Multiple sequence alignment - TraesCS5B01G520100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G520100 chr5B 100.000 2520 0 0 1 2520 682461235 682458716 0.000000e+00 4654.0
1 TraesCS5B01G520100 chr5B 99.038 1872 16 2 1 1871 682420931 682419061 0.000000e+00 3356.0
2 TraesCS5B01G520100 chr5D 92.654 1021 56 6 770 1775 540235766 540234750 0.000000e+00 1452.0
3 TraesCS5B01G520100 chr4A 89.831 1062 64 15 770 1809 628084749 628083710 0.000000e+00 1323.0
4 TraesCS5B01G520100 chr4A 98.615 650 9 0 1871 2520 717461840 717461191 0.000000e+00 1151.0
5 TraesCS5B01G520100 chr4A 93.421 76 5 0 1796 1871 313626668 313626743 2.050000e-21 113.0
6 TraesCS5B01G520100 chr4A 93.421 76 4 1 1796 1871 591880729 591880655 7.370000e-21 111.0
7 TraesCS5B01G520100 chr6B 99.385 650 4 0 1871 2520 391086455 391085806 0.000000e+00 1179.0
8 TraesCS5B01G520100 chr7B 98.769 650 8 0 1871 2520 192773703 192774352 0.000000e+00 1157.0
9 TraesCS5B01G520100 chr6A 98.769 650 8 0 1871 2520 11432285 11431636 0.000000e+00 1157.0
10 TraesCS5B01G520100 chr6A 92.152 739 50 5 3 740 614112426 614113157 0.000000e+00 1037.0
11 TraesCS5B01G520100 chr5A 98.615 650 9 0 1871 2520 328022894 328022245 0.000000e+00 1151.0
12 TraesCS5B01G520100 chr3B 98.615 650 9 0 1871 2520 818927411 818928060 0.000000e+00 1151.0
13 TraesCS5B01G520100 chr3B 98.615 650 9 0 1871 2520 820555335 820555984 0.000000e+00 1151.0
14 TraesCS5B01G520100 chr3B 91.851 724 51 5 4 722 783307046 783307766 0.000000e+00 1003.0
15 TraesCS5B01G520100 chr3B 93.506 77 5 0 1795 1871 48886589 48886513 5.700000e-22 115.0
16 TraesCS5B01G520100 chr2B 98.462 650 10 0 1871 2520 47196581 47195932 0.000000e+00 1146.0
17 TraesCS5B01G520100 chr2B 90.934 739 58 7 3 736 479592136 479592870 0.000000e+00 985.0
18 TraesCS5B01G520100 chr2B 95.890 73 3 0 1799 1871 508006434 508006506 4.400000e-23 119.0
19 TraesCS5B01G520100 chr2B 92.405 79 6 0 1793 1871 662882129 662882207 2.050000e-21 113.0
20 TraesCS5B01G520100 chr1A 98.462 650 10 0 1871 2520 12674184 12674833 0.000000e+00 1146.0
21 TraesCS5B01G520100 chr7D 91.995 737 53 6 4 736 246548839 246548105 0.000000e+00 1029.0
22 TraesCS5B01G520100 chr7D 90.836 742 63 4 4 740 566576936 566577677 0.000000e+00 989.0
23 TraesCS5B01G520100 chr2A 91.263 744 58 5 4 743 752782700 752781960 0.000000e+00 1007.0
24 TraesCS5B01G520100 chr2A 93.506 77 5 0 1795 1871 58791633 58791557 5.700000e-22 115.0
25 TraesCS5B01G520100 chr2A 89.412 85 8 1 1787 1871 529797173 529797256 3.430000e-19 106.0
26 TraesCS5B01G520100 chr3D 90.958 741 62 5 4 739 30003110 30002370 0.000000e+00 992.0
27 TraesCS5B01G520100 chr3D 91.045 737 60 6 4 736 42310058 42310792 0.000000e+00 990.0
28 TraesCS5B01G520100 chr4B 91.566 83 7 0 1789 1871 529838235 529838317 5.700000e-22 115.0
29 TraesCS5B01G520100 chr4B 100.000 28 0 0 738 765 635012774 635012747 5.000000e-03 52.8
30 TraesCS5B01G520100 chr2D 97.143 35 1 0 735 769 643675593 643675627 2.710000e-05 60.2
31 TraesCS5B01G520100 chr4D 100.000 30 0 0 738 767 379702109 379702138 3.500000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G520100 chr5B 682458716 682461235 2519 True 4654 4654 100.000 1 2520 1 chr5B.!!$R2 2519
1 TraesCS5B01G520100 chr5B 682419061 682420931 1870 True 3356 3356 99.038 1 1871 1 chr5B.!!$R1 1870
2 TraesCS5B01G520100 chr5D 540234750 540235766 1016 True 1452 1452 92.654 770 1775 1 chr5D.!!$R1 1005
3 TraesCS5B01G520100 chr4A 628083710 628084749 1039 True 1323 1323 89.831 770 1809 1 chr4A.!!$R2 1039
4 TraesCS5B01G520100 chr4A 717461191 717461840 649 True 1151 1151 98.615 1871 2520 1 chr4A.!!$R3 649
5 TraesCS5B01G520100 chr6B 391085806 391086455 649 True 1179 1179 99.385 1871 2520 1 chr6B.!!$R1 649
6 TraesCS5B01G520100 chr7B 192773703 192774352 649 False 1157 1157 98.769 1871 2520 1 chr7B.!!$F1 649
7 TraesCS5B01G520100 chr6A 11431636 11432285 649 True 1157 1157 98.769 1871 2520 1 chr6A.!!$R1 649
8 TraesCS5B01G520100 chr6A 614112426 614113157 731 False 1037 1037 92.152 3 740 1 chr6A.!!$F1 737
9 TraesCS5B01G520100 chr5A 328022245 328022894 649 True 1151 1151 98.615 1871 2520 1 chr5A.!!$R1 649
10 TraesCS5B01G520100 chr3B 818927411 818928060 649 False 1151 1151 98.615 1871 2520 1 chr3B.!!$F2 649
11 TraesCS5B01G520100 chr3B 820555335 820555984 649 False 1151 1151 98.615 1871 2520 1 chr3B.!!$F3 649
12 TraesCS5B01G520100 chr3B 783307046 783307766 720 False 1003 1003 91.851 4 722 1 chr3B.!!$F1 718
13 TraesCS5B01G520100 chr2B 47195932 47196581 649 True 1146 1146 98.462 1871 2520 1 chr2B.!!$R1 649
14 TraesCS5B01G520100 chr2B 479592136 479592870 734 False 985 985 90.934 3 736 1 chr2B.!!$F1 733
15 TraesCS5B01G520100 chr1A 12674184 12674833 649 False 1146 1146 98.462 1871 2520 1 chr1A.!!$F1 649
16 TraesCS5B01G520100 chr7D 246548105 246548839 734 True 1029 1029 91.995 4 736 1 chr7D.!!$R1 732
17 TraesCS5B01G520100 chr7D 566576936 566577677 741 False 989 989 90.836 4 740 1 chr7D.!!$F1 736
18 TraesCS5B01G520100 chr2A 752781960 752782700 740 True 1007 1007 91.263 4 743 1 chr2A.!!$R2 739
19 TraesCS5B01G520100 chr3D 30002370 30003110 740 True 992 992 90.958 4 739 1 chr3D.!!$R1 735
20 TraesCS5B01G520100 chr3D 42310058 42310792 734 False 990 990 91.045 4 736 1 chr3D.!!$F1 732

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
205 209 0.250124 CGGTGTTGTTGCCCTAGTCA 60.25 55.0 0.0 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1829 1864 0.508641 GATACATCCACATGCGCGAC 59.491 55.0 12.1 0.88 32.57 5.19 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
205 209 0.250124 CGGTGTTGTTGCCCTAGTCA 60.250 55.000 0.00 0.0 0.00 3.41
537 542 0.827925 ACTGGTGCTTCGGAGTCTCA 60.828 55.000 1.47 0.0 0.00 3.27
1463 1490 3.361977 AACCGCATGTGAACCGGC 61.362 61.111 8.11 0.0 45.58 6.13
1815 1850 4.142359 GCATCATATGTACTACTCCCTCCG 60.142 50.000 1.90 0.0 0.00 4.63
1829 1864 2.093869 TCCCTCCGTTCCGAATTACTTG 60.094 50.000 0.00 0.0 0.00 3.16
1904 1939 6.866770 TCTTTTGTATAGGCAGTATATCGCAC 59.133 38.462 0.00 0.0 0.00 5.34
2495 2530 2.961741 ACCATCGATGCTACACTCATCT 59.038 45.455 20.25 0.0 38.47 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
205 209 0.038159 CAACGAAGAAGAGGAGCCGT 60.038 55.000 0.00 0.00 0.00 5.68
537 542 1.965754 GAGATCGCCCACCAAGCTCT 61.966 60.000 0.00 0.00 0.00 4.09
1815 1850 1.526384 GCGCGACAAGTAATTCGGAAC 60.526 52.381 12.10 0.00 35.73 3.62
1829 1864 0.508641 GATACATCCACATGCGCGAC 59.491 55.000 12.10 0.88 32.57 5.19
2158 2193 2.665000 CAGGGAGAAGAAGCGGCA 59.335 61.111 1.45 0.00 0.00 5.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.