Multiple sequence alignment - TraesCS5B01G550500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G550500 chr5B 100.000 2264 0 0 1 2264 701833126 701830863 0.000000e+00 4181
1 TraesCS5B01G550500 chr5B 97.734 971 22 0 451 1421 506965992 506966962 0.000000e+00 1672
2 TraesCS5B01G550500 chr5B 99.117 453 4 0 1 453 64274009 64274461 0.000000e+00 815
3 TraesCS5B01G550500 chr5B 99.117 453 4 0 1 453 234887413 234886961 0.000000e+00 815
4 TraesCS5B01G550500 chr5B 98.896 453 5 0 1 453 709187854 709187402 0.000000e+00 809
5 TraesCS5B01G550500 chr5B 97.376 343 9 0 1922 2264 234883426 234883084 3.240000e-163 584
6 TraesCS5B01G550500 chr5B 95.810 358 13 2 1909 2264 584814532 584814175 5.420000e-161 577
7 TraesCS5B01G550500 chr5B 94.776 268 12 2 1490 1755 584815141 584814874 1.250000e-112 416
8 TraesCS5B01G550500 chr5B 93.750 272 12 3 1490 1756 535135913 535136184 9.740000e-109 403
9 TraesCS5B01G550500 chr5B 88.327 257 24 6 1712 1963 584814883 584814628 1.020000e-78 303
10 TraesCS5B01G550500 chr5B 88.235 255 24 6 1712 1961 584814766 584814513 1.310000e-77 300
11 TraesCS5B01G550500 chr5B 87.938 257 25 5 1712 1963 584815000 584814745 4.730000e-77 298
12 TraesCS5B01G550500 chr5B 100.000 72 0 0 1431 1502 506967235 506967306 1.410000e-27 134
13 TraesCS5B01G550500 chr6B 98.970 971 10 0 451 1421 679252082 679253052 0.000000e+00 1738
14 TraesCS5B01G550500 chr6B 98.661 971 13 0 451 1421 599876551 599877521 0.000000e+00 1722
15 TraesCS5B01G550500 chr6B 99.117 453 4 0 1 453 181113358 181112906 0.000000e+00 815
16 TraesCS5B01G550500 chr6B 98.896 453 4 1 1 453 599875373 599875824 0.000000e+00 808
17 TraesCS5B01G550500 chr6B 96.369 358 11 2 1909 2264 679253758 679254115 2.510000e-164 588
18 TraesCS5B01G550500 chr6B 97.554 327 7 1 1431 1756 679253325 679253651 1.960000e-155 558
19 TraesCS5B01G550500 chr6B 95.149 268 11 2 1490 1755 599877889 599878156 2.690000e-114 422
20 TraesCS5B01G550500 chr6B 91.235 251 18 4 1712 1958 679253524 679253774 2.790000e-89 339
21 TraesCS5B01G550500 chr6B 100.000 72 0 0 1431 1502 84605071 84605142 1.410000e-27 134
22 TraesCS5B01G550500 chr2B 98.661 971 13 0 451 1421 68145781 68146751 0.000000e+00 1722
23 TraesCS5B01G550500 chr2B 98.455 971 15 0 451 1421 549353296 549354266 0.000000e+00 1711
24 TraesCS5B01G550500 chr2B 97.734 971 22 0 451 1421 454449675 454450645 0.000000e+00 1672
25 TraesCS5B01G550500 chr2B 96.369 358 11 2 1909 2264 68147457 68147814 2.510000e-164 588
26 TraesCS5B01G550500 chr2B 98.165 327 5 1 1431 1756 68147024 68147350 9.070000e-159 569
27 TraesCS5B01G550500 chr2B 94.972 358 16 2 1909 2264 549355125 549355482 5.460000e-156 560
28 TraesCS5B01G550500 chr2B 94.382 267 13 2 1490 1754 549354634 549354900 2.090000e-110 409
29 TraesCS5B01G550500 chr2B 93.361 241 14 2 1725 1963 68147238 68147478 2.770000e-94 355
30 TraesCS5B01G550500 chr2B 87.970 266 27 5 1702 1963 549354766 549355030 2.180000e-80 309
31 TraesCS5B01G550500 chr2B 90.254 236 20 3 1725 1958 549354907 549355141 2.830000e-79 305
32 TraesCS5B01G550500 chr2B 92.405 158 11 1 1807 1963 68147204 68147361 8.140000e-55 224
33 TraesCS5B01G550500 chr2B 100.000 72 0 0 1431 1502 454450918 454450989 1.410000e-27 134
34 TraesCS5B01G550500 chr2B 100.000 72 0 0 1431 1502 454475051 454475122 1.410000e-27 134
35 TraesCS5B01G550500 chr3B 98.043 971 19 0 451 1421 558277922 558276952 0.000000e+00 1688
36 TraesCS5B01G550500 chr3B 97.538 975 24 0 447 1421 604265596 604264622 0.000000e+00 1668
37 TraesCS5B01G550500 chr3B 98.896 453 5 0 1 453 604267836 604267384 0.000000e+00 809
38 TraesCS5B01G550500 chr3B 95.101 347 14 3 1490 1834 776221187 776221532 5.500000e-151 544
39 TraesCS5B01G550500 chr3B 92.453 371 13 6 1909 2264 604263875 604263505 1.200000e-142 516
40 TraesCS5B01G550500 chr3B 95.604 273 6 3 1490 1756 604264254 604263982 1.240000e-117 433
41 TraesCS5B01G550500 chr3B 88.669 353 31 8 1490 1836 420919395 420919046 2.690000e-114 422
42 TraesCS5B01G550500 chr3B 90.196 255 17 5 1712 1958 604264113 604263859 2.170000e-85 326
43 TraesCS5B01G550500 chr3B 100.000 72 0 0 1431 1502 760825228 760825299 1.410000e-27 134
44 TraesCS5B01G550500 chr4B 97.734 971 18 2 451 1421 551060487 551061453 0.000000e+00 1668
45 TraesCS5B01G550500 chr4B 98.896 453 5 0 1 453 396488682 396489134 0.000000e+00 809
46 TraesCS5B01G550500 chr4B 95.810 358 13 2 1909 2264 310258321 310258678 5.420000e-161 577
47 TraesCS5B01G550500 chr4B 87.003 377 28 5 1909 2264 551062261 551062637 2.710000e-109 405
48 TraesCS5B01G550500 chr4B 100.000 72 0 0 1431 1502 551061726 551061797 1.410000e-27 134
49 TraesCS5B01G550500 chr1B 98.896 453 5 0 1 453 571424196 571423744 0.000000e+00 809
50 TraesCS5B01G550500 chr1B 86.133 375 31 3 1909 2262 571420318 571419944 3.530000e-103 385
51 TraesCS5B01G550500 chrUn 98.675 453 6 0 1 453 86407653 86408105 0.000000e+00 804
52 TraesCS5B01G550500 chr2A 93.061 245 17 0 2020 2264 764943864 764943620 2.140000e-95 359
53 TraesCS5B01G550500 chr5D 92.653 245 18 0 2020 2264 21544233 21543989 9.950000e-94 353
54 TraesCS5B01G550500 chr6A 80.347 346 44 15 1431 1755 7031436 7031778 8.080000e-60 241


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G550500 chr5B 701830863 701833126 2263 True 4181.000000 4181 100.000000 1 2264 1 chr5B.!!$R1 2263
1 TraesCS5B01G550500 chr5B 506965992 506967306 1314 False 903.000000 1672 98.867000 451 1502 2 chr5B.!!$F3 1051
2 TraesCS5B01G550500 chr5B 234883084 234887413 4329 True 699.500000 815 98.246500 1 2264 2 chr5B.!!$R3 2263
3 TraesCS5B01G550500 chr5B 584814175 584815141 966 True 378.800000 577 91.017200 1490 2264 5 chr5B.!!$R4 774
4 TraesCS5B01G550500 chr6B 599875373 599878156 2783 False 984.000000 1722 97.568667 1 1755 3 chr6B.!!$F2 1754
5 TraesCS5B01G550500 chr6B 679252082 679254115 2033 False 805.750000 1738 96.032000 451 2264 4 chr6B.!!$F3 1813
6 TraesCS5B01G550500 chr2B 454449675 454450989 1314 False 903.000000 1672 98.867000 451 1502 2 chr2B.!!$F3 1051
7 TraesCS5B01G550500 chr2B 68145781 68147814 2033 False 691.600000 1722 95.792200 451 2264 5 chr2B.!!$F2 1813
8 TraesCS5B01G550500 chr2B 549353296 549355482 2186 False 658.800000 1711 93.206600 451 2264 5 chr2B.!!$F4 1813
9 TraesCS5B01G550500 chr3B 558276952 558277922 970 True 1688.000000 1688 98.043000 451 1421 1 chr3B.!!$R2 970
10 TraesCS5B01G550500 chr3B 604263505 604267836 4331 True 750.400000 1668 94.937400 1 2264 5 chr3B.!!$R3 2263
11 TraesCS5B01G550500 chr4B 551060487 551062637 2150 False 735.666667 1668 94.912333 451 2264 3 chr4B.!!$F3 1813
12 TraesCS5B01G550500 chr1B 571419944 571424196 4252 True 597.000000 809 92.514500 1 2262 2 chr1B.!!$R1 2261

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
426 427 2.240667 AGTTGGATGAGGATGGGTTGAG 59.759 50.0 0.0 0.0 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1770 4076 0.782384 CGGTCTTGGTTTCTTCGTCG 59.218 55.0 0.0 0.0 0.0 5.12 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
369 370 5.078683 ACCCTCCCTTATAACCGTATGTA 57.921 43.478 0.00 0.00 0.00 2.29
426 427 2.240667 AGTTGGATGAGGATGGGTTGAG 59.759 50.000 0.00 0.00 0.00 3.02
810 2619 3.327404 CTTGTAGGGGCCCGTGGT 61.327 66.667 27.46 8.55 0.00 4.16
1129 2938 1.678635 CCGCCATGTTGGTGTGGAT 60.679 57.895 6.37 0.00 46.25 3.41
1429 3238 3.124686 GCCAACGGCCACAAAAGA 58.875 55.556 2.24 0.00 44.06 2.52
1527 3673 8.706322 AGTTTGTTAGTGTATTCTGGGATTTT 57.294 30.769 0.00 0.00 0.00 1.82
1734 4003 1.825622 GTAGGACCGGACCCTACCG 60.826 68.421 30.38 0.00 46.52 4.02
2162 4623 3.059570 GCTCGACGACACATGTTCTAAAG 59.940 47.826 0.00 0.00 0.00 1.85
2166 4627 3.326747 ACGACACATGTTCTAAAGAGGC 58.673 45.455 0.00 0.00 0.00 4.70
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
369 370 3.493334 TCGTCATCCGAGTTATACCCAT 58.507 45.455 0.00 0.00 41.60 4.00
426 427 2.650608 AGATTTCGTTTTCTTGCGCAC 58.349 42.857 11.12 0.00 0.00 5.34
810 2619 2.019249 CTAGAACCACCGGATACACGA 58.981 52.381 9.46 0.00 35.47 4.35
1129 2938 4.072131 GACTCCTTCACCTTGCAAACATA 58.928 43.478 0.00 0.00 0.00 2.29
1192 3001 4.573021 AAGCATAATTGGGGCAAACAAT 57.427 36.364 0.00 0.00 40.07 2.71
1421 3230 8.942338 TGCCTTAGTACTACATATCTTTTGTG 57.058 34.615 0.91 0.00 0.00 3.33
1426 3235 9.110502 GCTTTTTGCCTTAGTACTACATATCTT 57.889 33.333 0.91 0.00 35.15 2.40
1738 4007 2.847234 CCCTACCGCCATGGCCTA 60.847 66.667 30.79 18.39 43.94 3.93
1770 4076 0.782384 CGGTCTTGGTTTCTTCGTCG 59.218 55.000 0.00 0.00 0.00 5.12
1794 4100 1.307647 GTAGGGTCCGGTCCTACCA 59.692 63.158 29.66 12.14 46.75 3.25
1941 4351 2.040606 ACCAGACCCTACCGCCAT 59.959 61.111 0.00 0.00 0.00 4.40
2166 4627 6.870965 GTCTGATAGGTATGAGGCTTATGTTG 59.129 42.308 1.43 0.00 0.00 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.