Multiple sequence alignment - TraesCS5B01G550800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G550800 chr5B 100.000 9150 0 0 1 9150 702367274 702376423 0.000000e+00 16897.0
1 TraesCS5B01G550800 chr5B 91.159 328 28 1 3691 4017 595333486 595333159 2.340000e-120 444.0
2 TraesCS5B01G550800 chr5B 90.506 316 27 3 3690 4004 233240222 233240535 1.840000e-111 414.0
3 TraesCS5B01G550800 chr5B 82.288 271 19 5 1 248 480244133 480244397 3.350000e-49 207.0
4 TraesCS5B01G550800 chr5B 74.300 393 71 16 4398 4767 39716672 39716287 1.240000e-28 139.0
5 TraesCS5B01G550800 chr5B 77.778 180 32 5 4206 4378 702422612 702422434 4.520000e-18 104.0
6 TraesCS5B01G550800 chr5B 80.882 136 20 4 4247 4379 700332251 700332119 1.630000e-17 102.0
7 TraesCS5B01G550800 chr5B 84.536 97 14 1 255 350 92216813 92216717 2.720000e-15 95.3
8 TraesCS5B01G550800 chr5B 82.075 106 12 5 249 353 369472629 369472728 5.890000e-12 84.2
9 TraesCS5B01G550800 chr5B 83.333 90 13 2 250 338 700669673 700669761 2.120000e-11 82.4
10 TraesCS5B01G550800 chr5B 81.915 94 17 0 4275 4368 700327578 700327485 7.620000e-11 80.5
11 TraesCS5B01G550800 chr5B 78.992 119 20 4 5171 5287 702415186 702415071 9.850000e-10 76.8
12 TraesCS5B01G550800 chr5B 100.000 35 0 0 6821 6855 702374019 702374053 2.130000e-06 65.8
13 TraesCS5B01G550800 chr5B 100.000 35 0 0 6746 6780 702374094 702374128 2.130000e-06 65.8
14 TraesCS5B01G550800 chr5B 82.857 70 12 0 4310 4379 692480941 692481010 7.670000e-06 63.9
15 TraesCS5B01G550800 chr5B 96.774 31 1 0 4047 4077 62943726 62943696 1.700000e-02 52.8
16 TraesCS5B01G550800 chr4A 79.651 1032 129 40 983 2006 617459100 617458142 0.000000e+00 667.0
17 TraesCS5B01G550800 chr4A 93.902 410 8 6 4381 4776 662109746 662109340 3.660000e-168 603.0
18 TraesCS5B01G550800 chr4A 92.424 330 23 2 3690 4019 740627182 740626855 3.870000e-128 470.0
19 TraesCS5B01G550800 chr4A 76.444 900 156 33 4901 5753 617452712 617451822 3.920000e-118 436.0
20 TraesCS5B01G550800 chr4A 80.492 610 71 22 988 1580 617421337 617421915 3.050000e-114 424.0
21 TraesCS5B01G550800 chr4A 88.158 152 15 2 983 1134 617471777 617471629 2.630000e-40 178.0
22 TraesCS5B01G550800 chr4A 88.435 147 14 2 983 1129 617459661 617459518 3.400000e-39 174.0
23 TraesCS5B01G550800 chr4A 88.435 147 14 2 983 1129 617460222 617460079 3.400000e-39 174.0
24 TraesCS5B01G550800 chr4A 88.435 147 14 2 983 1129 617460783 617460640 3.400000e-39 174.0
25 TraesCS5B01G550800 chr4A 88.435 147 14 2 983 1129 617461344 617461201 3.400000e-39 174.0
26 TraesCS5B01G550800 chr4A 92.500 120 9 0 9031 9150 617446381 617446262 1.220000e-38 172.0
27 TraesCS5B01G550800 chr4A 87.500 152 16 2 983 1134 617467520 617467372 1.220000e-38 172.0
28 TraesCS5B01G550800 chr4A 81.600 125 20 3 4247 4368 620190676 620190552 5.850000e-17 100.0
29 TraesCS5B01G550800 chr2D 96.314 407 3 6 4383 4780 645455226 645455629 0.000000e+00 658.0
30 TraesCS5B01G550800 chr2D 95.652 46 2 0 303 348 172390558 172390603 3.540000e-09 75.0
31 TraesCS5B01G550800 chr2D 86.364 66 8 1 498 562 598236933 598236998 4.580000e-08 71.3
32 TraesCS5B01G550800 chr6B 94.272 419 5 6 4375 4780 696855453 696855865 2.810000e-174 623.0
33 TraesCS5B01G550800 chr6B 93.888 409 9 6 4385 4780 706478383 706477978 3.660000e-168 603.0
34 TraesCS5B01G550800 chr6B 90.172 407 25 6 4385 4780 149602527 149602125 4.900000e-142 516.0
35 TraesCS5B01G550800 chr6B 92.093 215 2 4 4384 4591 696853093 696852887 1.160000e-73 289.0
36 TraesCS5B01G550800 chr2A 93.659 410 8 6 4385 4782 559827280 559826877 1.700000e-166 597.0
37 TraesCS5B01G550800 chr2A 89.426 331 32 3 3691 4019 715213868 715214197 1.840000e-111 414.0
38 TraesCS5B01G550800 chr2A 100.000 28 0 0 4047 4074 39592427 39592454 1.700000e-02 52.8
39 TraesCS5B01G550800 chr2B 92.654 422 3 6 4383 4780 715304687 715305104 4.760000e-162 582.0
40 TraesCS5B01G550800 chr2B 85.000 100 14 1 250 348 13368037 13367938 5.850000e-17 100.0
41 TraesCS5B01G550800 chr2B 96.970 33 1 0 4047 4079 703802402 703802434 1.000000e-03 56.5
42 TraesCS5B01G550800 chr5A 91.344 439 10 10 4373 4786 680049123 680048688 7.970000e-160 575.0
43 TraesCS5B01G550800 chr5A 75.000 396 69 15 4398 4767 680048707 680049098 1.230000e-33 156.0
44 TraesCS5B01G550800 chr5A 86.408 103 13 1 249 350 471460322 471460424 2.700000e-20 111.0
45 TraesCS5B01G550800 chr5A 84.848 99 9 5 368 461 103746165 103746068 2.720000e-15 95.3
46 TraesCS5B01G550800 chr5A 86.076 79 11 0 508 586 245522743 245522821 1.640000e-12 86.1
47 TraesCS5B01G550800 chr5A 93.750 48 3 0 515 562 689612914 689612961 1.270000e-08 73.1
48 TraesCS5B01G550800 chr5D 92.402 408 9 9 4385 4780 473042043 473041646 6.200000e-156 562.0
49 TraesCS5B01G550800 chr5D 94.578 332 17 1 3689 4019 399291337 399291668 6.340000e-141 512.0
50 TraesCS5B01G550800 chr5D 77.979 386 55 14 4398 4767 473041659 473042030 2.000000e-51 215.0
51 TraesCS5B01G550800 chr5D 93.333 105 7 0 9046 9150 550205938 550205834 1.230000e-33 156.0
52 TraesCS5B01G550800 chr5D 80.282 142 22 6 4241 4379 522035481 522035619 1.630000e-17 102.0
53 TraesCS5B01G550800 chr5D 85.135 74 8 3 492 565 558845288 558845358 1.270000e-08 73.1
54 TraesCS5B01G550800 chr7B 91.509 424 5 8 4383 4781 614915349 614914932 1.040000e-153 555.0
55 TraesCS5B01G550800 chr7B 89.489 333 32 3 3686 4017 509011159 509010829 1.420000e-112 418.0
56 TraesCS5B01G550800 chr7B 88.583 254 22 6 1 252 537665954 537666202 1.490000e-77 302.0
57 TraesCS5B01G550800 chr7B 76.590 393 63 15 4398 4767 672987435 672987821 1.210000e-43 189.0
58 TraesCS5B01G550800 chr7B 76.336 393 66 13 4398 4767 614914946 614915334 1.570000e-42 185.0
59 TraesCS5B01G550800 chr7B 80.693 202 32 5 4178 4373 718976728 718976528 5.720000e-32 150.0
60 TraesCS5B01G550800 chrUn 90.172 407 25 6 4385 4780 314347175 314347577 4.900000e-142 516.0
61 TraesCS5B01G550800 chrUn 88.435 147 14 2 983 1129 470693936 470693793 3.400000e-39 174.0
62 TraesCS5B01G550800 chr1A 90.000 410 24 6 4385 4782 550661198 550660794 1.760000e-141 514.0
63 TraesCS5B01G550800 chr1A 81.579 114 18 3 245 357 522186345 522186234 3.520000e-14 91.6
64 TraesCS5B01G550800 chr4B 94.529 329 17 1 3690 4018 387439583 387439256 2.950000e-139 507.0
65 TraesCS5B01G550800 chr4B 91.200 375 4 11 4382 4733 5410668 5410300 4.970000e-132 483.0
66 TraesCS5B01G550800 chr4B 89.113 248 24 2 1 248 481635661 481635417 1.150000e-78 305.0
67 TraesCS5B01G550800 chr1D 93.030 330 22 1 3691 4019 37209391 37209720 1.790000e-131 481.0
68 TraesCS5B01G550800 chr1D 90.244 82 6 2 352 432 378289412 378289332 1.260000e-18 106.0
69 TraesCS5B01G550800 chr7D 92.424 330 25 0 3690 4019 4173374 4173703 1.080000e-128 472.0
70 TraesCS5B01G550800 chr7D 81.522 184 18 12 249 428 167098454 167098625 4.460000e-28 137.0
71 TraesCS5B01G550800 chr7D 84.211 95 11 4 373 463 54992205 54992111 1.270000e-13 89.8
72 TraesCS5B01G550800 chr3D 89.062 128 11 2 77 201 586471099 586471226 1.230000e-33 156.0
73 TraesCS5B01G550800 chr6D 74.495 396 58 16 4398 4767 331180604 331180982 2.070000e-26 132.0
74 TraesCS5B01G550800 chr7A 84.298 121 11 7 346 461 27235428 27235311 2.700000e-20 111.0
75 TraesCS5B01G550800 chr7A 100.000 29 0 0 4047 4075 577778324 577778296 5.000000e-03 54.7
76 TraesCS5B01G550800 chr1B 90.123 81 5 3 352 431 506176419 506176341 1.630000e-17 102.0
77 TraesCS5B01G550800 chr1B 86.170 94 9 4 346 437 392432679 392432770 2.100000e-16 99.0
78 TraesCS5B01G550800 chr1B 89.189 74 8 0 508 581 548612623 548612550 9.780000e-15 93.5
79 TraesCS5B01G550800 chr6A 83.178 107 9 6 361 461 96601719 96601822 1.270000e-13 89.8
80 TraesCS5B01G550800 chr6A 84.946 93 7 7 381 467 377700191 377700282 4.550000e-13 87.9
81 TraesCS5B01G550800 chr6A 100.000 28 0 0 4047 4074 97299493 97299466 1.700000e-02 52.8
82 TraesCS5B01G550800 chr3A 82.353 102 17 1 249 349 534201070 534201171 4.550000e-13 87.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G550800 chr5B 702367274 702376423 9149 False 5676.2 16897 100.0000 1 9150 3 chr5B.!!$F6 9149
1 TraesCS5B01G550800 chr4A 617451822 617452712 890 True 436.0 436 76.4440 4901 5753 1 chr4A.!!$R2 852
2 TraesCS5B01G550800 chr4A 617421337 617421915 578 False 424.0 424 80.4920 988 1580 1 chr4A.!!$F1 592
3 TraesCS5B01G550800 chr4A 617458142 617461344 3202 True 272.6 667 86.6782 983 2006 5 chr4A.!!$R8 1023


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
754 755 0.035176 GGCTACCAAACACACCCGTA 59.965 55.0 0.00 0.00 0.00 4.02 F
1861 4119 0.096454 GGCAACCGTCGTAATGAAGC 59.904 55.0 0.00 0.00 0.00 3.86 F
2272 4530 0.036010 AGGACGGTTGATGAGCTTGG 60.036 55.0 0.00 0.00 0.00 3.61 F
2273 4531 0.036388 GGACGGTTGATGAGCTTGGA 60.036 55.0 0.00 0.00 0.00 3.53 F
3840 6098 0.035152 TCCGCATGGAGCAAAGTCAT 60.035 50.0 0.00 0.00 46.13 3.06 F
4771 7029 0.038599 TACACCCGAGAGTAGCCACA 59.961 55.0 0.00 0.00 0.00 4.17 F
4818 7076 0.033601 TTGTGGTTCAGGTGTTGGCT 60.034 50.0 0.00 0.00 0.00 4.75 F
6335 8636 0.036164 TTGTGTTCCACTGCGCCTAT 59.964 50.0 4.18 0.00 35.11 2.57 F
6908 9209 0.029167 GAGGCTTCTCTACGGCGTAC 59.971 60.0 16.97 5.06 34.77 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1923 4181 0.032952 CAACCACCGGACTCTCGAAA 59.967 55.0 9.46 0.00 0.00 3.46 R
2831 5089 0.032130 GACGTGCCTTCACAGACAGA 59.968 55.0 0.00 0.00 43.28 3.41 R
3821 6079 0.035152 ATGACTTTGCTCCATGCGGA 60.035 50.0 0.00 0.00 46.63 5.54 R
3919 6177 0.178767 CAAGAGATGATGGGTGCCGA 59.821 55.0 0.00 0.00 0.00 5.54 R
4799 7057 0.033601 AGCCAACACCTGAACCACAA 60.034 50.0 0.00 0.00 0.00 3.33 R
6765 9066 0.033504 AGTCCACACGTAGCTTGGTG 59.966 55.0 13.47 13.47 39.98 4.17 R
6767 9068 0.317160 TGAGTCCACACGTAGCTTGG 59.683 55.0 0.00 0.00 0.00 3.61 R
7971 10272 0.035534 TCCATAGTGTTGCGCCACAT 60.036 50.0 18.04 9.29 37.82 3.21 R
8668 10969 0.032952 GGTACTGTCGTCTGTTGCCA 59.967 55.0 0.00 0.00 0.00 4.92 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 7.966246 ATTTGTTACATTTTGTGTGCATGAT 57.034 28.000 0.00 0.00 42.24 2.45
25 26 7.783090 TTTGTTACATTTTGTGTGCATGATT 57.217 28.000 0.00 0.00 42.24 2.57
26 27 7.783090 TTGTTACATTTTGTGTGCATGATTT 57.217 28.000 0.00 0.00 42.24 2.17
27 28 7.783090 TGTTACATTTTGTGTGCATGATTTT 57.217 28.000 0.00 0.00 42.24 1.82
28 29 8.206325 TGTTACATTTTGTGTGCATGATTTTT 57.794 26.923 0.00 0.00 42.24 1.94
29 30 8.333908 TGTTACATTTTGTGTGCATGATTTTTC 58.666 29.630 0.00 0.00 42.24 2.29
30 31 6.303021 ACATTTTGTGTGCATGATTTTTCC 57.697 33.333 0.00 0.00 40.28 3.13
31 32 5.239087 ACATTTTGTGTGCATGATTTTTCCC 59.761 36.000 0.00 0.00 40.28 3.97
32 33 2.721274 TGTGTGCATGATTTTTCCCG 57.279 45.000 0.00 0.00 0.00 5.14
33 34 1.336702 TGTGTGCATGATTTTTCCCGC 60.337 47.619 0.00 0.00 0.00 6.13
34 35 0.964700 TGTGCATGATTTTTCCCGCA 59.035 45.000 0.00 0.00 0.00 5.69
35 36 1.067706 TGTGCATGATTTTTCCCGCAG 60.068 47.619 0.00 0.00 0.00 5.18
36 37 0.108709 TGCATGATTTTTCCCGCAGC 60.109 50.000 0.00 0.00 0.00 5.25
37 38 0.174162 GCATGATTTTTCCCGCAGCT 59.826 50.000 0.00 0.00 0.00 4.24
38 39 1.405105 GCATGATTTTTCCCGCAGCTA 59.595 47.619 0.00 0.00 0.00 3.32
39 40 2.159254 GCATGATTTTTCCCGCAGCTAA 60.159 45.455 0.00 0.00 0.00 3.09
40 41 3.675775 GCATGATTTTTCCCGCAGCTAAA 60.676 43.478 0.00 0.00 0.00 1.85
41 42 3.848272 TGATTTTTCCCGCAGCTAAAG 57.152 42.857 0.00 0.00 0.00 1.85
42 43 2.491693 TGATTTTTCCCGCAGCTAAAGG 59.508 45.455 0.00 0.00 0.00 3.11
43 44 2.279935 TTTTTCCCGCAGCTAAAGGA 57.720 45.000 3.16 0.00 0.00 3.36
44 45 2.507407 TTTTCCCGCAGCTAAAGGAT 57.493 45.000 3.16 0.00 0.00 3.24
45 46 3.637911 TTTTCCCGCAGCTAAAGGATA 57.362 42.857 3.16 0.00 0.00 2.59
46 47 3.637911 TTTCCCGCAGCTAAAGGATAA 57.362 42.857 3.16 0.00 0.00 1.75
47 48 3.857157 TTCCCGCAGCTAAAGGATAAT 57.143 42.857 3.16 0.00 0.00 1.28
48 49 3.126001 TCCCGCAGCTAAAGGATAATG 57.874 47.619 3.16 0.00 0.00 1.90
49 50 2.703536 TCCCGCAGCTAAAGGATAATGA 59.296 45.455 3.16 0.00 0.00 2.57
50 51 2.808543 CCCGCAGCTAAAGGATAATGAC 59.191 50.000 3.16 0.00 0.00 3.06
51 52 2.476619 CCGCAGCTAAAGGATAATGACG 59.523 50.000 0.00 0.00 0.00 4.35
52 53 2.096713 CGCAGCTAAAGGATAATGACGC 60.097 50.000 0.00 0.00 0.00 5.19
53 54 2.224314 GCAGCTAAAGGATAATGACGCC 59.776 50.000 0.00 0.00 0.00 5.68
54 55 3.466836 CAGCTAAAGGATAATGACGCCA 58.533 45.455 0.00 0.00 0.00 5.69
55 56 4.067896 CAGCTAAAGGATAATGACGCCAT 58.932 43.478 0.00 0.00 33.66 4.40
56 57 4.067896 AGCTAAAGGATAATGACGCCATG 58.932 43.478 0.00 0.00 32.36 3.66
57 58 3.365364 GCTAAAGGATAATGACGCCATGC 60.365 47.826 0.00 0.00 32.36 4.06
58 59 1.609208 AAGGATAATGACGCCATGCC 58.391 50.000 0.00 0.00 32.36 4.40
59 60 0.603707 AGGATAATGACGCCATGCCG 60.604 55.000 0.00 0.00 32.36 5.69
60 61 0.884704 GGATAATGACGCCATGCCGT 60.885 55.000 0.00 0.00 45.30 5.68
61 62 0.235665 GATAATGACGCCATGCCGTG 59.764 55.000 6.40 0.00 42.24 4.94
62 63 0.463654 ATAATGACGCCATGCCGTGT 60.464 50.000 6.40 0.00 42.24 4.49
63 64 0.675208 TAATGACGCCATGCCGTGTT 60.675 50.000 6.40 4.06 42.24 3.32
64 65 1.523154 AATGACGCCATGCCGTGTTT 61.523 50.000 6.40 0.00 42.24 2.83
65 66 2.126888 GACGCCATGCCGTGTTTG 60.127 61.111 6.40 0.00 42.24 2.93
66 67 2.903547 GACGCCATGCCGTGTTTGT 61.904 57.895 6.40 0.00 42.24 2.83
67 68 2.428902 CGCCATGCCGTGTTTGTG 60.429 61.111 0.00 0.00 0.00 3.33
68 69 2.049248 GCCATGCCGTGTTTGTGG 60.049 61.111 0.00 0.00 0.00 4.17
74 75 4.347096 CCGTGTTTGTGGCTACGA 57.653 55.556 0.00 0.00 38.72 3.43
75 76 2.607457 CCGTGTTTGTGGCTACGAA 58.393 52.632 0.00 0.00 38.72 3.85
76 77 0.938713 CCGTGTTTGTGGCTACGAAA 59.061 50.000 4.19 0.00 38.72 3.46
77 78 1.331138 CCGTGTTTGTGGCTACGAAAA 59.669 47.619 4.19 0.00 38.72 2.29
78 79 2.223294 CCGTGTTTGTGGCTACGAAAAA 60.223 45.455 4.19 0.00 38.72 1.94
117 118 9.178427 GCATAGTAGATGATCTTCAATTTTTGC 57.822 33.333 0.00 8.40 0.00 3.68
118 119 9.674824 CATAGTAGATGATCTTCAATTTTTGCC 57.325 33.333 0.00 0.00 0.00 4.52
119 120 7.707624 AGTAGATGATCTTCAATTTTTGCCA 57.292 32.000 0.00 0.00 0.00 4.92
120 121 8.302515 AGTAGATGATCTTCAATTTTTGCCAT 57.697 30.769 0.00 0.00 0.00 4.40
121 122 8.755977 AGTAGATGATCTTCAATTTTTGCCATT 58.244 29.630 0.00 0.00 0.00 3.16
122 123 9.374838 GTAGATGATCTTCAATTTTTGCCATTT 57.625 29.630 0.00 0.00 0.00 2.32
123 124 8.488651 AGATGATCTTCAATTTTTGCCATTTC 57.511 30.769 10.90 0.00 0.00 2.17
124 125 8.319146 AGATGATCTTCAATTTTTGCCATTTCT 58.681 29.630 10.90 0.00 0.00 2.52
125 126 8.857694 ATGATCTTCAATTTTTGCCATTTCTT 57.142 26.923 0.00 0.00 0.00 2.52
126 127 8.680039 TGATCTTCAATTTTTGCCATTTCTTT 57.320 26.923 0.00 0.00 0.00 2.52
127 128 9.775854 TGATCTTCAATTTTTGCCATTTCTTTA 57.224 25.926 0.00 0.00 0.00 1.85
130 131 8.558700 TCTTCAATTTTTGCCATTTCTTTAAGC 58.441 29.630 0.00 0.00 0.00 3.09
131 132 8.449251 TTCAATTTTTGCCATTTCTTTAAGCT 57.551 26.923 0.00 0.00 0.00 3.74
132 133 9.553064 TTCAATTTTTGCCATTTCTTTAAGCTA 57.447 25.926 0.00 0.00 0.00 3.32
133 134 9.723601 TCAATTTTTGCCATTTCTTTAAGCTAT 57.276 25.926 0.00 0.00 0.00 2.97
139 140 9.651913 TTTGCCATTTCTTTAAGCTATTTTAGG 57.348 29.630 0.00 0.00 0.00 2.69
140 141 8.361169 TGCCATTTCTTTAAGCTATTTTAGGT 57.639 30.769 0.00 0.00 38.32 3.08
141 142 9.469097 TGCCATTTCTTTAAGCTATTTTAGGTA 57.531 29.630 0.00 0.00 35.05 3.08
151 152 7.497925 AAGCTATTTTAGGTATTGCTACTGC 57.502 36.000 0.00 0.00 33.91 4.40
152 153 5.696724 AGCTATTTTAGGTATTGCTACTGCG 59.303 40.000 0.00 0.00 37.02 5.18
153 154 5.694910 GCTATTTTAGGTATTGCTACTGCGA 59.305 40.000 0.00 0.00 43.34 5.10
154 155 6.369065 GCTATTTTAGGTATTGCTACTGCGAT 59.631 38.462 0.00 0.00 44.82 4.58
155 156 7.544566 GCTATTTTAGGTATTGCTACTGCGATA 59.455 37.037 0.00 0.00 42.81 2.92
156 157 7.891183 ATTTTAGGTATTGCTACTGCGATAG 57.109 36.000 0.00 0.00 43.87 2.08
157 158 3.944055 AGGTATTGCTACTGCGATAGG 57.056 47.619 0.00 0.00 43.87 2.57
158 159 3.497332 AGGTATTGCTACTGCGATAGGA 58.503 45.455 0.00 0.00 43.87 2.94
159 160 3.895656 AGGTATTGCTACTGCGATAGGAA 59.104 43.478 3.92 3.92 43.87 3.36
160 161 4.344102 AGGTATTGCTACTGCGATAGGAAA 59.656 41.667 5.32 0.00 43.87 3.13
161 162 5.054477 GGTATTGCTACTGCGATAGGAAAA 58.946 41.667 5.32 0.00 43.87 2.29
162 163 5.701290 GGTATTGCTACTGCGATAGGAAAAT 59.299 40.000 5.32 0.00 43.87 1.82
163 164 6.204882 GGTATTGCTACTGCGATAGGAAAATT 59.795 38.462 5.32 0.00 43.87 1.82
164 165 5.484173 TTGCTACTGCGATAGGAAAATTG 57.516 39.130 0.00 0.00 43.34 2.32
165 166 3.312421 TGCTACTGCGATAGGAAAATTGC 59.688 43.478 0.00 0.00 43.34 3.56
166 167 3.561725 GCTACTGCGATAGGAAAATTGCT 59.438 43.478 0.00 0.00 37.20 3.91
167 168 4.319118 GCTACTGCGATAGGAAAATTGCTC 60.319 45.833 0.00 0.00 37.20 4.26
168 169 3.878778 ACTGCGATAGGAAAATTGCTCT 58.121 40.909 0.00 0.00 37.20 4.09
169 170 4.265073 ACTGCGATAGGAAAATTGCTCTT 58.735 39.130 0.00 0.00 37.20 2.85
170 171 4.095483 ACTGCGATAGGAAAATTGCTCTTG 59.905 41.667 0.00 0.00 37.20 3.02
171 172 3.181497 TGCGATAGGAAAATTGCTCTTGC 60.181 43.478 5.64 5.64 37.20 4.01
172 173 3.065925 GCGATAGGAAAATTGCTCTTGCT 59.934 43.478 5.41 0.00 40.48 3.91
173 174 4.273480 GCGATAGGAAAATTGCTCTTGCTA 59.727 41.667 5.41 0.00 40.48 3.49
174 175 5.049129 GCGATAGGAAAATTGCTCTTGCTAT 60.049 40.000 2.37 2.37 38.45 2.97
175 176 6.369005 CGATAGGAAAATTGCTCTTGCTATG 58.631 40.000 6.41 0.00 36.62 2.23
176 177 6.017605 CGATAGGAAAATTGCTCTTGCTATGT 60.018 38.462 6.41 0.00 36.62 2.29
177 178 5.320549 AGGAAAATTGCTCTTGCTATGTG 57.679 39.130 0.00 0.00 40.48 3.21
178 179 5.012239 AGGAAAATTGCTCTTGCTATGTGA 58.988 37.500 0.00 0.00 40.48 3.58
179 180 5.477984 AGGAAAATTGCTCTTGCTATGTGAA 59.522 36.000 0.00 0.00 40.48 3.18
180 181 5.574443 GGAAAATTGCTCTTGCTATGTGAAC 59.426 40.000 0.00 0.00 40.48 3.18
181 182 5.710513 AAATTGCTCTTGCTATGTGAACA 57.289 34.783 0.00 0.00 40.48 3.18
182 183 5.909621 AATTGCTCTTGCTATGTGAACAT 57.090 34.783 0.95 0.95 40.48 2.71
183 184 5.909621 ATTGCTCTTGCTATGTGAACATT 57.090 34.783 0.47 0.00 40.48 2.71
184 185 5.710513 TTGCTCTTGCTATGTGAACATTT 57.289 34.783 0.47 0.00 40.48 2.32
185 186 5.710513 TGCTCTTGCTATGTGAACATTTT 57.289 34.783 0.47 0.00 40.48 1.82
186 187 6.816134 TGCTCTTGCTATGTGAACATTTTA 57.184 33.333 0.47 0.00 40.48 1.52
187 188 6.845302 TGCTCTTGCTATGTGAACATTTTAG 58.155 36.000 0.47 0.00 40.48 1.85
188 189 6.654582 TGCTCTTGCTATGTGAACATTTTAGA 59.345 34.615 0.47 0.51 40.48 2.10
189 190 7.337689 TGCTCTTGCTATGTGAACATTTTAGAT 59.662 33.333 0.47 0.00 40.48 1.98
190 191 8.830580 GCTCTTGCTATGTGAACATTTTAGATA 58.169 33.333 0.47 0.00 37.76 1.98
200 201 9.460019 TGTGAACATTTTAGATATCACATTGGA 57.540 29.630 5.32 0.00 41.39 3.53
227 228 5.982465 AAAACATTGAACACCCAATTTCG 57.018 34.783 0.00 0.00 34.77 3.46
228 229 4.927978 AACATTGAACACCCAATTTCGA 57.072 36.364 0.00 0.00 34.77 3.71
229 230 4.927978 ACATTGAACACCCAATTTCGAA 57.072 36.364 0.00 0.00 34.77 3.71
230 231 5.269505 ACATTGAACACCCAATTTCGAAA 57.730 34.783 13.91 13.91 34.77 3.46
231 232 5.852827 ACATTGAACACCCAATTTCGAAAT 58.147 33.333 17.60 17.60 34.77 2.17
232 233 5.925969 ACATTGAACACCCAATTTCGAAATC 59.074 36.000 22.93 9.98 34.77 2.17
233 234 4.513198 TGAACACCCAATTTCGAAATCC 57.487 40.909 22.93 6.67 0.00 3.01
234 235 4.148838 TGAACACCCAATTTCGAAATCCT 58.851 39.130 22.93 6.55 0.00 3.24
235 236 4.022416 TGAACACCCAATTTCGAAATCCTG 60.022 41.667 22.93 17.61 0.00 3.86
236 237 2.825532 ACACCCAATTTCGAAATCCTGG 59.174 45.455 25.26 25.26 0.00 4.45
237 238 3.088532 CACCCAATTTCGAAATCCTGGA 58.911 45.455 30.43 0.00 31.04 3.86
238 239 3.701040 CACCCAATTTCGAAATCCTGGAT 59.299 43.478 30.43 18.99 31.04 3.41
239 240 3.954258 ACCCAATTTCGAAATCCTGGATC 59.046 43.478 30.43 0.00 31.04 3.36
240 241 3.319122 CCCAATTTCGAAATCCTGGATCC 59.681 47.826 30.43 4.20 31.04 3.36
241 242 3.003689 CCAATTTCGAAATCCTGGATCCG 59.996 47.826 27.02 19.22 31.04 4.18
242 243 1.663695 TTTCGAAATCCTGGATCCGC 58.336 50.000 20.01 9.05 0.00 5.54
243 244 0.179056 TTCGAAATCCTGGATCCGCC 60.179 55.000 20.01 6.91 37.10 6.13
244 245 1.146041 CGAAATCCTGGATCCGCCA 59.854 57.895 10.14 0.00 46.96 5.69
245 246 1.160329 CGAAATCCTGGATCCGCCAC 61.160 60.000 10.14 0.00 43.33 5.01
246 247 0.181350 GAAATCCTGGATCCGCCACT 59.819 55.000 10.14 0.00 43.33 4.00
247 248 0.107017 AAATCCTGGATCCGCCACTG 60.107 55.000 10.14 0.00 43.33 3.66
248 249 2.615227 AATCCTGGATCCGCCACTGC 62.615 60.000 10.14 0.00 43.33 4.40
249 250 4.100084 CCTGGATCCGCCACTGCA 62.100 66.667 7.39 0.00 43.33 4.41
250 251 2.046023 CTGGATCCGCCACTGCAA 60.046 61.111 7.39 0.00 43.33 4.08
251 252 2.359850 TGGATCCGCCACTGCAAC 60.360 61.111 7.39 0.00 43.33 4.17
252 253 3.134127 GGATCCGCCACTGCAACC 61.134 66.667 0.00 0.00 37.32 3.77
253 254 2.359850 GATCCGCCACTGCAACCA 60.360 61.111 0.00 0.00 37.32 3.67
254 255 2.360350 ATCCGCCACTGCAACCAG 60.360 61.111 0.00 0.00 44.80 4.00
273 274 4.760530 CAGTGGTTGGATGATTAGGAGA 57.239 45.455 0.00 0.00 0.00 3.71
274 275 4.446371 CAGTGGTTGGATGATTAGGAGAC 58.554 47.826 0.00 0.00 0.00 3.36
275 276 3.456277 AGTGGTTGGATGATTAGGAGACC 59.544 47.826 0.00 0.00 0.00 3.85
276 277 3.199946 GTGGTTGGATGATTAGGAGACCA 59.800 47.826 0.00 0.00 33.84 4.02
277 278 3.455910 TGGTTGGATGATTAGGAGACCAG 59.544 47.826 0.00 0.00 32.57 4.00
278 279 3.456277 GGTTGGATGATTAGGAGACCAGT 59.544 47.826 0.00 0.00 0.00 4.00
279 280 4.446371 GTTGGATGATTAGGAGACCAGTG 58.554 47.826 0.00 0.00 0.00 3.66
280 281 3.041211 TGGATGATTAGGAGACCAGTGG 58.959 50.000 7.91 7.91 0.00 4.00
281 282 3.041946 GGATGATTAGGAGACCAGTGGT 58.958 50.000 16.70 16.70 39.44 4.16
282 283 4.223953 GGATGATTAGGAGACCAGTGGTA 58.776 47.826 16.72 0.00 35.25 3.25
283 284 4.841246 GGATGATTAGGAGACCAGTGGTAT 59.159 45.833 16.72 13.26 35.25 2.73
284 285 5.046950 GGATGATTAGGAGACCAGTGGTATC 60.047 48.000 25.82 25.82 42.55 2.24
290 291 1.410882 GAGACCAGTGGTATCCTCAGC 59.589 57.143 23.87 5.50 37.91 4.26
291 292 0.466124 GACCAGTGGTATCCTCAGCC 59.534 60.000 16.72 0.00 35.25 4.85
292 293 0.983378 ACCAGTGGTATCCTCAGCCC 60.983 60.000 14.87 0.00 32.11 5.19
293 294 0.982852 CCAGTGGTATCCTCAGCCCA 60.983 60.000 0.00 0.00 0.00 5.36
294 295 0.179000 CAGTGGTATCCTCAGCCCAC 59.821 60.000 0.00 0.00 46.17 4.61
295 296 1.144057 GTGGTATCCTCAGCCCACG 59.856 63.158 0.00 0.00 38.14 4.94
296 297 1.001120 TGGTATCCTCAGCCCACGA 59.999 57.895 0.00 0.00 0.00 4.35
297 298 1.043116 TGGTATCCTCAGCCCACGAG 61.043 60.000 0.00 0.00 0.00 4.18
305 306 2.756400 AGCCCACGAGGATGCAAA 59.244 55.556 0.00 0.00 38.24 3.68
306 307 1.304282 AGCCCACGAGGATGCAAAT 59.696 52.632 0.00 0.00 38.24 2.32
307 308 0.749454 AGCCCACGAGGATGCAAATC 60.749 55.000 0.00 0.00 38.24 2.17
308 309 1.728490 GCCCACGAGGATGCAAATCC 61.728 60.000 0.00 0.00 41.02 3.01
315 316 2.892025 GGATGCAAATCCTGGTGCT 58.108 52.632 8.92 0.00 41.48 4.40
316 317 0.743097 GGATGCAAATCCTGGTGCTC 59.257 55.000 8.92 4.67 41.48 4.26
317 318 0.379669 GATGCAAATCCTGGTGCTCG 59.620 55.000 8.92 0.00 41.48 5.03
318 319 1.660560 ATGCAAATCCTGGTGCTCGC 61.661 55.000 8.92 1.14 41.48 5.03
319 320 2.334946 GCAAATCCTGGTGCTCGCA 61.335 57.895 0.85 0.00 37.78 5.10
320 321 1.660560 GCAAATCCTGGTGCTCGCAT 61.661 55.000 0.00 0.00 37.78 4.73
321 322 0.813184 CAAATCCTGGTGCTCGCATT 59.187 50.000 0.00 0.00 0.00 3.56
322 323 2.016318 CAAATCCTGGTGCTCGCATTA 58.984 47.619 0.00 0.00 0.00 1.90
323 324 2.620115 CAAATCCTGGTGCTCGCATTAT 59.380 45.455 0.00 0.00 0.00 1.28
324 325 2.645838 ATCCTGGTGCTCGCATTATT 57.354 45.000 0.00 0.00 0.00 1.40
325 326 1.953559 TCCTGGTGCTCGCATTATTC 58.046 50.000 0.00 0.00 0.00 1.75
326 327 0.947244 CCTGGTGCTCGCATTATTCC 59.053 55.000 0.00 0.00 0.00 3.01
327 328 1.475751 CCTGGTGCTCGCATTATTCCT 60.476 52.381 0.00 0.00 0.00 3.36
328 329 2.292267 CTGGTGCTCGCATTATTCCTT 58.708 47.619 0.00 0.00 0.00 3.36
329 330 2.016318 TGGTGCTCGCATTATTCCTTG 58.984 47.619 0.00 0.00 0.00 3.61
330 331 2.288666 GGTGCTCGCATTATTCCTTGA 58.711 47.619 0.00 0.00 0.00 3.02
331 332 2.880890 GGTGCTCGCATTATTCCTTGAT 59.119 45.455 0.00 0.00 0.00 2.57
332 333 3.316308 GGTGCTCGCATTATTCCTTGATT 59.684 43.478 0.00 0.00 0.00 2.57
333 334 4.202050 GGTGCTCGCATTATTCCTTGATTT 60.202 41.667 0.00 0.00 0.00 2.17
334 335 5.008613 GGTGCTCGCATTATTCCTTGATTTA 59.991 40.000 0.00 0.00 0.00 1.40
335 336 6.294176 GGTGCTCGCATTATTCCTTGATTTAT 60.294 38.462 0.00 0.00 0.00 1.40
336 337 7.141363 GTGCTCGCATTATTCCTTGATTTATT 58.859 34.615 0.00 0.00 0.00 1.40
337 338 7.649306 GTGCTCGCATTATTCCTTGATTTATTT 59.351 33.333 0.00 0.00 0.00 1.40
338 339 8.196771 TGCTCGCATTATTCCTTGATTTATTTT 58.803 29.630 0.00 0.00 0.00 1.82
339 340 9.677567 GCTCGCATTATTCCTTGATTTATTTTA 57.322 29.630 0.00 0.00 0.00 1.52
348 349 8.677148 TTCCTTGATTTATTTTAGGATCTCCG 57.323 34.615 0.00 0.00 42.08 4.63
349 350 7.224297 TCCTTGATTTATTTTAGGATCTCCGG 58.776 38.462 0.00 0.00 42.08 5.14
350 351 6.998673 CCTTGATTTATTTTAGGATCTCCGGT 59.001 38.462 0.00 0.00 42.08 5.28
351 352 7.041098 CCTTGATTTATTTTAGGATCTCCGGTG 60.041 40.741 0.00 0.00 42.08 4.94
352 353 7.131907 TGATTTATTTTAGGATCTCCGGTGA 57.868 36.000 8.96 8.96 42.08 4.02
353 354 6.990349 TGATTTATTTTAGGATCTCCGGTGAC 59.010 38.462 8.68 3.16 42.08 3.67
354 355 6.555463 TTTATTTTAGGATCTCCGGTGACT 57.445 37.500 8.68 5.15 42.08 3.41
355 356 7.664552 TTTATTTTAGGATCTCCGGTGACTA 57.335 36.000 8.68 4.14 42.08 2.59
356 357 4.996788 TTTTAGGATCTCCGGTGACTAC 57.003 45.455 8.68 2.22 42.08 2.73
357 358 3.657398 TTAGGATCTCCGGTGACTACA 57.343 47.619 8.68 0.00 42.08 2.74
358 359 2.526888 AGGATCTCCGGTGACTACAA 57.473 50.000 8.68 0.00 42.08 2.41
359 360 2.379972 AGGATCTCCGGTGACTACAAG 58.620 52.381 8.68 0.00 42.08 3.16
360 361 1.409427 GGATCTCCGGTGACTACAAGG 59.591 57.143 8.68 0.00 0.00 3.61
361 362 0.824759 ATCTCCGGTGACTACAAGGC 59.175 55.000 8.68 0.00 0.00 4.35
362 363 1.218316 CTCCGGTGACTACAAGGCC 59.782 63.158 0.00 0.00 0.00 5.19
363 364 1.229082 TCCGGTGACTACAAGGCCT 60.229 57.895 0.00 0.00 0.00 5.19
364 365 0.834687 TCCGGTGACTACAAGGCCTT 60.835 55.000 13.78 13.78 0.00 4.35
365 366 0.391263 CCGGTGACTACAAGGCCTTC 60.391 60.000 17.29 4.43 0.00 3.46
366 367 0.736325 CGGTGACTACAAGGCCTTCG 60.736 60.000 17.29 13.93 0.00 3.79
367 368 0.320697 GGTGACTACAAGGCCTTCGT 59.679 55.000 17.29 18.96 0.00 3.85
368 369 1.429463 GTGACTACAAGGCCTTCGTG 58.571 55.000 17.29 8.43 0.00 4.35
369 370 1.000506 GTGACTACAAGGCCTTCGTGA 59.999 52.381 17.29 4.51 0.00 4.35
370 371 1.899814 TGACTACAAGGCCTTCGTGAT 59.100 47.619 17.29 9.83 0.00 3.06
371 372 2.271800 GACTACAAGGCCTTCGTGATG 58.728 52.381 17.29 6.68 0.00 3.07
372 373 1.899814 ACTACAAGGCCTTCGTGATGA 59.100 47.619 17.29 1.92 0.00 2.92
373 374 2.271800 CTACAAGGCCTTCGTGATGAC 58.728 52.381 17.29 0.00 0.00 3.06
374 375 0.687354 ACAAGGCCTTCGTGATGACT 59.313 50.000 17.29 0.00 0.00 3.41
375 376 1.072331 ACAAGGCCTTCGTGATGACTT 59.928 47.619 17.29 0.00 0.00 3.01
376 377 1.734465 CAAGGCCTTCGTGATGACTTC 59.266 52.381 17.29 0.00 0.00 3.01
377 378 0.250513 AGGCCTTCGTGATGACTTCC 59.749 55.000 0.00 0.00 0.00 3.46
378 379 0.250513 GGCCTTCGTGATGACTTCCT 59.749 55.000 0.00 0.00 0.00 3.36
379 380 1.646189 GCCTTCGTGATGACTTCCTC 58.354 55.000 0.00 0.00 0.00 3.71
380 381 1.066858 GCCTTCGTGATGACTTCCTCA 60.067 52.381 0.00 0.00 0.00 3.86
381 382 2.612972 GCCTTCGTGATGACTTCCTCAA 60.613 50.000 0.00 0.00 30.60 3.02
382 383 3.866651 CCTTCGTGATGACTTCCTCAAT 58.133 45.455 0.00 0.00 30.60 2.57
383 384 3.868077 CCTTCGTGATGACTTCCTCAATC 59.132 47.826 0.00 0.00 30.60 2.67
384 385 4.382470 CCTTCGTGATGACTTCCTCAATCT 60.382 45.833 0.00 0.00 30.60 2.40
385 386 4.377839 TCGTGATGACTTCCTCAATCTC 57.622 45.455 0.00 0.00 30.60 2.75
386 387 3.763897 TCGTGATGACTTCCTCAATCTCA 59.236 43.478 0.00 0.00 30.60 3.27
387 388 4.220602 TCGTGATGACTTCCTCAATCTCAA 59.779 41.667 0.00 0.00 30.60 3.02
388 389 4.565962 CGTGATGACTTCCTCAATCTCAAG 59.434 45.833 0.00 0.00 30.60 3.02
389 390 5.623141 CGTGATGACTTCCTCAATCTCAAGA 60.623 44.000 0.00 0.00 30.60 3.02
390 391 6.347696 GTGATGACTTCCTCAATCTCAAGAT 58.652 40.000 0.00 0.00 36.07 2.40
391 392 6.258287 GTGATGACTTCCTCAATCTCAAGATG 59.742 42.308 0.00 0.00 34.49 2.90
392 393 6.155737 TGATGACTTCCTCAATCTCAAGATGA 59.844 38.462 0.00 0.00 34.49 2.92
393 394 6.556974 TGACTTCCTCAATCTCAAGATGAT 57.443 37.500 0.00 0.00 34.49 2.45
394 395 7.666063 TGACTTCCTCAATCTCAAGATGATA 57.334 36.000 0.00 0.00 34.49 2.15
395 396 8.260099 TGACTTCCTCAATCTCAAGATGATAT 57.740 34.615 0.00 0.00 34.49 1.63
396 397 9.372189 TGACTTCCTCAATCTCAAGATGATATA 57.628 33.333 0.00 0.00 34.49 0.86
399 400 9.518906 CTTCCTCAATCTCAAGATGATATATCG 57.481 37.037 8.19 0.00 34.49 2.92
400 401 8.005192 TCCTCAATCTCAAGATGATATATCGG 57.995 38.462 8.19 0.00 34.49 4.18
401 402 6.700960 CCTCAATCTCAAGATGATATATCGGC 59.299 42.308 8.19 2.79 34.49 5.54
402 403 7.415592 TCAATCTCAAGATGATATATCGGCT 57.584 36.000 8.19 4.99 34.49 5.52
403 404 7.487484 TCAATCTCAAGATGATATATCGGCTC 58.513 38.462 8.19 5.21 34.49 4.70
404 405 7.123247 TCAATCTCAAGATGATATATCGGCTCA 59.877 37.037 8.19 0.00 34.49 4.26
405 406 6.448207 TCTCAAGATGATATATCGGCTCAG 57.552 41.667 8.19 7.42 0.00 3.35
406 407 5.948758 TCTCAAGATGATATATCGGCTCAGT 59.051 40.000 8.19 0.00 0.00 3.41
407 408 6.094742 TCTCAAGATGATATATCGGCTCAGTC 59.905 42.308 8.19 0.00 0.00 3.51
408 409 5.948758 TCAAGATGATATATCGGCTCAGTCT 59.051 40.000 8.19 1.02 0.00 3.24
409 410 6.094742 TCAAGATGATATATCGGCTCAGTCTC 59.905 42.308 8.19 0.00 0.00 3.36
410 411 5.754782 AGATGATATATCGGCTCAGTCTCT 58.245 41.667 8.19 0.00 0.00 3.10
411 412 5.822519 AGATGATATATCGGCTCAGTCTCTC 59.177 44.000 8.19 0.00 0.00 3.20
412 413 3.935828 TGATATATCGGCTCAGTCTCTCG 59.064 47.826 8.19 0.00 0.00 4.04
413 414 2.552599 ATATCGGCTCAGTCTCTCGA 57.447 50.000 0.00 0.00 0.00 4.04
414 415 2.327200 TATCGGCTCAGTCTCTCGAA 57.673 50.000 0.00 0.00 33.53 3.71
415 416 1.021202 ATCGGCTCAGTCTCTCGAAG 58.979 55.000 0.00 0.00 33.53 3.79
416 417 0.036294 TCGGCTCAGTCTCTCGAAGA 60.036 55.000 0.00 0.00 0.00 2.87
417 418 1.021202 CGGCTCAGTCTCTCGAAGAT 58.979 55.000 0.00 0.00 36.11 2.40
418 419 1.268488 CGGCTCAGTCTCTCGAAGATG 60.268 57.143 0.00 0.00 36.11 2.90
419 420 1.535860 GGCTCAGTCTCTCGAAGATGC 60.536 57.143 0.00 0.00 36.11 3.91
420 421 1.405105 GCTCAGTCTCTCGAAGATGCT 59.595 52.381 0.00 0.00 36.11 3.79
421 422 2.541588 GCTCAGTCTCTCGAAGATGCTC 60.542 54.545 0.00 0.00 36.11 4.26
422 423 2.682352 CTCAGTCTCTCGAAGATGCTCA 59.318 50.000 0.00 0.00 36.11 4.26
423 424 3.286353 TCAGTCTCTCGAAGATGCTCAT 58.714 45.455 0.00 0.00 36.11 2.90
424 425 4.455606 TCAGTCTCTCGAAGATGCTCATA 58.544 43.478 0.00 0.00 36.11 2.15
425 426 4.514816 TCAGTCTCTCGAAGATGCTCATAG 59.485 45.833 0.00 0.00 36.11 2.23
426 427 3.820467 AGTCTCTCGAAGATGCTCATAGG 59.180 47.826 0.00 0.00 36.11 2.57
427 428 3.057596 GTCTCTCGAAGATGCTCATAGGG 60.058 52.174 0.00 0.00 36.11 3.53
428 429 3.153130 CTCTCGAAGATGCTCATAGGGA 58.847 50.000 0.00 0.00 33.89 4.20
429 430 3.763360 CTCTCGAAGATGCTCATAGGGAT 59.237 47.826 0.00 0.00 33.89 3.85
430 431 4.923415 TCTCGAAGATGCTCATAGGGATA 58.077 43.478 0.00 0.00 33.89 2.59
431 432 4.946772 TCTCGAAGATGCTCATAGGGATAG 59.053 45.833 0.00 0.00 33.89 2.08
432 433 4.923415 TCGAAGATGCTCATAGGGATAGA 58.077 43.478 0.00 0.00 0.00 1.98
433 434 4.946772 TCGAAGATGCTCATAGGGATAGAG 59.053 45.833 0.00 0.00 0.00 2.43
434 435 4.704540 CGAAGATGCTCATAGGGATAGAGT 59.295 45.833 0.00 0.00 0.00 3.24
435 436 5.163663 CGAAGATGCTCATAGGGATAGAGTC 60.164 48.000 0.00 0.00 0.00 3.36
436 437 5.534914 AGATGCTCATAGGGATAGAGTCT 57.465 43.478 0.00 0.00 0.00 3.24
437 438 6.650622 AGATGCTCATAGGGATAGAGTCTA 57.349 41.667 1.45 1.45 0.00 2.59
438 439 6.423182 AGATGCTCATAGGGATAGAGTCTAC 58.577 44.000 0.85 0.00 0.00 2.59
439 440 5.851808 TGCTCATAGGGATAGAGTCTACT 57.148 43.478 0.85 0.00 0.00 2.57
440 441 6.207509 TGCTCATAGGGATAGAGTCTACTT 57.792 41.667 0.85 0.00 0.00 2.24
441 442 6.007076 TGCTCATAGGGATAGAGTCTACTTG 58.993 44.000 0.85 0.00 0.00 3.16
442 443 6.007703 GCTCATAGGGATAGAGTCTACTTGT 58.992 44.000 0.85 0.00 0.00 3.16
443 444 6.492087 GCTCATAGGGATAGAGTCTACTTGTT 59.508 42.308 0.85 0.00 0.00 2.83
444 445 7.308951 GCTCATAGGGATAGAGTCTACTTGTTC 60.309 44.444 0.85 0.00 0.00 3.18
445 446 7.583625 TCATAGGGATAGAGTCTACTTGTTCA 58.416 38.462 0.85 0.00 0.00 3.18
446 447 8.228206 TCATAGGGATAGAGTCTACTTGTTCAT 58.772 37.037 0.85 0.00 0.00 2.57
447 448 9.521841 CATAGGGATAGAGTCTACTTGTTCATA 57.478 37.037 0.85 0.00 0.00 2.15
448 449 9.747898 ATAGGGATAGAGTCTACTTGTTCATAG 57.252 37.037 0.85 0.00 0.00 2.23
449 450 7.817440 AGGGATAGAGTCTACTTGTTCATAGA 58.183 38.462 0.85 0.00 0.00 1.98
450 451 8.282982 AGGGATAGAGTCTACTTGTTCATAGAA 58.717 37.037 0.85 0.00 0.00 2.10
451 452 8.915036 GGGATAGAGTCTACTTGTTCATAGAAA 58.085 37.037 0.85 0.00 0.00 2.52
456 457 9.030452 AGAGTCTACTTGTTCATAGAAATGAGT 57.970 33.333 0.00 0.00 42.97 3.41
457 458 8.994429 AGTCTACTTGTTCATAGAAATGAGTG 57.006 34.615 0.00 0.00 42.97 3.51
458 459 8.589338 AGTCTACTTGTTCATAGAAATGAGTGT 58.411 33.333 0.00 0.00 42.97 3.55
459 460 9.856488 GTCTACTTGTTCATAGAAATGAGTGTA 57.144 33.333 0.00 0.00 42.97 2.90
463 464 9.601217 ACTTGTTCATAGAAATGAGTGTATACC 57.399 33.333 0.00 0.00 42.97 2.73
464 465 9.599866 CTTGTTCATAGAAATGAGTGTATACCA 57.400 33.333 0.00 0.00 42.97 3.25
465 466 9.952030 TTGTTCATAGAAATGAGTGTATACCAA 57.048 29.630 0.00 0.00 42.97 3.67
466 467 9.599866 TGTTCATAGAAATGAGTGTATACCAAG 57.400 33.333 0.00 0.00 42.97 3.61
467 468 9.817809 GTTCATAGAAATGAGTGTATACCAAGA 57.182 33.333 0.00 0.00 42.97 3.02
495 496 9.651913 AAAAATAATGCACTACACAAAATAGGG 57.348 29.630 0.00 0.00 0.00 3.53
496 497 7.954666 AATAATGCACTACACAAAATAGGGT 57.045 32.000 0.00 0.00 0.00 4.34
497 498 5.897377 AATGCACTACACAAAATAGGGTC 57.103 39.130 0.00 0.00 0.00 4.46
498 499 3.331150 TGCACTACACAAAATAGGGTCG 58.669 45.455 0.00 0.00 0.00 4.79
499 500 2.095372 GCACTACACAAAATAGGGTCGC 59.905 50.000 0.00 0.00 0.00 5.19
500 501 3.596214 CACTACACAAAATAGGGTCGCT 58.404 45.455 0.00 0.00 0.00 4.93
501 502 4.751060 CACTACACAAAATAGGGTCGCTA 58.249 43.478 0.00 0.00 0.00 4.26
502 503 5.357257 CACTACACAAAATAGGGTCGCTAT 58.643 41.667 3.63 3.63 0.00 2.97
503 504 5.815740 CACTACACAAAATAGGGTCGCTATT 59.184 40.000 14.69 14.69 0.00 1.73
504 505 5.815740 ACTACACAAAATAGGGTCGCTATTG 59.184 40.000 19.63 13.57 0.00 1.90
505 506 3.945285 ACACAAAATAGGGTCGCTATTGG 59.055 43.478 19.63 16.89 0.00 3.16
506 507 4.196193 CACAAAATAGGGTCGCTATTGGA 58.804 43.478 19.63 0.00 0.00 3.53
507 508 4.035208 CACAAAATAGGGTCGCTATTGGAC 59.965 45.833 19.63 0.00 0.00 4.02
508 509 2.814280 AATAGGGTCGCTATTGGACG 57.186 50.000 18.56 0.00 35.24 4.79
509 510 0.317479 ATAGGGTCGCTATTGGACGC 59.683 55.000 3.63 1.29 44.83 5.19
514 515 4.245054 CGCTATTGGACGCGCTAT 57.755 55.556 5.73 0.00 43.01 2.97
515 516 3.394800 CGCTATTGGACGCGCTATA 57.605 52.632 5.73 0.00 43.01 1.31
516 517 1.260206 CGCTATTGGACGCGCTATAG 58.740 55.000 5.73 8.35 43.01 1.31
517 518 0.992802 GCTATTGGACGCGCTATAGC 59.007 55.000 15.09 15.09 38.83 2.97
530 531 3.132629 GCTATAGCGTGCTATTAGCGA 57.867 47.619 18.62 0.92 46.26 4.93
531 532 3.102276 GCTATAGCGTGCTATTAGCGAG 58.898 50.000 18.62 11.00 46.26 5.03
532 533 3.181509 GCTATAGCGTGCTATTAGCGAGA 60.182 47.826 18.62 0.00 46.26 4.04
533 534 4.496673 GCTATAGCGTGCTATTAGCGAGAT 60.497 45.833 18.62 8.37 46.26 2.75
534 535 5.277393 GCTATAGCGTGCTATTAGCGAGATA 60.277 44.000 18.62 10.12 46.26 1.98
535 536 5.759506 ATAGCGTGCTATTAGCGAGATAT 57.240 39.130 8.54 11.73 46.26 1.63
536 537 4.442375 AGCGTGCTATTAGCGAGATATT 57.558 40.909 10.94 0.00 46.26 1.28
537 538 5.562506 AGCGTGCTATTAGCGAGATATTA 57.437 39.130 10.94 0.00 46.26 0.98
538 539 6.137794 AGCGTGCTATTAGCGAGATATTAT 57.862 37.500 10.94 0.00 46.26 1.28
539 540 7.260558 AGCGTGCTATTAGCGAGATATTATA 57.739 36.000 10.94 0.00 46.26 0.98
540 541 7.133513 AGCGTGCTATTAGCGAGATATTATAC 58.866 38.462 10.94 0.00 46.26 1.47
541 542 6.910972 GCGTGCTATTAGCGAGATATTATACA 59.089 38.462 10.94 0.00 46.26 2.29
542 543 7.591795 GCGTGCTATTAGCGAGATATTATACAT 59.408 37.037 10.94 0.00 46.26 2.29
543 544 9.452065 CGTGCTATTAGCGAGATATTATACATT 57.548 33.333 10.94 0.00 46.26 2.71
552 553 9.896645 AGCGAGATATTATACATTGATCCATTT 57.103 29.630 0.00 0.00 0.00 2.32
560 561 8.534333 TTATACATTGATCCATTTAGCGAGAC 57.466 34.615 0.00 0.00 0.00 3.36
561 562 4.769688 ACATTGATCCATTTAGCGAGACA 58.230 39.130 0.00 0.00 0.00 3.41
562 563 5.185454 ACATTGATCCATTTAGCGAGACAA 58.815 37.500 0.00 0.00 0.00 3.18
563 564 5.824624 ACATTGATCCATTTAGCGAGACAAT 59.175 36.000 0.00 0.00 0.00 2.71
564 565 6.319658 ACATTGATCCATTTAGCGAGACAATT 59.680 34.615 0.00 0.00 0.00 2.32
565 566 6.757897 TTGATCCATTTAGCGAGACAATTT 57.242 33.333 0.00 0.00 0.00 1.82
566 567 6.757897 TGATCCATTTAGCGAGACAATTTT 57.242 33.333 0.00 0.00 0.00 1.82
567 568 7.156876 TGATCCATTTAGCGAGACAATTTTT 57.843 32.000 0.00 0.00 0.00 1.94
568 569 7.250569 TGATCCATTTAGCGAGACAATTTTTC 58.749 34.615 0.00 0.00 0.00 2.29
569 570 6.567687 TCCATTTAGCGAGACAATTTTTCA 57.432 33.333 0.00 0.00 0.00 2.69
570 571 6.378582 TCCATTTAGCGAGACAATTTTTCAC 58.621 36.000 0.00 0.00 0.00 3.18
571 572 5.283717 CCATTTAGCGAGACAATTTTTCACG 59.716 40.000 0.00 0.00 0.00 4.35
573 574 0.967803 GCGAGACAATTTTTCACGCG 59.032 50.000 3.53 3.53 41.88 6.01
574 575 0.967803 CGAGACAATTTTTCACGCGC 59.032 50.000 5.73 0.00 0.00 6.86
575 576 1.398451 CGAGACAATTTTTCACGCGCT 60.398 47.619 5.73 0.00 0.00 5.92
576 577 2.159894 CGAGACAATTTTTCACGCGCTA 60.160 45.455 5.73 0.00 0.00 4.26
577 578 3.483574 CGAGACAATTTTTCACGCGCTAT 60.484 43.478 5.73 0.00 0.00 2.97
578 579 4.259650 CGAGACAATTTTTCACGCGCTATA 60.260 41.667 5.73 0.00 0.00 1.31
579 580 5.143916 AGACAATTTTTCACGCGCTATAG 57.856 39.130 5.73 0.00 0.00 1.31
580 581 3.680789 ACAATTTTTCACGCGCTATAGC 58.319 40.909 15.09 15.09 37.78 2.97
597 598 4.725758 CGTGCTGCGCTACTTTTC 57.274 55.556 9.73 0.00 0.00 2.29
598 599 2.153913 CGTGCTGCGCTACTTTTCT 58.846 52.632 9.73 0.00 0.00 2.52
599 600 0.093705 CGTGCTGCGCTACTTTTCTC 59.906 55.000 9.73 0.00 0.00 2.87
600 601 1.148310 GTGCTGCGCTACTTTTCTCA 58.852 50.000 9.73 0.00 0.00 3.27
601 602 1.127582 GTGCTGCGCTACTTTTCTCAG 59.872 52.381 9.73 0.00 0.00 3.35
602 603 1.270305 TGCTGCGCTACTTTTCTCAGT 60.270 47.619 9.73 0.00 0.00 3.41
603 604 1.127582 GCTGCGCTACTTTTCTCAGTG 59.872 52.381 9.73 0.00 0.00 3.66
604 605 1.728971 CTGCGCTACTTTTCTCAGTGG 59.271 52.381 9.73 0.00 0.00 4.00
605 606 1.070134 TGCGCTACTTTTCTCAGTGGT 59.930 47.619 9.73 0.00 0.00 4.16
606 607 1.461127 GCGCTACTTTTCTCAGTGGTG 59.539 52.381 0.00 0.00 38.46 4.17
607 608 2.755650 CGCTACTTTTCTCAGTGGTGT 58.244 47.619 0.00 0.00 32.59 4.16
608 609 3.859627 GCGCTACTTTTCTCAGTGGTGTA 60.860 47.826 0.00 0.00 37.89 2.90
609 610 4.495422 CGCTACTTTTCTCAGTGGTGTAT 58.505 43.478 0.00 0.00 32.59 2.29
610 611 5.647589 CGCTACTTTTCTCAGTGGTGTATA 58.352 41.667 0.00 0.00 32.59 1.47
611 612 5.515626 CGCTACTTTTCTCAGTGGTGTATAC 59.484 44.000 0.00 0.00 32.59 1.47
612 613 5.515626 GCTACTTTTCTCAGTGGTGTATACG 59.484 44.000 0.00 0.00 0.00 3.06
613 614 4.243270 ACTTTTCTCAGTGGTGTATACGC 58.757 43.478 7.95 7.95 0.00 4.42
614 615 2.953466 TTCTCAGTGGTGTATACGCC 57.047 50.000 25.68 25.68 46.40 5.68
625 626 5.640189 GGTGTATACGCCAGTATATGAGT 57.360 43.478 27.08 0.00 44.72 3.41
626 627 6.022163 GGTGTATACGCCAGTATATGAGTT 57.978 41.667 27.08 0.00 44.72 3.01
627 628 6.453092 GGTGTATACGCCAGTATATGAGTTT 58.547 40.000 27.08 0.00 44.72 2.66
628 629 6.927381 GGTGTATACGCCAGTATATGAGTTTT 59.073 38.462 27.08 0.00 44.72 2.43
629 630 7.115947 GGTGTATACGCCAGTATATGAGTTTTC 59.884 40.741 27.08 0.00 44.72 2.29
630 631 7.866393 GTGTATACGCCAGTATATGAGTTTTCT 59.134 37.037 5.03 0.00 44.72 2.52
631 632 8.080417 TGTATACGCCAGTATATGAGTTTTCTC 58.920 37.037 0.00 0.00 44.72 2.87
632 633 7.050970 ATACGCCAGTATATGAGTTTTCTCA 57.949 36.000 0.43 0.43 45.84 3.27
633 634 7.148641 ATACGCCAGTATATGAGTTTTCTCAG 58.851 38.462 4.34 0.00 45.63 3.35
634 635 7.201920 ATACGCCAGTATATGAGTTTTCTCAGT 60.202 37.037 4.34 0.00 45.63 3.41
645 646 4.243270 AGTTTTCTCAGTGGTGTATACGC 58.757 43.478 7.95 7.95 0.00 4.42
646 647 2.953466 TTCTCAGTGGTGTATACGCC 57.047 50.000 25.68 25.68 46.40 5.68
647 648 2.139323 TCTCAGTGGTGTATACGCCT 57.861 50.000 30.45 13.29 46.36 5.52
648 649 3.286329 TCTCAGTGGTGTATACGCCTA 57.714 47.619 30.45 17.29 46.36 3.93
649 650 3.828921 TCTCAGTGGTGTATACGCCTAT 58.171 45.455 30.45 18.78 46.36 2.57
650 651 4.976864 TCTCAGTGGTGTATACGCCTATA 58.023 43.478 30.45 12.61 46.36 1.31
651 652 5.567430 TCTCAGTGGTGTATACGCCTATAT 58.433 41.667 30.45 14.45 46.36 0.86
652 653 6.714278 TCTCAGTGGTGTATACGCCTATATA 58.286 40.000 30.45 11.92 46.36 0.86
653 654 7.344134 TCTCAGTGGTGTATACGCCTATATAT 58.656 38.462 30.45 11.44 46.36 0.86
654 655 7.282450 TCTCAGTGGTGTATACGCCTATATATG 59.718 40.741 30.45 19.99 46.36 1.78
655 656 7.114095 TCAGTGGTGTATACGCCTATATATGA 58.886 38.462 30.45 21.44 46.36 2.15
656 657 7.612633 TCAGTGGTGTATACGCCTATATATGAA 59.387 37.037 30.45 9.23 46.36 2.57
657 658 8.414003 CAGTGGTGTATACGCCTATATATGAAT 58.586 37.037 30.45 9.21 46.36 2.57
658 659 8.414003 AGTGGTGTATACGCCTATATATGAATG 58.586 37.037 30.45 0.00 46.36 2.67
659 660 8.195436 GTGGTGTATACGCCTATATATGAATGT 58.805 37.037 30.45 0.00 46.36 2.71
660 661 8.410912 TGGTGTATACGCCTATATATGAATGTC 58.589 37.037 30.45 4.53 46.36 3.06
661 662 8.630917 GGTGTATACGCCTATATATGAATGTCT 58.369 37.037 25.26 0.00 43.02 3.41
664 665 9.808808 GTATACGCCTATATATGAATGTCTACG 57.191 37.037 0.00 0.00 0.00 3.51
665 666 6.754702 ACGCCTATATATGAATGTCTACGT 57.245 37.500 0.00 0.00 0.00 3.57
666 667 6.783162 ACGCCTATATATGAATGTCTACGTC 58.217 40.000 0.00 0.00 0.00 4.34
667 668 6.598457 ACGCCTATATATGAATGTCTACGTCT 59.402 38.462 0.00 0.00 0.00 4.18
668 669 6.907748 CGCCTATATATGAATGTCTACGTCTG 59.092 42.308 0.00 0.00 0.00 3.51
669 670 7.414208 CGCCTATATATGAATGTCTACGTCTGT 60.414 40.741 0.00 0.00 0.00 3.41
670 671 8.890718 GCCTATATATGAATGTCTACGTCTGTA 58.109 37.037 0.00 0.00 0.00 2.74
678 679 9.817809 ATGAATGTCTACGTCTGTATTGTATTT 57.182 29.630 0.00 0.00 0.00 1.40
710 711 7.524294 AAAACTTTTGTTGAGTTAGCATGTG 57.476 32.000 0.00 0.00 42.67 3.21
711 712 5.186996 ACTTTTGTTGAGTTAGCATGTGG 57.813 39.130 0.00 0.00 0.00 4.17
712 713 4.887071 ACTTTTGTTGAGTTAGCATGTGGA 59.113 37.500 0.00 0.00 0.00 4.02
713 714 5.359576 ACTTTTGTTGAGTTAGCATGTGGAA 59.640 36.000 0.00 0.00 0.00 3.53
714 715 4.829064 TTGTTGAGTTAGCATGTGGAAC 57.171 40.909 0.00 0.00 37.35 3.62
715 716 2.805671 TGTTGAGTTAGCATGTGGAACG 59.194 45.455 0.00 0.00 42.39 3.95
716 717 3.064207 GTTGAGTTAGCATGTGGAACGA 58.936 45.455 0.00 0.00 42.39 3.85
717 718 2.683968 TGAGTTAGCATGTGGAACGAC 58.316 47.619 0.00 0.00 42.39 4.34
718 719 2.036604 TGAGTTAGCATGTGGAACGACA 59.963 45.455 0.00 0.00 42.39 4.35
719 720 3.064207 GAGTTAGCATGTGGAACGACAA 58.936 45.455 0.00 0.00 42.39 3.18
720 721 3.674997 AGTTAGCATGTGGAACGACAAT 58.325 40.909 0.00 0.00 42.39 2.71
721 722 3.436704 AGTTAGCATGTGGAACGACAATG 59.563 43.478 0.00 0.00 42.39 2.82
722 723 2.183478 AGCATGTGGAACGACAATGA 57.817 45.000 0.00 0.00 42.39 2.57
723 724 2.715046 AGCATGTGGAACGACAATGAT 58.285 42.857 0.00 0.00 42.39 2.45
724 725 3.872696 AGCATGTGGAACGACAATGATA 58.127 40.909 0.00 0.00 42.39 2.15
725 726 4.454678 AGCATGTGGAACGACAATGATAT 58.545 39.130 0.00 0.00 42.39 1.63
726 727 4.274214 AGCATGTGGAACGACAATGATATG 59.726 41.667 0.00 0.00 42.39 1.78
727 728 4.273235 GCATGTGGAACGACAATGATATGA 59.727 41.667 0.00 0.00 42.39 2.15
728 729 5.049198 GCATGTGGAACGACAATGATATGAT 60.049 40.000 0.00 0.00 42.39 2.45
729 730 6.147656 GCATGTGGAACGACAATGATATGATA 59.852 38.462 0.00 0.00 42.39 2.15
730 731 7.622880 GCATGTGGAACGACAATGATATGATAG 60.623 40.741 0.00 0.00 42.39 2.08
731 732 6.223120 TGTGGAACGACAATGATATGATAGG 58.777 40.000 0.00 0.00 42.39 2.57
732 733 6.041523 TGTGGAACGACAATGATATGATAGGA 59.958 38.462 0.00 0.00 42.39 2.94
733 734 6.929049 GTGGAACGACAATGATATGATAGGAA 59.071 38.462 0.00 0.00 0.00 3.36
734 735 6.929049 TGGAACGACAATGATATGATAGGAAC 59.071 38.462 0.00 0.00 0.00 3.62
735 736 6.089551 GGAACGACAATGATATGATAGGAACG 59.910 42.308 0.00 0.00 0.00 3.95
736 737 5.470368 ACGACAATGATATGATAGGAACGG 58.530 41.667 0.00 0.00 0.00 4.44
737 738 4.327357 CGACAATGATATGATAGGAACGGC 59.673 45.833 0.00 0.00 0.00 5.68
738 739 5.482908 GACAATGATATGATAGGAACGGCT 58.517 41.667 0.00 0.00 0.00 5.52
739 740 6.605471 ACAATGATATGATAGGAACGGCTA 57.395 37.500 0.00 0.00 0.00 3.93
740 741 6.398918 ACAATGATATGATAGGAACGGCTAC 58.601 40.000 0.00 0.00 0.00 3.58
741 742 5.599999 ATGATATGATAGGAACGGCTACC 57.400 43.478 0.00 0.00 0.00 3.18
742 743 4.412843 TGATATGATAGGAACGGCTACCA 58.587 43.478 0.00 0.00 0.00 3.25
743 744 4.836175 TGATATGATAGGAACGGCTACCAA 59.164 41.667 0.00 0.00 0.00 3.67
744 745 5.305902 TGATATGATAGGAACGGCTACCAAA 59.694 40.000 0.00 0.00 0.00 3.28
745 746 3.255969 TGATAGGAACGGCTACCAAAC 57.744 47.619 0.00 0.00 0.00 2.93
746 747 2.568062 TGATAGGAACGGCTACCAAACA 59.432 45.455 0.00 0.00 0.00 2.83
747 748 2.460757 TAGGAACGGCTACCAAACAC 57.539 50.000 0.00 0.00 0.00 3.32
748 749 0.470766 AGGAACGGCTACCAAACACA 59.529 50.000 0.00 0.00 0.00 3.72
749 750 0.589708 GGAACGGCTACCAAACACAC 59.410 55.000 0.00 0.00 0.00 3.82
750 751 0.589708 GAACGGCTACCAAACACACC 59.410 55.000 0.00 0.00 0.00 4.16
751 752 0.820482 AACGGCTACCAAACACACCC 60.820 55.000 0.00 0.00 0.00 4.61
752 753 2.322081 CGGCTACCAAACACACCCG 61.322 63.158 0.00 0.00 0.00 5.28
753 754 1.228033 GGCTACCAAACACACCCGT 60.228 57.895 0.00 0.00 0.00 5.28
754 755 0.035176 GGCTACCAAACACACCCGTA 59.965 55.000 0.00 0.00 0.00 4.02
755 756 1.435577 GCTACCAAACACACCCGTAG 58.564 55.000 0.00 0.00 0.00 3.51
756 757 1.001181 GCTACCAAACACACCCGTAGA 59.999 52.381 0.00 0.00 0.00 2.59
757 758 2.354403 GCTACCAAACACACCCGTAGAT 60.354 50.000 0.00 0.00 0.00 1.98
758 759 2.943036 ACCAAACACACCCGTAGATT 57.057 45.000 0.00 0.00 0.00 2.40
759 760 2.774687 ACCAAACACACCCGTAGATTC 58.225 47.619 0.00 0.00 0.00 2.52
760 761 2.081462 CCAAACACACCCGTAGATTCC 58.919 52.381 0.00 0.00 0.00 3.01
761 762 1.730064 CAAACACACCCGTAGATTCCG 59.270 52.381 0.00 0.00 0.00 4.30
762 763 0.248289 AACACACCCGTAGATTCCGG 59.752 55.000 0.00 0.00 45.07 5.14
763 764 0.901580 ACACACCCGTAGATTCCGGT 60.902 55.000 0.00 0.00 43.98 5.28
764 765 0.248289 CACACCCGTAGATTCCGGTT 59.752 55.000 0.00 0.00 43.98 4.44
765 766 1.477700 CACACCCGTAGATTCCGGTTA 59.522 52.381 0.00 0.00 43.98 2.85
766 767 2.101917 CACACCCGTAGATTCCGGTTAT 59.898 50.000 0.00 0.00 43.98 1.89
767 768 2.363359 ACACCCGTAGATTCCGGTTATC 59.637 50.000 0.00 6.27 43.98 1.75
768 769 1.610522 ACCCGTAGATTCCGGTTATCG 59.389 52.381 0.00 0.45 43.98 2.92
769 770 1.668047 CCCGTAGATTCCGGTTATCGC 60.668 57.143 0.00 4.47 43.98 4.58
770 771 1.268899 CCGTAGATTCCGGTTATCGCT 59.731 52.381 0.00 0.00 40.59 4.93
771 772 2.582687 CGTAGATTCCGGTTATCGCTC 58.417 52.381 0.00 2.24 37.59 5.03
772 773 2.582687 GTAGATTCCGGTTATCGCTCG 58.417 52.381 0.00 0.00 37.59 5.03
773 774 0.314302 AGATTCCGGTTATCGCTCGG 59.686 55.000 0.00 0.00 44.59 4.63
775 776 3.113745 TCCGGTTATCGCTCGGAC 58.886 61.111 0.00 0.00 46.48 4.79
776 777 2.027169 CCGGTTATCGCTCGGACC 59.973 66.667 0.00 0.00 45.96 4.46
778 779 3.113745 GGTTATCGCTCGGACCGA 58.886 61.111 17.28 17.28 39.24 4.69
779 780 1.298938 GGTTATCGCTCGGACCGAC 60.299 63.158 13.88 9.33 37.56 4.79
780 781 1.653533 GTTATCGCTCGGACCGACG 60.654 63.158 23.89 23.89 37.56 5.12
781 782 3.459378 TTATCGCTCGGACCGACGC 62.459 63.158 24.60 22.98 37.56 5.19
785 786 3.039588 GCTCGGACCGACGCAAAA 61.040 61.111 24.36 1.91 33.08 2.44
786 787 3.011760 GCTCGGACCGACGCAAAAG 62.012 63.158 24.36 11.68 33.08 2.27
787 788 1.372499 CTCGGACCGACGCAAAAGA 60.372 57.895 13.88 0.00 0.00 2.52
788 789 1.344942 CTCGGACCGACGCAAAAGAG 61.345 60.000 13.88 0.00 0.00 2.85
789 790 1.663702 CGGACCGACGCAAAAGAGT 60.664 57.895 8.64 0.00 0.00 3.24
790 791 0.387622 CGGACCGACGCAAAAGAGTA 60.388 55.000 8.64 0.00 0.00 2.59
791 792 1.787012 GGACCGACGCAAAAGAGTAA 58.213 50.000 0.00 0.00 0.00 2.24
792 793 2.137523 GGACCGACGCAAAAGAGTAAA 58.862 47.619 0.00 0.00 0.00 2.01
793 794 2.545106 GGACCGACGCAAAAGAGTAAAA 59.455 45.455 0.00 0.00 0.00 1.52
794 795 3.187842 GGACCGACGCAAAAGAGTAAAAT 59.812 43.478 0.00 0.00 0.00 1.82
795 796 4.389687 GGACCGACGCAAAAGAGTAAAATA 59.610 41.667 0.00 0.00 0.00 1.40
796 797 5.106987 GGACCGACGCAAAAGAGTAAAATAA 60.107 40.000 0.00 0.00 0.00 1.40
797 798 6.303021 ACCGACGCAAAAGAGTAAAATAAA 57.697 33.333 0.00 0.00 0.00 1.40
798 799 6.727215 ACCGACGCAAAAGAGTAAAATAAAA 58.273 32.000 0.00 0.00 0.00 1.52
799 800 7.364970 ACCGACGCAAAAGAGTAAAATAAAAT 58.635 30.769 0.00 0.00 0.00 1.82
800 801 8.505625 ACCGACGCAAAAGAGTAAAATAAAATA 58.494 29.630 0.00 0.00 0.00 1.40
801 802 9.332301 CCGACGCAAAAGAGTAAAATAAAATAA 57.668 29.630 0.00 0.00 0.00 1.40
821 822 8.726870 AAATAAAATAAAGATTCGGACTCGGA 57.273 30.769 0.00 0.00 36.95 4.55
822 823 7.710766 ATAAAATAAAGATTCGGACTCGGAC 57.289 36.000 0.00 0.00 36.95 4.79
823 824 4.730949 AATAAAGATTCGGACTCGGACA 57.269 40.909 0.00 0.00 36.95 4.02
824 825 4.939052 ATAAAGATTCGGACTCGGACAT 57.061 40.909 0.00 0.00 36.95 3.06
825 826 6.401047 AATAAAGATTCGGACTCGGACATA 57.599 37.500 0.00 0.00 36.95 2.29
826 827 3.992260 AAGATTCGGACTCGGACATAG 57.008 47.619 0.00 0.00 36.95 2.23
827 828 1.609555 AGATTCGGACTCGGACATAGC 59.390 52.381 0.00 0.00 36.95 2.97
828 829 0.674534 ATTCGGACTCGGACATAGCC 59.325 55.000 0.00 0.00 36.95 3.93
853 854 2.045438 CATGCGGCCCCAAGTGTA 60.045 61.111 0.00 0.00 0.00 2.90
854 855 2.045340 ATGCGGCCCCAAGTGTAC 60.045 61.111 0.00 0.00 0.00 2.90
855 856 2.901281 ATGCGGCCCCAAGTGTACA 61.901 57.895 0.00 0.00 0.00 2.90
856 857 2.746277 GCGGCCCCAAGTGTACAG 60.746 66.667 0.00 0.00 0.00 2.74
857 858 2.747686 CGGCCCCAAGTGTACAGT 59.252 61.111 0.00 0.00 0.00 3.55
858 859 1.072505 CGGCCCCAAGTGTACAGTT 59.927 57.895 10.24 10.24 0.00 3.16
859 860 0.953960 CGGCCCCAAGTGTACAGTTC 60.954 60.000 13.12 2.41 0.00 3.01
860 861 0.400594 GGCCCCAAGTGTACAGTTCT 59.599 55.000 13.12 0.00 0.00 3.01
861 862 1.202891 GGCCCCAAGTGTACAGTTCTT 60.203 52.381 13.12 2.16 0.00 2.52
862 863 2.583143 GCCCCAAGTGTACAGTTCTTT 58.417 47.619 13.12 0.00 0.00 2.52
863 864 2.956333 GCCCCAAGTGTACAGTTCTTTT 59.044 45.455 13.12 0.00 0.00 2.27
864 865 3.243401 GCCCCAAGTGTACAGTTCTTTTG 60.243 47.826 13.12 2.83 0.00 2.44
865 866 4.204012 CCCCAAGTGTACAGTTCTTTTGA 58.796 43.478 13.12 0.00 0.00 2.69
866 867 4.036380 CCCCAAGTGTACAGTTCTTTTGAC 59.964 45.833 13.12 0.00 0.00 3.18
867 868 4.260620 CCCAAGTGTACAGTTCTTTTGACG 60.261 45.833 13.12 0.09 0.00 4.35
868 869 4.569162 CCAAGTGTACAGTTCTTTTGACGA 59.431 41.667 13.12 0.00 0.00 4.20
869 870 5.276868 CCAAGTGTACAGTTCTTTTGACGAG 60.277 44.000 13.12 0.00 0.00 4.18
870 871 4.369182 AGTGTACAGTTCTTTTGACGAGG 58.631 43.478 0.00 0.00 0.00 4.63
871 872 4.098960 AGTGTACAGTTCTTTTGACGAGGA 59.901 41.667 0.00 0.00 0.00 3.71
872 873 4.444720 GTGTACAGTTCTTTTGACGAGGAG 59.555 45.833 0.00 0.00 0.00 3.69
873 874 3.821421 ACAGTTCTTTTGACGAGGAGT 57.179 42.857 0.00 0.00 0.00 3.85
883 884 2.442056 ACGAGGAGTCAAGCCAAGT 58.558 52.632 0.00 0.00 0.00 3.16
884 885 0.318762 ACGAGGAGTCAAGCCAAGTC 59.681 55.000 0.00 0.00 0.00 3.01
885 886 0.605589 CGAGGAGTCAAGCCAAGTCT 59.394 55.000 0.00 0.00 0.00 3.24
886 887 1.819288 CGAGGAGTCAAGCCAAGTCTA 59.181 52.381 0.00 0.00 0.00 2.59
887 888 2.416162 CGAGGAGTCAAGCCAAGTCTAC 60.416 54.545 0.00 0.00 0.00 2.59
888 889 2.829120 GAGGAGTCAAGCCAAGTCTACT 59.171 50.000 0.00 0.00 0.00 2.57
889 890 2.829120 AGGAGTCAAGCCAAGTCTACTC 59.171 50.000 0.00 0.00 34.08 2.59
890 891 2.093921 GGAGTCAAGCCAAGTCTACTCC 60.094 54.545 0.00 0.00 44.36 3.85
891 892 2.829120 GAGTCAAGCCAAGTCTACTCCT 59.171 50.000 0.00 0.00 0.00 3.69
892 893 2.564947 AGTCAAGCCAAGTCTACTCCTG 59.435 50.000 0.00 0.00 0.00 3.86
893 894 2.300437 GTCAAGCCAAGTCTACTCCTGT 59.700 50.000 0.00 0.00 0.00 4.00
894 895 2.563179 TCAAGCCAAGTCTACTCCTGTC 59.437 50.000 0.00 0.00 0.00 3.51
895 896 2.300152 CAAGCCAAGTCTACTCCTGTCA 59.700 50.000 0.00 0.00 0.00 3.58
896 897 2.175202 AGCCAAGTCTACTCCTGTCAG 58.825 52.381 0.00 0.00 0.00 3.51
897 898 1.404851 GCCAAGTCTACTCCTGTCAGC 60.405 57.143 0.00 0.00 0.00 4.26
898 899 1.205893 CCAAGTCTACTCCTGTCAGCC 59.794 57.143 0.00 0.00 0.00 4.85
899 900 1.135257 CAAGTCTACTCCTGTCAGCCG 60.135 57.143 0.00 0.00 0.00 5.52
900 901 0.681564 AGTCTACTCCTGTCAGCCGG 60.682 60.000 0.00 0.00 0.00 6.13
901 902 0.680280 GTCTACTCCTGTCAGCCGGA 60.680 60.000 5.05 0.00 0.00 5.14
903 904 1.668101 CTACTCCTGTCAGCCGGACC 61.668 65.000 5.05 0.00 46.38 4.46
904 905 2.435120 TACTCCTGTCAGCCGGACCA 62.435 60.000 5.05 0.00 46.38 4.02
905 906 2.284625 TCCTGTCAGCCGGACCAT 60.285 61.111 5.05 0.00 46.38 3.55
906 907 2.124983 CCTGTCAGCCGGACCATG 60.125 66.667 5.05 0.00 46.38 3.66
907 908 2.665000 CTGTCAGCCGGACCATGT 59.335 61.111 5.05 0.00 46.38 3.21
908 909 1.742880 CTGTCAGCCGGACCATGTG 60.743 63.158 5.05 0.00 46.38 3.21
909 910 3.127533 GTCAGCCGGACCATGTGC 61.128 66.667 5.05 0.00 40.83 4.57
910 911 3.635191 TCAGCCGGACCATGTGCA 61.635 61.111 5.05 0.00 0.00 4.57
911 912 2.672651 CAGCCGGACCATGTGCAA 60.673 61.111 5.05 0.00 0.00 4.08
912 913 2.360350 AGCCGGACCATGTGCAAG 60.360 61.111 5.05 0.00 0.00 4.01
913 914 4.120331 GCCGGACCATGTGCAAGC 62.120 66.667 5.05 0.00 0.00 4.01
914 915 3.803082 CCGGACCATGTGCAAGCG 61.803 66.667 0.00 0.00 0.00 4.68
915 916 4.465512 CGGACCATGTGCAAGCGC 62.466 66.667 0.00 0.00 39.24 5.92
925 926 4.268939 GCAAGCGCAACCACAGCA 62.269 61.111 11.47 0.00 38.36 4.41
926 927 2.412525 CAAGCGCAACCACAGCAA 59.587 55.556 11.47 0.00 0.00 3.91
927 928 1.659335 CAAGCGCAACCACAGCAAG 60.659 57.895 11.47 0.00 0.00 4.01
928 929 3.489277 AAGCGCAACCACAGCAAGC 62.489 57.895 11.47 0.00 0.00 4.01
929 930 4.268939 GCGCAACCACAGCAAGCA 62.269 61.111 0.30 0.00 0.00 3.91
930 931 2.050714 CGCAACCACAGCAAGCAG 60.051 61.111 0.00 0.00 0.00 4.24
931 932 2.355481 GCAACCACAGCAAGCAGC 60.355 61.111 0.00 0.00 46.19 5.25
976 977 3.917760 CTGGCCCCTCCGTCGATC 61.918 72.222 0.00 0.00 37.80 3.69
977 978 4.770362 TGGCCCCTCCGTCGATCA 62.770 66.667 0.00 0.00 37.80 2.92
978 979 3.467226 GGCCCCTCCGTCGATCAA 61.467 66.667 0.00 0.00 0.00 2.57
979 980 2.107141 GCCCCTCCGTCGATCAAG 59.893 66.667 0.00 0.00 0.00 3.02
980 981 2.423898 GCCCCTCCGTCGATCAAGA 61.424 63.158 0.00 0.00 0.00 3.02
981 982 1.749334 GCCCCTCCGTCGATCAAGAT 61.749 60.000 0.00 0.00 0.00 2.40
986 987 2.860735 CCTCCGTCGATCAAGATTCAAC 59.139 50.000 0.00 0.00 0.00 3.18
1032 3284 2.274760 GAGCTGCAATCCCTGGCT 59.725 61.111 1.02 0.00 35.86 4.75
1060 3312 1.221840 GATTTCCTCGAGCTGGCCA 59.778 57.895 4.71 4.71 0.00 5.36
1073 3325 4.416738 GGCCAAGCTTCTCCGGCT 62.417 66.667 21.12 0.00 44.27 5.52
1095 3347 2.125106 GTCGCCGGAGAGCCATTT 60.125 61.111 8.65 0.00 0.00 2.32
1098 3350 2.592308 GCCGGAGAGCCATTTCCT 59.408 61.111 5.05 0.00 0.00 3.36
1099 3351 1.524849 GCCGGAGAGCCATTTCCTC 60.525 63.158 5.05 0.00 0.00 3.71
1103 3355 1.741732 CGGAGAGCCATTTCCTCACAG 60.742 57.143 0.00 0.00 0.00 3.66
1117 3369 0.390340 TCACAGCTTCATCCACGAGC 60.390 55.000 0.00 0.00 36.68 5.03
1220 3472 1.117150 GGGATGGCGTGGTACTTCTA 58.883 55.000 0.00 0.00 0.00 2.10
1225 3477 0.459759 GGCGTGGTACTTCTACAGCC 60.460 60.000 0.00 0.00 38.79 4.85
1229 3481 0.251922 TGGTACTTCTACAGCCCCGT 60.252 55.000 0.00 0.00 0.00 5.28
1233 3485 1.276622 ACTTCTACAGCCCCGTCAAT 58.723 50.000 0.00 0.00 0.00 2.57
1236 3488 0.251916 TCTACAGCCCCGTCAATTGG 59.748 55.000 5.42 0.00 0.00 3.16
1242 3494 2.686816 CCCCGTCAATTGGCACGAC 61.687 63.158 18.27 3.13 38.32 4.34
1347 3599 2.610859 ATTCTGGGCCCGGACAGT 60.611 61.111 34.06 18.99 36.17 3.55
1395 3647 2.710760 CTCTCGTACGTGCTCAAGATC 58.289 52.381 16.05 0.00 0.00 2.75
1398 3650 3.128764 TCTCGTACGTGCTCAAGATCAAT 59.871 43.478 16.05 0.00 0.00 2.57
1407 3659 3.141398 GCTCAAGATCAATAATCCGCCA 58.859 45.455 0.00 0.00 34.67 5.69
1464 3716 1.718757 GGTGCATGGTCGAGATTGGC 61.719 60.000 0.00 0.00 0.00 4.52
1468 3720 0.533755 CATGGTCGAGATTGGCCTCC 60.534 60.000 3.32 0.00 0.00 4.30
1530 3785 1.375523 CAAGGTGTACAGGTCGCCC 60.376 63.158 0.00 0.00 36.26 6.13
1531 3786 1.535687 AAGGTGTACAGGTCGCCCT 60.536 57.895 0.00 0.00 44.02 5.19
1532 3787 1.542187 AAGGTGTACAGGTCGCCCTC 61.542 60.000 0.00 0.00 39.89 4.30
1533 3788 2.181021 GTGTACAGGTCGCCCTCG 59.819 66.667 0.00 0.00 39.89 4.63
1534 3789 3.755628 TGTACAGGTCGCCCTCGC 61.756 66.667 0.00 0.00 39.89 5.03
1535 3790 4.509737 GTACAGGTCGCCCTCGCC 62.510 72.222 0.00 0.00 39.89 5.54
1628 3883 0.596859 GGTAACGGCGTATCTGGAGC 60.597 60.000 15.20 0.61 0.00 4.70
1634 3889 0.249657 GGCGTATCTGGAGCTGAAGG 60.250 60.000 0.00 0.00 0.00 3.46
1636 3891 0.249657 CGTATCTGGAGCTGAAGGCC 60.250 60.000 0.00 0.00 43.05 5.19
1707 3962 1.016130 GCGATATGCCATGTCCTCCG 61.016 60.000 0.00 0.00 37.76 4.63
1709 3964 0.674895 GATATGCCATGTCCTCCGGC 60.675 60.000 0.00 0.00 46.43 6.13
1727 3982 1.210931 CACCGCCATCTGCTTTGTG 59.789 57.895 0.00 0.00 38.05 3.33
1738 3993 5.388111 CATCTGCTTTGTGTGACTACAATG 58.612 41.667 0.00 0.00 40.00 2.82
1745 4000 6.707440 TTTGTGTGACTACAATGTCCATTT 57.293 33.333 0.00 0.00 40.00 2.32
1748 4003 4.156008 GTGTGACTACAATGTCCATTTCCC 59.844 45.833 0.00 0.00 38.82 3.97
1749 4004 3.694566 GTGACTACAATGTCCATTTCCCC 59.305 47.826 0.00 0.00 36.21 4.81
1753 4008 1.042559 CAATGTCCATTTCCCCGGGG 61.043 60.000 35.80 35.80 0.00 5.73
1755 4010 1.933307 ATGTCCATTTCCCCGGGGTC 61.933 60.000 38.73 19.81 36.47 4.46
1756 4011 2.204167 TCCATTTCCCCGGGGTCA 60.204 61.111 38.73 26.27 36.47 4.02
1757 4012 1.853095 TCCATTTCCCCGGGGTCAA 60.853 57.895 38.73 30.45 36.47 3.18
1781 4036 2.420890 CCCAGCTCTCCTCATCGC 59.579 66.667 0.00 0.00 0.00 4.58
1794 4049 4.954118 ATCGCCCCCGCCTCCATA 62.954 66.667 0.00 0.00 0.00 2.74
1798 4053 4.235762 CCCCCGCCTCCATACACG 62.236 72.222 0.00 0.00 0.00 4.49
1806 4061 1.207329 GCCTCCATACACGGAACTCTT 59.793 52.381 0.00 0.00 33.65 2.85
1809 4064 1.621317 TCCATACACGGAACTCTTGCA 59.379 47.619 0.00 0.00 29.93 4.08
1813 4068 4.634004 CCATACACGGAACTCTTGCAATTA 59.366 41.667 0.00 0.00 0.00 1.40
1818 4073 5.106555 ACACGGAACTCTTGCAATTATGAAG 60.107 40.000 0.00 0.00 0.00 3.02
1822 4077 6.092670 CGGAACTCTTGCAATTATGAAGAAGA 59.907 38.462 0.00 0.00 0.00 2.87
1825 4080 5.352569 ACTCTTGCAATTATGAAGAAGACCG 59.647 40.000 0.00 0.00 0.00 4.79
1833 4088 0.737367 TGAAGAAGACCGATGCTGCG 60.737 55.000 0.00 0.00 0.00 5.18
1834 4089 0.737715 GAAGAAGACCGATGCTGCGT 60.738 55.000 0.00 0.00 0.00 5.24
1861 4119 0.096454 GGCAACCGTCGTAATGAAGC 59.904 55.000 0.00 0.00 0.00 3.86
1865 4123 0.806868 ACCGTCGTAATGAAGCTCGA 59.193 50.000 0.00 0.00 0.00 4.04
1899 4157 4.207281 TCGGCCGAGCGGATGAAG 62.207 66.667 27.28 0.00 37.50 3.02
1911 4169 1.685148 GGATGAAGGAGATGGCCAAC 58.315 55.000 10.96 7.42 0.00 3.77
1922 4180 4.452733 GGCCAACCTCGTCCTCGG 62.453 72.222 0.00 0.00 37.69 4.63
1923 4181 3.692406 GCCAACCTCGTCCTCGGT 61.692 66.667 0.00 0.00 37.69 4.69
1925 4183 1.370064 CCAACCTCGTCCTCGGTTT 59.630 57.895 0.00 0.00 41.37 3.27
1926 4184 0.669625 CCAACCTCGTCCTCGGTTTC 60.670 60.000 0.00 0.00 41.37 2.78
1927 4185 1.007336 CAACCTCGTCCTCGGTTTCG 61.007 60.000 0.00 0.00 41.37 3.46
1944 4202 1.111116 TCGAGAGTCCGGTGGTTGTT 61.111 55.000 0.00 0.00 0.00 2.83
1945 4203 0.944311 CGAGAGTCCGGTGGTTGTTG 60.944 60.000 0.00 0.00 0.00 3.33
1950 4208 1.521906 TCCGGTGGTTGTTGTGTCG 60.522 57.895 0.00 0.00 0.00 4.35
1979 4237 0.823356 AACACCGCCAGCAACATTCT 60.823 50.000 0.00 0.00 0.00 2.40
1986 4244 1.915141 CCAGCAACATTCTCCTGGTT 58.085 50.000 0.00 0.00 39.93 3.67
1994 4252 6.151144 AGCAACATTCTCCTGGTTACATTTAC 59.849 38.462 0.00 0.00 0.00 2.01
1995 4253 6.151144 GCAACATTCTCCTGGTTACATTTACT 59.849 38.462 0.00 0.00 0.00 2.24
1999 4257 7.942341 ACATTCTCCTGGTTACATTTACTTCAA 59.058 33.333 0.00 0.00 0.00 2.69
2003 4261 9.010029 TCTCCTGGTTACATTTACTTCAAATTC 57.990 33.333 0.00 0.00 34.49 2.17
2006 4264 7.542130 CCTGGTTACATTTACTTCAAATTCAGC 59.458 37.037 0.00 0.00 34.49 4.26
2007 4265 8.177119 TGGTTACATTTACTTCAAATTCAGCT 57.823 30.769 0.00 0.00 34.49 4.24
2008 4266 8.296713 TGGTTACATTTACTTCAAATTCAGCTC 58.703 33.333 0.00 0.00 34.49 4.09
2009 4267 8.515414 GGTTACATTTACTTCAAATTCAGCTCT 58.485 33.333 0.00 0.00 34.49 4.09
2010 4268 9.334693 GTTACATTTACTTCAAATTCAGCTCTG 57.665 33.333 0.00 0.00 34.49 3.35
2011 4269 7.750229 ACATTTACTTCAAATTCAGCTCTGA 57.250 32.000 0.00 0.00 34.49 3.27
2012 4270 8.345724 ACATTTACTTCAAATTCAGCTCTGAT 57.654 30.769 0.00 0.00 39.64 2.90
2013 4271 8.242053 ACATTTACTTCAAATTCAGCTCTGATG 58.758 33.333 0.00 0.00 39.64 3.07
2014 4272 4.698583 ACTTCAAATTCAGCTCTGATGC 57.301 40.909 0.00 0.00 39.64 3.91
2015 4273 4.333690 ACTTCAAATTCAGCTCTGATGCT 58.666 39.130 0.00 0.00 45.18 3.79
2016 4274 4.765856 ACTTCAAATTCAGCTCTGATGCTT 59.234 37.500 0.00 0.00 41.98 3.91
2017 4275 4.696899 TCAAATTCAGCTCTGATGCTTG 57.303 40.909 0.00 5.41 41.98 4.01
2018 4276 3.119602 TCAAATTCAGCTCTGATGCTTGC 60.120 43.478 0.00 0.00 41.98 4.01
2019 4277 2.421751 ATTCAGCTCTGATGCTTGCT 57.578 45.000 0.00 0.00 41.98 3.91
2020 4278 3.555527 ATTCAGCTCTGATGCTTGCTA 57.444 42.857 0.00 0.00 41.98 3.49
2021 4279 3.555527 TTCAGCTCTGATGCTTGCTAT 57.444 42.857 0.00 0.00 41.98 2.97
2022 4280 2.835027 TCAGCTCTGATGCTTGCTATG 58.165 47.619 0.00 0.00 41.98 2.23
2023 4281 1.264557 CAGCTCTGATGCTTGCTATGC 59.735 52.381 0.00 0.00 41.98 3.14
2024 4282 0.235144 GCTCTGATGCTTGCTATGCG 59.765 55.000 0.00 0.00 0.00 4.73
2025 4283 1.861971 CTCTGATGCTTGCTATGCGA 58.138 50.000 0.00 0.00 0.00 5.10
2026 4284 1.526041 CTCTGATGCTTGCTATGCGAC 59.474 52.381 0.00 0.00 0.00 5.19
2027 4285 0.585357 CTGATGCTTGCTATGCGACC 59.415 55.000 0.00 0.00 0.00 4.79
2028 4286 0.107752 TGATGCTTGCTATGCGACCA 60.108 50.000 0.00 0.00 0.00 4.02
2029 4287 1.016627 GATGCTTGCTATGCGACCAA 58.983 50.000 0.00 0.00 0.00 3.67
2030 4288 1.003116 GATGCTTGCTATGCGACCAAG 60.003 52.381 0.00 0.00 39.08 3.61
2031 4289 0.321564 TGCTTGCTATGCGACCAAGT 60.322 50.000 0.00 0.00 38.50 3.16
2032 4290 0.097674 GCTTGCTATGCGACCAAGTG 59.902 55.000 0.00 0.00 38.50 3.16
2033 4291 1.442769 CTTGCTATGCGACCAAGTGT 58.557 50.000 0.00 0.00 33.17 3.55
2034 4292 1.806542 CTTGCTATGCGACCAAGTGTT 59.193 47.619 0.00 0.00 33.17 3.32
2035 4293 1.890876 TGCTATGCGACCAAGTGTTT 58.109 45.000 0.00 0.00 0.00 2.83
2036 4294 1.804151 TGCTATGCGACCAAGTGTTTC 59.196 47.619 0.00 0.00 0.00 2.78
2037 4295 1.201921 GCTATGCGACCAAGTGTTTCG 60.202 52.381 0.00 0.00 35.82 3.46
2038 4296 2.333926 CTATGCGACCAAGTGTTTCGA 58.666 47.619 4.28 0.00 34.62 3.71
2039 4297 1.808411 ATGCGACCAAGTGTTTCGAT 58.192 45.000 4.28 0.00 34.62 3.59
2040 4298 1.588674 TGCGACCAAGTGTTTCGATT 58.411 45.000 4.28 0.00 34.62 3.34
2041 4299 1.529438 TGCGACCAAGTGTTTCGATTC 59.471 47.619 4.28 0.00 34.62 2.52
2042 4300 1.461888 GCGACCAAGTGTTTCGATTCG 60.462 52.381 0.00 0.00 34.62 3.34
2043 4301 1.790623 CGACCAAGTGTTTCGATTCGT 59.209 47.619 5.89 0.00 34.62 3.85
2044 4302 2.220133 CGACCAAGTGTTTCGATTCGTT 59.780 45.455 5.89 0.00 34.62 3.85
2045 4303 3.302870 CGACCAAGTGTTTCGATTCGTTT 60.303 43.478 5.89 0.00 34.62 3.60
2046 4304 4.084952 CGACCAAGTGTTTCGATTCGTTTA 60.085 41.667 5.89 0.00 34.62 2.01
2047 4305 5.338614 ACCAAGTGTTTCGATTCGTTTAG 57.661 39.130 5.89 0.00 0.00 1.85
2048 4306 4.148891 CCAAGTGTTTCGATTCGTTTAGC 58.851 43.478 5.89 0.00 0.00 3.09
2049 4307 4.319190 CCAAGTGTTTCGATTCGTTTAGCA 60.319 41.667 5.89 0.00 0.00 3.49
2050 4308 5.382303 CAAGTGTTTCGATTCGTTTAGCAT 58.618 37.500 5.89 0.00 0.00 3.79
2051 4309 5.607119 AGTGTTTCGATTCGTTTAGCATT 57.393 34.783 5.89 0.00 0.00 3.56
2052 4310 6.715344 AGTGTTTCGATTCGTTTAGCATTA 57.285 33.333 5.89 0.00 0.00 1.90
2053 4311 7.303634 AGTGTTTCGATTCGTTTAGCATTAT 57.696 32.000 5.89 0.00 0.00 1.28
2054 4312 8.415192 AGTGTTTCGATTCGTTTAGCATTATA 57.585 30.769 5.89 0.00 0.00 0.98
2055 4313 8.875803 AGTGTTTCGATTCGTTTAGCATTATAA 58.124 29.630 5.89 0.00 0.00 0.98
2056 4314 9.646336 GTGTTTCGATTCGTTTAGCATTATAAT 57.354 29.630 5.89 0.00 0.00 1.28
2057 4315 9.858247 TGTTTCGATTCGTTTAGCATTATAATC 57.142 29.630 5.89 0.00 0.00 1.75
2058 4316 9.314501 GTTTCGATTCGTTTAGCATTATAATCC 57.685 33.333 5.89 0.00 0.00 3.01
2059 4317 8.596271 TTCGATTCGTTTAGCATTATAATCCA 57.404 30.769 5.89 0.00 0.00 3.41
2060 4318 8.014322 TCGATTCGTTTAGCATTATAATCCAC 57.986 34.615 5.89 0.00 0.00 4.02
2061 4319 7.117236 TCGATTCGTTTAGCATTATAATCCACC 59.883 37.037 5.89 0.00 0.00 4.61
2062 4320 7.095397 CGATTCGTTTAGCATTATAATCCACCA 60.095 37.037 0.00 0.00 0.00 4.17
2063 4321 6.854496 TCGTTTAGCATTATAATCCACCAC 57.146 37.500 0.00 0.00 0.00 4.16
2064 4322 6.588204 TCGTTTAGCATTATAATCCACCACT 58.412 36.000 0.00 0.00 0.00 4.00
2065 4323 7.728148 TCGTTTAGCATTATAATCCACCACTA 58.272 34.615 0.00 0.00 0.00 2.74
2066 4324 7.654520 TCGTTTAGCATTATAATCCACCACTAC 59.345 37.037 0.00 0.00 0.00 2.73
2067 4325 7.439955 CGTTTAGCATTATAATCCACCACTACA 59.560 37.037 0.00 0.00 0.00 2.74
2068 4326 9.284968 GTTTAGCATTATAATCCACCACTACAT 57.715 33.333 0.00 0.00 0.00 2.29
2069 4327 8.846943 TTAGCATTATAATCCACCACTACATG 57.153 34.615 0.00 0.00 0.00 3.21
2070 4328 5.707298 AGCATTATAATCCACCACTACATGC 59.293 40.000 0.00 0.00 34.74 4.06
2071 4329 5.707298 GCATTATAATCCACCACTACATGCT 59.293 40.000 0.00 0.00 32.37 3.79
2072 4330 6.878923 GCATTATAATCCACCACTACATGCTA 59.121 38.462 0.00 0.00 32.37 3.49
2073 4331 7.390440 GCATTATAATCCACCACTACATGCTAA 59.610 37.037 0.00 0.00 32.37 3.09
2074 4332 9.453572 CATTATAATCCACCACTACATGCTAAT 57.546 33.333 0.00 0.00 0.00 1.73
2078 4336 9.860650 ATAATCCACCACTACATGCTAATTAAA 57.139 29.630 0.00 0.00 0.00 1.52
2079 4337 8.766994 AATCCACCACTACATGCTAATTAAAT 57.233 30.769 0.00 0.00 0.00 1.40
2080 4338 9.860650 AATCCACCACTACATGCTAATTAAATA 57.139 29.630 0.00 0.00 0.00 1.40
2082 4340 9.283768 TCCACCACTACATGCTAATTAAATATG 57.716 33.333 0.00 0.00 0.00 1.78
2083 4341 8.514594 CCACCACTACATGCTAATTAAATATGG 58.485 37.037 0.00 0.00 0.00 2.74
2084 4342 8.023128 CACCACTACATGCTAATTAAATATGGC 58.977 37.037 0.00 0.00 0.00 4.40
2085 4343 7.176690 ACCACTACATGCTAATTAAATATGGCC 59.823 37.037 0.00 0.00 0.00 5.36
2086 4344 7.243487 CACTACATGCTAATTAAATATGGCCG 58.757 38.462 0.00 0.00 0.00 6.13
2087 4345 6.940298 ACTACATGCTAATTAAATATGGCCGT 59.060 34.615 1.35 1.35 0.00 5.68
2088 4346 6.012658 ACATGCTAATTAAATATGGCCGTG 57.987 37.500 8.05 0.00 0.00 4.94
2089 4347 4.497473 TGCTAATTAAATATGGCCGTGC 57.503 40.909 8.05 0.00 0.00 5.34
2090 4348 3.885901 TGCTAATTAAATATGGCCGTGCA 59.114 39.130 8.05 1.78 0.00 4.57
2091 4349 4.023279 TGCTAATTAAATATGGCCGTGCAG 60.023 41.667 8.05 0.00 0.00 4.41
2092 4350 4.615912 GCTAATTAAATATGGCCGTGCAGG 60.616 45.833 8.05 0.00 44.97 4.85
2114 4372 2.478989 CATGGAAGGCACTGAGCTG 58.521 57.895 0.00 0.00 44.79 4.24
2115 4373 1.378250 ATGGAAGGCACTGAGCTGC 60.378 57.895 0.00 0.00 44.79 5.25
2116 4374 3.123620 GGAAGGCACTGAGCTGCG 61.124 66.667 0.00 0.00 44.79 5.18
2117 4375 2.047844 GAAGGCACTGAGCTGCGA 60.048 61.111 0.00 0.00 44.79 5.10
2118 4376 2.358003 AAGGCACTGAGCTGCGAC 60.358 61.111 0.00 0.00 44.79 5.19
2119 4377 3.890936 AAGGCACTGAGCTGCGACC 62.891 63.158 0.00 0.00 44.79 4.79
2120 4378 4.385405 GGCACTGAGCTGCGACCT 62.385 66.667 0.00 0.00 44.79 3.85
2121 4379 2.813042 GCACTGAGCTGCGACCTC 60.813 66.667 0.00 0.00 41.15 3.85
2122 4380 2.125753 CACTGAGCTGCGACCTCC 60.126 66.667 0.00 0.00 0.00 4.30
2123 4381 2.601666 ACTGAGCTGCGACCTCCA 60.602 61.111 0.00 0.00 0.00 3.86
2124 4382 2.210013 ACTGAGCTGCGACCTCCAA 61.210 57.895 0.00 0.00 0.00 3.53
2125 4383 1.447489 CTGAGCTGCGACCTCCAAG 60.447 63.158 0.00 0.00 0.00 3.61
2126 4384 1.881903 CTGAGCTGCGACCTCCAAGA 61.882 60.000 0.00 0.00 0.00 3.02
2127 4385 1.153667 GAGCTGCGACCTCCAAGAG 60.154 63.158 0.00 0.00 0.00 2.85
2135 4393 3.452786 CCTCCAAGAGGCGAGCGA 61.453 66.667 0.00 0.00 43.29 4.93
2136 4394 2.573869 CTCCAAGAGGCGAGCGAA 59.426 61.111 0.00 0.00 33.74 4.70
2137 4395 1.079819 CTCCAAGAGGCGAGCGAAA 60.080 57.895 0.00 0.00 33.74 3.46
2138 4396 0.460987 CTCCAAGAGGCGAGCGAAAT 60.461 55.000 0.00 0.00 33.74 2.17
2139 4397 0.460284 TCCAAGAGGCGAGCGAAATC 60.460 55.000 0.00 0.00 33.74 2.17
2140 4398 1.633171 CAAGAGGCGAGCGAAATCG 59.367 57.895 0.00 0.00 45.48 3.34
2141 4399 0.802222 CAAGAGGCGAGCGAAATCGA 60.802 55.000 7.06 0.00 45.56 3.59
2144 4402 2.578713 GGCGAGCGAAATCGACGA 60.579 61.111 20.23 0.00 45.56 4.20
2145 4403 2.568912 GGCGAGCGAAATCGACGAG 61.569 63.158 20.23 5.67 45.56 4.18
2146 4404 1.868251 GCGAGCGAAATCGACGAGT 60.868 57.895 20.23 0.00 45.56 4.18
2147 4405 1.403972 GCGAGCGAAATCGACGAGTT 61.404 55.000 10.72 10.72 45.56 3.01
2148 4406 0.562044 CGAGCGAAATCGACGAGTTC 59.438 55.000 24.03 24.03 45.56 3.01
2149 4407 1.614385 GAGCGAAATCGACGAGTTCA 58.386 50.000 30.21 0.00 43.02 3.18
2150 4408 1.983605 GAGCGAAATCGACGAGTTCAA 59.016 47.619 30.21 0.00 43.02 2.69
2151 4409 1.986378 AGCGAAATCGACGAGTTCAAG 59.014 47.619 30.21 19.30 43.02 3.02
2152 4410 1.983605 GCGAAATCGACGAGTTCAAGA 59.016 47.619 30.21 0.00 43.02 3.02
2153 4411 2.407361 GCGAAATCGACGAGTTCAAGAA 59.593 45.455 30.21 0.00 43.02 2.52
2154 4412 3.718323 GCGAAATCGACGAGTTCAAGAAC 60.718 47.826 30.21 14.54 43.02 3.01
2155 4413 3.424198 CGAAATCGACGAGTTCAAGAACA 59.576 43.478 30.21 0.00 41.82 3.18
2156 4414 4.090066 CGAAATCGACGAGTTCAAGAACAT 59.910 41.667 30.21 0.00 41.82 2.71
2157 4415 5.285370 CGAAATCGACGAGTTCAAGAACATA 59.715 40.000 30.21 0.00 41.82 2.29
2158 4416 6.183359 CGAAATCGACGAGTTCAAGAACATAA 60.183 38.462 30.21 0.00 41.82 1.90
2159 4417 6.633668 AATCGACGAGTTCAAGAACATAAG 57.366 37.500 14.69 5.79 43.47 1.73
2160 4418 4.482386 TCGACGAGTTCAAGAACATAAGG 58.518 43.478 14.69 2.29 43.47 2.69
2161 4419 3.612860 CGACGAGTTCAAGAACATAAGGG 59.387 47.826 14.69 0.99 43.47 3.95
2162 4420 4.617530 CGACGAGTTCAAGAACATAAGGGA 60.618 45.833 14.69 0.00 43.47 4.20
2163 4421 4.822026 ACGAGTTCAAGAACATAAGGGAG 58.178 43.478 14.69 0.79 43.47 4.30
2164 4422 3.619038 CGAGTTCAAGAACATAAGGGAGC 59.381 47.826 14.69 0.00 43.47 4.70
2165 4423 4.621747 CGAGTTCAAGAACATAAGGGAGCT 60.622 45.833 14.69 0.00 43.47 4.09
2166 4424 4.583871 AGTTCAAGAACATAAGGGAGCTG 58.416 43.478 14.69 0.00 43.47 4.24
2167 4425 2.991250 TCAAGAACATAAGGGAGCTGC 58.009 47.619 0.00 0.00 0.00 5.25
2168 4426 2.305635 TCAAGAACATAAGGGAGCTGCA 59.694 45.455 7.79 0.00 0.00 4.41
2169 4427 3.054139 TCAAGAACATAAGGGAGCTGCAT 60.054 43.478 7.79 0.00 0.00 3.96
2170 4428 3.205784 AGAACATAAGGGAGCTGCATC 57.794 47.619 7.79 0.00 0.00 3.91
2171 4429 2.776536 AGAACATAAGGGAGCTGCATCT 59.223 45.455 7.79 0.00 0.00 2.90
2172 4430 2.926778 ACATAAGGGAGCTGCATCTC 57.073 50.000 9.11 9.11 0.00 2.75
2173 4431 2.121948 ACATAAGGGAGCTGCATCTCA 58.878 47.619 18.65 0.00 34.84 3.27
2174 4432 2.104451 ACATAAGGGAGCTGCATCTCAG 59.896 50.000 18.65 4.37 45.62 3.35
2175 4433 1.126488 TAAGGGAGCTGCATCTCAGG 58.874 55.000 18.65 0.00 43.06 3.86
2180 4438 4.709840 GCTGCATCTCAGGTGTGT 57.290 55.556 0.00 0.00 43.06 3.72
2181 4439 2.168947 GCTGCATCTCAGGTGTGTG 58.831 57.895 0.00 0.00 43.06 3.82
2182 4440 1.919956 GCTGCATCTCAGGTGTGTGC 61.920 60.000 0.00 0.00 43.06 4.57
2183 4441 0.321387 CTGCATCTCAGGTGTGTGCT 60.321 55.000 0.00 0.00 39.15 4.40
2184 4442 0.604511 TGCATCTCAGGTGTGTGCTG 60.605 55.000 0.00 0.00 36.78 4.41
2185 4443 0.604780 GCATCTCAGGTGTGTGCTGT 60.605 55.000 0.00 0.00 33.25 4.40
2186 4444 1.154197 CATCTCAGGTGTGTGCTGTG 58.846 55.000 0.00 0.00 0.00 3.66
2187 4445 0.761187 ATCTCAGGTGTGTGCTGTGT 59.239 50.000 0.00 0.00 0.00 3.72
2188 4446 0.541392 TCTCAGGTGTGTGCTGTGTT 59.459 50.000 0.00 0.00 0.00 3.32
2189 4447 1.065491 TCTCAGGTGTGTGCTGTGTTT 60.065 47.619 0.00 0.00 0.00 2.83
2190 4448 1.331756 CTCAGGTGTGTGCTGTGTTTC 59.668 52.381 0.00 0.00 0.00 2.78
2191 4449 1.093972 CAGGTGTGTGCTGTGTTTCA 58.906 50.000 0.00 0.00 0.00 2.69
2192 4450 1.677576 CAGGTGTGTGCTGTGTTTCAT 59.322 47.619 0.00 0.00 0.00 2.57
2193 4451 2.099592 CAGGTGTGTGCTGTGTTTCATT 59.900 45.455 0.00 0.00 0.00 2.57
2194 4452 2.760092 AGGTGTGTGCTGTGTTTCATTT 59.240 40.909 0.00 0.00 0.00 2.32
2195 4453 3.115554 GGTGTGTGCTGTGTTTCATTTC 58.884 45.455 0.00 0.00 0.00 2.17
2196 4454 3.115554 GTGTGTGCTGTGTTTCATTTCC 58.884 45.455 0.00 0.00 0.00 3.13
2197 4455 3.023119 TGTGTGCTGTGTTTCATTTCCT 58.977 40.909 0.00 0.00 0.00 3.36
2198 4456 3.066621 TGTGTGCTGTGTTTCATTTCCTC 59.933 43.478 0.00 0.00 0.00 3.71
2199 4457 3.316308 GTGTGCTGTGTTTCATTTCCTCT 59.684 43.478 0.00 0.00 0.00 3.69
2200 4458 3.316029 TGTGCTGTGTTTCATTTCCTCTG 59.684 43.478 0.00 0.00 0.00 3.35
2201 4459 2.294233 TGCTGTGTTTCATTTCCTCTGC 59.706 45.455 0.00 0.00 0.00 4.26
2202 4460 2.555757 GCTGTGTTTCATTTCCTCTGCT 59.444 45.455 0.00 0.00 0.00 4.24
2203 4461 3.005155 GCTGTGTTTCATTTCCTCTGCTT 59.995 43.478 0.00 0.00 0.00 3.91
2204 4462 4.500375 GCTGTGTTTCATTTCCTCTGCTTT 60.500 41.667 0.00 0.00 0.00 3.51
2205 4463 5.594926 CTGTGTTTCATTTCCTCTGCTTTT 58.405 37.500 0.00 0.00 0.00 2.27
2206 4464 5.591099 TGTGTTTCATTTCCTCTGCTTTTC 58.409 37.500 0.00 0.00 0.00 2.29
2207 4465 5.360714 TGTGTTTCATTTCCTCTGCTTTTCT 59.639 36.000 0.00 0.00 0.00 2.52
2208 4466 6.127366 TGTGTTTCATTTCCTCTGCTTTTCTT 60.127 34.615 0.00 0.00 0.00 2.52
2209 4467 6.199719 GTGTTTCATTTCCTCTGCTTTTCTTG 59.800 38.462 0.00 0.00 0.00 3.02
2210 4468 6.127366 TGTTTCATTTCCTCTGCTTTTCTTGT 60.127 34.615 0.00 0.00 0.00 3.16
2211 4469 5.443185 TCATTTCCTCTGCTTTTCTTGTG 57.557 39.130 0.00 0.00 0.00 3.33
2212 4470 3.715628 TTTCCTCTGCTTTTCTTGTGC 57.284 42.857 0.00 0.00 0.00 4.57
2213 4471 2.346766 TCCTCTGCTTTTCTTGTGCA 57.653 45.000 0.00 0.00 35.30 4.57
2214 4472 2.867624 TCCTCTGCTTTTCTTGTGCAT 58.132 42.857 0.00 0.00 36.07 3.96
2215 4473 2.816087 TCCTCTGCTTTTCTTGTGCATC 59.184 45.455 0.00 0.00 36.07 3.91
2216 4474 2.094854 CCTCTGCTTTTCTTGTGCATCC 60.095 50.000 0.00 0.00 36.07 3.51
2217 4475 1.536766 TCTGCTTTTCTTGTGCATCCG 59.463 47.619 0.00 0.00 36.07 4.18
2218 4476 0.597568 TGCTTTTCTTGTGCATCCGG 59.402 50.000 0.00 0.00 0.00 5.14
2219 4477 0.598065 GCTTTTCTTGTGCATCCGGT 59.402 50.000 0.00 0.00 0.00 5.28
2220 4478 1.401539 GCTTTTCTTGTGCATCCGGTC 60.402 52.381 0.00 0.00 0.00 4.79
2221 4479 1.200020 CTTTTCTTGTGCATCCGGTCC 59.800 52.381 0.00 0.00 0.00 4.46
2222 4480 0.400213 TTTCTTGTGCATCCGGTCCT 59.600 50.000 0.00 0.00 0.00 3.85
2223 4481 0.036388 TTCTTGTGCATCCGGTCCTC 60.036 55.000 0.00 0.00 0.00 3.71
2224 4482 1.191489 TCTTGTGCATCCGGTCCTCA 61.191 55.000 0.00 0.00 0.00 3.86
2225 4483 0.107508 CTTGTGCATCCGGTCCTCAT 60.108 55.000 0.00 0.00 0.00 2.90
2226 4484 1.138859 CTTGTGCATCCGGTCCTCATA 59.861 52.381 0.00 0.00 0.00 2.15
2227 4485 1.423584 TGTGCATCCGGTCCTCATAT 58.576 50.000 0.00 0.00 0.00 1.78
2228 4486 1.070601 TGTGCATCCGGTCCTCATATG 59.929 52.381 0.00 0.00 0.00 1.78
2229 4487 1.070758 GTGCATCCGGTCCTCATATGT 59.929 52.381 0.00 0.00 0.00 2.29
2230 4488 2.299013 GTGCATCCGGTCCTCATATGTA 59.701 50.000 0.00 0.00 0.00 2.29
2231 4489 2.562738 TGCATCCGGTCCTCATATGTAG 59.437 50.000 0.00 0.00 0.00 2.74
2232 4490 2.563179 GCATCCGGTCCTCATATGTAGT 59.437 50.000 0.00 0.00 0.00 2.73
2233 4491 3.006967 GCATCCGGTCCTCATATGTAGTT 59.993 47.826 0.00 0.00 0.00 2.24
2234 4492 4.503296 GCATCCGGTCCTCATATGTAGTTT 60.503 45.833 0.00 0.00 0.00 2.66
2235 4493 5.611374 CATCCGGTCCTCATATGTAGTTTT 58.389 41.667 0.00 0.00 0.00 2.43
2236 4494 5.687166 TCCGGTCCTCATATGTAGTTTTT 57.313 39.130 0.00 0.00 0.00 1.94
2237 4495 5.667466 TCCGGTCCTCATATGTAGTTTTTC 58.333 41.667 0.00 0.00 0.00 2.29
2238 4496 4.814771 CCGGTCCTCATATGTAGTTTTTCC 59.185 45.833 1.90 0.00 0.00 3.13
2239 4497 5.396436 CCGGTCCTCATATGTAGTTTTTCCT 60.396 44.000 1.90 0.00 0.00 3.36
2240 4498 5.753921 CGGTCCTCATATGTAGTTTTTCCTC 59.246 44.000 1.90 0.00 0.00 3.71
2241 4499 6.407074 CGGTCCTCATATGTAGTTTTTCCTCT 60.407 42.308 1.90 0.00 0.00 3.69
2242 4500 7.201884 CGGTCCTCATATGTAGTTTTTCCTCTA 60.202 40.741 1.90 0.00 0.00 2.43
2243 4501 7.927092 GGTCCTCATATGTAGTTTTTCCTCTAC 59.073 40.741 1.90 0.00 37.58 2.59
2244 4502 8.697292 GTCCTCATATGTAGTTTTTCCTCTACT 58.303 37.037 1.90 0.00 37.83 2.57
2245 4503 8.915036 TCCTCATATGTAGTTTTTCCTCTACTC 58.085 37.037 1.90 0.00 37.83 2.59
2246 4504 8.919145 CCTCATATGTAGTTTTTCCTCTACTCT 58.081 37.037 1.90 0.00 37.83 3.24
2247 4505 9.743057 CTCATATGTAGTTTTTCCTCTACTCTG 57.257 37.037 1.90 0.00 37.83 3.35
2248 4506 9.256228 TCATATGTAGTTTTTCCTCTACTCTGT 57.744 33.333 1.90 0.00 37.83 3.41
2249 4507 9.877178 CATATGTAGTTTTTCCTCTACTCTGTT 57.123 33.333 0.00 0.00 37.83 3.16
2251 4509 7.598759 TGTAGTTTTTCCTCTACTCTGTTCT 57.401 36.000 0.00 0.00 37.83 3.01
2252 4510 7.659186 TGTAGTTTTTCCTCTACTCTGTTCTC 58.341 38.462 0.00 0.00 37.83 2.87
2253 4511 6.732896 AGTTTTTCCTCTACTCTGTTCTCA 57.267 37.500 0.00 0.00 0.00 3.27
2254 4512 6.754193 AGTTTTTCCTCTACTCTGTTCTCAG 58.246 40.000 0.00 0.00 42.54 3.35
2255 4513 5.730296 TTTTCCTCTACTCTGTTCTCAGG 57.270 43.478 0.00 0.00 41.59 3.86
2256 4514 4.659529 TTCCTCTACTCTGTTCTCAGGA 57.340 45.455 0.00 0.00 41.59 3.86
2257 4515 3.958018 TCCTCTACTCTGTTCTCAGGAC 58.042 50.000 0.00 0.00 41.59 3.85
2258 4516 2.680841 CCTCTACTCTGTTCTCAGGACG 59.319 54.545 0.00 0.00 41.59 4.79
2259 4517 2.680841 CTCTACTCTGTTCTCAGGACGG 59.319 54.545 0.00 0.00 41.59 4.79
2260 4518 2.040012 TCTACTCTGTTCTCAGGACGGT 59.960 50.000 0.00 0.00 41.59 4.83
2261 4519 1.705873 ACTCTGTTCTCAGGACGGTT 58.294 50.000 0.00 0.00 41.59 4.44
2262 4520 1.341531 ACTCTGTTCTCAGGACGGTTG 59.658 52.381 0.00 0.00 41.59 3.77
2263 4521 1.613925 CTCTGTTCTCAGGACGGTTGA 59.386 52.381 0.00 0.00 41.59 3.18
2264 4522 2.232452 CTCTGTTCTCAGGACGGTTGAT 59.768 50.000 0.00 0.00 41.59 2.57
2265 4523 2.029020 TCTGTTCTCAGGACGGTTGATG 60.029 50.000 0.00 0.00 41.59 3.07
2266 4524 1.967779 TGTTCTCAGGACGGTTGATGA 59.032 47.619 0.00 0.00 0.00 2.92
2267 4525 2.029020 TGTTCTCAGGACGGTTGATGAG 60.029 50.000 10.28 10.28 40.42 2.90
2268 4526 0.532573 TCTCAGGACGGTTGATGAGC 59.467 55.000 11.23 0.00 39.21 4.26
2269 4527 0.534412 CTCAGGACGGTTGATGAGCT 59.466 55.000 0.00 0.00 33.41 4.09
2270 4528 0.976641 TCAGGACGGTTGATGAGCTT 59.023 50.000 0.00 0.00 0.00 3.74
2271 4529 1.081892 CAGGACGGTTGATGAGCTTG 58.918 55.000 0.00 0.00 0.00 4.01
2272 4530 0.036010 AGGACGGTTGATGAGCTTGG 60.036 55.000 0.00 0.00 0.00 3.61
2273 4531 0.036388 GGACGGTTGATGAGCTTGGA 60.036 55.000 0.00 0.00 0.00 3.53
2274 4532 1.407437 GGACGGTTGATGAGCTTGGAT 60.407 52.381 0.00 0.00 0.00 3.41
2275 4533 2.359900 GACGGTTGATGAGCTTGGATT 58.640 47.619 0.00 0.00 0.00 3.01
2276 4534 3.531538 GACGGTTGATGAGCTTGGATTA 58.468 45.455 0.00 0.00 0.00 1.75
2277 4535 3.535561 ACGGTTGATGAGCTTGGATTAG 58.464 45.455 0.00 0.00 0.00 1.73
2278 4536 3.197766 ACGGTTGATGAGCTTGGATTAGA 59.802 43.478 0.00 0.00 0.00 2.10
2279 4537 4.141620 ACGGTTGATGAGCTTGGATTAGAT 60.142 41.667 0.00 0.00 0.00 1.98
2280 4538 5.070446 ACGGTTGATGAGCTTGGATTAGATA 59.930 40.000 0.00 0.00 0.00 1.98
2281 4539 5.636965 CGGTTGATGAGCTTGGATTAGATAG 59.363 44.000 0.00 0.00 0.00 2.08
2282 4540 5.411053 GGTTGATGAGCTTGGATTAGATAGC 59.589 44.000 0.00 0.00 0.00 2.97
2283 4541 6.229733 GTTGATGAGCTTGGATTAGATAGCT 58.770 40.000 0.00 0.00 46.02 3.32
2288 4546 5.885449 AGCTTGGATTAGATAGCTCAACT 57.115 39.130 0.00 0.00 39.67 3.16
2289 4547 5.609423 AGCTTGGATTAGATAGCTCAACTG 58.391 41.667 0.00 0.00 39.67 3.16
2290 4548 5.130145 AGCTTGGATTAGATAGCTCAACTGT 59.870 40.000 0.00 0.00 39.67 3.55
2291 4549 5.819901 GCTTGGATTAGATAGCTCAACTGTT 59.180 40.000 0.00 0.00 0.00 3.16
2292 4550 6.317391 GCTTGGATTAGATAGCTCAACTGTTT 59.683 38.462 0.00 0.00 0.00 2.83
2293 4551 7.466590 GCTTGGATTAGATAGCTCAACTGTTTC 60.467 40.741 0.00 0.00 0.00 2.78
2294 4552 6.946340 TGGATTAGATAGCTCAACTGTTTCA 58.054 36.000 0.00 0.00 0.00 2.69
2295 4553 7.044181 TGGATTAGATAGCTCAACTGTTTCAG 58.956 38.462 0.00 0.00 37.52 3.02
2296 4554 6.481644 GGATTAGATAGCTCAACTGTTTCAGG 59.518 42.308 0.00 0.00 35.51 3.86
2297 4555 4.899352 AGATAGCTCAACTGTTTCAGGT 57.101 40.909 0.00 6.30 35.51 4.00
2298 4556 7.476540 TTAGATAGCTCAACTGTTTCAGGTA 57.523 36.000 9.44 9.44 35.51 3.08
2299 4557 6.552445 AGATAGCTCAACTGTTTCAGGTAT 57.448 37.500 15.69 15.69 35.51 2.73
2300 4558 6.344500 AGATAGCTCAACTGTTTCAGGTATG 58.656 40.000 18.69 0.00 35.51 2.39
2301 4559 4.357918 AGCTCAACTGTTTCAGGTATGT 57.642 40.909 0.00 0.00 35.51 2.29
2302 4560 4.718961 AGCTCAACTGTTTCAGGTATGTT 58.281 39.130 0.00 0.00 35.51 2.71
2303 4561 4.516698 AGCTCAACTGTTTCAGGTATGTTG 59.483 41.667 0.00 0.00 35.51 3.33
2304 4562 4.787598 CTCAACTGTTTCAGGTATGTTGC 58.212 43.478 0.00 0.00 35.51 4.17
2305 4563 4.460263 TCAACTGTTTCAGGTATGTTGCT 58.540 39.130 0.00 0.00 35.51 3.91
2306 4564 4.275689 TCAACTGTTTCAGGTATGTTGCTG 59.724 41.667 0.00 0.00 35.51 4.41
2307 4565 3.820557 ACTGTTTCAGGTATGTTGCTGT 58.179 40.909 1.90 0.00 35.51 4.40
2308 4566 3.815401 ACTGTTTCAGGTATGTTGCTGTC 59.185 43.478 1.90 0.00 35.51 3.51
2309 4567 3.814625 TGTTTCAGGTATGTTGCTGTCA 58.185 40.909 0.00 0.00 0.00 3.58
2310 4568 4.397420 TGTTTCAGGTATGTTGCTGTCAT 58.603 39.130 0.00 0.00 0.00 3.06
2311 4569 4.826733 TGTTTCAGGTATGTTGCTGTCATT 59.173 37.500 0.00 0.00 0.00 2.57
2312 4570 5.048782 TGTTTCAGGTATGTTGCTGTCATTC 60.049 40.000 0.00 0.00 0.00 2.67
2313 4571 4.558226 TCAGGTATGTTGCTGTCATTCT 57.442 40.909 0.00 0.00 0.00 2.40
2314 4572 4.507710 TCAGGTATGTTGCTGTCATTCTC 58.492 43.478 0.00 0.00 0.00 2.87
2315 4573 4.223700 TCAGGTATGTTGCTGTCATTCTCT 59.776 41.667 0.00 0.00 0.00 3.10
2316 4574 5.422012 TCAGGTATGTTGCTGTCATTCTCTA 59.578 40.000 0.00 0.00 0.00 2.43
2317 4575 6.098838 TCAGGTATGTTGCTGTCATTCTCTAT 59.901 38.462 0.00 0.00 0.00 1.98
2318 4576 6.423302 CAGGTATGTTGCTGTCATTCTCTATC 59.577 42.308 0.00 0.00 0.00 2.08
2319 4577 6.326064 AGGTATGTTGCTGTCATTCTCTATCT 59.674 38.462 0.00 0.00 0.00 1.98
2320 4578 6.644592 GGTATGTTGCTGTCATTCTCTATCTC 59.355 42.308 0.00 0.00 0.00 2.75
2321 4579 5.929058 TGTTGCTGTCATTCTCTATCTCT 57.071 39.130 0.00 0.00 0.00 3.10
2322 4580 6.291648 TGTTGCTGTCATTCTCTATCTCTT 57.708 37.500 0.00 0.00 0.00 2.85
2323 4581 6.104665 TGTTGCTGTCATTCTCTATCTCTTG 58.895 40.000 0.00 0.00 0.00 3.02
2324 4582 5.929058 TGCTGTCATTCTCTATCTCTTGT 57.071 39.130 0.00 0.00 0.00 3.16
2325 4583 7.093771 TGTTGCTGTCATTCTCTATCTCTTGTA 60.094 37.037 0.00 0.00 0.00 2.41
2326 4584 6.800543 TGCTGTCATTCTCTATCTCTTGTAC 58.199 40.000 0.00 0.00 0.00 2.90
2327 4585 6.183360 TGCTGTCATTCTCTATCTCTTGTACC 60.183 42.308 0.00 0.00 0.00 3.34
2328 4586 6.378710 TGTCATTCTCTATCTCTTGTACCG 57.621 41.667 0.00 0.00 0.00 4.02
2329 4587 5.299531 TGTCATTCTCTATCTCTTGTACCGG 59.700 44.000 0.00 0.00 0.00 5.28
2330 4588 4.278669 TCATTCTCTATCTCTTGTACCGGC 59.721 45.833 0.00 0.00 0.00 6.13
2331 4589 3.579534 TCTCTATCTCTTGTACCGGCT 57.420 47.619 0.00 0.00 0.00 5.52
2332 4590 4.701651 TCTCTATCTCTTGTACCGGCTA 57.298 45.455 0.00 0.00 0.00 3.93
2333 4591 4.643463 TCTCTATCTCTTGTACCGGCTAG 58.357 47.826 0.00 0.00 0.00 3.42
2334 4592 4.347292 TCTCTATCTCTTGTACCGGCTAGA 59.653 45.833 0.00 0.00 0.00 2.43
2335 4593 5.013287 TCTCTATCTCTTGTACCGGCTAGAT 59.987 44.000 0.00 3.75 0.00 1.98
2336 4594 5.632118 TCTATCTCTTGTACCGGCTAGATT 58.368 41.667 0.00 0.00 0.00 2.40
2337 4595 4.857509 ATCTCTTGTACCGGCTAGATTC 57.142 45.455 0.00 0.00 0.00 2.52
2338 4596 3.628008 TCTCTTGTACCGGCTAGATTCA 58.372 45.455 0.00 0.00 0.00 2.57
2339 4597 3.632604 TCTCTTGTACCGGCTAGATTCAG 59.367 47.826 0.00 0.00 0.00 3.02
2340 4598 3.362706 TCTTGTACCGGCTAGATTCAGT 58.637 45.455 0.00 0.00 0.00 3.41
2341 4599 3.130516 TCTTGTACCGGCTAGATTCAGTG 59.869 47.826 0.00 0.00 0.00 3.66
2342 4600 1.136305 TGTACCGGCTAGATTCAGTGC 59.864 52.381 0.00 0.00 0.00 4.40
2343 4601 1.136305 GTACCGGCTAGATTCAGTGCA 59.864 52.381 0.00 0.00 0.00 4.57
2344 4602 0.833287 ACCGGCTAGATTCAGTGCAT 59.167 50.000 0.00 0.00 0.00 3.96
2345 4603 1.202580 ACCGGCTAGATTCAGTGCATC 60.203 52.381 0.00 0.00 0.00 3.91
2346 4604 1.202568 CCGGCTAGATTCAGTGCATCA 60.203 52.381 5.55 0.00 0.00 3.07
2347 4605 2.549563 CCGGCTAGATTCAGTGCATCAT 60.550 50.000 5.55 0.00 0.00 2.45
2348 4606 2.735663 CGGCTAGATTCAGTGCATCATC 59.264 50.000 5.55 0.00 0.00 2.92
2349 4607 3.072944 GGCTAGATTCAGTGCATCATCC 58.927 50.000 5.55 0.00 0.00 3.51
2350 4608 3.072944 GCTAGATTCAGTGCATCATCCC 58.927 50.000 5.55 0.00 0.00 3.85
2351 4609 3.495629 GCTAGATTCAGTGCATCATCCCA 60.496 47.826 5.55 0.00 0.00 4.37
2352 4610 3.210232 AGATTCAGTGCATCATCCCAG 57.790 47.619 5.55 0.00 0.00 4.45
2353 4611 2.775960 AGATTCAGTGCATCATCCCAGA 59.224 45.455 5.55 0.00 0.00 3.86
2354 4612 3.394940 AGATTCAGTGCATCATCCCAGAT 59.605 43.478 5.55 0.00 0.00 2.90
2355 4613 3.657398 TTCAGTGCATCATCCCAGATT 57.343 42.857 0.00 0.00 0.00 2.40
2356 4614 3.204306 TCAGTGCATCATCCCAGATTC 57.796 47.619 0.00 0.00 0.00 2.52
2357 4615 2.158711 TCAGTGCATCATCCCAGATTCC 60.159 50.000 0.00 0.00 0.00 3.01
2358 4616 1.144503 AGTGCATCATCCCAGATTCCC 59.855 52.381 0.00 0.00 0.00 3.97
2359 4617 1.133699 GTGCATCATCCCAGATTCCCA 60.134 52.381 0.00 0.00 0.00 4.37
2360 4618 1.144298 TGCATCATCCCAGATTCCCAG 59.856 52.381 0.00 0.00 0.00 4.45
2361 4619 1.547223 GCATCATCCCAGATTCCCAGG 60.547 57.143 0.00 0.00 0.00 4.45
2362 4620 2.060275 CATCATCCCAGATTCCCAGGA 58.940 52.381 0.00 0.00 0.00 3.86
2363 4621 2.520188 TCATCCCAGATTCCCAGGAT 57.480 50.000 0.00 0.00 39.76 3.24
2364 4622 2.342659 TCATCCCAGATTCCCAGGATC 58.657 52.381 0.00 0.00 36.99 3.36
2365 4623 2.089753 TCATCCCAGATTCCCAGGATCT 60.090 50.000 0.00 0.00 36.99 2.75
2366 4624 2.594536 TCCCAGATTCCCAGGATCTT 57.405 50.000 0.00 0.00 0.00 2.40
2367 4625 3.724966 TCCCAGATTCCCAGGATCTTA 57.275 47.619 0.00 0.00 0.00 2.10
2368 4626 3.318313 TCCCAGATTCCCAGGATCTTAC 58.682 50.000 0.00 0.00 0.00 2.34
2369 4627 2.373502 CCCAGATTCCCAGGATCTTACC 59.626 54.545 0.00 0.00 0.00 2.85
2370 4628 3.321950 CCAGATTCCCAGGATCTTACCT 58.678 50.000 0.00 0.00 41.43 3.08
2371 4629 3.718956 CCAGATTCCCAGGATCTTACCTT 59.281 47.826 0.00 0.00 38.32 3.50
2372 4630 4.907875 CCAGATTCCCAGGATCTTACCTTA 59.092 45.833 0.00 0.00 38.32 2.69
2373 4631 5.012561 CCAGATTCCCAGGATCTTACCTTAG 59.987 48.000 0.00 0.00 38.32 2.18
2374 4632 5.841237 CAGATTCCCAGGATCTTACCTTAGA 59.159 44.000 0.00 0.00 38.32 2.10
2375 4633 6.500049 CAGATTCCCAGGATCTTACCTTAGAT 59.500 42.308 0.00 0.00 38.32 1.98
2376 4634 7.017056 CAGATTCCCAGGATCTTACCTTAGATT 59.983 40.741 0.00 0.00 38.32 2.40
2377 4635 7.574372 AGATTCCCAGGATCTTACCTTAGATTT 59.426 37.037 0.00 0.00 38.32 2.17
2378 4636 8.814448 ATTCCCAGGATCTTACCTTAGATTTA 57.186 34.615 0.00 0.00 38.32 1.40
2379 4637 7.613551 TCCCAGGATCTTACCTTAGATTTAC 57.386 40.000 0.00 0.00 38.32 2.01
2380 4638 7.136885 TCCCAGGATCTTACCTTAGATTTACA 58.863 38.462 0.00 0.00 38.32 2.41
2381 4639 7.794683 TCCCAGGATCTTACCTTAGATTTACAT 59.205 37.037 0.00 0.00 38.32 2.29
2382 4640 8.440771 CCCAGGATCTTACCTTAGATTTACATT 58.559 37.037 0.00 0.00 38.32 2.71
2383 4641 9.277783 CCAGGATCTTACCTTAGATTTACATTG 57.722 37.037 0.00 0.00 38.32 2.82
2384 4642 9.277783 CAGGATCTTACCTTAGATTTACATTGG 57.722 37.037 0.00 0.00 38.32 3.16
2385 4643 7.939588 AGGATCTTACCTTAGATTTACATTGGC 59.060 37.037 0.00 0.00 36.86 4.52
2386 4644 7.719633 GGATCTTACCTTAGATTTACATTGGCA 59.280 37.037 0.00 0.00 35.06 4.92
2387 4645 9.120538 GATCTTACCTTAGATTTACATTGGCAA 57.879 33.333 0.68 0.68 35.06 4.52
2388 4646 8.276252 TCTTACCTTAGATTTACATTGGCAAC 57.724 34.615 0.00 0.00 0.00 4.17
2420 4678 9.672673 AGTTGAATATACTTTCACTTATGCAGT 57.327 29.630 0.00 0.00 35.42 4.40
2434 4692 8.915871 CACTTATGCAGTGCAAAAATACTAAT 57.084 30.769 23.90 3.64 46.70 1.73
2435 4693 9.013490 CACTTATGCAGTGCAAAAATACTAATC 57.987 33.333 23.90 0.00 46.70 1.75
2436 4694 8.739039 ACTTATGCAGTGCAAAAATACTAATCA 58.261 29.630 23.90 0.00 43.62 2.57
2437 4695 9.740239 CTTATGCAGTGCAAAAATACTAATCAT 57.260 29.630 23.90 2.35 43.62 2.45
2438 4696 7.997107 ATGCAGTGCAAAAATACTAATCATG 57.003 32.000 23.90 0.00 43.62 3.07
2439 4697 6.923012 TGCAGTGCAAAAATACTAATCATGT 58.077 32.000 17.26 0.00 34.76 3.21
2440 4698 6.807720 TGCAGTGCAAAAATACTAATCATGTG 59.192 34.615 17.26 0.00 34.76 3.21
2441 4699 6.237648 GCAGTGCAAAAATACTAATCATGTGC 60.238 38.462 11.09 0.00 0.00 4.57
2442 4700 6.021232 CAGTGCAAAAATACTAATCATGTGCG 60.021 38.462 0.00 0.00 32.19 5.34
2443 4701 4.797868 TGCAAAAATACTAATCATGTGCGC 59.202 37.500 0.00 0.00 32.19 6.09
2444 4702 5.036737 GCAAAAATACTAATCATGTGCGCT 58.963 37.500 9.73 0.00 0.00 5.92
2445 4703 5.052172 GCAAAAATACTAATCATGTGCGCTG 60.052 40.000 9.73 0.00 0.00 5.18
2446 4704 6.257423 CAAAAATACTAATCATGTGCGCTGA 58.743 36.000 9.73 4.26 0.00 4.26
2447 4705 6.624352 AAAATACTAATCATGTGCGCTGAT 57.376 33.333 9.73 6.91 34.86 2.90
2448 4706 5.602458 AATACTAATCATGTGCGCTGATG 57.398 39.130 9.73 10.92 33.69 3.07
2449 4707 1.600957 ACTAATCATGTGCGCTGATGC 59.399 47.619 9.73 0.00 33.69 3.91
2450 4708 1.600485 CTAATCATGTGCGCTGATGCA 59.400 47.619 9.73 0.00 43.95 3.96
2458 4716 2.888834 TGCGCTGATGCAGTATCTAA 57.111 45.000 9.73 0.00 40.62 2.10
2459 4717 3.177997 TGCGCTGATGCAGTATCTAAA 57.822 42.857 9.73 0.00 40.62 1.85
2460 4718 2.866156 TGCGCTGATGCAGTATCTAAAC 59.134 45.455 9.73 0.00 40.62 2.01
2461 4719 2.866156 GCGCTGATGCAGTATCTAAACA 59.134 45.455 0.00 0.00 39.64 2.83
2462 4720 3.302740 GCGCTGATGCAGTATCTAAACAC 60.303 47.826 0.00 0.00 39.64 3.32
2463 4721 3.060940 CGCTGATGCAGTATCTAAACACG 60.061 47.826 0.00 0.00 39.64 4.49
2464 4722 3.865745 GCTGATGCAGTATCTAAACACGT 59.134 43.478 0.00 0.00 39.41 4.49
2465 4723 4.259970 GCTGATGCAGTATCTAAACACGTG 60.260 45.833 15.48 15.48 39.41 4.49
2466 4724 3.616821 TGATGCAGTATCTAAACACGTGC 59.383 43.478 17.22 0.00 36.71 5.34
2467 4725 3.033368 TGCAGTATCTAAACACGTGCA 57.967 42.857 17.22 0.00 37.12 4.57
2468 4726 2.734606 TGCAGTATCTAAACACGTGCAC 59.265 45.455 17.22 6.82 34.65 4.57
2469 4727 2.993899 GCAGTATCTAAACACGTGCACT 59.006 45.455 17.22 2.35 0.00 4.40
2470 4728 3.181530 GCAGTATCTAAACACGTGCACTG 60.182 47.826 17.22 16.58 36.18 3.66
2471 4729 2.993899 AGTATCTAAACACGTGCACTGC 59.006 45.455 17.22 0.00 0.00 4.40
2472 4730 1.877637 ATCTAAACACGTGCACTGCA 58.122 45.000 17.22 0.00 35.60 4.41
2473 4731 1.217001 TCTAAACACGTGCACTGCAG 58.783 50.000 17.22 13.48 40.08 4.41
2474 4732 1.202475 TCTAAACACGTGCACTGCAGA 60.202 47.619 23.35 11.88 40.08 4.26
2475 4733 1.597195 CTAAACACGTGCACTGCAGAA 59.403 47.619 23.35 2.14 40.08 3.02
2476 4734 0.098728 AAACACGTGCACTGCAGAAC 59.901 50.000 23.35 14.18 40.08 3.01
2477 4735 1.024046 AACACGTGCACTGCAGAACA 61.024 50.000 23.35 15.02 40.08 3.18
2478 4736 0.815213 ACACGTGCACTGCAGAACAT 60.815 50.000 23.35 0.80 40.08 2.71
2479 4737 0.385098 CACGTGCACTGCAGAACATG 60.385 55.000 23.35 22.95 40.08 3.21
2480 4738 0.815213 ACGTGCACTGCAGAACATGT 60.815 50.000 23.35 23.58 40.08 3.21
2481 4739 1.147473 CGTGCACTGCAGAACATGTA 58.853 50.000 23.35 4.53 40.08 2.29
2482 4740 1.136252 CGTGCACTGCAGAACATGTAC 60.136 52.381 23.35 16.19 40.08 2.90
2483 4741 2.146342 GTGCACTGCAGAACATGTACT 58.854 47.619 23.35 0.00 40.08 2.73
2484 4742 3.325870 GTGCACTGCAGAACATGTACTA 58.674 45.455 23.35 0.00 40.08 1.82
2485 4743 3.745975 GTGCACTGCAGAACATGTACTAA 59.254 43.478 23.35 0.00 40.08 2.24
2486 4744 4.393062 GTGCACTGCAGAACATGTACTAAT 59.607 41.667 23.35 0.00 40.08 1.73
2487 4745 4.631377 TGCACTGCAGAACATGTACTAATC 59.369 41.667 23.35 0.00 33.32 1.75
2488 4746 4.259970 GCACTGCAGAACATGTACTAATCG 60.260 45.833 23.35 0.00 0.00 3.34
2489 4747 4.864806 CACTGCAGAACATGTACTAATCGT 59.135 41.667 23.35 0.00 0.00 3.73
2490 4748 6.033966 CACTGCAGAACATGTACTAATCGTA 58.966 40.000 23.35 0.00 0.00 3.43
2491 4749 6.697455 CACTGCAGAACATGTACTAATCGTAT 59.303 38.462 23.35 0.00 0.00 3.06
2492 4750 7.222805 CACTGCAGAACATGTACTAATCGTATT 59.777 37.037 23.35 0.00 0.00 1.89
2493 4751 7.222805 ACTGCAGAACATGTACTAATCGTATTG 59.777 37.037 23.35 0.00 0.00 1.90
2494 4752 7.262048 TGCAGAACATGTACTAATCGTATTGA 58.738 34.615 0.00 0.00 0.00 2.57
2495 4753 7.222031 TGCAGAACATGTACTAATCGTATTGAC 59.778 37.037 0.00 0.00 0.00 3.18
2496 4754 7.306632 GCAGAACATGTACTAATCGTATTGACC 60.307 40.741 0.00 0.00 0.00 4.02
2497 4755 7.704899 CAGAACATGTACTAATCGTATTGACCA 59.295 37.037 0.00 0.00 0.00 4.02
2498 4756 8.421784 AGAACATGTACTAATCGTATTGACCAT 58.578 33.333 0.00 0.00 0.00 3.55
2499 4757 7.946655 ACATGTACTAATCGTATTGACCATG 57.053 36.000 0.00 0.00 35.42 3.66
2500 4758 6.423905 ACATGTACTAATCGTATTGACCATGC 59.576 38.462 0.00 0.00 33.91 4.06
2501 4759 5.294356 TGTACTAATCGTATTGACCATGCC 58.706 41.667 0.00 0.00 0.00 4.40
2502 4760 4.415881 ACTAATCGTATTGACCATGCCA 57.584 40.909 0.00 0.00 0.00 4.92
2503 4761 4.973168 ACTAATCGTATTGACCATGCCAT 58.027 39.130 0.00 0.00 0.00 4.40
2504 4762 5.376625 ACTAATCGTATTGACCATGCCATT 58.623 37.500 0.00 0.00 0.00 3.16
2505 4763 4.836125 AATCGTATTGACCATGCCATTC 57.164 40.909 0.00 0.00 0.00 2.67
2506 4764 3.274095 TCGTATTGACCATGCCATTCA 57.726 42.857 0.00 0.00 0.00 2.57
2507 4765 3.615155 TCGTATTGACCATGCCATTCAA 58.385 40.909 0.00 0.00 33.89 2.69
2508 4766 3.376859 TCGTATTGACCATGCCATTCAAC 59.623 43.478 0.00 0.00 32.21 3.18
2509 4767 3.128415 CGTATTGACCATGCCATTCAACA 59.872 43.478 0.00 0.00 32.21 3.33
2510 4768 4.380339 CGTATTGACCATGCCATTCAACAA 60.380 41.667 0.00 0.00 32.21 2.83
2511 4769 3.383620 TTGACCATGCCATTCAACAAC 57.616 42.857 0.00 0.00 0.00 3.32
2512 4770 1.269174 TGACCATGCCATTCAACAACG 59.731 47.619 0.00 0.00 0.00 4.10
2513 4771 1.539388 GACCATGCCATTCAACAACGA 59.461 47.619 0.00 0.00 0.00 3.85
2514 4772 1.959985 ACCATGCCATTCAACAACGAA 59.040 42.857 0.00 0.00 0.00 3.85
2515 4773 2.288152 ACCATGCCATTCAACAACGAAC 60.288 45.455 0.00 0.00 0.00 3.95
2516 4774 2.030007 CCATGCCATTCAACAACGAACT 60.030 45.455 0.00 0.00 0.00 3.01
2517 4775 2.772568 TGCCATTCAACAACGAACTG 57.227 45.000 0.00 0.00 0.00 3.16
2518 4776 2.293170 TGCCATTCAACAACGAACTGA 58.707 42.857 0.00 0.00 0.00 3.41
2519 4777 2.290367 TGCCATTCAACAACGAACTGAG 59.710 45.455 0.00 0.00 0.00 3.35
2520 4778 2.548057 GCCATTCAACAACGAACTGAGA 59.452 45.455 0.00 0.00 0.00 3.27
2521 4779 3.607078 GCCATTCAACAACGAACTGAGAC 60.607 47.826 0.00 0.00 0.00 3.36
2522 4780 3.559655 CCATTCAACAACGAACTGAGACA 59.440 43.478 0.00 0.00 0.00 3.41
2523 4781 4.518217 CATTCAACAACGAACTGAGACAC 58.482 43.478 0.00 0.00 0.00 3.67
2524 4782 3.239587 TCAACAACGAACTGAGACACA 57.760 42.857 0.00 0.00 0.00 3.72
2525 4783 3.792401 TCAACAACGAACTGAGACACAT 58.208 40.909 0.00 0.00 0.00 3.21
2526 4784 4.939271 TCAACAACGAACTGAGACACATA 58.061 39.130 0.00 0.00 0.00 2.29
2527 4785 5.538118 TCAACAACGAACTGAGACACATAT 58.462 37.500 0.00 0.00 0.00 1.78
2528 4786 5.405269 TCAACAACGAACTGAGACACATATG 59.595 40.000 0.00 0.00 0.00 1.78
2529 4787 5.134202 ACAACGAACTGAGACACATATGA 57.866 39.130 10.38 0.00 0.00 2.15
2530 4788 5.538118 ACAACGAACTGAGACACATATGAA 58.462 37.500 10.38 0.00 0.00 2.57
2531 4789 5.989168 ACAACGAACTGAGACACATATGAAA 59.011 36.000 10.38 0.00 0.00 2.69
2532 4790 6.650807 ACAACGAACTGAGACACATATGAAAT 59.349 34.615 10.38 0.00 0.00 2.17
2533 4791 6.653273 ACGAACTGAGACACATATGAAATG 57.347 37.500 10.38 0.00 0.00 2.32
2534 4792 6.166279 ACGAACTGAGACACATATGAAATGT 58.834 36.000 10.38 3.18 0.00 2.71
2535 4793 6.650807 ACGAACTGAGACACATATGAAATGTT 59.349 34.615 10.38 5.04 0.00 2.71
2536 4794 6.957635 CGAACTGAGACACATATGAAATGTTG 59.042 38.462 10.38 0.00 0.00 3.33
2537 4795 7.360353 CGAACTGAGACACATATGAAATGTTGT 60.360 37.037 10.38 1.56 0.00 3.32
2538 4796 8.846943 AACTGAGACACATATGAAATGTTGTA 57.153 30.769 10.38 0.00 0.00 2.41
2539 4797 9.453572 AACTGAGACACATATGAAATGTTGTAT 57.546 29.630 10.38 0.00 0.00 2.29
2540 4798 8.886719 ACTGAGACACATATGAAATGTTGTATG 58.113 33.333 10.38 0.00 0.00 2.39
2541 4799 9.101655 CTGAGACACATATGAAATGTTGTATGA 57.898 33.333 10.38 0.00 0.00 2.15
2542 4800 9.617523 TGAGACACATATGAAATGTTGTATGAT 57.382 29.630 10.38 0.00 0.00 2.45
2569 4827 9.809096 ATCACAACTATATCATAATCGGATCAC 57.191 33.333 0.00 0.00 0.00 3.06
2570 4828 9.025041 TCACAACTATATCATAATCGGATCACT 57.975 33.333 0.00 0.00 0.00 3.41
2571 4829 9.295214 CACAACTATATCATAATCGGATCACTC 57.705 37.037 0.00 0.00 0.00 3.51
2572 4830 9.025041 ACAACTATATCATAATCGGATCACTCA 57.975 33.333 0.00 0.00 0.00 3.41
2581 4839 9.371136 TCATAATCGGATCACTCATTATTTAGC 57.629 33.333 0.00 0.00 0.00 3.09
2582 4840 9.376075 CATAATCGGATCACTCATTATTTAGCT 57.624 33.333 0.00 0.00 0.00 3.32
2583 4841 9.950496 ATAATCGGATCACTCATTATTTAGCTT 57.050 29.630 0.00 0.00 0.00 3.74
2584 4842 8.682936 AATCGGATCACTCATTATTTAGCTTT 57.317 30.769 0.00 0.00 0.00 3.51
2585 4843 8.682936 ATCGGATCACTCATTATTTAGCTTTT 57.317 30.769 0.00 0.00 0.00 2.27
2586 4844 8.506168 TCGGATCACTCATTATTTAGCTTTTT 57.494 30.769 0.00 0.00 0.00 1.94
2587 4845 8.612619 TCGGATCACTCATTATTTAGCTTTTTC 58.387 33.333 0.00 0.00 0.00 2.29
2588 4846 8.616076 CGGATCACTCATTATTTAGCTTTTTCT 58.384 33.333 0.00 0.00 0.00 2.52
2602 4860 8.716646 TTAGCTTTTTCTTTTTCTTTCTTGGG 57.283 30.769 0.00 0.00 0.00 4.12
2603 4861 5.586243 AGCTTTTTCTTTTTCTTTCTTGGGC 59.414 36.000 0.00 0.00 0.00 5.36
2604 4862 5.586243 GCTTTTTCTTTTTCTTTCTTGGGCT 59.414 36.000 0.00 0.00 0.00 5.19
2605 4863 6.761242 GCTTTTTCTTTTTCTTTCTTGGGCTA 59.239 34.615 0.00 0.00 0.00 3.93
2606 4864 7.279981 GCTTTTTCTTTTTCTTTCTTGGGCTAA 59.720 33.333 0.00 0.00 0.00 3.09
2607 4865 9.330063 CTTTTTCTTTTTCTTTCTTGGGCTAAT 57.670 29.630 0.00 0.00 0.00 1.73
2608 4866 9.679661 TTTTTCTTTTTCTTTCTTGGGCTAATT 57.320 25.926 0.00 0.00 0.00 1.40
2610 4868 9.981114 TTTCTTTTTCTTTCTTGGGCTAATTAG 57.019 29.630 8.20 8.20 0.00 1.73
2611 4869 8.706322 TCTTTTTCTTTCTTGGGCTAATTAGT 57.294 30.769 13.91 0.00 0.00 2.24
2612 4870 9.143155 TCTTTTTCTTTCTTGGGCTAATTAGTT 57.857 29.630 13.91 0.00 0.00 2.24
2616 4874 7.625828 TCTTTCTTGGGCTAATTAGTTAAGC 57.374 36.000 13.91 1.44 0.00 3.09
2617 4875 7.172342 TCTTTCTTGGGCTAATTAGTTAAGCA 58.828 34.615 13.91 4.57 0.00 3.91
2618 4876 6.753107 TTCTTGGGCTAATTAGTTAAGCAC 57.247 37.500 13.91 3.42 0.00 4.40
2619 4877 6.062258 TCTTGGGCTAATTAGTTAAGCACT 57.938 37.500 13.91 0.00 39.87 4.40
2620 4878 6.481643 TCTTGGGCTAATTAGTTAAGCACTT 58.518 36.000 13.91 0.00 36.88 3.16
2621 4879 6.598064 TCTTGGGCTAATTAGTTAAGCACTTC 59.402 38.462 13.91 0.00 36.88 3.01
2622 4880 4.873827 TGGGCTAATTAGTTAAGCACTTCG 59.126 41.667 13.91 0.00 36.88 3.79
2623 4881 4.260661 GGGCTAATTAGTTAAGCACTTCGC 60.261 45.833 13.91 0.00 36.88 4.70
2624 4882 4.331717 GGCTAATTAGTTAAGCACTTCGCA 59.668 41.667 13.91 0.00 46.13 5.10
2625 4883 5.007724 GGCTAATTAGTTAAGCACTTCGCAT 59.992 40.000 13.91 0.00 46.13 4.73
2626 4884 6.458342 GGCTAATTAGTTAAGCACTTCGCATT 60.458 38.462 13.91 0.00 46.13 3.56
2627 4885 6.629252 GCTAATTAGTTAAGCACTTCGCATTC 59.371 38.462 13.91 0.00 46.13 2.67
2628 4886 4.939509 TTAGTTAAGCACTTCGCATTCC 57.060 40.909 0.00 0.00 46.13 3.01
2629 4887 3.059352 AGTTAAGCACTTCGCATTCCT 57.941 42.857 0.00 0.00 46.13 3.36
2630 4888 3.412386 AGTTAAGCACTTCGCATTCCTT 58.588 40.909 0.00 0.00 46.13 3.36
2631 4889 3.821033 AGTTAAGCACTTCGCATTCCTTT 59.179 39.130 0.00 0.00 46.13 3.11
2632 4890 2.712057 AAGCACTTCGCATTCCTTTG 57.288 45.000 0.00 0.00 46.13 2.77
2633 4891 1.609208 AGCACTTCGCATTCCTTTGT 58.391 45.000 0.00 0.00 46.13 2.83
2634 4892 1.956477 AGCACTTCGCATTCCTTTGTT 59.044 42.857 0.00 0.00 46.13 2.83
2635 4893 2.362077 AGCACTTCGCATTCCTTTGTTT 59.638 40.909 0.00 0.00 46.13 2.83
2636 4894 3.123050 GCACTTCGCATTCCTTTGTTTT 58.877 40.909 0.00 0.00 41.79 2.43
2637 4895 3.182372 GCACTTCGCATTCCTTTGTTTTC 59.818 43.478 0.00 0.00 41.79 2.29
2638 4896 4.358851 CACTTCGCATTCCTTTGTTTTCA 58.641 39.130 0.00 0.00 0.00 2.69
2639 4897 4.207019 CACTTCGCATTCCTTTGTTTTCAC 59.793 41.667 0.00 0.00 0.00 3.18
2640 4898 4.142271 ACTTCGCATTCCTTTGTTTTCACA 60.142 37.500 0.00 0.00 0.00 3.58
2641 4899 3.963665 TCGCATTCCTTTGTTTTCACAG 58.036 40.909 0.00 0.00 33.22 3.66
2642 4900 3.629855 TCGCATTCCTTTGTTTTCACAGA 59.370 39.130 0.00 0.00 33.22 3.41
2643 4901 4.097135 TCGCATTCCTTTGTTTTCACAGAA 59.903 37.500 0.00 0.00 33.22 3.02
2644 4902 4.803088 CGCATTCCTTTGTTTTCACAGAAA 59.197 37.500 0.00 0.00 33.22 2.52
2645 4903 5.290643 CGCATTCCTTTGTTTTCACAGAAAA 59.709 36.000 1.09 1.09 33.22 2.29
2646 4904 6.183360 CGCATTCCTTTGTTTTCACAGAAAAA 60.183 34.615 6.50 0.00 33.22 1.94
2647 4905 7.465781 CGCATTCCTTTGTTTTCACAGAAAAAT 60.466 33.333 6.50 0.00 33.22 1.82
2648 4906 8.825745 GCATTCCTTTGTTTTCACAGAAAAATA 58.174 29.630 6.50 0.00 33.22 1.40
2651 4909 9.883142 TTCCTTTGTTTTCACAGAAAAATATGT 57.117 25.926 6.50 0.00 33.22 2.29
2652 4910 9.883142 TCCTTTGTTTTCACAGAAAAATATGTT 57.117 25.926 6.50 0.00 33.22 2.71
2653 4911 9.919348 CCTTTGTTTTCACAGAAAAATATGTTG 57.081 29.630 6.50 0.00 33.22 3.33
2656 4914 9.645059 TTGTTTTCACAGAAAAATATGTTGTCA 57.355 25.926 6.50 0.00 33.22 3.58
2657 4915 9.814899 TGTTTTCACAGAAAAATATGTTGTCAT 57.185 25.926 6.50 0.00 38.00 3.06
2660 4918 9.462174 TTTCACAGAAAAATATGTTGTCATGAC 57.538 29.630 19.27 19.27 35.70 3.06
2661 4919 8.164058 TCACAGAAAAATATGTTGTCATGACA 57.836 30.769 24.56 24.56 39.98 3.58
2677 4935 9.730705 TTGTCATGACAATAAAATTCTCTCTCT 57.269 29.630 32.36 0.00 45.42 3.10
2678 4936 9.376075 TGTCATGACAATAAAATTCTCTCTCTC 57.624 33.333 26.02 0.00 38.56 3.20
2679 4937 9.598517 GTCATGACAATAAAATTCTCTCTCTCT 57.401 33.333 21.07 0.00 0.00 3.10
2680 4938 9.814899 TCATGACAATAAAATTCTCTCTCTCTC 57.185 33.333 0.00 0.00 0.00 3.20
2681 4939 9.820725 CATGACAATAAAATTCTCTCTCTCTCT 57.179 33.333 0.00 0.00 0.00 3.10
2683 4941 9.253832 TGACAATAAAATTCTCTCTCTCTCTCT 57.746 33.333 0.00 0.00 0.00 3.10
2684 4942 9.736023 GACAATAAAATTCTCTCTCTCTCTCTC 57.264 37.037 0.00 0.00 0.00 3.20
2685 4943 9.479549 ACAATAAAATTCTCTCTCTCTCTCTCT 57.520 33.333 0.00 0.00 0.00 3.10
2686 4944 9.956720 CAATAAAATTCTCTCTCTCTCTCTCTC 57.043 37.037 0.00 0.00 0.00 3.20
2687 4945 9.927081 AATAAAATTCTCTCTCTCTCTCTCTCT 57.073 33.333 0.00 0.00 0.00 3.10
2688 4946 7.872113 AAAATTCTCTCTCTCTCTCTCTCTC 57.128 40.000 0.00 0.00 0.00 3.20
2689 4947 6.821616 AATTCTCTCTCTCTCTCTCTCTCT 57.178 41.667 0.00 0.00 0.00 3.10
2690 4948 5.860941 TTCTCTCTCTCTCTCTCTCTCTC 57.139 47.826 0.00 0.00 0.00 3.20
2691 4949 5.136068 TCTCTCTCTCTCTCTCTCTCTCT 57.864 47.826 0.00 0.00 0.00 3.10
2692 4950 5.136828 TCTCTCTCTCTCTCTCTCTCTCTC 58.863 50.000 0.00 0.00 0.00 3.20
2693 4951 5.103728 TCTCTCTCTCTCTCTCTCTCTCTCT 60.104 48.000 0.00 0.00 0.00 3.10
2694 4952 6.101881 TCTCTCTCTCTCTCTCTCTCTCTCTA 59.898 46.154 0.00 0.00 0.00 2.43
2695 4953 6.857848 TCTCTCTCTCTCTCTCTCTCTCTAT 58.142 44.000 0.00 0.00 0.00 1.98
2696 4954 7.301420 TCTCTCTCTCTCTCTCTCTCTCTATT 58.699 42.308 0.00 0.00 0.00 1.73
2697 4955 7.786943 TCTCTCTCTCTCTCTCTCTCTCTATTT 59.213 40.741 0.00 0.00 0.00 1.40
2698 4956 8.324191 TCTCTCTCTCTCTCTCTCTCTATTTT 57.676 38.462 0.00 0.00 0.00 1.82
2699 4957 8.772250 TCTCTCTCTCTCTCTCTCTCTATTTTT 58.228 37.037 0.00 0.00 0.00 1.94
2719 4977 3.846423 TTTCGCAATTGAGCAATAGCA 57.154 38.095 10.34 0.00 45.49 3.49
2720 4978 4.374843 TTTCGCAATTGAGCAATAGCAT 57.625 36.364 10.34 0.00 45.49 3.79
2721 4979 4.374843 TTCGCAATTGAGCAATAGCATT 57.625 36.364 10.34 0.00 45.49 3.56
2722 4980 3.697982 TCGCAATTGAGCAATAGCATTG 58.302 40.909 10.34 4.97 45.49 2.82
2723 4981 2.217847 CGCAATTGAGCAATAGCATTGC 59.782 45.455 19.73 19.73 46.15 3.56
2733 4991 5.834239 GCAATAGCATTGCATTTATCACC 57.166 39.130 21.39 0.00 44.34 4.02
2734 4992 4.383649 GCAATAGCATTGCATTTATCACCG 59.616 41.667 21.39 0.00 44.34 4.94
2735 4993 5.522456 CAATAGCATTGCATTTATCACCGT 58.478 37.500 11.91 0.00 0.00 4.83
2736 4994 5.772825 ATAGCATTGCATTTATCACCGTT 57.227 34.783 11.91 0.00 0.00 4.44
2737 4995 6.875948 ATAGCATTGCATTTATCACCGTTA 57.124 33.333 11.91 0.00 0.00 3.18
2738 4996 5.574891 AGCATTGCATTTATCACCGTTAA 57.425 34.783 11.91 0.00 0.00 2.01
2739 4997 5.960113 AGCATTGCATTTATCACCGTTAAA 58.040 33.333 11.91 0.00 0.00 1.52
2740 4998 5.804979 AGCATTGCATTTATCACCGTTAAAC 59.195 36.000 11.91 0.00 0.00 2.01
2741 4999 5.804979 GCATTGCATTTATCACCGTTAAACT 59.195 36.000 3.15 0.00 0.00 2.66
2742 5000 6.020678 GCATTGCATTTATCACCGTTAAACTC 60.021 38.462 3.15 0.00 0.00 3.01
2743 5001 6.561737 TTGCATTTATCACCGTTAAACTCA 57.438 33.333 0.00 0.00 0.00 3.41
2744 5002 6.561737 TGCATTTATCACCGTTAAACTCAA 57.438 33.333 0.00 0.00 0.00 3.02
2745 5003 6.375377 TGCATTTATCACCGTTAAACTCAAC 58.625 36.000 0.00 0.00 0.00 3.18
2746 5004 6.017026 TGCATTTATCACCGTTAAACTCAACA 60.017 34.615 0.00 0.00 0.00 3.33
2747 5005 6.523201 GCATTTATCACCGTTAAACTCAACAG 59.477 38.462 0.00 0.00 0.00 3.16
2748 5006 6.548441 TTTATCACCGTTAAACTCAACAGG 57.452 37.500 0.00 0.00 0.00 4.00
2749 5007 3.547054 TCACCGTTAAACTCAACAGGT 57.453 42.857 0.00 0.00 36.45 4.00
2750 5008 3.876341 TCACCGTTAAACTCAACAGGTT 58.124 40.909 0.00 0.00 34.97 3.50
2751 5009 3.872771 TCACCGTTAAACTCAACAGGTTC 59.127 43.478 0.00 0.00 34.97 3.62
2752 5010 3.623960 CACCGTTAAACTCAACAGGTTCA 59.376 43.478 0.00 0.00 34.97 3.18
2753 5011 3.624410 ACCGTTAAACTCAACAGGTTCAC 59.376 43.478 0.00 0.00 34.11 3.18
2754 5012 3.875134 CCGTTAAACTCAACAGGTTCACT 59.125 43.478 0.00 0.00 29.81 3.41
2764 5022 1.735386 CAGGTTCACTGGATCAGCTG 58.265 55.000 7.63 7.63 43.70 4.24
2765 5023 0.617413 AGGTTCACTGGATCAGCTGG 59.383 55.000 15.13 0.00 34.37 4.85
2766 5024 0.615331 GGTTCACTGGATCAGCTGGA 59.385 55.000 15.13 0.57 34.37 3.86
2767 5025 1.003580 GGTTCACTGGATCAGCTGGAA 59.996 52.381 15.13 4.50 34.37 3.53
2768 5026 2.079925 GTTCACTGGATCAGCTGGAAC 58.920 52.381 15.13 13.25 35.20 3.62
2769 5027 1.351076 TCACTGGATCAGCTGGAACA 58.649 50.000 15.13 9.26 34.37 3.18
2770 5028 1.699083 TCACTGGATCAGCTGGAACAA 59.301 47.619 15.13 0.00 33.97 2.83
2771 5029 1.808945 CACTGGATCAGCTGGAACAAC 59.191 52.381 15.13 0.00 33.97 3.32
2772 5030 1.421268 ACTGGATCAGCTGGAACAACA 59.579 47.619 15.13 4.26 33.97 3.33
2773 5031 2.040813 ACTGGATCAGCTGGAACAACAT 59.959 45.455 15.13 0.00 33.97 2.71
2774 5032 2.681848 CTGGATCAGCTGGAACAACATC 59.318 50.000 15.13 7.31 38.70 3.06
2775 5033 2.306805 TGGATCAGCTGGAACAACATCT 59.693 45.455 15.13 0.00 38.70 2.90
2776 5034 3.245016 TGGATCAGCTGGAACAACATCTT 60.245 43.478 15.13 0.00 38.70 2.40
2777 5035 3.376546 GGATCAGCTGGAACAACATCTTC 59.623 47.826 15.13 0.00 38.70 2.87
2778 5036 3.490439 TCAGCTGGAACAACATCTTCA 57.510 42.857 15.13 0.00 38.70 3.02
2779 5037 3.405831 TCAGCTGGAACAACATCTTCAG 58.594 45.455 15.13 0.00 38.70 3.02
2780 5038 3.144506 CAGCTGGAACAACATCTTCAGT 58.855 45.455 5.57 0.00 38.70 3.41
2781 5039 4.040339 TCAGCTGGAACAACATCTTCAGTA 59.960 41.667 15.13 0.00 38.70 2.74
2782 5040 4.940046 CAGCTGGAACAACATCTTCAGTAT 59.060 41.667 5.57 0.00 38.70 2.12
2783 5041 4.940046 AGCTGGAACAACATCTTCAGTATG 59.060 41.667 0.00 0.00 38.70 2.39
2784 5042 4.437930 GCTGGAACAACATCTTCAGTATGC 60.438 45.833 0.00 0.00 38.70 3.14
2785 5043 4.650734 TGGAACAACATCTTCAGTATGCA 58.349 39.130 0.00 0.00 30.71 3.96
2786 5044 4.696877 TGGAACAACATCTTCAGTATGCAG 59.303 41.667 0.00 0.00 30.71 4.41
2787 5045 4.437930 GGAACAACATCTTCAGTATGCAGC 60.438 45.833 0.00 0.00 34.76 5.25
2788 5046 3.947868 ACAACATCTTCAGTATGCAGCT 58.052 40.909 0.00 0.00 34.76 4.24
2789 5047 5.089970 ACAACATCTTCAGTATGCAGCTA 57.910 39.130 0.00 0.00 34.76 3.32
2790 5048 5.678583 ACAACATCTTCAGTATGCAGCTAT 58.321 37.500 0.00 0.00 34.76 2.97
2791 5049 5.526479 ACAACATCTTCAGTATGCAGCTATG 59.474 40.000 0.00 0.00 34.76 2.23
2792 5050 5.541953 ACATCTTCAGTATGCAGCTATGA 57.458 39.130 0.00 0.00 34.76 2.15
2793 5051 5.295950 ACATCTTCAGTATGCAGCTATGAC 58.704 41.667 0.00 0.00 34.76 3.06
2794 5052 5.163374 ACATCTTCAGTATGCAGCTATGACA 60.163 40.000 0.00 0.00 34.76 3.58
2795 5053 5.343307 TCTTCAGTATGCAGCTATGACAA 57.657 39.130 0.00 0.00 34.76 3.18
2796 5054 5.733676 TCTTCAGTATGCAGCTATGACAAA 58.266 37.500 0.00 0.00 34.76 2.83
2797 5055 6.172630 TCTTCAGTATGCAGCTATGACAAAA 58.827 36.000 0.00 0.00 34.76 2.44
2798 5056 6.314648 TCTTCAGTATGCAGCTATGACAAAAG 59.685 38.462 0.00 0.00 34.76 2.27
2799 5057 5.733676 TCAGTATGCAGCTATGACAAAAGA 58.266 37.500 0.00 0.00 34.76 2.52
2800 5058 5.814188 TCAGTATGCAGCTATGACAAAAGAG 59.186 40.000 0.00 0.00 34.76 2.85
2801 5059 5.814188 CAGTATGCAGCTATGACAAAAGAGA 59.186 40.000 0.00 0.00 0.00 3.10
2802 5060 6.482641 CAGTATGCAGCTATGACAAAAGAGAT 59.517 38.462 0.00 0.00 0.00 2.75
2803 5061 5.752892 ATGCAGCTATGACAAAAGAGATG 57.247 39.130 0.00 0.00 0.00 2.90
2804 5062 4.835678 TGCAGCTATGACAAAAGAGATGA 58.164 39.130 0.00 0.00 0.00 2.92
2805 5063 4.633126 TGCAGCTATGACAAAAGAGATGAC 59.367 41.667 0.00 0.00 0.00 3.06
2806 5064 4.874966 GCAGCTATGACAAAAGAGATGACT 59.125 41.667 0.00 0.00 0.00 3.41
2807 5065 5.353678 GCAGCTATGACAAAAGAGATGACTT 59.646 40.000 0.00 0.00 0.00 3.01
2808 5066 6.456718 GCAGCTATGACAAAAGAGATGACTTC 60.457 42.308 0.00 0.00 0.00 3.01
2809 5067 6.817641 CAGCTATGACAAAAGAGATGACTTCT 59.182 38.462 0.00 0.00 37.41 2.85
2810 5068 7.978414 CAGCTATGACAAAAGAGATGACTTCTA 59.022 37.037 0.00 0.00 33.74 2.10
2811 5069 8.703743 AGCTATGACAAAAGAGATGACTTCTAT 58.296 33.333 0.00 0.00 33.74 1.98
2812 5070 8.763356 GCTATGACAAAAGAGATGACTTCTATG 58.237 37.037 0.00 0.00 33.74 2.23
2814 5072 8.715191 ATGACAAAAGAGATGACTTCTATGAC 57.285 34.615 0.00 0.00 33.74 3.06
2815 5073 7.670364 TGACAAAAGAGATGACTTCTATGACA 58.330 34.615 0.00 0.00 33.74 3.58
2816 5074 7.600375 TGACAAAAGAGATGACTTCTATGACAC 59.400 37.037 0.00 0.00 33.74 3.67
2817 5075 6.587990 ACAAAAGAGATGACTTCTATGACACG 59.412 38.462 0.00 0.00 33.74 4.49
2818 5076 6.516739 AAAGAGATGACTTCTATGACACGA 57.483 37.500 0.00 0.00 33.74 4.35
2819 5077 5.749596 AGAGATGACTTCTATGACACGAG 57.250 43.478 0.00 0.00 33.74 4.18
2820 5078 5.432645 AGAGATGACTTCTATGACACGAGA 58.567 41.667 0.00 0.00 33.74 4.04
2821 5079 6.061441 AGAGATGACTTCTATGACACGAGAT 58.939 40.000 0.00 0.00 33.74 2.75
2822 5080 6.545666 AGAGATGACTTCTATGACACGAGATT 59.454 38.462 0.00 0.00 33.74 2.40
2823 5081 6.502652 AGATGACTTCTATGACACGAGATTG 58.497 40.000 0.00 0.00 30.96 2.67
2824 5082 4.424626 TGACTTCTATGACACGAGATTGC 58.575 43.478 0.00 0.00 0.00 3.56
2825 5083 3.786635 ACTTCTATGACACGAGATTGCC 58.213 45.455 0.00 0.00 0.00 4.52
2826 5084 3.449018 ACTTCTATGACACGAGATTGCCT 59.551 43.478 0.00 0.00 0.00 4.75
2827 5085 4.081420 ACTTCTATGACACGAGATTGCCTT 60.081 41.667 0.00 0.00 0.00 4.35
2828 5086 3.785486 TCTATGACACGAGATTGCCTTG 58.215 45.455 0.00 0.00 0.00 3.61
2829 5087 2.479566 ATGACACGAGATTGCCTTGT 57.520 45.000 0.00 0.00 40.13 3.16
2830 5088 2.254546 TGACACGAGATTGCCTTGTT 57.745 45.000 0.00 0.00 37.41 2.83
2831 5089 2.571212 TGACACGAGATTGCCTTGTTT 58.429 42.857 0.00 0.00 37.41 2.83
2832 5090 2.548057 TGACACGAGATTGCCTTGTTTC 59.452 45.455 0.00 0.00 37.41 2.78
2833 5091 2.808543 GACACGAGATTGCCTTGTTTCT 59.191 45.455 0.00 0.00 37.41 2.52
2834 5092 2.549754 ACACGAGATTGCCTTGTTTCTG 59.450 45.455 0.00 0.00 37.41 3.02
2835 5093 2.549754 CACGAGATTGCCTTGTTTCTGT 59.450 45.455 0.00 0.00 37.41 3.41
2836 5094 2.808543 ACGAGATTGCCTTGTTTCTGTC 59.191 45.455 0.00 0.00 36.04 3.51
2837 5095 3.070018 CGAGATTGCCTTGTTTCTGTCT 58.930 45.455 0.00 0.00 0.00 3.41
2838 5096 3.120408 CGAGATTGCCTTGTTTCTGTCTG 60.120 47.826 0.00 0.00 0.00 3.51
2839 5097 3.817647 GAGATTGCCTTGTTTCTGTCTGT 59.182 43.478 0.00 0.00 0.00 3.41
2840 5098 3.567164 AGATTGCCTTGTTTCTGTCTGTG 59.433 43.478 0.00 0.00 0.00 3.66
2841 5099 2.708216 TGCCTTGTTTCTGTCTGTGA 57.292 45.000 0.00 0.00 0.00 3.58
2842 5100 2.997980 TGCCTTGTTTCTGTCTGTGAA 58.002 42.857 0.00 0.00 0.00 3.18
2843 5101 2.945008 TGCCTTGTTTCTGTCTGTGAAG 59.055 45.455 0.00 0.00 0.00 3.02
2844 5102 2.291741 GCCTTGTTTCTGTCTGTGAAGG 59.708 50.000 0.00 0.00 33.10 3.46
2845 5103 2.291741 CCTTGTTTCTGTCTGTGAAGGC 59.708 50.000 0.00 0.00 0.00 4.35
2846 5104 2.708216 TGTTTCTGTCTGTGAAGGCA 57.292 45.000 0.00 0.00 0.00 4.75
2847 5105 2.288666 TGTTTCTGTCTGTGAAGGCAC 58.711 47.619 0.00 0.00 45.35 5.01
2856 5114 3.484524 GTGAAGGCACGTCTACGAA 57.515 52.632 9.86 0.00 43.02 3.85
2857 5115 1.774639 GTGAAGGCACGTCTACGAAA 58.225 50.000 9.86 0.00 43.02 3.46
2858 5116 2.129607 GTGAAGGCACGTCTACGAAAA 58.870 47.619 9.86 0.00 43.02 2.29
2859 5117 2.735134 GTGAAGGCACGTCTACGAAAAT 59.265 45.455 9.86 0.00 43.02 1.82
2860 5118 2.734606 TGAAGGCACGTCTACGAAAATG 59.265 45.455 9.86 0.00 43.02 2.32
2861 5119 2.450609 AGGCACGTCTACGAAAATGT 57.549 45.000 9.86 0.00 43.02 2.71
2862 5120 2.762745 AGGCACGTCTACGAAAATGTT 58.237 42.857 9.86 0.00 43.02 2.71
2863 5121 3.135994 AGGCACGTCTACGAAAATGTTT 58.864 40.909 9.86 0.00 43.02 2.83
2864 5122 3.562557 AGGCACGTCTACGAAAATGTTTT 59.437 39.130 9.86 0.00 43.02 2.43
2865 5123 4.035909 AGGCACGTCTACGAAAATGTTTTT 59.964 37.500 9.86 0.00 43.02 1.94
2866 5124 4.377738 GGCACGTCTACGAAAATGTTTTTC 59.622 41.667 9.86 3.23 43.02 2.29
2888 5146 9.947433 TTTTCGAGTATCTAAATAAACTTGGGA 57.053 29.630 0.00 0.00 29.48 4.37
2889 5147 9.947433 TTTCGAGTATCTAAATAAACTTGGGAA 57.053 29.630 0.00 0.00 0.00 3.97
2890 5148 9.947433 TTCGAGTATCTAAATAAACTTGGGAAA 57.053 29.630 0.00 0.00 0.00 3.13
2891 5149 9.595823 TCGAGTATCTAAATAAACTTGGGAAAG 57.404 33.333 0.00 0.00 0.00 2.62
2892 5150 8.827677 CGAGTATCTAAATAAACTTGGGAAAGG 58.172 37.037 0.00 0.00 0.00 3.11
2893 5151 9.901172 GAGTATCTAAATAAACTTGGGAAAGGA 57.099 33.333 0.00 0.00 0.00 3.36
2894 5152 9.907229 AGTATCTAAATAAACTTGGGAAAGGAG 57.093 33.333 0.00 0.00 0.00 3.69
2895 5153 7.646548 ATCTAAATAAACTTGGGAAAGGAGC 57.353 36.000 0.00 0.00 0.00 4.70
2896 5154 4.783764 AAATAAACTTGGGAAAGGAGCG 57.216 40.909 0.00 0.00 0.00 5.03
2897 5155 2.194201 TAAACTTGGGAAAGGAGCGG 57.806 50.000 0.00 0.00 0.00 5.52
2898 5156 0.185175 AAACTTGGGAAAGGAGCGGT 59.815 50.000 0.00 0.00 0.00 5.68
2899 5157 1.061546 AACTTGGGAAAGGAGCGGTA 58.938 50.000 0.00 0.00 0.00 4.02
2900 5158 0.323957 ACTTGGGAAAGGAGCGGTAC 59.676 55.000 0.00 0.00 0.00 3.34
2901 5159 0.323629 CTTGGGAAAGGAGCGGTACA 59.676 55.000 0.00 0.00 0.00 2.90
2902 5160 0.323629 TTGGGAAAGGAGCGGTACAG 59.676 55.000 0.00 0.00 0.00 2.74
2903 5161 1.221021 GGGAAAGGAGCGGTACAGG 59.779 63.158 0.00 0.00 0.00 4.00
2904 5162 1.551019 GGGAAAGGAGCGGTACAGGT 61.551 60.000 0.00 0.00 0.00 4.00
2905 5163 1.188863 GGAAAGGAGCGGTACAGGTA 58.811 55.000 0.00 0.00 0.00 3.08
2906 5164 1.134877 GGAAAGGAGCGGTACAGGTAC 60.135 57.143 0.00 0.00 35.40 3.34
2907 5165 0.529378 AAAGGAGCGGTACAGGTACG 59.471 55.000 0.00 0.00 36.94 3.67
2908 5166 0.610232 AAGGAGCGGTACAGGTACGT 60.610 55.000 0.00 0.00 36.94 3.57
2909 5167 0.253044 AGGAGCGGTACAGGTACGTA 59.747 55.000 0.00 0.00 36.94 3.57
2910 5168 0.378610 GGAGCGGTACAGGTACGTAC 59.621 60.000 17.56 17.56 40.89 3.67
2911 5169 1.373570 GAGCGGTACAGGTACGTACT 58.626 55.000 24.07 8.34 41.28 2.73
2912 5170 1.740025 GAGCGGTACAGGTACGTACTT 59.260 52.381 24.07 15.22 41.28 2.24
2913 5171 1.740025 AGCGGTACAGGTACGTACTTC 59.260 52.381 24.07 9.57 41.28 3.01
2914 5172 1.468520 GCGGTACAGGTACGTACTTCA 59.531 52.381 24.07 5.21 41.28 3.02
2915 5173 2.095263 GCGGTACAGGTACGTACTTCAA 60.095 50.000 24.07 5.21 41.28 2.69
2916 5174 3.611530 GCGGTACAGGTACGTACTTCAAA 60.612 47.826 24.07 5.14 41.28 2.69
2917 5175 3.914364 CGGTACAGGTACGTACTTCAAAC 59.086 47.826 24.07 15.29 41.28 2.93
2918 5176 4.556501 CGGTACAGGTACGTACTTCAAACA 60.557 45.833 24.07 2.33 41.28 2.83
2919 5177 5.288804 GGTACAGGTACGTACTTCAAACAA 58.711 41.667 24.07 1.17 41.28 2.83
2920 5178 5.752955 GGTACAGGTACGTACTTCAAACAAA 59.247 40.000 24.07 0.00 41.28 2.83
2921 5179 6.424812 GGTACAGGTACGTACTTCAAACAAAT 59.575 38.462 24.07 2.87 41.28 2.32
2922 5180 6.295039 ACAGGTACGTACTTCAAACAAATG 57.705 37.500 24.07 5.24 0.00 2.32
2923 5181 5.144359 CAGGTACGTACTTCAAACAAATGC 58.856 41.667 24.07 3.91 0.00 3.56
2924 5182 4.817464 AGGTACGTACTTCAAACAAATGCA 59.183 37.500 24.07 0.00 0.00 3.96
2925 5183 5.297278 AGGTACGTACTTCAAACAAATGCAA 59.703 36.000 24.07 0.00 0.00 4.08
2926 5184 6.016610 AGGTACGTACTTCAAACAAATGCAAT 60.017 34.615 24.07 0.00 0.00 3.56
2927 5185 7.173562 AGGTACGTACTTCAAACAAATGCAATA 59.826 33.333 24.07 0.00 0.00 1.90
2928 5186 7.804129 GGTACGTACTTCAAACAAATGCAATAA 59.196 33.333 24.07 0.00 0.00 1.40
2929 5187 9.171701 GTACGTACTTCAAACAAATGCAATAAA 57.828 29.630 18.47 0.00 0.00 1.40
2930 5188 8.635877 ACGTACTTCAAACAAATGCAATAAAA 57.364 26.923 0.00 0.00 0.00 1.52
2931 5189 9.255304 ACGTACTTCAAACAAATGCAATAAAAT 57.745 25.926 0.00 0.00 0.00 1.82
2938 5196 9.894783 TCAAACAAATGCAATAAAATTTGATGG 57.105 25.926 13.60 1.84 43.41 3.51
2939 5197 9.894783 CAAACAAATGCAATAAAATTTGATGGA 57.105 25.926 13.60 0.00 43.41 3.41
2942 5200 8.895737 ACAAATGCAATAAAATTTGATGGATCC 58.104 29.630 13.60 4.20 43.41 3.36
2943 5201 8.894731 CAAATGCAATAAAATTTGATGGATCCA 58.105 29.630 18.88 18.88 43.41 3.41
2944 5202 9.463902 AAATGCAATAAAATTTGATGGATCCAA 57.536 25.926 20.67 1.57 0.00 3.53
2945 5203 9.463902 AATGCAATAAAATTTGATGGATCCAAA 57.536 25.926 20.67 9.37 37.82 3.28
2946 5204 9.635404 ATGCAATAAAATTTGATGGATCCAAAT 57.365 25.926 20.67 11.51 43.66 2.32
2947 5205 8.894731 TGCAATAAAATTTGATGGATCCAAATG 58.105 29.630 20.67 3.21 41.71 2.32
2948 5206 7.858879 GCAATAAAATTTGATGGATCCAAATGC 59.141 33.333 20.67 9.94 41.71 3.56
2949 5207 8.894731 CAATAAAATTTGATGGATCCAAATGCA 58.105 29.630 20.67 11.88 41.71 3.96
2950 5208 6.995511 AAAATTTGATGGATCCAAATGCAG 57.004 33.333 20.67 0.00 41.71 4.41
2951 5209 5.687166 AATTTGATGGATCCAAATGCAGT 57.313 34.783 20.67 0.00 41.71 4.40
2952 5210 6.795144 AATTTGATGGATCCAAATGCAGTA 57.205 33.333 20.67 7.40 41.71 2.74
2953 5211 6.795144 ATTTGATGGATCCAAATGCAGTAA 57.205 33.333 20.67 7.53 41.20 2.24
2954 5212 6.795144 TTTGATGGATCCAAATGCAGTAAT 57.205 33.333 20.67 0.00 36.60 1.89
2955 5213 6.795144 TTGATGGATCCAAATGCAGTAATT 57.205 33.333 20.67 0.00 36.60 1.40
2956 5214 6.795144 TGATGGATCCAAATGCAGTAATTT 57.205 33.333 20.67 0.00 36.60 1.82
2957 5215 7.894753 TGATGGATCCAAATGCAGTAATTTA 57.105 32.000 20.67 0.00 36.60 1.40
2958 5216 7.944061 TGATGGATCCAAATGCAGTAATTTAG 58.056 34.615 20.67 0.00 36.60 1.85
2959 5217 7.560991 TGATGGATCCAAATGCAGTAATTTAGT 59.439 33.333 20.67 0.00 36.60 2.24
2960 5218 8.995027 ATGGATCCAAATGCAGTAATTTAGTA 57.005 30.769 20.67 0.00 36.60 1.82
2961 5219 8.450578 TGGATCCAAATGCAGTAATTTAGTAG 57.549 34.615 13.46 0.00 0.00 2.57
2962 5220 8.052748 TGGATCCAAATGCAGTAATTTAGTAGT 58.947 33.333 13.46 0.00 0.00 2.73
2963 5221 8.903820 GGATCCAAATGCAGTAATTTAGTAGTT 58.096 33.333 6.95 0.00 0.00 2.24
3019 5277 9.315363 TCATTCTTTTTCTAGACTCTAGAACCT 57.685 33.333 22.98 6.59 33.73 3.50
3020 5278 9.936759 CATTCTTTTTCTAGACTCTAGAACCTT 57.063 33.333 22.98 7.27 33.73 3.50
3023 5281 9.984190 TCTTTTTCTAGACTCTAGAACCTTTTC 57.016 33.333 22.98 0.00 33.73 2.29
3024 5282 9.990360 CTTTTTCTAGACTCTAGAACCTTTTCT 57.010 33.333 22.98 0.00 44.70 2.52
3084 5342 9.166173 TGTATATATGCATTTGGAAGATAGTGC 57.834 33.333 3.54 0.00 0.00 4.40
3085 5343 9.166173 GTATATATGCATTTGGAAGATAGTGCA 57.834 33.333 3.54 0.03 45.28 4.57
3086 5344 6.964807 ATATGCATTTGGAAGATAGTGCAA 57.035 33.333 3.54 0.00 44.51 4.08
3087 5345 5.864418 ATGCATTTGGAAGATAGTGCAAT 57.136 34.783 0.00 0.00 44.51 3.56
3088 5346 6.964807 ATGCATTTGGAAGATAGTGCAATA 57.035 33.333 0.00 0.00 44.51 1.90
3089 5347 6.772360 TGCATTTGGAAGATAGTGCAATAA 57.228 33.333 0.00 0.00 39.36 1.40
3090 5348 6.798482 TGCATTTGGAAGATAGTGCAATAAG 58.202 36.000 0.00 0.00 39.36 1.73
3091 5349 6.183360 TGCATTTGGAAGATAGTGCAATAAGG 60.183 38.462 0.00 0.00 39.36 2.69
3092 5350 6.183360 GCATTTGGAAGATAGTGCAATAAGGT 60.183 38.462 0.00 0.00 33.09 3.50
3093 5351 7.013274 GCATTTGGAAGATAGTGCAATAAGGTA 59.987 37.037 0.00 0.00 33.09 3.08
3094 5352 8.562892 CATTTGGAAGATAGTGCAATAAGGTAG 58.437 37.037 0.00 0.00 0.00 3.18
3095 5353 6.808321 TGGAAGATAGTGCAATAAGGTAGT 57.192 37.500 0.00 0.00 0.00 2.73
3096 5354 7.907841 TGGAAGATAGTGCAATAAGGTAGTA 57.092 36.000 0.00 0.00 0.00 1.82
3097 5355 7.952671 TGGAAGATAGTGCAATAAGGTAGTAG 58.047 38.462 0.00 0.00 0.00 2.57
3098 5356 7.563924 TGGAAGATAGTGCAATAAGGTAGTAGT 59.436 37.037 0.00 0.00 0.00 2.73
3099 5357 9.075678 GGAAGATAGTGCAATAAGGTAGTAGTA 57.924 37.037 0.00 0.00 0.00 1.82
3100 5358 9.896263 GAAGATAGTGCAATAAGGTAGTAGTAC 57.104 37.037 0.00 0.00 0.00 2.73
3101 5359 8.991783 AGATAGTGCAATAAGGTAGTAGTACA 57.008 34.615 9.89 0.00 0.00 2.90
3102 5360 9.417561 AGATAGTGCAATAAGGTAGTAGTACAA 57.582 33.333 9.89 0.00 0.00 2.41
3103 5361 9.680315 GATAGTGCAATAAGGTAGTAGTACAAG 57.320 37.037 9.89 0.00 0.00 3.16
3104 5362 7.713734 AGTGCAATAAGGTAGTAGTACAAGA 57.286 36.000 9.89 0.00 0.00 3.02
3105 5363 8.307582 AGTGCAATAAGGTAGTAGTACAAGAT 57.692 34.615 9.89 0.00 0.00 2.40
3106 5364 8.759782 AGTGCAATAAGGTAGTAGTACAAGATT 58.240 33.333 9.89 3.00 0.00 2.40
3107 5365 8.818057 GTGCAATAAGGTAGTAGTACAAGATTG 58.182 37.037 9.89 13.80 31.87 2.67
3108 5366 7.494625 TGCAATAAGGTAGTAGTACAAGATTGC 59.505 37.037 26.52 26.52 42.31 3.56
3109 5367 7.711339 GCAATAAGGTAGTAGTACAAGATTGCT 59.289 37.037 26.27 8.86 40.83 3.91
3112 5370 7.713734 AAGGTAGTAGTACAAGATTGCTACA 57.286 36.000 9.89 0.00 37.02 2.74
3113 5371 7.713734 AGGTAGTAGTACAAGATTGCTACAA 57.286 36.000 9.89 0.00 37.02 2.41
3114 5372 8.130671 AGGTAGTAGTACAAGATTGCTACAAA 57.869 34.615 9.89 0.47 37.02 2.83
3115 5373 8.759782 AGGTAGTAGTACAAGATTGCTACAAAT 58.240 33.333 9.89 0.00 37.02 2.32
3139 5397 5.784750 TTTCTCAATATCTTGCTGTCACG 57.215 39.130 0.00 0.00 32.11 4.35
3140 5398 4.718940 TCTCAATATCTTGCTGTCACGA 57.281 40.909 0.00 0.00 32.11 4.35
3141 5399 5.072040 TCTCAATATCTTGCTGTCACGAA 57.928 39.130 0.00 0.00 32.11 3.85
3142 5400 5.478407 TCTCAATATCTTGCTGTCACGAAA 58.522 37.500 0.00 0.00 32.11 3.46
3143 5401 6.108687 TCTCAATATCTTGCTGTCACGAAAT 58.891 36.000 0.00 0.00 32.11 2.17
3144 5402 7.264947 TCTCAATATCTTGCTGTCACGAAATA 58.735 34.615 0.00 0.00 32.11 1.40
3145 5403 7.928167 TCTCAATATCTTGCTGTCACGAAATAT 59.072 33.333 0.00 0.00 32.11 1.28
3146 5404 8.437360 TCAATATCTTGCTGTCACGAAATATT 57.563 30.769 0.00 0.00 32.11 1.28
3147 5405 8.337532 TCAATATCTTGCTGTCACGAAATATTG 58.662 33.333 0.00 0.00 31.54 1.90
3148 5406 8.337532 CAATATCTTGCTGTCACGAAATATTGA 58.662 33.333 0.00 0.00 31.72 2.57
3149 5407 6.932356 ATCTTGCTGTCACGAAATATTGAT 57.068 33.333 0.00 0.00 0.00 2.57
3150 5408 6.349973 TCTTGCTGTCACGAAATATTGATC 57.650 37.500 0.00 0.00 0.00 2.92
3151 5409 5.874261 TCTTGCTGTCACGAAATATTGATCA 59.126 36.000 0.00 0.00 0.00 2.92
3152 5410 6.371271 TCTTGCTGTCACGAAATATTGATCAA 59.629 34.615 11.26 11.26 0.00 2.57
3153 5411 6.682423 TGCTGTCACGAAATATTGATCAAT 57.318 33.333 23.75 23.75 34.93 2.57
3154 5412 7.784633 TGCTGTCACGAAATATTGATCAATA 57.215 32.000 26.24 26.24 37.64 1.90
3155 5413 8.382030 TGCTGTCACGAAATATTGATCAATAT 57.618 30.769 27.94 27.94 43.67 1.28
3156 5414 8.284693 TGCTGTCACGAAATATTGATCAATATG 58.715 33.333 31.94 23.92 41.66 1.78
3157 5415 8.285394 GCTGTCACGAAATATTGATCAATATGT 58.715 33.333 31.94 28.59 41.66 2.29
3159 5417 9.934190 TGTCACGAAATATTGATCAATATGTTG 57.066 29.630 31.94 30.58 41.66 3.33
3160 5418 8.895845 GTCACGAAATATTGATCAATATGTTGC 58.104 33.333 31.94 20.17 41.66 4.17
3161 5419 8.619546 TCACGAAATATTGATCAATATGTTGCA 58.380 29.630 31.94 20.74 41.66 4.08
3162 5420 8.898792 CACGAAATATTGATCAATATGTTGCAG 58.101 33.333 31.94 23.46 41.66 4.41
3163 5421 8.839343 ACGAAATATTGATCAATATGTTGCAGA 58.161 29.630 31.94 11.85 41.66 4.26
3164 5422 9.667989 CGAAATATTGATCAATATGTTGCAGAA 57.332 29.630 31.94 11.21 41.66 3.02
3195 5453 6.515272 TTTTCCAAGATGATAGGAACAAGC 57.485 37.500 0.00 0.00 40.88 4.01
3196 5454 5.441718 TTCCAAGATGATAGGAACAAGCT 57.558 39.130 0.00 0.00 36.55 3.74
3197 5455 5.441718 TCCAAGATGATAGGAACAAGCTT 57.558 39.130 0.00 0.00 0.00 3.74
3198 5456 5.188434 TCCAAGATGATAGGAACAAGCTTG 58.812 41.667 24.84 24.84 35.53 4.01
3199 5457 5.045651 TCCAAGATGATAGGAACAAGCTTGA 60.046 40.000 32.50 10.47 36.64 3.02
3200 5458 5.065731 CCAAGATGATAGGAACAAGCTTGAC 59.934 44.000 32.50 22.84 36.64 3.18
3201 5459 5.426689 AGATGATAGGAACAAGCTTGACA 57.573 39.130 32.50 17.90 0.00 3.58
3202 5460 5.426504 AGATGATAGGAACAAGCTTGACAG 58.573 41.667 32.50 6.72 0.00 3.51
3203 5461 4.623932 TGATAGGAACAAGCTTGACAGT 57.376 40.909 32.50 15.80 0.00 3.55
3204 5462 4.973168 TGATAGGAACAAGCTTGACAGTT 58.027 39.130 32.50 16.22 0.00 3.16
3205 5463 5.376625 TGATAGGAACAAGCTTGACAGTTT 58.623 37.500 32.50 15.83 0.00 2.66
3206 5464 5.827797 TGATAGGAACAAGCTTGACAGTTTT 59.172 36.000 32.50 15.08 0.00 2.43
3207 5465 4.376340 AGGAACAAGCTTGACAGTTTTG 57.624 40.909 32.50 3.87 0.00 2.44
3208 5466 3.131046 AGGAACAAGCTTGACAGTTTTGG 59.869 43.478 32.50 2.31 0.00 3.28
3209 5467 3.130340 GGAACAAGCTTGACAGTTTTGGA 59.870 43.478 32.50 0.00 0.00 3.53
3210 5468 4.354587 GAACAAGCTTGACAGTTTTGGAG 58.645 43.478 32.50 1.52 0.00 3.86
3211 5469 3.356290 ACAAGCTTGACAGTTTTGGAGT 58.644 40.909 32.50 2.30 0.00 3.85
3212 5470 3.763897 ACAAGCTTGACAGTTTTGGAGTT 59.236 39.130 32.50 1.82 0.00 3.01
3213 5471 4.220602 ACAAGCTTGACAGTTTTGGAGTTT 59.779 37.500 32.50 1.12 0.00 2.66
3214 5472 5.170748 CAAGCTTGACAGTTTTGGAGTTTT 58.829 37.500 22.31 0.00 0.00 2.43
3215 5473 4.747810 AGCTTGACAGTTTTGGAGTTTTG 58.252 39.130 0.00 0.00 0.00 2.44
3216 5474 3.306973 GCTTGACAGTTTTGGAGTTTTGC 59.693 43.478 0.00 0.00 0.00 3.68
3217 5475 4.747810 CTTGACAGTTTTGGAGTTTTGCT 58.252 39.130 0.00 0.00 0.00 3.91
3218 5476 4.799564 TGACAGTTTTGGAGTTTTGCTT 57.200 36.364 0.00 0.00 0.00 3.91
3219 5477 4.743493 TGACAGTTTTGGAGTTTTGCTTC 58.257 39.130 0.00 0.00 0.00 3.86
3220 5478 4.462483 TGACAGTTTTGGAGTTTTGCTTCT 59.538 37.500 0.00 0.00 0.00 2.85
3221 5479 5.650266 TGACAGTTTTGGAGTTTTGCTTCTA 59.350 36.000 0.00 0.00 0.00 2.10
3222 5480 6.321181 TGACAGTTTTGGAGTTTTGCTTCTAT 59.679 34.615 0.00 0.00 0.00 1.98
3223 5481 7.500892 TGACAGTTTTGGAGTTTTGCTTCTATA 59.499 33.333 0.00 0.00 0.00 1.31
3224 5482 8.409358 ACAGTTTTGGAGTTTTGCTTCTATAT 57.591 30.769 0.00 0.00 0.00 0.86
3225 5483 9.515226 ACAGTTTTGGAGTTTTGCTTCTATATA 57.485 29.630 0.00 0.00 0.00 0.86
3256 5514 9.868277 TGTTCCTTTAAGCATATTTGGTTTATG 57.132 29.630 5.92 0.57 40.57 1.90
3257 5515 9.313118 GTTCCTTTAAGCATATTTGGTTTATGG 57.687 33.333 5.92 8.73 40.57 2.74
3258 5516 8.830915 TCCTTTAAGCATATTTGGTTTATGGA 57.169 30.769 13.67 13.67 40.57 3.41
3259 5517 9.432982 TCCTTTAAGCATATTTGGTTTATGGAT 57.567 29.630 13.67 0.00 40.57 3.41
3260 5518 9.480053 CCTTTAAGCATATTTGGTTTATGGATG 57.520 33.333 5.92 0.00 40.57 3.51
3261 5519 8.885494 TTTAAGCATATTTGGTTTATGGATGC 57.115 30.769 5.92 0.00 40.57 3.91
3262 5520 5.125100 AGCATATTTGGTTTATGGATGCG 57.875 39.130 0.00 0.00 42.30 4.73
3263 5521 4.584325 AGCATATTTGGTTTATGGATGCGT 59.416 37.500 0.00 0.00 42.30 5.24
3264 5522 5.767665 AGCATATTTGGTTTATGGATGCGTA 59.232 36.000 0.00 0.00 42.30 4.42
3265 5523 6.072508 AGCATATTTGGTTTATGGATGCGTAG 60.073 38.462 0.00 0.00 42.30 3.51
3266 5524 6.293955 GCATATTTGGTTTATGGATGCGTAGT 60.294 38.462 0.00 0.00 0.00 2.73
3267 5525 4.955925 TTTGGTTTATGGATGCGTAGTG 57.044 40.909 0.00 0.00 0.00 2.74
3268 5526 3.620427 TGGTTTATGGATGCGTAGTGT 57.380 42.857 0.00 0.00 0.00 3.55
3269 5527 3.527533 TGGTTTATGGATGCGTAGTGTC 58.472 45.455 0.00 0.00 0.00 3.67
3270 5528 3.055747 TGGTTTATGGATGCGTAGTGTCA 60.056 43.478 0.00 0.00 0.00 3.58
3271 5529 4.127171 GGTTTATGGATGCGTAGTGTCAT 58.873 43.478 0.00 0.00 0.00 3.06
3272 5530 5.163395 TGGTTTATGGATGCGTAGTGTCATA 60.163 40.000 0.00 0.00 0.00 2.15
3273 5531 5.932303 GGTTTATGGATGCGTAGTGTCATAT 59.068 40.000 0.00 0.00 0.00 1.78
3274 5532 6.090898 GGTTTATGGATGCGTAGTGTCATATC 59.909 42.308 0.00 0.00 0.00 1.63
3275 5533 3.660501 TGGATGCGTAGTGTCATATCC 57.339 47.619 0.00 0.00 35.72 2.59
3276 5534 2.299013 TGGATGCGTAGTGTCATATCCC 59.701 50.000 0.00 0.00 34.57 3.85
3277 5535 2.299013 GGATGCGTAGTGTCATATCCCA 59.701 50.000 0.00 0.00 0.00 4.37
3278 5536 3.244078 GGATGCGTAGTGTCATATCCCAA 60.244 47.826 0.00 0.00 0.00 4.12
3279 5537 3.897141 TGCGTAGTGTCATATCCCAAA 57.103 42.857 0.00 0.00 0.00 3.28
3280 5538 4.209307 TGCGTAGTGTCATATCCCAAAA 57.791 40.909 0.00 0.00 0.00 2.44
3281 5539 4.776349 TGCGTAGTGTCATATCCCAAAAT 58.224 39.130 0.00 0.00 0.00 1.82
3282 5540 5.919755 TGCGTAGTGTCATATCCCAAAATA 58.080 37.500 0.00 0.00 0.00 1.40
3283 5541 6.350103 TGCGTAGTGTCATATCCCAAAATAA 58.650 36.000 0.00 0.00 0.00 1.40
3284 5542 6.259167 TGCGTAGTGTCATATCCCAAAATAAC 59.741 38.462 0.00 0.00 0.00 1.89
3285 5543 6.293244 GCGTAGTGTCATATCCCAAAATAACC 60.293 42.308 0.00 0.00 0.00 2.85
3286 5544 6.764085 CGTAGTGTCATATCCCAAAATAACCA 59.236 38.462 0.00 0.00 0.00 3.67
3287 5545 7.281324 CGTAGTGTCATATCCCAAAATAACCAA 59.719 37.037 0.00 0.00 0.00 3.67
3288 5546 9.131791 GTAGTGTCATATCCCAAAATAACCAAT 57.868 33.333 0.00 0.00 0.00 3.16
3289 5547 8.608185 AGTGTCATATCCCAAAATAACCAATT 57.392 30.769 0.00 0.00 0.00 2.32
3290 5548 9.045745 AGTGTCATATCCCAAAATAACCAATTT 57.954 29.630 0.00 0.00 39.56 1.82
3297 5555 8.679344 ATCCCAAAATAACCAATTTAAGTCCT 57.321 30.769 0.00 0.00 36.76 3.85
3298 5556 8.499288 TCCCAAAATAACCAATTTAAGTCCTT 57.501 30.769 0.00 0.00 36.76 3.36
3299 5557 9.603189 TCCCAAAATAACCAATTTAAGTCCTTA 57.397 29.630 0.00 0.00 36.76 2.69
3309 5567 9.668497 ACCAATTTAAGTCCTTATCACTAGAAC 57.332 33.333 0.00 0.00 0.00 3.01
3310 5568 8.818057 CCAATTTAAGTCCTTATCACTAGAACG 58.182 37.037 0.00 0.00 0.00 3.95
3311 5569 8.818057 CAATTTAAGTCCTTATCACTAGAACGG 58.182 37.037 0.00 0.00 0.00 4.44
3312 5570 7.707624 TTTAAGTCCTTATCACTAGAACGGA 57.292 36.000 0.00 0.00 0.00 4.69
3313 5571 7.707624 TTAAGTCCTTATCACTAGAACGGAA 57.292 36.000 0.00 0.00 0.00 4.30
3314 5572 6.600882 AAGTCCTTATCACTAGAACGGAAA 57.399 37.500 0.00 0.00 0.00 3.13
3315 5573 6.793505 AGTCCTTATCACTAGAACGGAAAT 57.206 37.500 0.00 0.00 0.00 2.17
3316 5574 6.807789 AGTCCTTATCACTAGAACGGAAATC 58.192 40.000 0.00 0.00 0.00 2.17
3317 5575 6.608002 AGTCCTTATCACTAGAACGGAAATCT 59.392 38.462 0.00 0.00 0.00 2.40
3318 5576 6.697892 GTCCTTATCACTAGAACGGAAATCTG 59.302 42.308 0.00 0.00 0.00 2.90
3319 5577 6.380274 TCCTTATCACTAGAACGGAAATCTGT 59.620 38.462 0.00 0.00 36.96 3.41
3320 5578 7.558807 TCCTTATCACTAGAACGGAAATCTGTA 59.441 37.037 0.00 0.00 34.49 2.74
3321 5579 7.648510 CCTTATCACTAGAACGGAAATCTGTAC 59.351 40.741 0.00 0.00 34.49 2.90
3322 5580 6.777213 ATCACTAGAACGGAAATCTGTACT 57.223 37.500 0.00 0.00 34.49 2.73
3323 5581 6.585695 TCACTAGAACGGAAATCTGTACTT 57.414 37.500 0.00 0.00 34.49 2.24
3324 5582 7.692460 TCACTAGAACGGAAATCTGTACTTA 57.308 36.000 0.00 0.00 34.49 2.24
3325 5583 8.114331 TCACTAGAACGGAAATCTGTACTTAA 57.886 34.615 0.00 0.00 34.49 1.85
3326 5584 8.579006 TCACTAGAACGGAAATCTGTACTTAAA 58.421 33.333 0.00 0.00 34.49 1.52
3327 5585 9.367444 CACTAGAACGGAAATCTGTACTTAAAT 57.633 33.333 0.00 0.00 34.49 1.40
3328 5586 9.939802 ACTAGAACGGAAATCTGTACTTAAATT 57.060 29.630 0.00 0.00 34.49 1.82
3352 5610 8.958119 TTTTATATCTAGTCAAATCGGCAAGT 57.042 30.769 0.00 0.00 0.00 3.16
3356 5614 6.663944 ATCTAGTCAAATCGGCAAGTAAAC 57.336 37.500 0.00 0.00 0.00 2.01
3357 5615 5.790593 TCTAGTCAAATCGGCAAGTAAACT 58.209 37.500 0.00 0.00 0.00 2.66
3358 5616 6.228258 TCTAGTCAAATCGGCAAGTAAACTT 58.772 36.000 0.00 0.00 36.45 2.66
3375 5633 9.787435 AAGTAAACTTGACAGTATAATGGTGAA 57.213 29.630 5.03 0.00 34.38 3.18
3376 5634 9.787435 AGTAAACTTGACAGTATAATGGTGAAA 57.213 29.630 5.03 0.00 30.68 2.69
3378 5636 8.691661 AAACTTGACAGTATAATGGTGAAAGT 57.308 30.769 5.03 5.85 30.68 2.66
3379 5637 7.672983 ACTTGACAGTATAATGGTGAAAGTG 57.327 36.000 5.03 0.00 0.00 3.16
3380 5638 6.149474 ACTTGACAGTATAATGGTGAAAGTGC 59.851 38.462 5.03 0.00 0.00 4.40
3381 5639 4.629634 TGACAGTATAATGGTGAAAGTGCG 59.370 41.667 5.03 0.00 0.00 5.34
3382 5640 4.575885 ACAGTATAATGGTGAAAGTGCGT 58.424 39.130 5.03 0.00 0.00 5.24
3383 5641 5.726397 ACAGTATAATGGTGAAAGTGCGTA 58.274 37.500 5.03 0.00 0.00 4.42
3384 5642 6.346096 ACAGTATAATGGTGAAAGTGCGTAT 58.654 36.000 5.03 0.00 0.00 3.06
3385 5643 6.257849 ACAGTATAATGGTGAAAGTGCGTATG 59.742 38.462 5.03 0.00 0.00 2.39
3386 5644 6.478673 CAGTATAATGGTGAAAGTGCGTATGA 59.521 38.462 0.00 0.00 0.00 2.15
3387 5645 7.011016 CAGTATAATGGTGAAAGTGCGTATGAA 59.989 37.037 0.00 0.00 0.00 2.57
3388 5646 6.751514 ATAATGGTGAAAGTGCGTATGAAA 57.248 33.333 0.00 0.00 0.00 2.69
3389 5647 5.643379 AATGGTGAAAGTGCGTATGAAAT 57.357 34.783 0.00 0.00 0.00 2.17
3390 5648 5.643379 ATGGTGAAAGTGCGTATGAAATT 57.357 34.783 0.00 0.00 0.00 1.82
3391 5649 5.446143 TGGTGAAAGTGCGTATGAAATTT 57.554 34.783 0.00 0.00 0.00 1.82
3392 5650 5.457140 TGGTGAAAGTGCGTATGAAATTTC 58.543 37.500 11.41 11.41 0.00 2.17
3393 5651 5.009110 TGGTGAAAGTGCGTATGAAATTTCA 59.991 36.000 22.52 22.52 42.14 2.69
3394 5652 5.569059 GGTGAAAGTGCGTATGAAATTTCAG 59.431 40.000 24.17 13.12 41.08 3.02
3395 5653 5.569059 GTGAAAGTGCGTATGAAATTTCAGG 59.431 40.000 24.17 16.74 41.08 3.86
3396 5654 5.471797 TGAAAGTGCGTATGAAATTTCAGGA 59.528 36.000 24.17 13.14 41.08 3.86
3397 5655 5.957842 AAGTGCGTATGAAATTTCAGGAA 57.042 34.783 24.17 10.98 41.08 3.36
3398 5656 6.515272 AAGTGCGTATGAAATTTCAGGAAT 57.485 33.333 24.17 11.43 41.08 3.01
3399 5657 5.883661 AGTGCGTATGAAATTTCAGGAATG 58.116 37.500 24.17 17.48 41.08 2.67
3400 5658 5.036737 GTGCGTATGAAATTTCAGGAATGG 58.963 41.667 24.17 11.91 41.08 3.16
3401 5659 4.097741 TGCGTATGAAATTTCAGGAATGGG 59.902 41.667 24.17 11.02 41.08 4.00
3402 5660 4.338118 GCGTATGAAATTTCAGGAATGGGA 59.662 41.667 24.17 0.00 41.08 4.37
3403 5661 5.163561 GCGTATGAAATTTCAGGAATGGGAA 60.164 40.000 24.17 0.00 41.08 3.97
3404 5662 6.461509 GCGTATGAAATTTCAGGAATGGGAAT 60.462 38.462 24.17 7.75 41.08 3.01
3405 5663 7.491682 CGTATGAAATTTCAGGAATGGGAATT 58.508 34.615 24.17 7.28 41.08 2.17
3406 5664 7.436080 CGTATGAAATTTCAGGAATGGGAATTG 59.564 37.037 24.17 0.00 41.08 2.32
3407 5665 5.490159 TGAAATTTCAGGAATGGGAATTGC 58.510 37.500 16.91 0.00 32.50 3.56
3408 5666 5.012871 TGAAATTTCAGGAATGGGAATTGCA 59.987 36.000 16.91 0.00 32.50 4.08
3409 5667 5.703730 AATTTCAGGAATGGGAATTGCAT 57.296 34.783 0.00 0.00 0.00 3.96
3410 5668 6.811634 AATTTCAGGAATGGGAATTGCATA 57.188 33.333 0.00 0.00 0.00 3.14
3411 5669 5.596836 TTTCAGGAATGGGAATTGCATAC 57.403 39.130 0.00 0.00 0.00 2.39
3412 5670 3.565307 TCAGGAATGGGAATTGCATACC 58.435 45.455 0.00 0.00 0.00 2.73
3413 5671 2.294233 CAGGAATGGGAATTGCATACCG 59.706 50.000 0.00 0.00 0.00 4.02
3414 5672 2.091885 AGGAATGGGAATTGCATACCGT 60.092 45.455 0.00 0.00 0.00 4.83
3415 5673 2.293399 GGAATGGGAATTGCATACCGTC 59.707 50.000 0.00 0.00 0.00 4.79
3416 5674 1.593196 ATGGGAATTGCATACCGTCG 58.407 50.000 0.00 0.00 0.00 5.12
3417 5675 1.092921 TGGGAATTGCATACCGTCGC 61.093 55.000 0.00 0.00 0.00 5.19
3418 5676 0.814010 GGGAATTGCATACCGTCGCT 60.814 55.000 0.00 0.00 0.00 4.93
3419 5677 0.304705 GGAATTGCATACCGTCGCTG 59.695 55.000 0.00 0.00 0.00 5.18
3420 5678 0.316196 GAATTGCATACCGTCGCTGC 60.316 55.000 0.00 5.91 36.45 5.25
3421 5679 0.744414 AATTGCATACCGTCGCTGCT 60.744 50.000 12.03 0.00 36.84 4.24
3422 5680 0.744414 ATTGCATACCGTCGCTGCTT 60.744 50.000 12.03 0.87 36.84 3.91
3423 5681 0.953471 TTGCATACCGTCGCTGCTTT 60.953 50.000 12.03 0.00 36.84 3.51
3424 5682 0.953471 TGCATACCGTCGCTGCTTTT 60.953 50.000 12.03 0.00 36.84 2.27
3425 5683 0.521242 GCATACCGTCGCTGCTTTTG 60.521 55.000 0.00 0.00 33.15 2.44
3426 5684 0.096976 CATACCGTCGCTGCTTTTGG 59.903 55.000 0.00 0.00 0.00 3.28
3427 5685 0.036765 ATACCGTCGCTGCTTTTGGA 60.037 50.000 0.00 0.00 0.00 3.53
3428 5686 0.249953 TACCGTCGCTGCTTTTGGAA 60.250 50.000 0.00 0.00 0.00 3.53
3429 5687 1.207593 CCGTCGCTGCTTTTGGAAG 59.792 57.895 0.00 0.00 35.92 3.46
3430 5688 1.507141 CCGTCGCTGCTTTTGGAAGT 61.507 55.000 0.00 0.00 35.25 3.01
3431 5689 0.384725 CGTCGCTGCTTTTGGAAGTG 60.385 55.000 0.00 0.00 35.25 3.16
3432 5690 0.944386 GTCGCTGCTTTTGGAAGTGA 59.056 50.000 0.00 0.00 37.75 3.41
3433 5691 1.537202 GTCGCTGCTTTTGGAAGTGAT 59.463 47.619 0.00 0.00 41.64 3.06
3434 5692 1.536766 TCGCTGCTTTTGGAAGTGATG 59.463 47.619 0.00 0.00 35.34 3.07
3435 5693 1.401931 CGCTGCTTTTGGAAGTGATGG 60.402 52.381 0.00 0.00 32.93 3.51
3436 5694 1.888512 GCTGCTTTTGGAAGTGATGGA 59.111 47.619 0.00 0.00 35.25 3.41
3437 5695 2.297033 GCTGCTTTTGGAAGTGATGGAA 59.703 45.455 0.00 0.00 35.25 3.53
3438 5696 3.243839 GCTGCTTTTGGAAGTGATGGAAA 60.244 43.478 0.00 0.00 35.25 3.13
3439 5697 4.562143 GCTGCTTTTGGAAGTGATGGAAAT 60.562 41.667 0.00 0.00 35.25 2.17
3440 5698 4.885413 TGCTTTTGGAAGTGATGGAAATG 58.115 39.130 0.00 0.00 35.25 2.32
3441 5699 4.588106 TGCTTTTGGAAGTGATGGAAATGA 59.412 37.500 0.00 0.00 35.25 2.57
3442 5700 4.925646 GCTTTTGGAAGTGATGGAAATGAC 59.074 41.667 0.00 0.00 35.25 3.06
3443 5701 5.279156 GCTTTTGGAAGTGATGGAAATGACT 60.279 40.000 0.00 0.00 35.25 3.41
3444 5702 6.729690 TTTTGGAAGTGATGGAAATGACTT 57.270 33.333 0.00 0.00 0.00 3.01
3445 5703 5.710513 TTGGAAGTGATGGAAATGACTTG 57.289 39.130 0.00 0.00 0.00 3.16
3446 5704 4.081406 TGGAAGTGATGGAAATGACTTGG 58.919 43.478 0.00 0.00 0.00 3.61
3447 5705 3.119352 GGAAGTGATGGAAATGACTTGGC 60.119 47.826 0.00 0.00 0.00 4.52
3448 5706 3.446442 AGTGATGGAAATGACTTGGCT 57.554 42.857 0.00 0.00 0.00 4.75
3449 5707 3.087031 AGTGATGGAAATGACTTGGCTG 58.913 45.455 0.00 0.00 0.00 4.85
3450 5708 1.820519 TGATGGAAATGACTTGGCTGC 59.179 47.619 0.00 0.00 0.00 5.25
3451 5709 1.820519 GATGGAAATGACTTGGCTGCA 59.179 47.619 0.50 0.00 0.00 4.41
3452 5710 1.250328 TGGAAATGACTTGGCTGCAG 58.750 50.000 10.11 10.11 0.00 4.41
3453 5711 0.108945 GGAAATGACTTGGCTGCAGC 60.109 55.000 30.88 30.88 41.14 5.25
3454 5712 0.886563 GAAATGACTTGGCTGCAGCT 59.113 50.000 35.82 18.48 41.70 4.24
3455 5713 2.086869 GAAATGACTTGGCTGCAGCTA 58.913 47.619 35.82 29.61 41.70 3.32
3456 5714 2.431954 AATGACTTGGCTGCAGCTAT 57.568 45.000 35.82 18.35 41.70 2.97
3457 5715 1.964552 ATGACTTGGCTGCAGCTATC 58.035 50.000 35.82 25.47 41.70 2.08
3458 5716 0.614812 TGACTTGGCTGCAGCTATCA 59.385 50.000 35.82 27.64 41.70 2.15
3459 5717 1.211212 TGACTTGGCTGCAGCTATCAT 59.789 47.619 35.82 19.35 41.70 2.45
3460 5718 2.295885 GACTTGGCTGCAGCTATCATT 58.704 47.619 35.82 16.89 41.70 2.57
3461 5719 2.022195 ACTTGGCTGCAGCTATCATTG 58.978 47.619 35.82 21.70 41.70 2.82
3462 5720 1.337071 CTTGGCTGCAGCTATCATTGG 59.663 52.381 35.82 15.32 41.70 3.16
3463 5721 1.105167 TGGCTGCAGCTATCATTGGC 61.105 55.000 35.82 17.61 41.70 4.52
3464 5722 1.105167 GGCTGCAGCTATCATTGGCA 61.105 55.000 35.82 0.00 41.70 4.92
3467 5725 1.963172 TGCAGCTATCATTGGCAGAG 58.037 50.000 0.00 0.00 0.00 3.35
3468 5726 1.487558 TGCAGCTATCATTGGCAGAGA 59.512 47.619 0.00 0.00 0.00 3.10
3469 5727 1.872313 GCAGCTATCATTGGCAGAGAC 59.128 52.381 0.00 0.00 0.00 3.36
3470 5728 2.485124 GCAGCTATCATTGGCAGAGACT 60.485 50.000 0.00 0.00 0.00 3.24
3471 5729 3.806380 CAGCTATCATTGGCAGAGACTT 58.194 45.455 0.00 0.00 0.00 3.01
3472 5730 3.560481 CAGCTATCATTGGCAGAGACTTG 59.440 47.826 0.00 0.00 0.00 3.16
3473 5731 2.877168 GCTATCATTGGCAGAGACTTGG 59.123 50.000 0.00 0.00 0.00 3.61
3474 5732 2.431954 ATCATTGGCAGAGACTTGGG 57.568 50.000 0.00 0.00 0.00 4.12
3475 5733 1.361204 TCATTGGCAGAGACTTGGGA 58.639 50.000 0.00 0.00 0.00 4.37
3476 5734 1.918262 TCATTGGCAGAGACTTGGGAT 59.082 47.619 0.00 0.00 0.00 3.85
3477 5735 2.309755 TCATTGGCAGAGACTTGGGATT 59.690 45.455 0.00 0.00 0.00 3.01
3478 5736 3.523157 TCATTGGCAGAGACTTGGGATTA 59.477 43.478 0.00 0.00 0.00 1.75
3479 5737 3.634397 TTGGCAGAGACTTGGGATTAG 57.366 47.619 0.00 0.00 0.00 1.73
3480 5738 2.832838 TGGCAGAGACTTGGGATTAGA 58.167 47.619 0.00 0.00 0.00 2.10
3481 5739 3.181329 TGGCAGAGACTTGGGATTAGAA 58.819 45.455 0.00 0.00 0.00 2.10
3482 5740 3.198635 TGGCAGAGACTTGGGATTAGAAG 59.801 47.826 0.00 0.00 0.00 2.85
3483 5741 3.452627 GGCAGAGACTTGGGATTAGAAGA 59.547 47.826 0.00 0.00 0.00 2.87
3484 5742 4.080863 GGCAGAGACTTGGGATTAGAAGAA 60.081 45.833 0.00 0.00 0.00 2.52
3485 5743 5.491982 GCAGAGACTTGGGATTAGAAGAAA 58.508 41.667 0.00 0.00 0.00 2.52
3486 5744 6.118852 GCAGAGACTTGGGATTAGAAGAAAT 58.881 40.000 0.00 0.00 0.00 2.17
3487 5745 7.275920 GCAGAGACTTGGGATTAGAAGAAATA 58.724 38.462 0.00 0.00 0.00 1.40
3488 5746 7.225734 GCAGAGACTTGGGATTAGAAGAAATAC 59.774 40.741 0.00 0.00 0.00 1.89
3489 5747 8.260818 CAGAGACTTGGGATTAGAAGAAATACA 58.739 37.037 0.00 0.00 0.00 2.29
3490 5748 8.482128 AGAGACTTGGGATTAGAAGAAATACAG 58.518 37.037 0.00 0.00 0.00 2.74
3491 5749 7.569240 AGACTTGGGATTAGAAGAAATACAGG 58.431 38.462 0.00 0.00 0.00 4.00
3492 5750 6.122964 ACTTGGGATTAGAAGAAATACAGGC 58.877 40.000 0.00 0.00 0.00 4.85
3493 5751 5.708736 TGGGATTAGAAGAAATACAGGCA 57.291 39.130 0.00 0.00 0.00 4.75
3494 5752 6.266131 TGGGATTAGAAGAAATACAGGCAT 57.734 37.500 0.00 0.00 0.00 4.40
3495 5753 6.064060 TGGGATTAGAAGAAATACAGGCATG 58.936 40.000 0.00 0.00 0.00 4.06
3496 5754 6.064717 GGGATTAGAAGAAATACAGGCATGT 58.935 40.000 9.77 9.77 43.76 3.21
3497 5755 6.547510 GGGATTAGAAGAAATACAGGCATGTT 59.452 38.462 10.25 0.00 41.01 2.71
3498 5756 7.420800 GGATTAGAAGAAATACAGGCATGTTG 58.579 38.462 10.25 0.00 41.01 3.33
3499 5757 7.067494 GGATTAGAAGAAATACAGGCATGTTGT 59.933 37.037 10.25 9.44 41.01 3.32
3500 5758 5.886960 AGAAGAAATACAGGCATGTTGTC 57.113 39.130 10.25 4.97 41.01 3.18
3501 5759 5.564550 AGAAGAAATACAGGCATGTTGTCT 58.435 37.500 10.25 7.38 41.01 3.41
3502 5760 6.006449 AGAAGAAATACAGGCATGTTGTCTT 58.994 36.000 10.25 15.51 41.01 3.01
3503 5761 7.168219 AGAAGAAATACAGGCATGTTGTCTTA 58.832 34.615 10.25 0.00 41.01 2.10
3504 5762 7.831193 AGAAGAAATACAGGCATGTTGTCTTAT 59.169 33.333 10.25 10.61 41.01 1.73
3505 5763 7.944729 AGAAATACAGGCATGTTGTCTTATT 57.055 32.000 10.25 0.00 41.01 1.40
3506 5764 8.353423 AGAAATACAGGCATGTTGTCTTATTT 57.647 30.769 10.25 8.37 41.01 1.40
3507 5765 8.806146 AGAAATACAGGCATGTTGTCTTATTTT 58.194 29.630 10.25 0.00 41.01 1.82
3508 5766 8.761575 AAATACAGGCATGTTGTCTTATTTTG 57.238 30.769 10.25 0.00 41.01 2.44
3509 5767 4.559153 ACAGGCATGTTGTCTTATTTTGC 58.441 39.130 0.00 0.00 35.63 3.68
3510 5768 4.281688 ACAGGCATGTTGTCTTATTTTGCT 59.718 37.500 0.00 0.00 35.63 3.91
3511 5769 5.221501 ACAGGCATGTTGTCTTATTTTGCTT 60.222 36.000 0.00 0.00 35.63 3.91
3512 5770 6.015519 ACAGGCATGTTGTCTTATTTTGCTTA 60.016 34.615 0.00 0.00 35.63 3.09
3513 5771 7.037438 CAGGCATGTTGTCTTATTTTGCTTAT 58.963 34.615 0.00 0.00 23.66 1.73
3514 5772 8.190122 CAGGCATGTTGTCTTATTTTGCTTATA 58.810 33.333 0.00 0.00 23.66 0.98
3515 5773 8.917088 AGGCATGTTGTCTTATTTTGCTTATAT 58.083 29.630 0.00 0.00 0.00 0.86
3516 5774 9.533253 GGCATGTTGTCTTATTTTGCTTATATT 57.467 29.630 0.00 0.00 0.00 1.28
3529 5787 8.980143 TTTTGCTTATATTACCTGTTGAAAGC 57.020 30.769 0.00 0.00 38.78 3.51
3530 5788 7.938140 TTGCTTATATTACCTGTTGAAAGCT 57.062 32.000 0.00 0.00 39.02 3.74
3531 5789 7.553881 TGCTTATATTACCTGTTGAAAGCTC 57.446 36.000 0.00 0.00 39.02 4.09
3532 5790 7.109501 TGCTTATATTACCTGTTGAAAGCTCA 58.890 34.615 0.00 0.00 39.02 4.26
3533 5791 7.775093 TGCTTATATTACCTGTTGAAAGCTCAT 59.225 33.333 0.00 0.00 39.02 2.90
3534 5792 8.624776 GCTTATATTACCTGTTGAAAGCTCATT 58.375 33.333 0.00 0.00 36.16 2.57
3537 5795 6.655078 ATTACCTGTTGAAAGCTCATTTGT 57.345 33.333 0.00 0.00 0.00 2.83
3538 5796 4.574599 ACCTGTTGAAAGCTCATTTGTC 57.425 40.909 0.00 0.00 0.00 3.18
3539 5797 3.319122 ACCTGTTGAAAGCTCATTTGTCC 59.681 43.478 0.00 0.00 0.00 4.02
3540 5798 3.571401 CCTGTTGAAAGCTCATTTGTCCT 59.429 43.478 0.00 0.00 0.00 3.85
3541 5799 4.761739 CCTGTTGAAAGCTCATTTGTCCTA 59.238 41.667 0.00 0.00 0.00 2.94
3542 5800 5.241506 CCTGTTGAAAGCTCATTTGTCCTAA 59.758 40.000 0.00 0.00 0.00 2.69
3543 5801 6.239008 CCTGTTGAAAGCTCATTTGTCCTAAA 60.239 38.462 0.00 0.00 0.00 1.85
3544 5802 7.106439 TGTTGAAAGCTCATTTGTCCTAAAA 57.894 32.000 0.00 0.00 0.00 1.52
3545 5803 7.551585 TGTTGAAAGCTCATTTGTCCTAAAAA 58.448 30.769 0.00 0.00 0.00 1.94
3546 5804 7.491048 TGTTGAAAGCTCATTTGTCCTAAAAAC 59.509 33.333 0.00 0.00 0.00 2.43
3547 5805 7.346751 TGAAAGCTCATTTGTCCTAAAAACT 57.653 32.000 0.00 0.00 0.00 2.66
3548 5806 7.425606 TGAAAGCTCATTTGTCCTAAAAACTC 58.574 34.615 0.00 0.00 0.00 3.01
3549 5807 5.966742 AGCTCATTTGTCCTAAAAACTCC 57.033 39.130 0.00 0.00 0.00 3.85
3550 5808 5.635120 AGCTCATTTGTCCTAAAAACTCCT 58.365 37.500 0.00 0.00 0.00 3.69
3551 5809 6.071320 AGCTCATTTGTCCTAAAAACTCCTT 58.929 36.000 0.00 0.00 0.00 3.36
3552 5810 6.207614 AGCTCATTTGTCCTAAAAACTCCTTC 59.792 38.462 0.00 0.00 0.00 3.46
3553 5811 6.016276 GCTCATTTGTCCTAAAAACTCCTTCA 60.016 38.462 0.00 0.00 0.00 3.02
3554 5812 7.470009 GCTCATTTGTCCTAAAAACTCCTTCAA 60.470 37.037 0.00 0.00 0.00 2.69
3555 5813 7.712797 TCATTTGTCCTAAAAACTCCTTCAAC 58.287 34.615 0.00 0.00 0.00 3.18
3556 5814 7.340743 TCATTTGTCCTAAAAACTCCTTCAACA 59.659 33.333 0.00 0.00 0.00 3.33
3557 5815 6.445357 TTGTCCTAAAAACTCCTTCAACAC 57.555 37.500 0.00 0.00 0.00 3.32
3558 5816 4.885325 TGTCCTAAAAACTCCTTCAACACC 59.115 41.667 0.00 0.00 0.00 4.16
3559 5817 5.131067 GTCCTAAAAACTCCTTCAACACCT 58.869 41.667 0.00 0.00 0.00 4.00
3560 5818 6.126710 TGTCCTAAAAACTCCTTCAACACCTA 60.127 38.462 0.00 0.00 0.00 3.08
3561 5819 6.769341 GTCCTAAAAACTCCTTCAACACCTAA 59.231 38.462 0.00 0.00 0.00 2.69
3562 5820 7.447545 GTCCTAAAAACTCCTTCAACACCTAAT 59.552 37.037 0.00 0.00 0.00 1.73
3563 5821 8.662255 TCCTAAAAACTCCTTCAACACCTAATA 58.338 33.333 0.00 0.00 0.00 0.98
3564 5822 9.292195 CCTAAAAACTCCTTCAACACCTAATAA 57.708 33.333 0.00 0.00 0.00 1.40
3578 5836 1.329599 CTAATAAGGAACAACCGGCGC 59.670 52.381 0.00 0.00 44.74 6.53
3579 5837 0.606944 AATAAGGAACAACCGGCGCA 60.607 50.000 10.83 0.00 44.74 6.09
3580 5838 1.303091 ATAAGGAACAACCGGCGCAC 61.303 55.000 10.83 0.00 44.74 5.34
3603 5861 2.270205 CTGCGCAGGAAGATGGGT 59.730 61.111 29.88 0.00 35.67 4.51
3604 5862 2.046023 TGCGCAGGAAGATGGGTG 60.046 61.111 5.66 0.00 35.67 4.61
3605 5863 2.825836 GCGCAGGAAGATGGGTGG 60.826 66.667 0.30 0.00 35.67 4.61
3606 5864 2.124570 CGCAGGAAGATGGGTGGG 60.125 66.667 0.00 0.00 0.00 4.61
3607 5865 2.971598 CGCAGGAAGATGGGTGGGT 61.972 63.158 0.00 0.00 0.00 4.51
3608 5866 1.379044 GCAGGAAGATGGGTGGGTG 60.379 63.158 0.00 0.00 0.00 4.61
3609 5867 1.379044 CAGGAAGATGGGTGGGTGC 60.379 63.158 0.00 0.00 0.00 5.01
3610 5868 2.438434 GGAAGATGGGTGGGTGCG 60.438 66.667 0.00 0.00 0.00 5.34
3611 5869 3.134127 GAAGATGGGTGGGTGCGC 61.134 66.667 0.00 0.00 0.00 6.09
3612 5870 3.628646 GAAGATGGGTGGGTGCGCT 62.629 63.158 9.73 0.00 0.00 5.92
3613 5871 2.252072 GAAGATGGGTGGGTGCGCTA 62.252 60.000 9.73 0.00 0.00 4.26
3614 5872 2.513897 GATGGGTGGGTGCGCTAC 60.514 66.667 9.73 5.08 0.00 3.58
3615 5873 4.467084 ATGGGTGGGTGCGCTACG 62.467 66.667 9.73 0.00 0.00 3.51
3617 5875 4.814294 GGGTGGGTGCGCTACGAG 62.814 72.222 9.73 0.00 0.00 4.18
3619 5877 4.735132 GTGGGTGCGCTACGAGCA 62.735 66.667 9.73 2.33 42.58 4.26
3624 5882 3.680786 TGCGCTACGAGCACACCT 61.681 61.111 9.73 0.00 42.58 4.00
3625 5883 3.181967 GCGCTACGAGCACACCTG 61.182 66.667 0.00 0.00 42.58 4.00
3626 5884 3.181967 CGCTACGAGCACACCTGC 61.182 66.667 7.47 0.00 42.58 4.85
3655 5913 4.836931 GCAGACGCTAAAAGTTACTACC 57.163 45.455 0.00 0.00 34.30 3.18
3656 5914 4.492611 GCAGACGCTAAAAGTTACTACCT 58.507 43.478 0.00 0.00 34.30 3.08
3657 5915 4.562000 GCAGACGCTAAAAGTTACTACCTC 59.438 45.833 0.00 0.00 34.30 3.85
3658 5916 5.100943 CAGACGCTAAAAGTTACTACCTCC 58.899 45.833 0.00 0.00 0.00 4.30
3659 5917 4.101235 GACGCTAAAAGTTACTACCTCCG 58.899 47.826 0.00 0.00 0.00 4.63
3660 5918 3.507622 ACGCTAAAAGTTACTACCTCCGT 59.492 43.478 0.00 0.00 0.00 4.69
3661 5919 4.101235 CGCTAAAAGTTACTACCTCCGTC 58.899 47.826 0.00 0.00 0.00 4.79
3662 5920 4.428209 GCTAAAAGTTACTACCTCCGTCC 58.572 47.826 0.00 0.00 0.00 4.79
3663 5921 3.969287 AAAAGTTACTACCTCCGTCCC 57.031 47.619 0.00 0.00 0.00 4.46
3664 5922 2.610438 AAGTTACTACCTCCGTCCCA 57.390 50.000 0.00 0.00 0.00 4.37
3665 5923 2.610438 AGTTACTACCTCCGTCCCAA 57.390 50.000 0.00 0.00 0.00 4.12
3666 5924 2.893424 AGTTACTACCTCCGTCCCAAA 58.107 47.619 0.00 0.00 0.00 3.28
3667 5925 3.447950 AGTTACTACCTCCGTCCCAAAT 58.552 45.455 0.00 0.00 0.00 2.32
3668 5926 3.842436 AGTTACTACCTCCGTCCCAAATT 59.158 43.478 0.00 0.00 0.00 1.82
3669 5927 5.025453 AGTTACTACCTCCGTCCCAAATTA 58.975 41.667 0.00 0.00 0.00 1.40
3670 5928 5.664457 AGTTACTACCTCCGTCCCAAATTAT 59.336 40.000 0.00 0.00 0.00 1.28
3671 5929 6.840705 AGTTACTACCTCCGTCCCAAATTATA 59.159 38.462 0.00 0.00 0.00 0.98
3672 5930 7.345392 AGTTACTACCTCCGTCCCAAATTATAA 59.655 37.037 0.00 0.00 0.00 0.98
3673 5931 6.758806 ACTACCTCCGTCCCAAATTATAAT 57.241 37.500 0.00 0.00 0.00 1.28
3674 5932 7.145474 ACTACCTCCGTCCCAAATTATAATT 57.855 36.000 4.81 4.81 0.00 1.40
3675 5933 6.996282 ACTACCTCCGTCCCAAATTATAATTG 59.004 38.462 11.42 6.16 0.00 2.32
3676 5934 5.137551 ACCTCCGTCCCAAATTATAATTGG 58.862 41.667 11.42 13.47 45.62 3.16
3677 5935 5.137551 CCTCCGTCCCAAATTATAATTGGT 58.862 41.667 11.42 0.00 44.77 3.67
3678 5936 5.596772 CCTCCGTCCCAAATTATAATTGGTT 59.403 40.000 11.42 0.00 44.77 3.67
3679 5937 6.097696 CCTCCGTCCCAAATTATAATTGGTTT 59.902 38.462 11.42 0.00 44.77 3.27
3680 5938 7.364320 CCTCCGTCCCAAATTATAATTGGTTTT 60.364 37.037 11.42 0.00 44.77 2.43
3681 5939 7.908453 TCCGTCCCAAATTATAATTGGTTTTT 58.092 30.769 11.42 0.00 44.77 1.94
3682 5940 7.819900 TCCGTCCCAAATTATAATTGGTTTTTG 59.180 33.333 11.42 5.85 44.77 2.44
3683 5941 7.604545 CCGTCCCAAATTATAATTGGTTTTTGT 59.395 33.333 11.42 0.00 44.77 2.83
3684 5942 9.640963 CGTCCCAAATTATAATTGGTTTTTGTA 57.359 29.630 11.42 0.00 44.77 2.41
3687 5945 8.888716 CCCAAATTATAATTGGTTTTTGTAGGC 58.111 33.333 11.42 0.00 44.77 3.93
3688 5946 9.665719 CCAAATTATAATTGGTTTTTGTAGGCT 57.334 29.630 11.42 0.00 41.95 4.58
3737 5995 7.741027 ATTGACTCATAATGTAGCATCAAGG 57.259 36.000 0.00 0.00 0.00 3.61
3738 5996 5.614308 TGACTCATAATGTAGCATCAAGGG 58.386 41.667 0.00 0.00 0.00 3.95
3739 5997 5.366477 TGACTCATAATGTAGCATCAAGGGA 59.634 40.000 0.00 0.00 0.00 4.20
3740 5998 6.043590 TGACTCATAATGTAGCATCAAGGGAT 59.956 38.462 0.00 0.00 0.00 3.85
3741 5999 7.235399 TGACTCATAATGTAGCATCAAGGGATA 59.765 37.037 0.00 0.00 30.87 2.59
3742 6000 7.390027 ACTCATAATGTAGCATCAAGGGATAC 58.610 38.462 0.00 0.00 30.87 2.24
3743 6001 7.016563 ACTCATAATGTAGCATCAAGGGATACA 59.983 37.037 0.00 0.00 40.86 2.29
3744 6002 7.744733 TCATAATGTAGCATCAAGGGATACAA 58.255 34.615 0.00 0.00 40.12 2.41
3745 6003 8.385491 TCATAATGTAGCATCAAGGGATACAAT 58.615 33.333 0.00 0.00 40.12 2.71
3746 6004 8.671921 CATAATGTAGCATCAAGGGATACAATC 58.328 37.037 0.00 0.00 40.12 2.67
3747 6005 5.628797 TGTAGCATCAAGGGATACAATCA 57.371 39.130 0.00 0.00 34.53 2.57
3748 6006 6.191657 TGTAGCATCAAGGGATACAATCAT 57.808 37.500 0.00 0.00 34.53 2.45
3749 6007 7.315066 TGTAGCATCAAGGGATACAATCATA 57.685 36.000 0.00 0.00 34.53 2.15
3750 6008 7.744733 TGTAGCATCAAGGGATACAATCATAA 58.255 34.615 0.00 0.00 34.53 1.90
3751 6009 8.385491 TGTAGCATCAAGGGATACAATCATAAT 58.615 33.333 0.00 0.00 34.53 1.28
3752 6010 7.698506 AGCATCAAGGGATACAATCATAATG 57.301 36.000 0.00 0.00 39.74 1.90
3753 6011 7.464273 AGCATCAAGGGATACAATCATAATGA 58.536 34.615 0.00 0.00 39.74 2.57
3754 6012 7.610692 AGCATCAAGGGATACAATCATAATGAG 59.389 37.037 0.00 0.00 39.74 2.90
3755 6013 7.392673 GCATCAAGGGATACAATCATAATGAGT 59.607 37.037 0.00 0.00 39.74 3.41
3756 6014 9.948964 CATCAAGGGATACAATCATAATGAGTA 57.051 33.333 0.00 0.00 39.74 2.59
3757 6015 9.950496 ATCAAGGGATACAATCATAATGAGTAC 57.050 33.333 0.00 0.00 39.74 2.73
3758 6016 8.933653 TCAAGGGATACAATCATAATGAGTACA 58.066 33.333 0.00 0.00 39.74 2.90
3759 6017 9.559732 CAAGGGATACAATCATAATGAGTACAA 57.440 33.333 0.00 0.00 39.74 2.41
3760 6018 9.561069 AAGGGATACAATCATAATGAGTACAAC 57.439 33.333 0.00 0.00 39.74 3.32
3761 6019 8.713971 AGGGATACAATCATAATGAGTACAACA 58.286 33.333 0.00 0.00 39.74 3.33
3762 6020 8.774586 GGGATACAATCATAATGAGTACAACAC 58.225 37.037 0.00 0.00 39.74 3.32
3763 6021 8.774586 GGATACAATCATAATGAGTACAACACC 58.225 37.037 0.00 0.00 0.00 4.16
3764 6022 8.677148 ATACAATCATAATGAGTACAACACCC 57.323 34.615 0.00 0.00 0.00 4.61
3765 6023 5.584649 ACAATCATAATGAGTACAACACCCG 59.415 40.000 0.00 0.00 0.00 5.28
3766 6024 4.131649 TCATAATGAGTACAACACCCGG 57.868 45.455 0.00 0.00 0.00 5.73
3767 6025 2.389962 TAATGAGTACAACACCCGGC 57.610 50.000 0.00 0.00 0.00 6.13
3768 6026 0.322187 AATGAGTACAACACCCGGCC 60.322 55.000 0.00 0.00 0.00 6.13
3769 6027 1.198759 ATGAGTACAACACCCGGCCT 61.199 55.000 0.00 0.00 0.00 5.19
3770 6028 1.079336 GAGTACAACACCCGGCCTC 60.079 63.158 0.00 0.00 0.00 4.70
3771 6029 1.535687 AGTACAACACCCGGCCTCT 60.536 57.895 0.00 0.00 0.00 3.69
3772 6030 1.375523 GTACAACACCCGGCCTCTG 60.376 63.158 0.00 0.00 0.00 3.35
3773 6031 3.248446 TACAACACCCGGCCTCTGC 62.248 63.158 0.00 0.00 0.00 4.26
3774 6032 4.641645 CAACACCCGGCCTCTGCA 62.642 66.667 0.00 0.00 40.13 4.41
3775 6033 3.650950 AACACCCGGCCTCTGCAT 61.651 61.111 0.00 0.00 40.13 3.96
3776 6034 2.297895 AACACCCGGCCTCTGCATA 61.298 57.895 0.00 0.00 40.13 3.14
3777 6035 2.109799 CACCCGGCCTCTGCATAG 59.890 66.667 0.00 0.00 40.13 2.23
3778 6036 3.866582 ACCCGGCCTCTGCATAGC 61.867 66.667 0.00 0.00 40.13 2.97
3779 6037 3.554342 CCCGGCCTCTGCATAGCT 61.554 66.667 0.00 0.00 40.13 3.32
3780 6038 2.210013 CCCGGCCTCTGCATAGCTA 61.210 63.158 0.00 0.00 40.13 3.32
3781 6039 1.291588 CCGGCCTCTGCATAGCTAG 59.708 63.158 0.00 0.00 40.13 3.42
3782 6040 1.181741 CCGGCCTCTGCATAGCTAGA 61.182 60.000 0.00 0.00 40.13 2.43
3783 6041 0.676184 CGGCCTCTGCATAGCTAGAA 59.324 55.000 0.00 0.00 40.13 2.10
3784 6042 1.274728 CGGCCTCTGCATAGCTAGAAT 59.725 52.381 0.00 0.00 40.13 2.40
3785 6043 2.697654 GGCCTCTGCATAGCTAGAATG 58.302 52.381 0.00 0.00 40.13 2.67
3793 6051 3.874400 CATAGCTAGAATGCACACAGC 57.126 47.619 0.00 0.00 45.96 4.40
3794 6052 2.315925 TAGCTAGAATGCACACAGCC 57.684 50.000 0.00 0.00 44.83 4.85
3795 6053 0.325933 AGCTAGAATGCACACAGCCA 59.674 50.000 0.00 0.00 44.83 4.75
3796 6054 1.167851 GCTAGAATGCACACAGCCAA 58.832 50.000 0.00 0.00 44.83 4.52
3797 6055 1.747355 GCTAGAATGCACACAGCCAAT 59.253 47.619 0.00 0.00 44.83 3.16
3798 6056 2.945008 GCTAGAATGCACACAGCCAATA 59.055 45.455 0.00 0.00 44.83 1.90
3799 6057 3.242870 GCTAGAATGCACACAGCCAATAC 60.243 47.826 0.00 0.00 44.83 1.89
3800 6058 3.077484 AGAATGCACACAGCCAATACT 57.923 42.857 0.00 0.00 44.83 2.12
3801 6059 4.220693 AGAATGCACACAGCCAATACTA 57.779 40.909 0.00 0.00 44.83 1.82
3802 6060 4.588899 AGAATGCACACAGCCAATACTAA 58.411 39.130 0.00 0.00 44.83 2.24
3803 6061 4.396166 AGAATGCACACAGCCAATACTAAC 59.604 41.667 0.00 0.00 44.83 2.34
3804 6062 3.133141 TGCACACAGCCAATACTAACA 57.867 42.857 0.00 0.00 44.83 2.41
3805 6063 2.811431 TGCACACAGCCAATACTAACAC 59.189 45.455 0.00 0.00 44.83 3.32
3806 6064 2.811431 GCACACAGCCAATACTAACACA 59.189 45.455 0.00 0.00 37.23 3.72
3807 6065 3.364964 GCACACAGCCAATACTAACACAC 60.365 47.826 0.00 0.00 37.23 3.82
3808 6066 3.812609 CACACAGCCAATACTAACACACA 59.187 43.478 0.00 0.00 0.00 3.72
3809 6067 3.813166 ACACAGCCAATACTAACACACAC 59.187 43.478 0.00 0.00 0.00 3.82
3810 6068 3.812609 CACAGCCAATACTAACACACACA 59.187 43.478 0.00 0.00 0.00 3.72
3811 6069 4.274705 CACAGCCAATACTAACACACACAA 59.725 41.667 0.00 0.00 0.00 3.33
3812 6070 4.884744 ACAGCCAATACTAACACACACAAA 59.115 37.500 0.00 0.00 0.00 2.83
3813 6071 5.534654 ACAGCCAATACTAACACACACAAAT 59.465 36.000 0.00 0.00 0.00 2.32
3814 6072 5.858049 CAGCCAATACTAACACACACAAATG 59.142 40.000 0.00 0.00 0.00 2.32
3815 6073 5.767665 AGCCAATACTAACACACACAAATGA 59.232 36.000 0.00 0.00 0.00 2.57
3816 6074 6.434028 AGCCAATACTAACACACACAAATGAT 59.566 34.615 0.00 0.00 0.00 2.45
3817 6075 6.747280 GCCAATACTAACACACACAAATGATC 59.253 38.462 0.00 0.00 0.00 2.92
3818 6076 7.574779 GCCAATACTAACACACACAAATGATCA 60.575 37.037 0.00 0.00 0.00 2.92
3819 6077 7.750458 CCAATACTAACACACACAAATGATCAC 59.250 37.037 0.00 0.00 0.00 3.06
3820 6078 5.342806 ACTAACACACACAAATGATCACG 57.657 39.130 0.00 0.00 0.00 4.35
3821 6079 4.814234 ACTAACACACACAAATGATCACGT 59.186 37.500 0.00 0.00 0.00 4.49
3822 6080 3.878086 ACACACACAAATGATCACGTC 57.122 42.857 0.00 0.00 0.00 4.34
3823 6081 2.548057 ACACACACAAATGATCACGTCC 59.452 45.455 0.00 0.00 0.00 4.79
3824 6082 1.798223 ACACACAAATGATCACGTCCG 59.202 47.619 0.00 0.00 0.00 4.79
3825 6083 0.796312 ACACAAATGATCACGTCCGC 59.204 50.000 0.00 0.00 0.00 5.54
3826 6084 0.795698 CACAAATGATCACGTCCGCA 59.204 50.000 0.00 0.00 0.00 5.69
3827 6085 1.398041 CACAAATGATCACGTCCGCAT 59.602 47.619 0.00 0.00 0.00 4.73
3828 6086 1.398041 ACAAATGATCACGTCCGCATG 59.602 47.619 0.00 0.00 0.00 4.06
3829 6087 1.016627 AAATGATCACGTCCGCATGG 58.983 50.000 0.00 0.00 0.00 3.66
3830 6088 0.177836 AATGATCACGTCCGCATGGA 59.822 50.000 0.00 0.00 43.88 3.41
3838 6096 4.301505 TCCGCATGGAGCAAAGTC 57.698 55.556 0.00 0.00 46.13 3.01
3839 6097 1.374568 TCCGCATGGAGCAAAGTCA 59.625 52.632 0.00 0.00 46.13 3.41
3840 6098 0.035152 TCCGCATGGAGCAAAGTCAT 60.035 50.000 0.00 0.00 46.13 3.06
3841 6099 1.209261 TCCGCATGGAGCAAAGTCATA 59.791 47.619 0.00 0.00 46.13 2.15
3842 6100 1.331756 CCGCATGGAGCAAAGTCATAC 59.668 52.381 0.00 0.00 46.13 2.39
3843 6101 2.009051 CGCATGGAGCAAAGTCATACA 58.991 47.619 0.00 0.00 46.13 2.29
3844 6102 2.419673 CGCATGGAGCAAAGTCATACAA 59.580 45.455 0.00 0.00 46.13 2.41
3845 6103 3.486375 CGCATGGAGCAAAGTCATACAAG 60.486 47.826 0.00 0.00 46.13 3.16
3846 6104 3.691118 GCATGGAGCAAAGTCATACAAGA 59.309 43.478 0.00 0.00 44.79 3.02
3847 6105 4.437930 GCATGGAGCAAAGTCATACAAGAC 60.438 45.833 0.00 0.00 44.79 3.01
3848 6106 3.674997 TGGAGCAAAGTCATACAAGACC 58.325 45.455 0.00 0.00 39.34 3.85
3849 6107 2.673368 GGAGCAAAGTCATACAAGACCG 59.327 50.000 0.00 0.00 39.34 4.79
3850 6108 3.585862 GAGCAAAGTCATACAAGACCGA 58.414 45.455 0.00 0.00 39.34 4.69
3851 6109 3.994392 GAGCAAAGTCATACAAGACCGAA 59.006 43.478 0.00 0.00 39.34 4.30
3852 6110 3.997021 AGCAAAGTCATACAAGACCGAAG 59.003 43.478 0.00 0.00 39.34 3.79
3853 6111 3.424962 GCAAAGTCATACAAGACCGAAGC 60.425 47.826 0.00 0.00 39.34 3.86
3854 6112 3.963428 AAGTCATACAAGACCGAAGCT 57.037 42.857 0.00 0.00 39.34 3.74
3855 6113 5.168569 CAAAGTCATACAAGACCGAAGCTA 58.831 41.667 0.00 0.00 39.34 3.32
3856 6114 5.599999 AAGTCATACAAGACCGAAGCTAT 57.400 39.130 0.00 0.00 39.34 2.97
3857 6115 4.938080 AGTCATACAAGACCGAAGCTATG 58.062 43.478 0.00 0.00 39.34 2.23
3858 6116 3.491267 GTCATACAAGACCGAAGCTATGC 59.509 47.826 0.00 0.00 32.36 3.14
3859 6117 2.596904 TACAAGACCGAAGCTATGCC 57.403 50.000 0.00 0.00 0.00 4.40
3860 6118 0.460284 ACAAGACCGAAGCTATGCCG 60.460 55.000 0.00 0.00 0.00 5.69
3862 6120 1.327690 AAGACCGAAGCTATGCCGGA 61.328 55.000 19.18 0.00 45.58 5.14
3863 6121 1.591863 GACCGAAGCTATGCCGGAC 60.592 63.158 19.18 11.76 45.58 4.79
3864 6122 2.658593 CCGAAGCTATGCCGGACG 60.659 66.667 5.05 0.00 45.58 4.79
3865 6123 2.411701 CGAAGCTATGCCGGACGA 59.588 61.111 5.05 0.00 0.00 4.20
3866 6124 1.226859 CGAAGCTATGCCGGACGAA 60.227 57.895 5.05 0.00 0.00 3.85
3867 6125 1.209275 CGAAGCTATGCCGGACGAAG 61.209 60.000 5.05 0.00 0.00 3.79
3898 6156 4.098416 GGAAAAATTCCTGAAGCGATTCG 58.902 43.478 9.12 0.62 46.57 3.34
3899 6157 4.142687 GGAAAAATTCCTGAAGCGATTCGA 60.143 41.667 10.88 0.00 46.57 3.71
3900 6158 4.342352 AAAATTCCTGAAGCGATTCGAC 57.658 40.909 10.88 1.21 0.00 4.20
3901 6159 2.672961 ATTCCTGAAGCGATTCGACA 57.327 45.000 10.88 5.65 0.00 4.35
3902 6160 2.448926 TTCCTGAAGCGATTCGACAA 57.551 45.000 10.88 0.00 0.00 3.18
3903 6161 2.672961 TCCTGAAGCGATTCGACAAT 57.327 45.000 10.88 0.00 0.00 2.71
3904 6162 3.793797 TCCTGAAGCGATTCGACAATA 57.206 42.857 10.88 0.00 0.00 1.90
3905 6163 4.322080 TCCTGAAGCGATTCGACAATAT 57.678 40.909 10.88 0.00 0.00 1.28
3906 6164 5.447624 TCCTGAAGCGATTCGACAATATA 57.552 39.130 10.88 0.00 0.00 0.86
3907 6165 5.220381 TCCTGAAGCGATTCGACAATATAC 58.780 41.667 10.88 0.00 0.00 1.47
3908 6166 4.088638 CCTGAAGCGATTCGACAATATACG 59.911 45.833 10.88 0.00 0.00 3.06
3909 6167 3.978855 TGAAGCGATTCGACAATATACGG 59.021 43.478 10.88 0.00 0.00 4.02
3910 6168 3.637998 AGCGATTCGACAATATACGGT 57.362 42.857 10.88 0.00 0.00 4.83
3911 6169 3.305964 AGCGATTCGACAATATACGGTG 58.694 45.455 10.88 0.00 0.00 4.94
3912 6170 2.407361 GCGATTCGACAATATACGGTGG 59.593 50.000 10.88 0.00 0.00 4.61
3913 6171 3.635331 CGATTCGACAATATACGGTGGT 58.365 45.455 0.00 0.00 0.00 4.16
3914 6172 3.424198 CGATTCGACAATATACGGTGGTG 59.576 47.826 0.00 0.00 0.00 4.17
3915 6173 4.613944 GATTCGACAATATACGGTGGTGA 58.386 43.478 0.00 0.00 0.00 4.02
3916 6174 3.425577 TCGACAATATACGGTGGTGAC 57.574 47.619 0.00 0.00 0.00 3.67
3917 6175 2.099592 TCGACAATATACGGTGGTGACC 59.900 50.000 0.00 0.00 39.14 4.02
3918 6176 2.159212 CGACAATATACGGTGGTGACCA 60.159 50.000 0.00 0.00 43.33 4.02
3919 6177 3.491964 CGACAATATACGGTGGTGACCAT 60.492 47.826 7.94 0.00 43.33 3.55
3920 6178 4.056050 GACAATATACGGTGGTGACCATC 58.944 47.826 7.94 6.08 43.33 3.51
3925 6183 2.746277 GGTGGTGACCATCGGCAC 60.746 66.667 7.94 0.00 42.59 5.01
3926 6184 2.746277 GTGGTGACCATCGGCACC 60.746 66.667 8.67 8.67 44.33 5.01
3927 6185 4.028490 TGGTGACCATCGGCACCC 62.028 66.667 13.37 0.00 43.84 4.61
3928 6186 4.028490 GGTGACCATCGGCACCCA 62.028 66.667 3.49 0.00 41.00 4.51
3929 6187 2.272146 GTGACCATCGGCACCCAT 59.728 61.111 0.00 0.00 0.00 4.00
3930 6188 1.819632 GTGACCATCGGCACCCATC 60.820 63.158 0.00 0.00 0.00 3.51
3931 6189 2.297129 TGACCATCGGCACCCATCA 61.297 57.895 0.00 0.00 0.00 3.07
3932 6190 1.149174 GACCATCGGCACCCATCAT 59.851 57.895 0.00 0.00 0.00 2.45
3933 6191 0.886490 GACCATCGGCACCCATCATC 60.886 60.000 0.00 0.00 0.00 2.92
3934 6192 1.348008 ACCATCGGCACCCATCATCT 61.348 55.000 0.00 0.00 0.00 2.90
3935 6193 0.604780 CCATCGGCACCCATCATCTC 60.605 60.000 0.00 0.00 0.00 2.75
3936 6194 0.395686 CATCGGCACCCATCATCTCT 59.604 55.000 0.00 0.00 0.00 3.10
3937 6195 1.135094 ATCGGCACCCATCATCTCTT 58.865 50.000 0.00 0.00 0.00 2.85
3938 6196 0.178767 TCGGCACCCATCATCTCTTG 59.821 55.000 0.00 0.00 0.00 3.02
3939 6197 0.178767 CGGCACCCATCATCTCTTGA 59.821 55.000 0.00 0.00 39.12 3.02
3940 6198 1.673168 GGCACCCATCATCTCTTGAC 58.327 55.000 0.00 0.00 37.11 3.18
3941 6199 1.065199 GGCACCCATCATCTCTTGACA 60.065 52.381 0.00 0.00 37.11 3.58
3942 6200 2.618816 GGCACCCATCATCTCTTGACAA 60.619 50.000 0.00 0.00 37.11 3.18
3943 6201 2.421424 GCACCCATCATCTCTTGACAAC 59.579 50.000 0.00 0.00 37.11 3.32
3944 6202 3.678289 CACCCATCATCTCTTGACAACA 58.322 45.455 0.00 0.00 37.11 3.33
3945 6203 3.438087 CACCCATCATCTCTTGACAACAC 59.562 47.826 0.00 0.00 37.11 3.32
3946 6204 3.072915 ACCCATCATCTCTTGACAACACA 59.927 43.478 0.00 0.00 37.11 3.72
3947 6205 4.074259 CCCATCATCTCTTGACAACACAA 58.926 43.478 0.00 0.00 37.11 3.33
3948 6206 4.155462 CCCATCATCTCTTGACAACACAAG 59.845 45.833 0.00 0.00 45.73 3.16
3949 6207 4.379186 CCATCATCTCTTGACAACACAAGC 60.379 45.833 0.00 0.00 44.52 4.01
3950 6208 3.807553 TCATCTCTTGACAACACAAGCA 58.192 40.909 0.00 0.00 44.52 3.91
3951 6209 4.198530 TCATCTCTTGACAACACAAGCAA 58.801 39.130 0.00 0.00 44.52 3.91
3952 6210 4.823442 TCATCTCTTGACAACACAAGCAAT 59.177 37.500 0.00 0.00 44.52 3.56
3953 6211 5.997129 TCATCTCTTGACAACACAAGCAATA 59.003 36.000 0.00 0.00 44.52 1.90
3954 6212 6.656270 TCATCTCTTGACAACACAAGCAATAT 59.344 34.615 0.00 0.00 44.52 1.28
3955 6213 6.245115 TCTCTTGACAACACAAGCAATATG 57.755 37.500 0.00 0.00 44.52 1.78
3956 6214 5.997129 TCTCTTGACAACACAAGCAATATGA 59.003 36.000 0.00 0.00 44.52 2.15
3957 6215 6.148315 TCTCTTGACAACACAAGCAATATGAG 59.852 38.462 0.00 0.00 44.52 2.90
3958 6216 5.997129 TCTTGACAACACAAGCAATATGAGA 59.003 36.000 0.00 0.00 44.52 3.27
3959 6217 6.486320 TCTTGACAACACAAGCAATATGAGAA 59.514 34.615 0.00 0.00 44.52 2.87
3960 6218 6.631971 TGACAACACAAGCAATATGAGAAA 57.368 33.333 0.00 0.00 0.00 2.52
3961 6219 6.671190 TGACAACACAAGCAATATGAGAAAG 58.329 36.000 0.00 0.00 0.00 2.62
3962 6220 6.017400 ACAACACAAGCAATATGAGAAAGG 57.983 37.500 0.00 0.00 0.00 3.11
3963 6221 5.536161 ACAACACAAGCAATATGAGAAAGGT 59.464 36.000 0.00 0.00 0.00 3.50
3964 6222 6.040842 ACAACACAAGCAATATGAGAAAGGTT 59.959 34.615 0.00 0.00 0.00 3.50
3965 6223 6.259550 ACACAAGCAATATGAGAAAGGTTC 57.740 37.500 0.00 0.00 0.00 3.62
3966 6224 6.006449 ACACAAGCAATATGAGAAAGGTTCT 58.994 36.000 0.00 0.00 44.21 3.01
3967 6225 6.491403 ACACAAGCAATATGAGAAAGGTTCTT 59.509 34.615 0.00 0.00 40.87 2.52
3968 6226 7.025963 CACAAGCAATATGAGAAAGGTTCTTC 58.974 38.462 0.00 0.00 40.87 2.87
3969 6227 6.716628 ACAAGCAATATGAGAAAGGTTCTTCA 59.283 34.615 0.00 0.00 40.87 3.02
3970 6228 7.231317 ACAAGCAATATGAGAAAGGTTCTTCAA 59.769 33.333 0.00 0.00 40.87 2.69
3971 6229 7.765695 AGCAATATGAGAAAGGTTCTTCAAA 57.234 32.000 0.00 0.00 40.87 2.69
3972 6230 8.181904 AGCAATATGAGAAAGGTTCTTCAAAA 57.818 30.769 0.00 0.00 40.87 2.44
3973 6231 8.302438 AGCAATATGAGAAAGGTTCTTCAAAAG 58.698 33.333 0.00 0.00 40.87 2.27
3974 6232 7.062722 GCAATATGAGAAAGGTTCTTCAAAAGC 59.937 37.037 0.00 0.00 40.87 3.51
3975 6233 4.552166 TGAGAAAGGTTCTTCAAAAGCG 57.448 40.909 0.00 0.00 40.87 4.68
3976 6234 4.196193 TGAGAAAGGTTCTTCAAAAGCGA 58.804 39.130 0.00 0.00 40.87 4.93
3977 6235 4.035208 TGAGAAAGGTTCTTCAAAAGCGAC 59.965 41.667 0.00 0.00 40.87 5.19
3978 6236 3.002348 AGAAAGGTTCTTCAAAAGCGACG 59.998 43.478 0.00 0.00 36.36 5.12
3979 6237 0.586802 AGGTTCTTCAAAAGCGACGC 59.413 50.000 13.03 13.03 0.00 5.19
3980 6238 0.385598 GGTTCTTCAAAAGCGACGCC 60.386 55.000 17.79 0.00 0.00 5.68
3981 6239 0.586802 GTTCTTCAAAAGCGACGCCT 59.413 50.000 17.79 0.00 0.00 5.52
3982 6240 0.865769 TTCTTCAAAAGCGACGCCTC 59.134 50.000 17.79 0.00 0.00 4.70
3983 6241 0.949105 TCTTCAAAAGCGACGCCTCC 60.949 55.000 17.79 0.00 0.00 4.30
3984 6242 1.227704 TTCAAAAGCGACGCCTCCA 60.228 52.632 17.79 0.00 0.00 3.86
3985 6243 1.227999 TTCAAAAGCGACGCCTCCAG 61.228 55.000 17.79 3.31 0.00 3.86
3986 6244 2.358737 AAAAGCGACGCCTCCAGG 60.359 61.111 17.79 0.00 38.53 4.45
3987 6245 2.879233 AAAAGCGACGCCTCCAGGA 61.879 57.895 17.79 0.00 37.39 3.86
3988 6246 2.391724 AAAAGCGACGCCTCCAGGAA 62.392 55.000 17.79 0.00 37.39 3.36
3989 6247 2.391724 AAAGCGACGCCTCCAGGAAA 62.392 55.000 17.79 0.00 37.39 3.13
3990 6248 2.788191 AAGCGACGCCTCCAGGAAAG 62.788 60.000 17.79 0.00 37.39 2.62
3991 6249 2.125512 CGACGCCTCCAGGAAAGG 60.126 66.667 0.00 0.00 37.39 3.11
3992 6250 2.646175 CGACGCCTCCAGGAAAGGA 61.646 63.158 0.00 0.00 35.83 3.36
3993 6251 1.677552 GACGCCTCCAGGAAAGGAA 59.322 57.895 0.00 0.00 37.20 3.36
3994 6252 0.673956 GACGCCTCCAGGAAAGGAAC 60.674 60.000 0.00 0.00 37.20 3.62
3995 6253 1.741770 CGCCTCCAGGAAAGGAACG 60.742 63.158 0.00 0.00 37.20 3.95
3996 6254 1.677552 GCCTCCAGGAAAGGAACGA 59.322 57.895 0.00 0.00 37.20 3.85
3997 6255 0.673956 GCCTCCAGGAAAGGAACGAC 60.674 60.000 0.00 0.00 37.20 4.34
3998 6256 0.389948 CCTCCAGGAAAGGAACGACG 60.390 60.000 0.00 0.00 37.20 5.12
3999 6257 1.005394 TCCAGGAAAGGAACGACGC 60.005 57.895 0.00 0.00 33.93 5.19
4000 6258 1.301401 CCAGGAAAGGAACGACGCA 60.301 57.895 0.00 0.00 0.00 5.24
4001 6259 1.566018 CCAGGAAAGGAACGACGCAC 61.566 60.000 0.00 0.00 0.00 5.34
4002 6260 0.878523 CAGGAAAGGAACGACGCACA 60.879 55.000 0.00 0.00 0.00 4.57
4003 6261 0.179067 AGGAAAGGAACGACGCACAA 60.179 50.000 0.00 0.00 0.00 3.33
4004 6262 0.658897 GGAAAGGAACGACGCACAAA 59.341 50.000 0.00 0.00 0.00 2.83
4005 6263 1.596220 GGAAAGGAACGACGCACAAAC 60.596 52.381 0.00 0.00 0.00 2.93
4006 6264 1.062880 GAAAGGAACGACGCACAAACA 59.937 47.619 0.00 0.00 0.00 2.83
4007 6265 0.375803 AAGGAACGACGCACAAACAC 59.624 50.000 0.00 0.00 0.00 3.32
4008 6266 1.010462 GGAACGACGCACAAACACC 60.010 57.895 0.00 0.00 0.00 4.16
4009 6267 1.367195 GAACGACGCACAAACACCG 60.367 57.895 0.00 0.00 0.00 4.94
4010 6268 3.443261 AACGACGCACAAACACCGC 62.443 57.895 0.00 0.00 0.00 5.68
4011 6269 4.659874 CGACGCACAAACACCGCC 62.660 66.667 0.00 0.00 0.00 6.13
4012 6270 4.659874 GACGCACAAACACCGCCG 62.660 66.667 0.00 0.00 0.00 6.46
4014 6272 4.659874 CGCACAAACACCGCCGTC 62.660 66.667 0.00 0.00 0.00 4.79
4015 6273 4.659874 GCACAAACACCGCCGTCG 62.660 66.667 0.00 0.00 0.00 5.12
4016 6274 4.659874 CACAAACACCGCCGTCGC 62.660 66.667 0.00 0.00 0.00 5.19
4025 6283 4.302172 CGCCGTCGCCGTTTTTGT 62.302 61.111 0.00 0.00 0.00 2.83
4026 6284 2.937486 GCCGTCGCCGTTTTTGTA 59.063 55.556 0.00 0.00 0.00 2.41
4027 6285 1.154543 GCCGTCGCCGTTTTTGTAG 60.155 57.895 0.00 0.00 0.00 2.74
4028 6286 1.494189 CCGTCGCCGTTTTTGTAGG 59.506 57.895 0.00 0.00 0.00 3.18
4029 6287 1.154543 CGTCGCCGTTTTTGTAGGC 60.155 57.895 0.00 0.00 46.88 3.93
4033 6291 3.990546 GCCGTTTTTGTAGGCTAGC 57.009 52.632 6.04 6.04 46.83 3.42
4034 6292 0.450583 GCCGTTTTTGTAGGCTAGCC 59.549 55.000 27.19 27.19 46.83 3.93
4036 6294 2.678769 GCCGTTTTTGTAGGCTAGCCTA 60.679 50.000 35.07 35.07 46.14 3.93
4046 6304 2.482494 AGGCTAGCCTACCAGAAATGT 58.518 47.619 35.28 6.16 46.14 2.71
4047 6305 2.436173 AGGCTAGCCTACCAGAAATGTC 59.564 50.000 35.28 1.76 46.14 3.06
4048 6306 2.436173 GGCTAGCCTACCAGAAATGTCT 59.564 50.000 27.17 0.00 32.85 3.41
4049 6307 3.118223 GGCTAGCCTACCAGAAATGTCTT 60.118 47.826 27.17 0.00 28.78 3.01
4050 6308 4.101119 GGCTAGCCTACCAGAAATGTCTTA 59.899 45.833 27.17 0.00 28.78 2.10
4051 6309 5.221742 GGCTAGCCTACCAGAAATGTCTTAT 60.222 44.000 27.17 0.00 28.78 1.73
4052 6310 6.014499 GGCTAGCCTACCAGAAATGTCTTATA 60.014 42.308 27.17 0.00 28.78 0.98
4053 6311 7.310734 GGCTAGCCTACCAGAAATGTCTTATAT 60.311 40.741 27.17 0.00 28.78 0.86
4054 6312 8.097662 GCTAGCCTACCAGAAATGTCTTATATT 58.902 37.037 2.29 0.00 28.78 1.28
4057 6315 9.125026 AGCCTACCAGAAATGTCTTATATTTTG 57.875 33.333 0.00 0.00 28.78 2.44
4058 6316 8.352942 GCCTACCAGAAATGTCTTATATTTTGG 58.647 37.037 0.00 0.00 34.94 3.28
4059 6317 8.850156 CCTACCAGAAATGTCTTATATTTTGGG 58.150 37.037 0.00 0.00 34.12 4.12
4060 6318 9.627123 CTACCAGAAATGTCTTATATTTTGGGA 57.373 33.333 0.00 0.00 34.12 4.37
4061 6319 8.293699 ACCAGAAATGTCTTATATTTTGGGAC 57.706 34.615 0.00 0.00 34.12 4.46
4062 6320 7.893302 ACCAGAAATGTCTTATATTTTGGGACA 59.107 33.333 0.00 0.00 40.43 4.02
4063 6321 8.408601 CCAGAAATGTCTTATATTTTGGGACAG 58.591 37.037 0.00 0.00 39.70 3.51
4064 6322 9.177608 CAGAAATGTCTTATATTTTGGGACAGA 57.822 33.333 0.00 0.00 39.70 3.41
4065 6323 9.401058 AGAAATGTCTTATATTTTGGGACAGAG 57.599 33.333 0.00 0.00 42.39 3.35
4066 6324 8.525290 AAATGTCTTATATTTTGGGACAGAGG 57.475 34.615 0.00 0.00 42.39 3.69
4067 6325 6.884472 TGTCTTATATTTTGGGACAGAGGA 57.116 37.500 0.00 0.00 42.39 3.71
4068 6326 7.265599 TGTCTTATATTTTGGGACAGAGGAA 57.734 36.000 0.00 0.00 42.39 3.36
4069 6327 7.338710 TGTCTTATATTTTGGGACAGAGGAAG 58.661 38.462 0.00 0.00 42.39 3.46
4070 6328 7.037586 TGTCTTATATTTTGGGACAGAGGAAGT 60.038 37.037 0.00 0.00 42.39 3.01
4071 6329 8.483758 GTCTTATATTTTGGGACAGAGGAAGTA 58.516 37.037 0.00 0.00 42.39 2.24
4072 6330 8.483758 TCTTATATTTTGGGACAGAGGAAGTAC 58.516 37.037 0.00 0.00 42.39 2.73
4073 6331 6.893020 ATATTTTGGGACAGAGGAAGTACT 57.107 37.500 0.00 0.00 42.39 2.73
4074 6332 7.989947 ATATTTTGGGACAGAGGAAGTACTA 57.010 36.000 0.00 0.00 42.39 1.82
4075 6333 6.697641 ATTTTGGGACAGAGGAAGTACTAA 57.302 37.500 0.00 0.00 42.39 2.24
4076 6334 6.697641 TTTTGGGACAGAGGAAGTACTAAT 57.302 37.500 0.00 0.00 42.39 1.73
4077 6335 6.697641 TTTGGGACAGAGGAAGTACTAATT 57.302 37.500 0.00 0.00 42.39 1.40
4078 6336 7.801893 TTTGGGACAGAGGAAGTACTAATTA 57.198 36.000 0.00 0.00 42.39 1.40
4079 6337 7.989947 TTGGGACAGAGGAAGTACTAATTAT 57.010 36.000 0.00 0.00 42.39 1.28
4080 6338 7.361457 TGGGACAGAGGAAGTACTAATTATG 57.639 40.000 0.00 0.00 0.00 1.90
4081 6339 6.326583 TGGGACAGAGGAAGTACTAATTATGG 59.673 42.308 0.00 0.00 0.00 2.74
4082 6340 6.553852 GGGACAGAGGAAGTACTAATTATGGA 59.446 42.308 0.00 0.00 0.00 3.41
4083 6341 7.235812 GGGACAGAGGAAGTACTAATTATGGAT 59.764 40.741 0.00 0.00 0.00 3.41
4084 6342 8.308207 GGACAGAGGAAGTACTAATTATGGATC 58.692 40.741 0.00 0.00 0.00 3.36
4085 6343 8.196378 ACAGAGGAAGTACTAATTATGGATCC 57.804 38.462 4.20 4.20 0.00 3.36
4086 6344 7.789831 ACAGAGGAAGTACTAATTATGGATCCA 59.210 37.037 18.88 18.88 0.00 3.41
4087 6345 8.651389 CAGAGGAAGTACTAATTATGGATCCAA 58.349 37.037 20.67 2.92 0.00 3.53
4088 6346 9.225682 AGAGGAAGTACTAATTATGGATCCAAA 57.774 33.333 20.67 14.46 0.00 3.28
4089 6347 9.847224 GAGGAAGTACTAATTATGGATCCAAAA 57.153 33.333 20.67 7.36 0.00 2.44
4090 6348 9.853177 AGGAAGTACTAATTATGGATCCAAAAG 57.147 33.333 20.67 13.59 0.00 2.27
4091 6349 8.568794 GGAAGTACTAATTATGGATCCAAAAGC 58.431 37.037 20.67 2.67 0.00 3.51
4092 6350 9.343539 GAAGTACTAATTATGGATCCAAAAGCT 57.656 33.333 20.67 3.98 0.00 3.74
4093 6351 9.700831 AAGTACTAATTATGGATCCAAAAGCTT 57.299 29.630 20.67 10.57 0.00 3.74
4094 6352 9.700831 AGTACTAATTATGGATCCAAAAGCTTT 57.299 29.630 20.67 5.69 0.00 3.51
4095 6353 9.736023 GTACTAATTATGGATCCAAAAGCTTTG 57.264 33.333 20.67 11.15 0.00 2.77
4096 6354 8.366359 ACTAATTATGGATCCAAAAGCTTTGT 57.634 30.769 20.67 11.73 0.00 2.83
4097 6355 8.253113 ACTAATTATGGATCCAAAAGCTTTGTG 58.747 33.333 20.67 12.52 0.00 3.33
4098 6356 6.610075 ATTATGGATCCAAAAGCTTTGTGT 57.390 33.333 20.67 0.00 0.00 3.72
4099 6357 4.525912 ATGGATCCAAAAGCTTTGTGTC 57.474 40.909 20.67 8.75 0.00 3.67
4100 6358 3.565307 TGGATCCAAAAGCTTTGTGTCT 58.435 40.909 13.46 0.00 0.00 3.41
4101 6359 3.960102 TGGATCCAAAAGCTTTGTGTCTT 59.040 39.130 13.46 0.00 0.00 3.01
4102 6360 4.405358 TGGATCCAAAAGCTTTGTGTCTTT 59.595 37.500 13.46 0.00 34.30 2.52
4103 6361 5.596361 TGGATCCAAAAGCTTTGTGTCTTTA 59.404 36.000 13.46 0.00 32.72 1.85
4104 6362 6.267471 TGGATCCAAAAGCTTTGTGTCTTTAT 59.733 34.615 13.46 0.00 32.72 1.40
4105 6363 7.154656 GGATCCAAAAGCTTTGTGTCTTTATT 58.845 34.615 13.54 0.00 32.72 1.40
4106 6364 7.657354 GGATCCAAAAGCTTTGTGTCTTTATTT 59.343 33.333 13.54 0.00 32.72 1.40
4107 6365 8.962884 ATCCAAAAGCTTTGTGTCTTTATTTT 57.037 26.923 13.54 0.00 32.72 1.82
4108 6366 8.195617 TCCAAAAGCTTTGTGTCTTTATTTTG 57.804 30.769 13.54 2.11 36.58 2.44
4109 6367 8.037758 TCCAAAAGCTTTGTGTCTTTATTTTGA 58.962 29.630 13.54 0.42 38.18 2.69
4110 6368 8.829612 CCAAAAGCTTTGTGTCTTTATTTTGAT 58.170 29.630 13.54 0.00 38.18 2.57
4111 6369 9.853921 CAAAAGCTTTGTGTCTTTATTTTGATC 57.146 29.630 13.54 0.00 38.18 2.92
4112 6370 9.598517 AAAAGCTTTGTGTCTTTATTTTGATCA 57.401 25.926 13.54 0.00 32.72 2.92
4113 6371 9.768662 AAAGCTTTGTGTCTTTATTTTGATCAT 57.231 25.926 11.80 0.00 31.39 2.45
4114 6372 9.768662 AAGCTTTGTGTCTTTATTTTGATCATT 57.231 25.926 0.00 0.00 0.00 2.57
4129 6387 8.421249 TTTTGATCATTATGTTTCTGGGAAGT 57.579 30.769 0.00 0.00 0.00 3.01
4130 6388 8.421249 TTTGATCATTATGTTTCTGGGAAGTT 57.579 30.769 0.00 0.00 0.00 2.66
4131 6389 9.527157 TTTGATCATTATGTTTCTGGGAAGTTA 57.473 29.630 0.00 0.00 0.00 2.24
4132 6390 9.699410 TTGATCATTATGTTTCTGGGAAGTTAT 57.301 29.630 0.00 0.00 0.00 1.89
4133 6391 9.342308 TGATCATTATGTTTCTGGGAAGTTATC 57.658 33.333 0.00 0.00 0.00 1.75
4154 6412 9.520204 GTTATCCATATGTTGAATCAAACAAGG 57.480 33.333 0.00 3.74 42.98 3.61
4155 6413 7.722949 ATCCATATGTTGAATCAAACAAGGT 57.277 32.000 0.00 0.00 42.98 3.50
4156 6414 8.821686 ATCCATATGTTGAATCAAACAAGGTA 57.178 30.769 0.00 0.00 42.98 3.08
4157 6415 8.279970 TCCATATGTTGAATCAAACAAGGTAG 57.720 34.615 0.00 0.00 42.98 3.18
4158 6416 7.888021 TCCATATGTTGAATCAAACAAGGTAGT 59.112 33.333 0.00 0.00 42.98 2.73
4159 6417 9.173021 CCATATGTTGAATCAAACAAGGTAGTA 57.827 33.333 0.00 0.00 42.98 1.82
4165 6423 9.916397 GTTGAATCAAACAAGGTAGTATAATCG 57.084 33.333 0.00 0.00 0.00 3.34
4166 6424 9.878667 TTGAATCAAACAAGGTAGTATAATCGA 57.121 29.630 0.00 0.00 0.00 3.59
4171 6429 9.529325 TCAAACAAGGTAGTATAATCGATTCTG 57.471 33.333 15.25 2.46 0.00 3.02
4172 6430 7.948278 AACAAGGTAGTATAATCGATTCTGC 57.052 36.000 15.25 8.75 0.00 4.26
4173 6431 7.050970 ACAAGGTAGTATAATCGATTCTGCA 57.949 36.000 15.25 0.00 0.00 4.41
4174 6432 7.148641 ACAAGGTAGTATAATCGATTCTGCAG 58.851 38.462 15.25 7.63 0.00 4.41
4175 6433 6.902771 AGGTAGTATAATCGATTCTGCAGT 57.097 37.500 15.25 4.13 0.00 4.40
4176 6434 7.997773 AGGTAGTATAATCGATTCTGCAGTA 57.002 36.000 15.25 4.08 0.00 2.74
4177 6435 8.582657 AGGTAGTATAATCGATTCTGCAGTAT 57.417 34.615 15.25 9.98 0.00 2.12
4178 6436 8.462811 AGGTAGTATAATCGATTCTGCAGTATG 58.537 37.037 15.25 5.17 40.87 2.39
4179 6437 8.244802 GGTAGTATAATCGATTCTGCAGTATGT 58.755 37.037 15.25 0.00 39.31 2.29
4180 6438 9.627395 GTAGTATAATCGATTCTGCAGTATGTT 57.373 33.333 15.25 6.96 39.31 2.71
4182 6440 9.197694 AGTATAATCGATTCTGCAGTATGTTTC 57.802 33.333 15.25 0.00 39.31 2.78
4183 6441 9.197694 GTATAATCGATTCTGCAGTATGTTTCT 57.802 33.333 15.25 2.85 39.31 2.52
4184 6442 5.980698 ATCGATTCTGCAGTATGTTTCTG 57.019 39.130 14.67 0.00 39.31 3.02
4185 6443 4.820897 TCGATTCTGCAGTATGTTTCTGT 58.179 39.130 14.67 0.00 39.31 3.41
4186 6444 5.961272 TCGATTCTGCAGTATGTTTCTGTA 58.039 37.500 14.67 0.00 39.31 2.74
4187 6445 5.805486 TCGATTCTGCAGTATGTTTCTGTAC 59.195 40.000 14.67 0.00 39.31 2.90
4188 6446 5.807520 CGATTCTGCAGTATGTTTCTGTACT 59.192 40.000 14.67 0.00 39.31 2.73
4189 6447 6.020281 CGATTCTGCAGTATGTTTCTGTACTC 60.020 42.308 14.67 0.00 39.31 2.59
4190 6448 5.073311 TCTGCAGTATGTTTCTGTACTCC 57.927 43.478 14.67 0.00 39.31 3.85
4191 6449 3.845178 TGCAGTATGTTTCTGTACTCCG 58.155 45.455 0.00 0.00 39.31 4.63
4192 6450 3.257375 TGCAGTATGTTTCTGTACTCCGT 59.743 43.478 0.00 0.00 39.31 4.69
4193 6451 4.243270 GCAGTATGTTTCTGTACTCCGTT 58.757 43.478 0.00 0.00 39.31 4.44
4194 6452 4.091509 GCAGTATGTTTCTGTACTCCGTTG 59.908 45.833 0.00 0.00 39.31 4.10
4195 6453 4.625742 CAGTATGTTTCTGTACTCCGTTGG 59.374 45.833 0.00 0.00 0.00 3.77
4196 6454 4.525487 AGTATGTTTCTGTACTCCGTTGGA 59.475 41.667 0.00 0.00 0.00 3.53
4197 6455 4.553330 ATGTTTCTGTACTCCGTTGGAT 57.447 40.909 0.00 0.00 0.00 3.41
4198 6456 4.345859 TGTTTCTGTACTCCGTTGGATT 57.654 40.909 0.00 0.00 0.00 3.01
4199 6457 4.312443 TGTTTCTGTACTCCGTTGGATTC 58.688 43.478 0.00 0.00 0.00 2.52
4200 6458 4.039973 TGTTTCTGTACTCCGTTGGATTCT 59.960 41.667 0.00 0.00 0.00 2.40
4201 6459 3.868757 TCTGTACTCCGTTGGATTCTG 57.131 47.619 0.00 0.00 0.00 3.02
4202 6460 2.094182 TCTGTACTCCGTTGGATTCTGC 60.094 50.000 0.00 0.00 0.00 4.26
4203 6461 1.621317 TGTACTCCGTTGGATTCTGCA 59.379 47.619 0.00 0.00 0.00 4.41
4204 6462 2.271800 GTACTCCGTTGGATTCTGCAG 58.728 52.381 7.63 7.63 0.00 4.41
4205 6463 0.687354 ACTCCGTTGGATTCTGCAGT 59.313 50.000 14.67 0.00 0.00 4.40
4206 6464 1.899814 ACTCCGTTGGATTCTGCAGTA 59.100 47.619 14.67 4.08 0.00 2.74
4207 6465 2.501723 ACTCCGTTGGATTCTGCAGTAT 59.498 45.455 14.67 9.98 0.00 2.12
4208 6466 2.868583 CTCCGTTGGATTCTGCAGTATG 59.131 50.000 14.67 0.00 40.87 2.39
4209 6467 2.236146 TCCGTTGGATTCTGCAGTATGT 59.764 45.455 14.67 0.00 39.31 2.29
4210 6468 3.009723 CCGTTGGATTCTGCAGTATGTT 58.990 45.455 14.67 0.00 39.31 2.71
4211 6469 3.440173 CCGTTGGATTCTGCAGTATGTTT 59.560 43.478 14.67 0.00 39.31 2.83
4212 6470 4.082787 CCGTTGGATTCTGCAGTATGTTTT 60.083 41.667 14.67 0.00 39.31 2.43
4213 6471 4.853196 CGTTGGATTCTGCAGTATGTTTTG 59.147 41.667 14.67 0.00 39.31 2.44
4214 6472 5.562696 CGTTGGATTCTGCAGTATGTTTTGT 60.563 40.000 14.67 0.00 39.31 2.83
4215 6473 5.375417 TGGATTCTGCAGTATGTTTTGTG 57.625 39.130 14.67 0.00 39.31 3.33
4216 6474 4.168760 GGATTCTGCAGTATGTTTTGTGC 58.831 43.478 14.67 0.00 39.31 4.57
4217 6475 4.082571 GGATTCTGCAGTATGTTTTGTGCT 60.083 41.667 14.67 0.00 39.31 4.40
4218 6476 5.123820 GGATTCTGCAGTATGTTTTGTGCTA 59.876 40.000 14.67 0.00 39.31 3.49
4219 6477 5.611796 TTCTGCAGTATGTTTTGTGCTAG 57.388 39.130 14.67 0.00 39.31 3.42
4220 6478 4.641396 TCTGCAGTATGTTTTGTGCTAGT 58.359 39.130 14.67 0.00 39.31 2.57
4221 6479 5.789521 TCTGCAGTATGTTTTGTGCTAGTA 58.210 37.500 14.67 0.00 39.31 1.82
4222 6480 6.406370 TCTGCAGTATGTTTTGTGCTAGTAT 58.594 36.000 14.67 0.00 39.31 2.12
4223 6481 7.552459 TCTGCAGTATGTTTTGTGCTAGTATA 58.448 34.615 14.67 0.00 39.31 1.47
4224 6482 8.038351 TCTGCAGTATGTTTTGTGCTAGTATAA 58.962 33.333 14.67 0.00 39.31 0.98
4225 6483 8.731275 TGCAGTATGTTTTGTGCTAGTATAAT 57.269 30.769 0.00 0.00 39.31 1.28
4226 6484 8.826710 TGCAGTATGTTTTGTGCTAGTATAATC 58.173 33.333 0.00 0.00 39.31 1.75
4227 6485 8.004344 GCAGTATGTTTTGTGCTAGTATAATCG 58.996 37.037 0.00 0.00 39.31 3.34
4228 6486 9.244799 CAGTATGTTTTGTGCTAGTATAATCGA 57.755 33.333 0.00 0.00 0.00 3.59
4229 6487 9.982651 AGTATGTTTTGTGCTAGTATAATCGAT 57.017 29.630 0.00 0.00 0.00 3.59
4233 6491 8.609176 TGTTTTGTGCTAGTATAATCGATTTCC 58.391 33.333 17.19 4.71 0.00 3.13
4234 6492 7.724305 TTTGTGCTAGTATAATCGATTTCCC 57.276 36.000 17.19 4.35 0.00 3.97
4235 6493 6.665992 TGTGCTAGTATAATCGATTTCCCT 57.334 37.500 17.19 11.43 0.00 4.20
4236 6494 6.455647 TGTGCTAGTATAATCGATTTCCCTG 58.544 40.000 17.19 4.42 0.00 4.45
4237 6495 6.266786 TGTGCTAGTATAATCGATTTCCCTGA 59.733 38.462 17.19 0.00 0.00 3.86
4238 6496 7.039011 TGTGCTAGTATAATCGATTTCCCTGAT 60.039 37.037 17.19 5.03 0.00 2.90
4239 6497 8.467598 GTGCTAGTATAATCGATTTCCCTGATA 58.532 37.037 17.19 4.01 0.00 2.15
4240 6498 9.201989 TGCTAGTATAATCGATTTCCCTGATAT 57.798 33.333 17.19 3.53 0.00 1.63
4241 6499 9.469807 GCTAGTATAATCGATTTCCCTGATATG 57.530 37.037 17.19 3.62 0.00 1.78
4248 6506 8.798859 AATCGATTTCCCTGATATGAAATAGG 57.201 34.615 4.39 0.00 40.34 2.57
4249 6507 7.316393 TCGATTTCCCTGATATGAAATAGGT 57.684 36.000 0.00 0.00 40.34 3.08
4250 6508 7.745717 TCGATTTCCCTGATATGAAATAGGTT 58.254 34.615 0.00 0.00 40.34 3.50
4251 6509 8.217799 TCGATTTCCCTGATATGAAATAGGTTT 58.782 33.333 0.00 0.00 40.34 3.27
4252 6510 8.292448 CGATTTCCCTGATATGAAATAGGTTTG 58.708 37.037 0.00 0.00 40.34 2.93
4253 6511 7.896383 TTTCCCTGATATGAAATAGGTTTGG 57.104 36.000 0.00 0.00 28.50 3.28
4254 6512 6.840090 TCCCTGATATGAAATAGGTTTGGA 57.160 37.500 0.00 0.00 28.50 3.53
4255 6513 7.219601 TCCCTGATATGAAATAGGTTTGGAA 57.780 36.000 0.00 0.00 28.50 3.53
4256 6514 7.290061 TCCCTGATATGAAATAGGTTTGGAAG 58.710 38.462 0.00 0.00 28.50 3.46
4257 6515 6.491403 CCCTGATATGAAATAGGTTTGGAAGG 59.509 42.308 0.00 0.00 28.50 3.46
4258 6516 7.290061 CCTGATATGAAATAGGTTTGGAAGGA 58.710 38.462 0.00 0.00 28.50 3.36
4259 6517 7.946776 CCTGATATGAAATAGGTTTGGAAGGAT 59.053 37.037 0.00 0.00 28.50 3.24
4260 6518 8.924511 TGATATGAAATAGGTTTGGAAGGATC 57.075 34.615 0.00 0.00 28.50 3.36
4261 6519 8.501904 TGATATGAAATAGGTTTGGAAGGATCA 58.498 33.333 0.00 0.00 28.50 2.92
4262 6520 9.354673 GATATGAAATAGGTTTGGAAGGATCAA 57.645 33.333 0.00 0.00 28.50 2.57
4263 6521 7.651027 ATGAAATAGGTTTGGAAGGATCAAG 57.349 36.000 0.00 0.00 0.00 3.02
4264 6522 6.789268 TGAAATAGGTTTGGAAGGATCAAGA 58.211 36.000 0.00 0.00 0.00 3.02
4265 6523 6.659242 TGAAATAGGTTTGGAAGGATCAAGAC 59.341 38.462 0.00 0.00 0.00 3.01
4266 6524 5.779241 ATAGGTTTGGAAGGATCAAGACA 57.221 39.130 0.00 0.00 0.00 3.41
4267 6525 4.664688 AGGTTTGGAAGGATCAAGACAT 57.335 40.909 0.00 0.00 0.00 3.06
4268 6526 4.593956 AGGTTTGGAAGGATCAAGACATC 58.406 43.478 0.00 0.00 0.00 3.06
4269 6527 4.290722 AGGTTTGGAAGGATCAAGACATCT 59.709 41.667 0.00 0.00 0.00 2.90
4270 6528 5.012893 GGTTTGGAAGGATCAAGACATCTT 58.987 41.667 0.00 0.00 36.45 2.40
4271 6529 5.124617 GGTTTGGAAGGATCAAGACATCTTC 59.875 44.000 0.00 0.00 33.11 2.87
4272 6530 5.503634 TTGGAAGGATCAAGACATCTTCA 57.496 39.130 0.00 0.00 33.11 3.02
4273 6531 4.836825 TGGAAGGATCAAGACATCTTCAC 58.163