Multiple sequence alignment - TraesCS5B01G530300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G530300 chr5B 100.000 4440 0 0 1 4440 689065323 689069762 0.000000e+00 8200.0
1 TraesCS5B01G530300 chr5B 99.505 4442 18 4 1 4440 688975551 688979990 0.000000e+00 8078.0
2 TraesCS5B01G530300 chr5B 87.636 275 31 3 3105 3378 689202558 689202830 2.580000e-82 316.0
3 TraesCS5B01G530300 chr5B 81.148 122 21 2 4281 4402 684165155 684165274 3.660000e-16 97.1
4 TraesCS5B01G530300 chr5B 98.039 51 1 0 446 496 688975950 688976000 6.120000e-14 89.8
5 TraesCS5B01G530300 chr5B 98.039 51 1 0 401 451 688975995 688976045 6.120000e-14 89.8
6 TraesCS5B01G530300 chr5B 98.039 51 1 0 446 496 689065723 689065773 6.120000e-14 89.8
7 TraesCS5B01G530300 chr5B 98.039 51 1 0 401 451 689065768 689065818 6.120000e-14 89.8
8 TraesCS5B01G530300 chr5D 93.722 3584 145 30 916 4440 545926510 545930072 0.000000e+00 5299.0
9 TraesCS5B01G530300 chr5D 87.336 229 28 1 3087 3315 546012257 546012484 1.220000e-65 261.0
10 TraesCS5B01G530300 chr5D 81.148 122 21 2 4281 4402 542454654 542454773 3.660000e-16 97.1
11 TraesCS5B01G530300 chrUn 100.000 2709 0 0 1474 4182 332382113 332384821 0.000000e+00 5003.0
12 TraesCS5B01G530300 chr4A 92.720 3324 161 30 1147 4440 623402436 623399164 0.000000e+00 4723.0
13 TraesCS5B01G530300 chr4A 91.457 199 10 4 922 1119 623402622 623402430 2.630000e-67 267.0
14 TraesCS5B01G530300 chr3B 94.664 506 19 7 1152 1654 670739172 670739672 0.000000e+00 778.0
15 TraesCS5B01G530300 chr3B 91.457 199 14 2 922 1119 670738983 670739179 2.040000e-68 270.0
16 TraesCS5B01G530300 chr6B 94.647 467 13 8 1147 1610 653582513 653582056 0.000000e+00 713.0
17 TraesCS5B01G530300 chr6B 93.048 187 13 0 933 1119 653582689 653582503 1.570000e-69 274.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G530300 chr5B 689065323 689069762 4439 False 8200.0 8200 100.0000 1 4440 1 chr5B.!!$F3 4439
1 TraesCS5B01G530300 chr5B 688975551 688979990 4439 False 8078.0 8078 99.5050 1 4440 1 chr5B.!!$F2 4439
2 TraesCS5B01G530300 chr5D 545926510 545930072 3562 False 5299.0 5299 93.7220 916 4440 1 chr5D.!!$F2 3524
3 TraesCS5B01G530300 chrUn 332382113 332384821 2708 False 5003.0 5003 100.0000 1474 4182 1 chrUn.!!$F1 2708
4 TraesCS5B01G530300 chr4A 623399164 623402622 3458 True 2495.0 4723 92.0885 922 4440 2 chr4A.!!$R1 3518
5 TraesCS5B01G530300 chr3B 670738983 670739672 689 False 524.0 778 93.0605 922 1654 2 chr3B.!!$F1 732
6 TraesCS5B01G530300 chr6B 653582056 653582689 633 True 493.5 713 93.8475 933 1610 2 chr6B.!!$R1 677

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
544 545 2.20261 TGTCGAGCGAAGGATGCG 60.203 61.111 0.0 0.0 43.07 4.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
4183 4252 9.282569 ACCAAATAAAAATGAAGCAAAGCATTA 57.717 25.926 0.0 0.0 33.87 1.9 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 3.399879 CGGCCTTCAAAAACATCGG 57.600 52.632 0.00 0.00 0.00 4.18
544 545 2.202610 TGTCGAGCGAAGGATGCG 60.203 61.111 0.00 0.00 43.07 4.73
702 704 5.147162 CCTTCGAATTCGGACAAAGAAAAG 58.853 41.667 26.47 17.74 40.29 2.27
807 809 6.689669 CCGAACGTTTTTCATGACTACTTTTT 59.310 34.615 0.46 0.00 0.00 1.94
4183 4252 5.592104 AGTCTGTTTTGTTTTCCCGAATT 57.408 34.783 0.00 0.00 0.00 2.17
4433 4502 0.677098 ACGAGGACGAAGAGCTGCTA 60.677 55.000 0.15 0.00 42.66 3.49
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
8 9 1.197721 CGAAGCTGCTCCGATGTTTTT 59.802 47.619 0.80 0.00 0.00 1.94
134 135 1.297158 CTATCGCGCTGCAAACTGC 60.297 57.895 5.56 0.00 45.29 4.40
150 151 0.472925 TGTGAGCTCCCCAACCACTA 60.473 55.000 12.15 0.00 0.00 2.74
157 158 3.241530 AGCGTTGTGAGCTCCCCA 61.242 61.111 12.15 5.08 41.83 4.96
307 308 1.568612 AAGCATCGTTGAGCACCACG 61.569 55.000 1.26 1.26 0.00 4.94
308 309 0.166814 GAAGCATCGTTGAGCACCAC 59.833 55.000 0.00 0.00 0.00 4.16
544 545 3.960102 ACTCATCTCTCCCTCTGTCAATC 59.040 47.826 0.00 0.00 0.00 2.67
702 704 5.461032 TCTGAACTCTCTCCTTCTTGTTC 57.539 43.478 0.00 0.00 35.68 3.18
807 809 7.929941 AAAAAGTAAACTTGCCATCCAAAAA 57.070 28.000 0.00 0.00 36.12 1.94
4183 4252 9.282569 ACCAAATAAAAATGAAGCAAAGCATTA 57.717 25.926 0.00 0.00 33.87 1.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.