS5B01G551400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G551400 chr5B 100.000 4913 0 0 1 4913 702628767 702623855 0.000000e+00 9073
1 TraesCS5B01G551400 chr5B 98.942 4913 43 1 1 4913 702760998 702756095 0.000000e+00 8776
2 TraesCS5B01G551400 chr5B 98.254 3493 46 6 1433 4913 702646494 702643005 0.000000e+00 6098
3 TraesCS5B01G551400 chr5B 98.073 2803 37 6 2123 4913 702797450 702794653 0.000000e+00 4861
4 TraesCS5B01G551400 chr5B 97.205 2755 55 5 2 2743 702742823 702740078 0.000000e+00 4641
5 TraesCS5B01G551400 chr5B 96.954 2758 58 9 1 2743 702610223 702607477 0.000000e+00 4604
6 TraesCS5B01G551400 chr5B 96.296 2187 66 5 2741 4913 702739997 702737812 0.000000e+00 3576
7 TraesCS5B01G551400 chr5B 97.915 1439 20 3 8 1437 702802281 702800844 0.000000e+00 2483
8 TraesCS5B01G551400 chr5B 97.751 1423 23 2 24 1437 702650368 702648946 0.000000e+00 2442
9 TraesCS5B01G551400 chr5B 97.267 1427 32 3 2741 4161 702607396 702605971 0.000000e+00 2412
10 TraesCS5B01G551400 chr5B 94.263 767 43 1 4148 4913 702605611 702604845 0.000000e+00 1171
11 TraesCS5B01G551400 chr5B 97.601 667 13 2 1429 2095 702798113 702797450 0.000000e+00 1140
12 TraesCS5B01G551400 chr5B 93.473 383 24 1 4532 4913 643258523 643258905 7.140000e-158 568
13 TraesCS5B01G551400 chr5B 83.495 206 28 6 2623 2826 607838561 607838360 2.330000e-43 187
14 TraesCS5B01G551400 chr5B 78.906 256 50 4 1 253 407775447 407775193 2.350000e-38 171
15 TraesCS5B01G551400 chr4A 82.273 1100 147 24 3085 4164 629120645 629121716 0.000000e+00 907
16 TraesCS5B01G551400 chr4A 88.372 301 27 3 933 1230 629110404 629110699 6.050000e-94 355
17 TraesCS5B01G551400 chr4A 84.615 195 23 5 2624 2813 92741144 92740952 2.330000e-43 187
18 TraesCS5B01G551400 chrUn 81.569 1096 150 25 3085 4160 351726217 351727280 0.000000e+00 857
19 TraesCS5B01G551400 chrUn 81.478 1096 151 25 3085 4160 224674195 224675258 0.000000e+00 852
20 TraesCS5B01G551400 chrUn 81.478 1096 151 30 3085 4160 351703717 351704780 0.000000e+00 852
21 TraesCS5B01G551400 chrUn 84.643 827 100 18 3141 3951 110464836 110465651 0.000000e+00 798
22 TraesCS5B01G551400 chrUn 83.607 793 91 22 962 1733 224672279 224673053 0.000000e+00 708
23 TraesCS5B01G551400 chrUn 83.607 793 91 22 962 1733 340348349 340347575 0.000000e+00 708
24 TraesCS5B01G551400 chrUn 83.333 792 96 19 962 1733 327006572 327007347 0.000000e+00 699
25 TraesCS5B01G551400 chrUn 97.551 245 5 1 2741 2984 476503335 476503091 7.610000e-113 418
26 TraesCS5B01G551400 chrUn 91.506 259 22 0 2241 2499 224673458 224673716 1.680000e-94 357
27 TraesCS5B01G551400 chrUn 91.506 259 22 0 2241 2499 340347170 340346912 1.680000e-94 357
28 TraesCS5B01G551400 chrUn 91.506 259 22 0 2241 2499 351702980 351703238 1.680000e-94 357
29 TraesCS5B01G551400 chrUn 91.506 259 22 0 2241 2499 351725480 351725738 1.680000e-94 357
30 TraesCS5B01G551400 chrUn 84.789 355 50 2 1347 1700 110463034 110463385 2.180000e-93 353
31 TraesCS5B01G551400 chrUn 84.746 354 33 14 3085 3434 340346433 340346097 7.880000e-88 335
32 TraesCS5B01G551400 chrUn 83.486 218 29 5 2871 3083 224673855 224674070 3.880000e-46 196
33 TraesCS5B01G551400 chrUn 83.486 218 29 5 2871 3083 340346773 340346558 3.880000e-46 196
34 TraesCS5B01G551400 chrUn 83.486 218 29 5 2871 3083 351703377 351703592 3.880000e-46 196
35 TraesCS5B01G551400 chr1D 93.540 387 24 1 4527 4913 228065886 228065501 4.270000e-160 575
36 TraesCS5B01G551400 chr3B 91.560 391 32 1 4523 4913 444843007 444842618 5.600000e-149 538
37 TraesCS5B01G551400 chr2B 91.371 394 31 3 4520 4913 742420727 742421117 2.010000e-148 536
38 TraesCS5B01G551400 chr5A 83.445 598 70 19 1360 1957 640400306 640400874 3.370000e-146 529
39 TraesCS5B01G551400 chr5A 89.820 167 16 1 2629 2795 320214408 320214243 3.850000e-51 213
40 TraesCS5B01G551400 chr5D 82.583 333 56 2 1 332 6647780 6648111 4.810000e-75 292
41 TraesCS5B01G551400 chr5D 78.187 353 53 8 1 331 5351025 5351375 2.320000e-48 204
42 TraesCS5B01G551400 chr4B 79.817 327 64 2 2 327 509279345 509279020 2.290000e-58 237
43 TraesCS5B01G551400 chr3D 88.636 176 17 3 2629 2802 87926165 87925991 1.390000e-50 211
44 TraesCS5B01G551400 chr7B 88.235 170 19 1 2629 2798 711234321 711234153 8.340000e-48 202
45 TraesCS5B01G551400 chr7B 88.095 126 12 3 2537 2659 372327664 372327789 3.960000e-31 147
46 TraesCS5B01G551400 chr4D 79.842 253 39 9 2551 2796 328542753 328542506 1.820000e-39 174
47 TraesCS5B01G551400 chr4D 85.156 128 11 6 2514 2633 402553150 402553277 1.860000e-24 124
48 TraesCS5B01G551400 chr4D 88.298 94 11 0 242 335 147558166 147558259 4.020000e-21 113
49 TraesCS5B01G551400 chr7A 92.929 99 7 0 237 335 92811156 92811254 1.430000e-30 145
50 TraesCS5B01G551400 chr3A 91.000 100 6 3 2537 2633 739801278 739801377 1.110000e-26 132


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G551400 chr5B 702623855 702628767 4912 True 9073.000000 9073 100.000000 1 4913 1 chr5B.!!$R3 4912
1 TraesCS5B01G551400 chr5B 702756095 702760998 4903 True 8776.000000 8776 98.942000 1 4913 1 chr5B.!!$R4 4912
2 TraesCS5B01G551400 chr5B 702643005 702650368 7363 True 4270.000000 6098 98.002500 24 4913 2 chr5B.!!$R6 4889
3 TraesCS5B01G551400 chr5B 702737812 702742823 5011 True 4108.500000 4641 96.750500 2 4913 2 chr5B.!!$R7 4911
4 TraesCS5B01G551400 chr5B 702794653 702802281 7628 True 2828.000000 4861 97.863000 8 4913 3 chr5B.!!$R8 4905
5 TraesCS5B01G551400 chr5B 702604845 702610223 5378 True 2729.000000 4604 96.161333 1 4913 3 chr5B.!!$R5 4912
6 TraesCS5B01G551400 chr4A 629120645 629121716 1071 False 907.000000 907 82.273000 3085 4164 1 chr4A.!!$F2 1079
7 TraesCS5B01G551400 chrUn 327006572 327007347 775 False 699.000000 699 83.333000 962 1733 1 chrUn.!!$F1 771
8 TraesCS5B01G551400 chrUn 351725480 351727280 1800 False 607.000000 857 86.537500 2241 4160 2 chrUn.!!$F5 1919
9 TraesCS5B01G551400 chrUn 110463034 110465651 2617 False 575.500000 798 84.716000 1347 3951 2 chrUn.!!$F2 2604
10 TraesCS5B01G551400 chrUn 224672279 224675258 2979 False 528.250000 852 85.019250 962 4160 4 chrUn.!!$F3 3198
11 TraesCS5B01G551400 chrUn 351702980 351704780 1800 False 468.333333 852 85.490000 2241 4160 3 chrUn.!!$F4 1919
12 TraesCS5B01G551400 chrUn 340346097 340348349 2252 True 399.000000 708 85.836250 962 3434 4 chrUn.!!$R2 2472
13 TraesCS5B01G551400 chr5A 640400306 640400874 568 False 529.000000 529 83.445000 1360 1957 1 chr5A.!!$F1 597

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
273 283 1.226746 GCACGGCTTCTGTAAGTGTT 58.773 50.00 0.00 0.0 34.99 3.32 F
1942 4828 5.736951 TTTCCCTGGGACAACATTTTATG 57.263 39.13 16.85 0.0 38.70 1.90 F
2287 5431 1.714794 ATGTGCAGAAGACAGTACGC 58.285 50.00 0.00 0.0 0.00 4.42 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1942 4828 5.458041 AATTTGTATACCTGCATGCATCC 57.542 39.130 22.97 6.17 0.00 3.51 R
3728 7201 1.615392 AGCAACAATCTTTCAGGTGCC 59.385 47.619 0.00 0.00 0.00 5.01 R
4141 7635 9.726232 CCTATTCATCATTGTGATACAAACAAG 57.274 33.333 0.00 0.00 41.96 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
50 51 2.433145 AGCAGTGCATCGTCGGTG 60.433 61.111 19.20 0.0 0.00 4.94
88 89 4.698056 GCTGCTTTTCGGCATAGC 57.302 55.556 0.00 0.0 46.35 2.97
161 162 1.461127 CTTTGCTCGCTAACTGTGTCC 59.539 52.381 0.00 0.0 0.00 4.02
273 283 1.226746 GCACGGCTTCTGTAAGTGTT 58.773 50.000 0.00 0.0 34.99 3.32
1942 4828 5.736951 TTTCCCTGGGACAACATTTTATG 57.263 39.130 16.85 0.0 38.70 1.90
2287 5431 1.714794 ATGTGCAGAAGACAGTACGC 58.285 50.000 0.00 0.0 0.00 4.42
3728 7201 3.370978 CGGAGTATAGGTGTGTGCTTTTG 59.629 47.826 0.00 0.0 0.00 2.44
4409 8276 2.158559 TGTGACCATCAACCATTTCCG 58.841 47.619 0.00 0.0 0.00 4.30
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
50 51 3.714001 GGTTCCACGGGGGTCTCC 61.714 72.222 2.42 0.00 38.11 3.71
88 89 2.888594 CATTGGGTAGTGTCGTACCAG 58.111 52.381 2.62 0.00 43.97 4.00
161 162 2.178890 GCGGAATGAGGAGCAGCTG 61.179 63.158 10.11 10.11 0.00 4.24
273 283 1.527380 GGGTTTGCGGAGTGGAACA 60.527 57.895 0.00 0.00 41.43 3.18
1942 4828 5.458041 AATTTGTATACCTGCATGCATCC 57.542 39.130 22.97 6.17 0.00 3.51
2224 5366 7.912250 CGCAAGCATATCAGATCTTAACTTTTT 59.088 33.333 0.00 0.00 0.00 1.94
2287 5431 0.456221 ACCTCTCTGCCAACGTATCG 59.544 55.000 0.00 0.00 0.00 2.92
3573 7046 5.450412 GCTTTGACTCATCCTGTGTTTTCAA 60.450 40.000 0.00 0.00 0.00 2.69
3728 7201 1.615392 AGCAACAATCTTTCAGGTGCC 59.385 47.619 0.00 0.00 0.00 5.01
4141 7635 9.726232 CCTATTCATCATTGTGATACAAACAAG 57.274 33.333 0.00 0.00 41.96 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.