Multiple sequence alignment - TraesCS5B01G527700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G527700 chr5B 100.000 2339 0 0 1 2339 686686118 686688456 0.000000e+00 4320.0
1 TraesCS5B01G527700 chr5B 97.990 2338 40 4 3 2339 686598016 686600347 0.000000e+00 4050.0
2 TraesCS5B01G527700 chr5B 97.862 2339 42 5 3 2339 686614324 686616656 0.000000e+00 4036.0
3 TraesCS5B01G527700 chr5B 96.662 2337 41 13 3 2339 686574705 686577004 0.000000e+00 3849.0
4 TraesCS5B01G527700 chr5B 87.024 1287 140 5 102 1363 547493135 547491851 0.000000e+00 1426.0
5 TraesCS5B01G527700 chr5B 86.636 1287 145 7 102 1363 677677487 677678771 0.000000e+00 1399.0
6 TraesCS5B01G527700 chr5B 97.305 668 18 0 3 670 686650605 686651272 0.000000e+00 1134.0
7 TraesCS5B01G527700 chr3B 87.413 1287 135 5 102 1363 161678767 161677483 0.000000e+00 1454.0
8 TraesCS5B01G527700 chr5D 87.345 1288 134 7 102 1363 383586057 383587341 0.000000e+00 1448.0
9 TraesCS5B01G527700 chr2B 87.067 1299 136 14 102 1373 390803449 390802156 0.000000e+00 1439.0
10 TraesCS5B01G527700 chr2B 87.364 1100 113 6 294 1368 793363233 793364331 0.000000e+00 1238.0
11 TraesCS5B01G527700 chr1B 86.791 1287 142 8 102 1363 92336475 92337758 0.000000e+00 1410.0
12 TraesCS5B01G527700 chr1A 86.750 1283 142 6 105 1362 213935755 213937034 0.000000e+00 1402.0
13 TraesCS5B01G527700 chr1A 88.095 1008 80 20 1364 2339 569729672 569728673 0.000000e+00 1160.0
14 TraesCS5B01G527700 chr1A 87.897 1008 80 23 1364 2339 569679339 569678342 0.000000e+00 1147.0
15 TraesCS5B01G527700 chr1A 92.473 93 3 1 3 95 569679410 569679322 1.890000e-26 130.0
16 TraesCS5B01G527700 chr1A 92.473 93 3 1 3 95 569729743 569729655 1.890000e-26 130.0
17 TraesCS5B01G527700 chr4D 86.780 1180 126 11 210 1363 469445645 469444470 0.000000e+00 1288.0
18 TraesCS5B01G527700 chr4A 87.972 1006 84 20 1364 2336 624432129 624433130 0.000000e+00 1153.0
19 TraesCS5B01G527700 chr4A 87.264 1005 85 21 1364 2336 624462892 624463885 0.000000e+00 1107.0
20 TraesCS5B01G527700 chr4A 91.398 93 4 1 3 95 624432058 624432146 8.780000e-25 124.0
21 TraesCS5B01G527700 chr4A 91.398 93 4 1 3 95 624462821 624462909 8.780000e-25 124.0
22 TraesCS5B01G527700 chrUn 98.161 435 5 1 1905 2339 375943811 375944242 0.000000e+00 756.0
23 TraesCS5B01G527700 chrUn 75.104 241 46 10 1776 2012 15473721 15473491 1.480000e-17 100.0
24 TraesCS5B01G527700 chrUn 80.952 105 16 4 2233 2335 9995840 9995942 1.930000e-11 80.5
25 TraesCS5B01G527700 chr2A 81.481 189 23 9 1818 1997 16842816 16842631 6.740000e-31 145.0
26 TraesCS5B01G527700 chr4B 75.000 272 32 22 1726 1993 40421682 40421921 2.470000e-15 93.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G527700 chr5B 686686118 686688456 2338 False 4320.0 4320 100.000 1 2339 1 chr5B.!!$F6 2338
1 TraesCS5B01G527700 chr5B 686598016 686600347 2331 False 4050.0 4050 97.990 3 2339 1 chr5B.!!$F3 2336
2 TraesCS5B01G527700 chr5B 686614324 686616656 2332 False 4036.0 4036 97.862 3 2339 1 chr5B.!!$F4 2336
3 TraesCS5B01G527700 chr5B 686574705 686577004 2299 False 3849.0 3849 96.662 3 2339 1 chr5B.!!$F2 2336
4 TraesCS5B01G527700 chr5B 547491851 547493135 1284 True 1426.0 1426 87.024 102 1363 1 chr5B.!!$R1 1261
5 TraesCS5B01G527700 chr5B 677677487 677678771 1284 False 1399.0 1399 86.636 102 1363 1 chr5B.!!$F1 1261
6 TraesCS5B01G527700 chr5B 686650605 686651272 667 False 1134.0 1134 97.305 3 670 1 chr5B.!!$F5 667
7 TraesCS5B01G527700 chr3B 161677483 161678767 1284 True 1454.0 1454 87.413 102 1363 1 chr3B.!!$R1 1261
8 TraesCS5B01G527700 chr5D 383586057 383587341 1284 False 1448.0 1448 87.345 102 1363 1 chr5D.!!$F1 1261
9 TraesCS5B01G527700 chr2B 390802156 390803449 1293 True 1439.0 1439 87.067 102 1373 1 chr2B.!!$R1 1271
10 TraesCS5B01G527700 chr2B 793363233 793364331 1098 False 1238.0 1238 87.364 294 1368 1 chr2B.!!$F1 1074
11 TraesCS5B01G527700 chr1B 92336475 92337758 1283 False 1410.0 1410 86.791 102 1363 1 chr1B.!!$F1 1261
12 TraesCS5B01G527700 chr1A 213935755 213937034 1279 False 1402.0 1402 86.750 105 1362 1 chr1A.!!$F1 1257
13 TraesCS5B01G527700 chr1A 569728673 569729743 1070 True 645.0 1160 90.284 3 2339 2 chr1A.!!$R2 2336
14 TraesCS5B01G527700 chr1A 569678342 569679410 1068 True 638.5 1147 90.185 3 2339 2 chr1A.!!$R1 2336
15 TraesCS5B01G527700 chr4D 469444470 469445645 1175 True 1288.0 1288 86.780 210 1363 1 chr4D.!!$R1 1153
16 TraesCS5B01G527700 chr4A 624432058 624433130 1072 False 638.5 1153 89.685 3 2336 2 chr4A.!!$F1 2333
17 TraesCS5B01G527700 chr4A 624462821 624463885 1064 False 615.5 1107 89.331 3 2336 2 chr4A.!!$F2 2333

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
484 507 2.533266 TGAAAGTCTCACCTGACTGC 57.467 50.0 0.0 0.0 45.49 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2279 2347 1.246649 TCGTTTGGCCGTGTACTCTA 58.753 50.0 0.0 0.0 0.0 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
319 321 2.946791 ATTTGGTGGAATGGGACCAT 57.053 45.000 0.00 0.00 41.92 3.55
484 507 2.533266 TGAAAGTCTCACCTGACTGC 57.467 50.000 0.00 0.00 45.49 4.40
551 578 3.243737 TGCGACAGAGCAAAAGAAGTCTA 60.244 43.478 0.00 0.00 45.06 2.59
630 657 5.067805 GGGTAAGGCAGTCTTGGAATATTTG 59.932 44.000 0.00 0.00 36.93 2.32
691 718 2.609350 GAAATGTGCGTGGCATGATTT 58.391 42.857 11.71 7.68 41.91 2.17
941 968 3.375699 TGAGGGTGGACTTAAGAGATCC 58.624 50.000 10.09 6.57 0.00 3.36
1052 1079 2.594592 GTTGGCGCAAGGGACAGT 60.595 61.111 10.83 0.00 38.28 3.55
1195 1223 9.922305 GTGATTTATTTGTTTCTAGATTCGAGG 57.078 33.333 0.00 0.00 0.00 4.63
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
174 175 8.128322 ACATCAATAGGTCATAGAGTATGTCC 57.872 38.462 2.94 2.94 42.36 4.02
296 298 3.076785 TGGTCCCATTCCACCAAATAAGT 59.923 43.478 0.00 0.00 39.85 2.24
304 306 2.459555 ATTGATGGTCCCATTCCACC 57.540 50.000 0.00 0.00 37.81 4.61
319 321 5.795972 TGTCGTAACTTGTTCCCATATTGA 58.204 37.500 0.00 0.00 0.00 2.57
444 467 9.190858 CTTTCACATGTCTATTAGCTAGCTTAG 57.809 37.037 24.88 18.90 0.00 2.18
484 507 3.414193 TGGCCCAGATGAGCAGGG 61.414 66.667 0.00 0.00 45.83 4.45
551 578 2.147958 CGTCTATCGCTAGCCTTCTCT 58.852 52.381 9.66 0.00 0.00 3.10
602 629 0.605319 CAAGACTGCCTTACCCGCAA 60.605 55.000 0.00 0.00 35.40 4.85
630 657 3.598019 TCCTGATTTGGCAATGAAAGC 57.402 42.857 0.00 0.00 0.00 3.51
791 818 3.584834 GAGGCATTAACAAAATTGGCGT 58.415 40.909 0.00 0.00 0.00 5.68
792 819 2.929398 GGAGGCATTAACAAAATTGGCG 59.071 45.455 0.00 0.00 0.00 5.69
941 968 4.189231 CCCAACGATGAACCTACCTTAAG 58.811 47.826 0.00 0.00 0.00 1.85
1177 1205 6.097915 ACAGTCCTCGAATCTAGAAACAAA 57.902 37.500 0.00 0.00 0.00 2.83
2270 2338 2.667724 GCCGTGTACTCTAGTGTGTGTC 60.668 54.545 7.70 0.00 0.00 3.67
2279 2347 1.246649 TCGTTTGGCCGTGTACTCTA 58.753 50.000 0.00 0.00 0.00 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.