Multiple sequence alignment - TraesCS5B01G519400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G519400 chr5B 100.000 5013 0 0 1 5013 682175846 682180858 0.000000e+00 9258.0
1 TraesCS5B01G519400 chr5B 93.525 278 15 3 4669 4945 320410909 320411184 1.300000e-110 411.0
2 TraesCS5B01G519400 chr5B 91.667 192 14 2 4337 4526 489304289 489304098 1.070000e-66 265.0
3 TraesCS5B01G519400 chr5B 89.552 201 14 6 4328 4525 685475894 685476090 1.080000e-61 248.0
4 TraesCS5B01G519400 chr5B 87.568 185 19 3 4343 4525 700915910 700915728 1.410000e-50 211.0
5 TraesCS5B01G519400 chr5B 96.667 90 1 2 2748 2836 704532032 704531944 1.120000e-31 148.0
6 TraesCS5B01G519400 chr4A 92.584 1227 66 13 2835 4057 627815651 627816856 0.000000e+00 1738.0
7 TraesCS5B01G519400 chr4A 91.166 566 35 8 2196 2755 627815097 627815653 0.000000e+00 754.0
8 TraesCS5B01G519400 chr4A 90.152 396 17 8 835 1217 627813828 627814214 3.490000e-136 496.0
9 TraesCS5B01G519400 chr4A 82.955 528 57 17 1045 1554 733801211 733801723 3.560000e-121 446.0
10 TraesCS5B01G519400 chr4A 76.577 555 76 33 1253 1774 627814288 627814821 6.440000e-64 255.0
11 TraesCS5B01G519400 chr4A 97.647 85 1 1 2753 2836 740662659 740662743 1.450000e-30 145.0
12 TraesCS5B01G519400 chr4A 84.127 126 8 5 4061 4174 52607361 52607236 1.480000e-20 111.0
13 TraesCS5B01G519400 chr4A 82.540 126 17 3 255 375 449824883 449824758 6.860000e-19 106.0
14 TraesCS5B01G519400 chr4A 78.723 141 20 6 4044 4181 739152430 739152563 8.940000e-13 86.1
15 TraesCS5B01G519400 chr4A 97.619 42 1 0 2798 2839 2540743 2540702 6.960000e-09 73.1
16 TraesCS5B01G519400 chr2B 97.967 738 10 1 1 738 663126142 663125410 0.000000e+00 1275.0
17 TraesCS5B01G519400 chr2B 82.759 290 37 8 1265 1554 307698274 307697998 3.880000e-61 246.0
18 TraesCS5B01G519400 chr2B 88.182 110 6 1 4085 4187 366017664 366017555 1.890000e-24 124.0
19 TraesCS5B01G519400 chr2B 76.296 135 25 5 4047 4181 69001070 69001197 1.160000e-06 65.8
20 TraesCS5B01G519400 chr2B 92.500 40 2 1 4046 4085 198592905 198592943 7.010000e-04 56.5
21 TraesCS5B01G519400 chr1B 92.517 735 36 4 17 739 415606227 415605500 0.000000e+00 1035.0
22 TraesCS5B01G519400 chr1B 94.186 172 4 4 1045 1210 647187296 647187467 1.790000e-64 257.0
23 TraesCS5B01G519400 chr1B 93.023 172 6 5 1052 1217 43358626 43358455 3.880000e-61 246.0
24 TraesCS5B01G519400 chr1B 77.095 358 39 23 4 348 58020357 58020030 3.100000e-37 167.0
25 TraesCS5B01G519400 chr1B 95.745 94 3 1 2749 2841 549520056 549520149 3.130000e-32 150.0
26 TraesCS5B01G519400 chr1B 94.118 85 4 1 2753 2836 566250516 566250600 1.460000e-25 128.0
27 TraesCS5B01G519400 chr1B 94.805 77 3 1 2761 2836 566025614 566025538 8.820000e-23 119.0
28 TraesCS5B01G519400 chr1B 85.915 71 5 4 369 439 415606389 415606454 2.500000e-08 71.3
29 TraesCS5B01G519400 chr5D 82.218 1136 133 47 2837 3951 539971076 539972163 0.000000e+00 915.0
30 TraesCS5B01G519400 chr5D 81.220 820 122 22 1938 2750 539970277 539971071 2.550000e-177 632.0
31 TraesCS5B01G519400 chr5D 91.743 436 21 6 759 1193 539969289 539969710 4.320000e-165 592.0
32 TraesCS5B01G519400 chr5D 79.154 331 48 9 1253 1578 539969824 539970138 5.090000e-50 209.0
33 TraesCS5B01G519400 chr5D 81.197 234 29 8 198 431 295078632 295078850 1.860000e-39 174.0
34 TraesCS5B01G519400 chr5D 97.727 44 1 0 1 44 295078482 295078525 5.380000e-10 76.8
35 TraesCS5B01G519400 chr5D 88.333 60 5 2 63 120 295078522 295078581 2.500000e-08 71.3
36 TraesCS5B01G519400 chr5A 85.772 492 56 9 5 492 210482883 210482402 4.480000e-140 508.0
37 TraesCS5B01G519400 chr5A 96.629 89 1 2 2750 2836 612161562 612161474 4.040000e-31 147.0
38 TraesCS5B01G519400 chr5A 97.647 85 1 1 2753 2836 612161474 612161558 1.450000e-30 145.0
39 TraesCS5B01G519400 chr5A 88.182 110 6 4 4085 4187 320214390 320214281 1.890000e-24 124.0
40 TraesCS5B01G519400 chr4D 94.853 272 13 1 4675 4945 437030444 437030173 1.670000e-114 424.0
41 TraesCS5B01G519400 chr4D 87.065 201 21 5 4328 4525 495994014 495993816 6.530000e-54 222.0
42 TraesCS5B01G519400 chr4D 100.000 28 0 0 2809 2836 287300902 287300929 9.000000e-03 52.8
43 TraesCS5B01G519400 chr4D 100.000 28 0 0 2809 2836 436892693 436892720 9.000000e-03 52.8
44 TraesCS5B01G519400 chr3D 93.796 274 16 1 4673 4945 145199366 145199639 1.300000e-110 411.0
45 TraesCS5B01G519400 chr3D 84.322 236 28 5 198 433 247878772 247878998 6.530000e-54 222.0
46 TraesCS5B01G519400 chr3D 95.181 83 4 0 322 404 105176643 105176561 1.130000e-26 132.0
47 TraesCS5B01G519400 chr3D 89.091 110 5 4 4085 4187 87926146 87926037 4.070000e-26 130.0
48 TraesCS5B01G519400 chr3D 88.785 107 5 4 4085 4184 593088490 593088596 1.890000e-24 124.0
49 TraesCS5B01G519400 chr3D 90.000 60 4 2 63 120 247878662 247878721 5.380000e-10 76.8
50 TraesCS5B01G519400 chr3D 95.556 45 1 1 1 44 247878621 247878665 2.500000e-08 71.3
51 TraesCS5B01G519400 chr3D 97.143 35 1 0 4052 4086 505010375 505010409 5.420000e-05 60.2
52 TraesCS5B01G519400 chr3D 94.737 38 2 0 1133 1170 596057150 596057187 5.420000e-05 60.2
53 TraesCS5B01G519400 chrUn 93.165 278 18 1 4671 4947 87033213 87032936 1.680000e-109 407.0
54 TraesCS5B01G519400 chrUn 93.165 278 18 1 4671 4947 445906721 445906444 1.680000e-109 407.0
55 TraesCS5B01G519400 chrUn 88.785 107 3 4 4085 4184 96478240 96478344 6.820000e-24 122.0
56 TraesCS5B01G519400 chr6B 93.141 277 17 2 4672 4947 678172092 678172367 6.040000e-109 405.0
57 TraesCS5B01G519400 chr6B 91.156 294 22 4 4666 4957 478751291 478751582 3.640000e-106 396.0
58 TraesCS5B01G519400 chr6B 82.781 302 37 11 1253 1553 349203820 349203533 6.440000e-64 255.0
59 TraesCS5B01G519400 chr6B 92.135 178 8 5 1046 1217 349204071 349203894 3.880000e-61 246.0
60 TraesCS5B01G519400 chr6B 93.023 172 6 5 1052 1217 482307934 482308105 3.880000e-61 246.0
61 TraesCS5B01G519400 chr6B 93.023 172 6 5 1045 1210 648633061 648633232 3.880000e-61 246.0
62 TraesCS5B01G519400 chr6B 82.414 290 38 9 1265 1554 482308191 482308467 1.800000e-59 241.0
63 TraesCS5B01G519400 chr6B 81.000 200 31 5 539 737 458586240 458586433 8.690000e-33 152.0
64 TraesCS5B01G519400 chr6B 71.708 767 142 50 25 734 458585972 458585224 1.450000e-30 145.0
65 TraesCS5B01G519400 chr6B 94.048 84 5 0 2753 2836 535996868 535996785 1.460000e-25 128.0
66 TraesCS5B01G519400 chr6B 93.182 44 1 2 4042 4085 317547321 317547280 4.190000e-06 63.9
67 TraesCS5B01G519400 chr3A 92.832 279 19 1 4670 4947 361973025 361973303 2.170000e-108 403.0
68 TraesCS5B01G519400 chr3A 95.833 96 3 1 2746 2840 69643765 69643860 2.420000e-33 154.0
69 TraesCS5B01G519400 chr3A 95.699 93 1 3 2747 2836 69643864 69643772 4.040000e-31 147.0
70 TraesCS5B01G519400 chr3A 96.591 88 2 1 2753 2839 696373517 696373430 1.450000e-30 145.0
71 TraesCS5B01G519400 chr3A 97.647 85 1 1 2753 2836 696373433 696373517 1.450000e-30 145.0
72 TraesCS5B01G519400 chr3A 95.294 85 3 1 2753 2836 663575410 663575326 3.150000e-27 134.0
73 TraesCS5B01G519400 chr2D 90.635 299 23 5 4670 4966 304329531 304329236 4.700000e-105 392.0
74 TraesCS5B01G519400 chr2D 79.603 353 51 11 1 351 601267006 601266673 3.020000e-57 233.0
75 TraesCS5B01G519400 chr2D 88.991 109 5 1 4085 4186 119798808 119798700 1.460000e-25 128.0
76 TraesCS5B01G519400 chr2D 88.182 110 6 1 4085 4187 296364064 296364173 1.890000e-24 124.0
77 TraesCS5B01G519400 chr2D 87.273 110 7 3 4085 4187 138293691 138293800 8.820000e-23 119.0
78 TraesCS5B01G519400 chr2D 79.755 163 30 2 364 526 601266514 601266355 1.140000e-21 115.0
79 TraesCS5B01G519400 chr2D 95.349 43 2 0 4061 4103 100314725 100314683 9.010000e-08 69.4
80 TraesCS5B01G519400 chr3B 93.855 179 5 5 1045 1217 680295652 680295830 1.070000e-66 265.0
81 TraesCS5B01G519400 chr3B 82.119 302 41 8 1253 1554 680295904 680296192 3.880000e-61 246.0
82 TraesCS5B01G519400 chr3B 82.593 270 34 8 1265 1534 735796405 735796149 5.050000e-55 226.0
83 TraesCS5B01G519400 chr3B 87.435 191 19 4 4337 4523 777006819 777007008 1.090000e-51 215.0
84 TraesCS5B01G519400 chr7B 82.450 302 40 8 1253 1554 733109675 733109963 8.330000e-63 252.0
85 TraesCS5B01G519400 chr7B 92.179 179 8 5 1045 1217 733109423 733109601 1.080000e-61 248.0
86 TraesCS5B01G519400 chr7D 87.958 191 19 4 4337 4525 101702665 101702477 6.530000e-54 222.0
87 TraesCS5B01G519400 chr7D 94.565 92 3 2 2747 2836 180444920 180445011 1.880000e-29 141.0
88 TraesCS5B01G519400 chr7D 78.832 137 22 4 4051 4187 420089853 420089982 8.940000e-13 86.1
89 TraesCS5B01G519400 chr6D 87.629 194 19 5 4337 4527 14973544 14973735 2.350000e-53 220.0
90 TraesCS5B01G519400 chr6D 87.234 47 5 1 4040 4085 18879657 18879703 9.000000e-03 52.8
91 TraesCS5B01G519400 chr1A 86.911 191 23 2 4337 4526 465257192 465257381 3.930000e-51 213.0
92 TraesCS5B01G519400 chr1A 86.979 192 21 4 4339 4528 555797298 555797487 3.930000e-51 213.0
93 TraesCS5B01G519400 chr1A 89.720 107 4 1 4085 4184 39438853 39438959 4.070000e-26 130.0
94 TraesCS5B01G519400 chr1A 79.592 196 26 10 550 738 397111171 397110983 1.460000e-25 128.0
95 TraesCS5B01G519400 chr1A 88.462 52 3 3 4073 4122 402935178 402935228 5.420000e-05 60.2
96 TraesCS5B01G519400 chr4B 98.077 104 2 0 19 122 327492287 327492184 1.110000e-41 182.0
97 TraesCS5B01G519400 chr4B 95.455 88 3 1 2750 2836 607645239 607645152 6.770000e-29 139.0
98 TraesCS5B01G519400 chr4B 84.524 84 3 1 2753 2836 401110995 401111068 1.940000e-09 75.0
99 TraesCS5B01G519400 chr4B 96.774 31 1 0 2806 2836 64610890 64610920 9.000000e-03 52.8
100 TraesCS5B01G519400 chr7A 95.699 93 4 0 2746 2838 553036598 553036690 3.130000e-32 150.0
101 TraesCS5B01G519400 chr1D 85.000 80 11 1 4188 4267 26559473 26559551 4.160000e-11 80.5
102 TraesCS5B01G519400 chr1D 97.436 39 1 0 2798 2836 3732189 3732227 3.240000e-07 67.6
103 TraesCS5B01G519400 chr6A 95.745 47 1 1 2791 2836 567941153 567941107 1.940000e-09 75.0
104 TraesCS5B01G519400 chr6A 97.436 39 1 0 2798 2836 356209033 356208995 3.240000e-07 67.6
105 TraesCS5B01G519400 chr6A 80.189 106 6 11 2746 2836 356208987 356209092 1.160000e-06 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G519400 chr5B 682175846 682180858 5012 False 9258.00 9258 100.00000 1 5013 1 chr5B.!!$F2 5012
1 TraesCS5B01G519400 chr4A 627813828 627816856 3028 False 810.75 1738 87.61975 835 4057 4 chr4A.!!$F4 3222
2 TraesCS5B01G519400 chr4A 733801211 733801723 512 False 446.00 446 82.95500 1045 1554 1 chr4A.!!$F1 509
3 TraesCS5B01G519400 chr2B 663125410 663126142 732 True 1275.00 1275 97.96700 1 738 1 chr2B.!!$R3 737
4 TraesCS5B01G519400 chr1B 415605500 415606227 727 True 1035.00 1035 92.51700 17 739 1 chr1B.!!$R3 722
5 TraesCS5B01G519400 chr5D 539969289 539972163 2874 False 587.00 915 83.58375 759 3951 4 chr5D.!!$F2 3192
6 TraesCS5B01G519400 chr6B 349203533 349204071 538 True 250.50 255 87.45800 1046 1553 2 chr6B.!!$R4 507
7 TraesCS5B01G519400 chr6B 482307934 482308467 533 False 243.50 246 87.71850 1052 1554 2 chr6B.!!$F5 502
8 TraesCS5B01G519400 chr3B 680295652 680296192 540 False 255.50 265 87.98700 1045 1554 2 chr3B.!!$F2 509
9 TraesCS5B01G519400 chr7B 733109423 733109963 540 False 250.00 252 87.31450 1045 1554 2 chr7B.!!$F1 509


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
611 612 0.032952 TCTGGACGTGGAAACGAAGG 59.967 55.0 5.12 0.00 36.85 3.46 F
612 613 0.032952 CTGGACGTGGAAACGAAGGA 59.967 55.0 5.12 0.00 36.85 3.36 F
1774 2117 0.042448 GCGTGTTCACGTTGAGTTCC 60.042 55.0 22.85 3.95 35.26 3.62 F
2646 3097 0.179059 TGTTCTGCCACGAAAGCTGA 60.179 50.0 0.00 0.00 36.55 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1942 2285 0.260816 ACTGCATGGGCCAAGATGAT 59.739 50.0 11.89 0.0 40.13 2.45 R
1952 2295 0.393944 ATGAGTGAGCACTGCATGGG 60.394 55.0 8.03 0.0 42.66 4.00 R
3564 4046 0.110823 GACGCATCAAACGACACCAC 60.111 55.0 0.00 0.0 0.00 4.16 R
4292 4774 0.030101 CGAACCACACGCACCAAATT 59.970 50.0 0.00 0.0 0.00 1.82 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
316 317 3.057547 GCGCCTCTCTTCTCTCGCA 62.058 63.158 0.00 0.00 41.84 5.10
317 318 1.508545 CGCCTCTCTTCTCTCGCAA 59.491 57.895 0.00 0.00 0.00 4.85
318 319 0.525242 CGCCTCTCTTCTCTCGCAAG 60.525 60.000 0.00 0.00 0.00 4.01
319 320 0.179113 GCCTCTCTTCTCTCGCAAGG 60.179 60.000 0.00 0.00 38.47 3.61
320 321 0.179113 CCTCTCTTCTCTCGCAAGGC 60.179 60.000 0.00 0.00 38.47 4.35
372 373 2.588877 CTGCATAGGAACGGGCGG 60.589 66.667 0.00 0.00 0.00 6.13
373 374 4.849310 TGCATAGGAACGGGCGGC 62.849 66.667 0.00 0.00 0.00 6.53
374 375 4.547367 GCATAGGAACGGGCGGCT 62.547 66.667 9.56 0.00 0.00 5.52
375 376 2.280186 CATAGGAACGGGCGGCTC 60.280 66.667 9.56 0.00 0.00 4.70
376 377 3.912907 ATAGGAACGGGCGGCTCG 61.913 66.667 22.48 22.48 0.00 5.03
420 421 4.637771 GGTTCACCGGGGAGAATG 57.362 61.111 6.46 0.00 0.00 2.67
421 422 1.749258 GGTTCACCGGGGAGAATGC 60.749 63.158 6.46 0.00 0.00 3.56
422 423 1.002624 GTTCACCGGGGAGAATGCA 60.003 57.895 6.46 0.00 0.00 3.96
423 424 0.394352 GTTCACCGGGGAGAATGCAT 60.394 55.000 6.46 0.00 0.00 3.96
424 425 0.394216 TTCACCGGGGAGAATGCATG 60.394 55.000 6.46 0.00 0.00 4.06
425 426 1.825191 CACCGGGGAGAATGCATGG 60.825 63.158 6.32 0.00 0.00 3.66
426 427 2.908940 CCGGGGAGAATGCATGGC 60.909 66.667 0.00 0.00 0.00 4.40
427 428 3.282157 CGGGGAGAATGCATGGCG 61.282 66.667 0.00 0.00 0.00 5.69
428 429 2.192979 GGGGAGAATGCATGGCGA 59.807 61.111 0.00 0.00 0.00 5.54
429 430 1.895707 GGGGAGAATGCATGGCGAG 60.896 63.158 0.00 0.00 0.00 5.03
430 431 1.895707 GGGAGAATGCATGGCGAGG 60.896 63.158 0.00 0.00 0.00 4.63
431 432 2.550101 GGAGAATGCATGGCGAGGC 61.550 63.158 0.00 0.00 0.00 4.70
432 433 2.890109 GAGAATGCATGGCGAGGCG 61.890 63.158 0.00 0.00 0.00 5.52
433 434 3.957535 GAATGCATGGCGAGGCGG 61.958 66.667 0.00 0.00 0.00 6.13
448 449 4.069232 CGGCAGCGTTCAGGAGGA 62.069 66.667 0.00 0.00 0.00 3.71
449 450 2.435059 GGCAGCGTTCAGGAGGAC 60.435 66.667 0.00 0.00 0.00 3.85
450 451 2.435059 GCAGCGTTCAGGAGGACC 60.435 66.667 0.00 0.00 0.00 4.46
451 452 2.125912 CAGCGTTCAGGAGGACCG 60.126 66.667 0.00 0.00 41.83 4.79
452 453 3.382832 AGCGTTCAGGAGGACCGG 61.383 66.667 0.00 0.00 41.83 5.28
453 454 3.379445 GCGTTCAGGAGGACCGGA 61.379 66.667 9.46 0.00 41.83 5.14
454 455 2.885861 CGTTCAGGAGGACCGGAG 59.114 66.667 9.46 0.00 41.00 4.63
467 468 2.415010 CGGAGGAGGCATGACGAG 59.585 66.667 0.00 0.00 0.00 4.18
468 469 2.818132 GGAGGAGGCATGACGAGG 59.182 66.667 0.00 0.00 0.00 4.63
469 470 2.107953 GAGGAGGCATGACGAGGC 59.892 66.667 0.00 0.00 0.00 4.70
470 471 2.685017 AGGAGGCATGACGAGGCA 60.685 61.111 0.00 0.00 0.00 4.75
471 472 2.202987 GGAGGCATGACGAGGCAG 60.203 66.667 0.00 0.00 0.00 4.85
472 473 2.894387 GAGGCATGACGAGGCAGC 60.894 66.667 0.00 0.00 0.00 5.25
473 474 4.827087 AGGCATGACGAGGCAGCG 62.827 66.667 0.00 0.00 37.29 5.18
489 490 2.471255 GCGGCACACTGCTTTATCT 58.529 52.632 0.00 0.00 45.33 1.98
490 491 1.651987 GCGGCACACTGCTTTATCTA 58.348 50.000 0.00 0.00 45.33 1.98
491 492 2.213499 GCGGCACACTGCTTTATCTAT 58.787 47.619 0.00 0.00 45.33 1.98
492 493 2.614057 GCGGCACACTGCTTTATCTATT 59.386 45.455 0.00 0.00 45.33 1.73
493 494 3.065371 GCGGCACACTGCTTTATCTATTT 59.935 43.478 0.00 0.00 45.33 1.40
494 495 4.272504 GCGGCACACTGCTTTATCTATTTA 59.727 41.667 0.00 0.00 45.33 1.40
495 496 5.049405 GCGGCACACTGCTTTATCTATTTAT 60.049 40.000 0.00 0.00 45.33 1.40
496 497 6.593978 CGGCACACTGCTTTATCTATTTATC 58.406 40.000 0.00 0.00 44.28 1.75
497 498 6.425114 CGGCACACTGCTTTATCTATTTATCT 59.575 38.462 0.00 0.00 44.28 1.98
498 499 7.359598 CGGCACACTGCTTTATCTATTTATCTC 60.360 40.741 0.00 0.00 44.28 2.75
499 500 7.442364 GGCACACTGCTTTATCTATTTATCTCA 59.558 37.037 0.00 0.00 44.28 3.27
500 501 8.997323 GCACACTGCTTTATCTATTTATCTCAT 58.003 33.333 0.00 0.00 40.96 2.90
504 505 9.499479 ACTGCTTTATCTATTTATCTCATGTGG 57.501 33.333 0.00 0.00 0.00 4.17
505 506 9.716531 CTGCTTTATCTATTTATCTCATGTGGA 57.283 33.333 0.00 0.00 0.00 4.02
512 513 8.992835 TCTATTTATCTCATGTGGATTCATCG 57.007 34.615 8.64 0.00 0.00 3.84
513 514 8.588472 TCTATTTATCTCATGTGGATTCATCGT 58.412 33.333 8.64 0.00 0.00 3.73
514 515 9.212641 CTATTTATCTCATGTGGATTCATCGTT 57.787 33.333 8.64 0.00 0.00 3.85
515 516 7.864108 TTTATCTCATGTGGATTCATCGTTT 57.136 32.000 8.64 0.00 0.00 3.60
516 517 5.998454 ATCTCATGTGGATTCATCGTTTC 57.002 39.130 0.00 0.00 0.00 2.78
517 518 4.831107 TCTCATGTGGATTCATCGTTTCA 58.169 39.130 0.00 0.00 0.00 2.69
518 519 5.430886 TCTCATGTGGATTCATCGTTTCAT 58.569 37.500 0.00 0.00 0.00 2.57
519 520 6.581712 TCTCATGTGGATTCATCGTTTCATA 58.418 36.000 0.00 0.00 0.00 2.15
520 521 7.047271 TCTCATGTGGATTCATCGTTTCATAA 58.953 34.615 0.00 0.00 0.00 1.90
521 522 7.225341 TCTCATGTGGATTCATCGTTTCATAAG 59.775 37.037 0.00 0.00 0.00 1.73
522 523 7.047271 TCATGTGGATTCATCGTTTCATAAGA 58.953 34.615 0.00 0.00 0.00 2.10
523 524 6.662414 TGTGGATTCATCGTTTCATAAGAC 57.338 37.500 0.00 0.00 0.00 3.01
524 525 5.584649 TGTGGATTCATCGTTTCATAAGACC 59.415 40.000 0.00 0.00 0.00 3.85
525 526 5.584649 GTGGATTCATCGTTTCATAAGACCA 59.415 40.000 0.00 0.00 0.00 4.02
526 527 5.817296 TGGATTCATCGTTTCATAAGACCAG 59.183 40.000 0.00 0.00 0.00 4.00
527 528 5.237344 GGATTCATCGTTTCATAAGACCAGG 59.763 44.000 0.00 0.00 0.00 4.45
528 529 5.414789 TTCATCGTTTCATAAGACCAGGA 57.585 39.130 0.00 0.00 0.00 3.86
529 530 5.414789 TCATCGTTTCATAAGACCAGGAA 57.585 39.130 0.00 0.00 0.00 3.36
530 531 5.800296 TCATCGTTTCATAAGACCAGGAAA 58.200 37.500 0.00 0.00 0.00 3.13
531 532 5.874810 TCATCGTTTCATAAGACCAGGAAAG 59.125 40.000 0.00 0.00 29.63 2.62
532 533 4.575885 TCGTTTCATAAGACCAGGAAAGG 58.424 43.478 0.00 0.00 36.15 3.11
533 534 4.041198 TCGTTTCATAAGACCAGGAAAGGT 59.959 41.667 0.00 0.00 46.82 3.50
534 535 4.760204 CGTTTCATAAGACCAGGAAAGGTT 59.240 41.667 0.00 0.00 43.38 3.50
535 536 5.106673 CGTTTCATAAGACCAGGAAAGGTTC 60.107 44.000 0.00 0.00 43.38 3.62
536 537 4.202245 TCATAAGACCAGGAAAGGTTCG 57.798 45.455 0.00 0.00 43.38 3.95
537 538 3.835978 TCATAAGACCAGGAAAGGTTCGA 59.164 43.478 0.00 0.00 43.38 3.71
538 539 4.469945 TCATAAGACCAGGAAAGGTTCGAT 59.530 41.667 0.00 0.00 43.38 3.59
539 540 2.770164 AGACCAGGAAAGGTTCGATG 57.230 50.000 0.00 0.00 43.38 3.84
540 541 1.279271 AGACCAGGAAAGGTTCGATGG 59.721 52.381 0.00 8.52 43.38 3.51
541 542 1.278127 GACCAGGAAAGGTTCGATGGA 59.722 52.381 14.39 0.00 43.38 3.41
542 543 1.702957 ACCAGGAAAGGTTCGATGGAA 59.297 47.619 14.39 0.00 39.34 3.53
543 544 2.107552 ACCAGGAAAGGTTCGATGGAAA 59.892 45.455 14.39 0.00 39.34 3.13
544 545 2.488153 CCAGGAAAGGTTCGATGGAAAC 59.512 50.000 0.00 0.00 40.30 2.78
545 546 2.159627 CAGGAAAGGTTCGATGGAAACG 59.840 50.000 0.00 0.00 44.79 3.60
546 547 2.038033 AGGAAAGGTTCGATGGAAACGA 59.962 45.455 0.00 0.00 44.79 3.85
547 548 2.159037 GGAAAGGTTCGATGGAAACGAC 59.841 50.000 0.00 0.00 42.14 4.34
548 549 2.833631 AAGGTTCGATGGAAACGACT 57.166 45.000 0.00 0.00 42.14 4.18
549 550 2.365408 AGGTTCGATGGAAACGACTC 57.635 50.000 0.00 0.00 42.14 3.36
550 551 0.989890 GGTTCGATGGAAACGACTCG 59.010 55.000 0.00 0.00 42.14 4.18
551 552 0.989890 GTTCGATGGAAACGACTCGG 59.010 55.000 2.98 0.00 42.14 4.63
552 553 0.883153 TTCGATGGAAACGACTCGGA 59.117 50.000 2.98 0.00 42.14 4.55
553 554 0.450583 TCGATGGAAACGACTCGGAG 59.549 55.000 2.83 2.83 35.75 4.63
554 555 0.525668 CGATGGAAACGACTCGGAGG 60.526 60.000 10.23 0.00 31.90 4.30
555 556 0.179108 GATGGAAACGACTCGGAGGG 60.179 60.000 10.23 3.43 0.00 4.30
556 557 2.125633 GGAAACGACTCGGAGGGC 60.126 66.667 10.23 0.04 0.00 5.19
557 558 2.654877 GAAACGACTCGGAGGGCA 59.345 61.111 10.23 0.00 0.00 5.36
558 559 1.005394 GAAACGACTCGGAGGGCAA 60.005 57.895 10.23 0.00 0.00 4.52
559 560 0.601841 GAAACGACTCGGAGGGCAAA 60.602 55.000 10.23 0.00 0.00 3.68
560 561 0.036306 AAACGACTCGGAGGGCAAAT 59.964 50.000 10.23 0.00 0.00 2.32
561 562 0.391263 AACGACTCGGAGGGCAAATC 60.391 55.000 10.23 0.00 0.00 2.17
562 563 1.521681 CGACTCGGAGGGCAAATCC 60.522 63.158 10.23 0.00 0.00 3.01
569 570 2.640316 GGAGGGCAAATCCGTCTTAT 57.360 50.000 4.03 0.00 46.35 1.73
570 571 3.764237 GGAGGGCAAATCCGTCTTATA 57.236 47.619 4.03 0.00 46.35 0.98
571 572 4.081322 GGAGGGCAAATCCGTCTTATAA 57.919 45.455 4.03 0.00 46.35 0.98
572 573 4.457466 GGAGGGCAAATCCGTCTTATAAA 58.543 43.478 4.03 0.00 46.35 1.40
573 574 4.885325 GGAGGGCAAATCCGTCTTATAAAA 59.115 41.667 4.03 0.00 46.35 1.52
574 575 5.535030 GGAGGGCAAATCCGTCTTATAAAAT 59.465 40.000 4.03 0.00 46.35 1.82
575 576 6.294010 GGAGGGCAAATCCGTCTTATAAAATC 60.294 42.308 4.03 0.00 46.35 2.17
576 577 5.238650 AGGGCAAATCCGTCTTATAAAATCG 59.761 40.000 0.00 0.00 34.94 3.34
577 578 5.237779 GGGCAAATCCGTCTTATAAAATCGA 59.762 40.000 0.00 0.00 34.94 3.59
578 579 6.238538 GGGCAAATCCGTCTTATAAAATCGAA 60.239 38.462 0.00 0.00 34.94 3.71
579 580 7.360361 GGCAAATCCGTCTTATAAAATCGAAT 58.640 34.615 0.00 0.00 0.00 3.34
580 581 8.500773 GGCAAATCCGTCTTATAAAATCGAATA 58.499 33.333 0.00 0.00 0.00 1.75
586 587 9.419297 TCCGTCTTATAAAATCGAATATGAAGG 57.581 33.333 12.49 12.49 35.04 3.46
587 588 8.656849 CCGTCTTATAAAATCGAATATGAAGGG 58.343 37.037 11.55 5.48 32.58 3.95
588 589 9.204570 CGTCTTATAAAATCGAATATGAAGGGT 57.795 33.333 0.00 0.00 0.00 4.34
590 591 9.502091 TCTTATAAAATCGAATATGAAGGGTGG 57.498 33.333 0.00 0.00 0.00 4.61
591 592 8.630054 TTATAAAATCGAATATGAAGGGTGGG 57.370 34.615 0.00 0.00 0.00 4.61
592 593 4.519906 AAATCGAATATGAAGGGTGGGT 57.480 40.909 0.00 0.00 0.00 4.51
593 594 3.771577 ATCGAATATGAAGGGTGGGTC 57.228 47.619 0.00 0.00 0.00 4.46
594 595 2.759355 TCGAATATGAAGGGTGGGTCT 58.241 47.619 0.00 0.00 0.00 3.85
595 596 2.434336 TCGAATATGAAGGGTGGGTCTG 59.566 50.000 0.00 0.00 0.00 3.51
596 597 2.485479 CGAATATGAAGGGTGGGTCTGG 60.485 54.545 0.00 0.00 0.00 3.86
597 598 2.587060 ATATGAAGGGTGGGTCTGGA 57.413 50.000 0.00 0.00 0.00 3.86
598 599 1.580059 TATGAAGGGTGGGTCTGGAC 58.420 55.000 0.00 0.00 0.00 4.02
599 600 1.553690 ATGAAGGGTGGGTCTGGACG 61.554 60.000 0.00 0.00 0.00 4.79
600 601 2.122547 AAGGGTGGGTCTGGACGT 60.123 61.111 0.00 0.00 0.00 4.34
601 602 2.450479 GAAGGGTGGGTCTGGACGTG 62.450 65.000 0.00 0.00 0.00 4.49
602 603 4.016706 GGGTGGGTCTGGACGTGG 62.017 72.222 0.00 0.00 0.00 4.94
603 604 2.920912 GGTGGGTCTGGACGTGGA 60.921 66.667 0.00 0.00 0.00 4.02
604 605 2.513259 GGTGGGTCTGGACGTGGAA 61.513 63.158 0.00 0.00 0.00 3.53
605 606 1.448497 GTGGGTCTGGACGTGGAAA 59.552 57.895 0.00 0.00 0.00 3.13
606 607 0.883370 GTGGGTCTGGACGTGGAAAC 60.883 60.000 0.00 0.00 0.00 2.78
607 608 1.666872 GGGTCTGGACGTGGAAACG 60.667 63.158 0.00 0.00 39.31 3.60
608 609 1.364901 GGTCTGGACGTGGAAACGA 59.635 57.895 5.12 0.00 36.85 3.85
609 610 0.249573 GGTCTGGACGTGGAAACGAA 60.250 55.000 5.12 0.00 36.85 3.85
610 611 1.137513 GTCTGGACGTGGAAACGAAG 58.862 55.000 5.12 0.47 36.85 3.79
611 612 0.032952 TCTGGACGTGGAAACGAAGG 59.967 55.000 5.12 0.00 36.85 3.46
612 613 0.032952 CTGGACGTGGAAACGAAGGA 59.967 55.000 5.12 0.00 36.85 3.36
613 614 0.464870 TGGACGTGGAAACGAAGGAA 59.535 50.000 5.12 0.00 36.85 3.36
614 615 1.134461 TGGACGTGGAAACGAAGGAAA 60.134 47.619 5.12 0.00 36.85 3.13
615 616 1.941975 GGACGTGGAAACGAAGGAAAA 59.058 47.619 5.12 0.00 36.85 2.29
616 617 2.355444 GGACGTGGAAACGAAGGAAAAA 59.645 45.455 5.12 0.00 36.85 1.94
643 644 7.687941 CCATTCTGTGGTGTTTTATCTAGTT 57.312 36.000 0.00 0.00 43.44 2.24
644 645 8.786826 CCATTCTGTGGTGTTTTATCTAGTTA 57.213 34.615 0.00 0.00 43.44 2.24
645 646 8.665685 CCATTCTGTGGTGTTTTATCTAGTTAC 58.334 37.037 0.00 0.00 43.44 2.50
646 647 8.665685 CATTCTGTGGTGTTTTATCTAGTTACC 58.334 37.037 0.00 0.00 0.00 2.85
647 648 7.305813 TCTGTGGTGTTTTATCTAGTTACCA 57.694 36.000 0.00 0.00 34.61 3.25
648 649 7.737869 TCTGTGGTGTTTTATCTAGTTACCAA 58.262 34.615 0.00 0.00 38.34 3.67
649 650 8.380099 TCTGTGGTGTTTTATCTAGTTACCAAT 58.620 33.333 0.00 0.00 38.34 3.16
650 651 9.661563 CTGTGGTGTTTTATCTAGTTACCAATA 57.338 33.333 0.00 0.00 38.34 1.90
670 671 9.920946 ACCAATATAAAGTGTGGTATTCAATCT 57.079 29.630 0.00 0.00 42.60 2.40
689 690 9.638239 TTCAATCTAATAAAATGAAAGGTGTGC 57.362 29.630 0.00 0.00 0.00 4.57
690 691 9.023962 TCAATCTAATAAAATGAAAGGTGTGCT 57.976 29.630 0.00 0.00 0.00 4.40
697 698 8.682936 ATAAAATGAAAGGTGTGCTATAGGAG 57.317 34.615 1.04 0.00 0.00 3.69
711 712 5.871396 CTATAGGAGCAAAGTACCAGGAA 57.129 43.478 0.00 0.00 0.00 3.36
712 713 6.235231 CTATAGGAGCAAAGTACCAGGAAA 57.765 41.667 0.00 0.00 0.00 3.13
713 714 3.876309 AGGAGCAAAGTACCAGGAAAA 57.124 42.857 0.00 0.00 0.00 2.29
714 715 3.756117 AGGAGCAAAGTACCAGGAAAAG 58.244 45.455 0.00 0.00 0.00 2.27
715 716 3.138468 AGGAGCAAAGTACCAGGAAAAGT 59.862 43.478 0.00 0.00 0.00 2.66
716 717 3.253432 GGAGCAAAGTACCAGGAAAAGTG 59.747 47.826 0.00 0.00 0.00 3.16
717 718 3.883489 GAGCAAAGTACCAGGAAAAGTGT 59.117 43.478 0.00 0.00 0.00 3.55
718 719 3.632145 AGCAAAGTACCAGGAAAAGTGTG 59.368 43.478 0.00 0.00 0.00 3.82
719 720 3.243401 GCAAAGTACCAGGAAAAGTGTGG 60.243 47.826 0.00 0.00 37.38 4.17
720 721 2.271944 AGTACCAGGAAAAGTGTGGC 57.728 50.000 0.00 0.00 34.40 5.01
721 722 1.493022 AGTACCAGGAAAAGTGTGGCA 59.507 47.619 0.00 0.00 34.40 4.92
722 723 2.108250 AGTACCAGGAAAAGTGTGGCAT 59.892 45.455 0.00 0.00 34.40 4.40
723 724 2.086610 ACCAGGAAAAGTGTGGCATT 57.913 45.000 0.00 0.00 34.40 3.56
724 725 2.397597 ACCAGGAAAAGTGTGGCATTT 58.602 42.857 0.00 0.00 34.40 2.32
725 726 2.365293 ACCAGGAAAAGTGTGGCATTTC 59.635 45.455 0.00 3.29 34.93 2.17
728 729 3.303881 GGAAAAGTGTGGCATTTCCTC 57.696 47.619 18.63 0.63 46.09 3.71
729 730 2.351738 GGAAAAGTGTGGCATTTCCTCG 60.352 50.000 18.63 0.00 46.09 4.63
730 731 2.270352 AAAGTGTGGCATTTCCTCGA 57.730 45.000 0.00 0.00 35.26 4.04
731 732 2.270352 AAGTGTGGCATTTCCTCGAA 57.730 45.000 0.00 0.00 35.26 3.71
732 733 2.496899 AGTGTGGCATTTCCTCGAAT 57.503 45.000 0.00 0.00 35.26 3.34
733 734 2.795329 AGTGTGGCATTTCCTCGAATT 58.205 42.857 0.00 0.00 35.26 2.17
734 735 2.489329 AGTGTGGCATTTCCTCGAATTG 59.511 45.455 0.00 0.00 35.26 2.32
735 736 1.202114 TGTGGCATTTCCTCGAATTGC 59.798 47.619 11.09 11.09 43.65 3.56
737 738 3.648528 GCATTTCCTCGAATTGCCC 57.351 52.632 9.15 0.00 40.67 5.36
738 739 0.817013 GCATTTCCTCGAATTGCCCA 59.183 50.000 9.15 0.00 40.67 5.36
739 740 1.410153 GCATTTCCTCGAATTGCCCAT 59.590 47.619 9.15 0.00 40.67 4.00
740 741 2.159057 GCATTTCCTCGAATTGCCCATT 60.159 45.455 9.15 0.00 40.67 3.16
741 742 3.679639 GCATTTCCTCGAATTGCCCATTT 60.680 43.478 9.15 0.00 40.67 2.32
742 743 4.506758 CATTTCCTCGAATTGCCCATTTT 58.493 39.130 0.00 0.00 0.00 1.82
743 744 4.615588 TTTCCTCGAATTGCCCATTTTT 57.384 36.364 0.00 0.00 0.00 1.94
777 778 0.247736 GGCCAGTGATCAGTTCGTCT 59.752 55.000 0.00 0.00 0.00 4.18
780 781 2.600731 CCAGTGATCAGTTCGTCTGTC 58.399 52.381 0.00 7.60 43.97 3.51
781 782 2.600731 CAGTGATCAGTTCGTCTGTCC 58.399 52.381 0.00 4.89 43.97 4.02
797 798 3.776969 TCTGTCCAGATGTTTGAGGCTAT 59.223 43.478 0.00 0.00 31.41 2.97
809 810 5.049680 TGTTTGAGGCTATTTTGAGACGTTC 60.050 40.000 0.00 0.00 0.00 3.95
815 816 0.872388 ATTTTGAGACGTTCGGGTGC 59.128 50.000 0.00 0.00 0.00 5.01
817 818 0.878523 TTTGAGACGTTCGGGTGCAG 60.879 55.000 0.00 0.00 0.00 4.41
823 824 1.153647 CGTTCGGGTGCAGATGCTA 60.154 57.895 6.35 0.00 42.66 3.49
825 826 0.727398 GTTCGGGTGCAGATGCTAAC 59.273 55.000 6.35 0.00 42.66 2.34
827 828 1.221840 CGGGTGCAGATGCTAACCT 59.778 57.895 12.49 0.00 42.66 3.50
829 830 1.134521 CGGGTGCAGATGCTAACCTAA 60.135 52.381 12.49 0.00 42.66 2.69
830 831 2.565841 GGGTGCAGATGCTAACCTAAG 58.434 52.381 12.49 0.00 42.66 2.18
831 832 2.092914 GGGTGCAGATGCTAACCTAAGT 60.093 50.000 12.49 0.00 42.66 2.24
832 833 2.939103 GGTGCAGATGCTAACCTAAGTG 59.061 50.000 6.35 0.00 42.66 3.16
833 834 3.369471 GGTGCAGATGCTAACCTAAGTGA 60.369 47.826 6.35 0.00 42.66 3.41
834 835 4.446371 GTGCAGATGCTAACCTAAGTGAT 58.554 43.478 6.35 0.00 42.66 3.06
835 836 5.453339 GGTGCAGATGCTAACCTAAGTGATA 60.453 44.000 6.35 0.00 42.66 2.15
836 837 6.049149 GTGCAGATGCTAACCTAAGTGATAA 58.951 40.000 6.35 0.00 42.66 1.75
837 838 6.538742 GTGCAGATGCTAACCTAAGTGATAAA 59.461 38.462 6.35 0.00 42.66 1.40
838 839 7.065803 GTGCAGATGCTAACCTAAGTGATAAAA 59.934 37.037 6.35 0.00 42.66 1.52
967 972 3.760537 CGTGAAAGGGAAACGAAAACAA 58.239 40.909 0.00 0.00 39.64 2.83
969 974 4.030865 CGTGAAAGGGAAACGAAAACAAAC 59.969 41.667 0.00 0.00 39.64 2.93
996 1001 2.737376 GACGTGTGCCTTCCCGTC 60.737 66.667 0.00 0.00 42.22 4.79
997 1002 4.309950 ACGTGTGCCTTCCCGTCC 62.310 66.667 0.00 0.00 0.00 4.79
999 1004 4.309950 GTGTGCCTTCCCGTCCGT 62.310 66.667 0.00 0.00 0.00 4.69
1000 1005 4.308458 TGTGCCTTCCCGTCCGTG 62.308 66.667 0.00 0.00 0.00 4.94
1001 1006 4.309950 GTGCCTTCCCGTCCGTGT 62.310 66.667 0.00 0.00 0.00 4.49
1205 1239 1.157276 CCTCCCCCGATCCATCTCT 59.843 63.158 0.00 0.00 0.00 3.10
1217 1251 0.753262 CCATCTCTACTGTTCCCCCG 59.247 60.000 0.00 0.00 0.00 5.73
1218 1252 1.688311 CCATCTCTACTGTTCCCCCGA 60.688 57.143 0.00 0.00 0.00 5.14
1219 1253 2.320781 CATCTCTACTGTTCCCCCGAT 58.679 52.381 0.00 0.00 0.00 4.18
1221 1255 1.041437 CTCTACTGTTCCCCCGATCC 58.959 60.000 0.00 0.00 0.00 3.36
1223 1257 1.745320 CTACTGTTCCCCCGATCCCG 61.745 65.000 0.00 0.00 0.00 5.14
1234 1281 1.094785 CCGATCCCGCTCAAATTGTT 58.905 50.000 0.00 0.00 0.00 2.83
1236 1283 2.518949 CGATCCCGCTCAAATTGTTTG 58.481 47.619 0.00 0.00 41.96 2.93
1241 1288 1.613437 CCGCTCAAATTGTTTGGAGGT 59.387 47.619 2.92 0.00 40.98 3.85
1249 1296 2.359975 GTTTGGAGGTGGGAGCGG 60.360 66.667 0.00 0.00 0.00 5.52
1251 1298 2.457323 TTTGGAGGTGGGAGCGGTT 61.457 57.895 0.00 0.00 0.00 4.44
1257 1329 2.593956 GGTGGGAGCGGTTCTTCCT 61.594 63.158 0.00 0.00 41.42 3.36
1259 1331 0.611714 GTGGGAGCGGTTCTTCCTTA 59.388 55.000 0.00 0.00 41.42 2.69
1260 1332 1.002773 GTGGGAGCGGTTCTTCCTTAA 59.997 52.381 0.00 0.00 41.42 1.85
1277 1453 2.850851 TAAGGATGCGGGGAAGGGGT 62.851 60.000 0.00 0.00 0.00 4.95
1289 1589 1.549950 GGAAGGGGTGCTTTGGATTGA 60.550 52.381 0.00 0.00 0.00 2.57
1310 1610 1.529438 TCAAAATTGCCGACGAGTGTC 59.471 47.619 0.00 0.00 41.91 3.67
1311 1611 1.262950 CAAAATTGCCGACGAGTGTCA 59.737 47.619 0.00 0.00 45.80 3.58
1319 1619 1.068541 CCGACGAGTGTCACAGATTCA 60.069 52.381 5.62 0.00 45.80 2.57
1331 1631 5.122239 TGTCACAGATTCATTCGATTGTTCC 59.878 40.000 7.16 0.00 0.00 3.62
1348 1648 1.227350 CCGATCAATGGCGAGCTGA 60.227 57.895 0.00 0.00 0.00 4.26
1350 1650 0.249197 CGATCAATGGCGAGCTGAGA 60.249 55.000 0.00 0.00 0.00 3.27
1356 1656 1.611474 ATGGCGAGCTGAGAAGCTGA 61.611 55.000 4.69 0.00 46.36 4.26
1375 1675 2.208431 GAATGCCCAGATCGAGAACTG 58.792 52.381 3.73 3.73 0.00 3.16
1379 1679 1.227089 CCAGATCGAGAACTGGCCG 60.227 63.158 14.93 0.00 45.30 6.13
1383 1683 1.696832 GATCGAGAACTGGCCGTTGC 61.697 60.000 16.02 8.22 35.56 4.17
1386 1686 2.032681 AGAACTGGCCGTTGCTCC 59.967 61.111 16.02 3.90 35.56 4.70
1388 1688 4.660938 AACTGGCCGTTGCTCCCC 62.661 66.667 11.39 0.00 37.74 4.81
1405 1705 3.470888 CCGGAGTTCGCCCAGGAT 61.471 66.667 0.00 0.00 37.59 3.24
1409 1709 1.296715 GAGTTCGCCCAGGATGTGT 59.703 57.895 0.00 0.00 0.00 3.72
1416 1716 0.895100 GCCCAGGATGTGTTTGCTCA 60.895 55.000 0.00 0.00 0.00 4.26
1451 1751 1.422402 GAGGGTTTAGGGTGGTGTGAA 59.578 52.381 0.00 0.00 0.00 3.18
1459 1759 0.319813 GGGTGGTGTGAATTGCTTGC 60.320 55.000 0.00 0.00 0.00 4.01
1460 1760 0.675633 GGTGGTGTGAATTGCTTGCT 59.324 50.000 0.00 0.00 0.00 3.91
1461 1761 1.069049 GGTGGTGTGAATTGCTTGCTT 59.931 47.619 0.00 0.00 0.00 3.91
1462 1762 2.129607 GTGGTGTGAATTGCTTGCTTG 58.870 47.619 0.00 0.00 0.00 4.01
1463 1763 1.068895 TGGTGTGAATTGCTTGCTTGG 59.931 47.619 0.00 0.00 0.00 3.61
1485 1785 4.342092 GGGGGTGAAATATTGGAACTCATG 59.658 45.833 0.00 0.00 0.00 3.07
1486 1786 4.956075 GGGGTGAAATATTGGAACTCATGT 59.044 41.667 0.00 0.00 0.00 3.21
1487 1787 6.126409 GGGGTGAAATATTGGAACTCATGTA 58.874 40.000 0.00 0.00 0.00 2.29
1488 1788 6.039382 GGGGTGAAATATTGGAACTCATGTAC 59.961 42.308 0.00 0.00 0.00 2.90
1489 1789 6.039382 GGGTGAAATATTGGAACTCATGTACC 59.961 42.308 0.00 0.00 0.00 3.34
1490 1790 6.828785 GGTGAAATATTGGAACTCATGTACCT 59.171 38.462 0.00 0.00 0.00 3.08
1491 1791 7.201732 GGTGAAATATTGGAACTCATGTACCTG 60.202 40.741 0.00 0.00 0.00 4.00
1492 1792 6.828273 TGAAATATTGGAACTCATGTACCTGG 59.172 38.462 0.00 0.00 0.00 4.45
1523 1827 0.326238 GGGATGACAGGGTAGTGGGA 60.326 60.000 0.00 0.00 0.00 4.37
1532 1836 3.775316 ACAGGGTAGTGGGAACTAGAATG 59.225 47.826 0.00 0.00 0.00 2.67
1534 1838 4.225267 CAGGGTAGTGGGAACTAGAATGTT 59.775 45.833 0.00 0.00 0.00 2.71
1554 1858 1.031235 TGTGCACCACCTGTTTGATG 58.969 50.000 15.69 0.00 32.73 3.07
1555 1859 0.318955 GTGCACCACCTGTTTGATGC 60.319 55.000 5.22 0.00 0.00 3.91
1556 1860 0.754587 TGCACCACCTGTTTGATGCA 60.755 50.000 0.00 0.00 40.57 3.96
1557 1861 0.318955 GCACCACCTGTTTGATGCAC 60.319 55.000 0.00 0.00 33.27 4.57
1558 1862 1.031235 CACCACCTGTTTGATGCACA 58.969 50.000 0.00 0.00 0.00 4.57
1559 1863 1.408340 CACCACCTGTTTGATGCACAA 59.592 47.619 0.00 0.00 36.65 3.33
1560 1864 1.408702 ACCACCTGTTTGATGCACAAC 59.591 47.619 0.00 0.00 38.29 3.32
1561 1865 1.600164 CCACCTGTTTGATGCACAACG 60.600 52.381 0.00 0.00 38.29 4.10
1565 1869 2.805671 CCTGTTTGATGCACAACGAGTA 59.194 45.455 0.00 0.00 38.29 2.59
1566 1870 3.363970 CCTGTTTGATGCACAACGAGTAC 60.364 47.826 0.00 0.00 38.29 2.73
1575 1879 4.267536 TGCACAACGAGTACCTACTAGAT 58.732 43.478 0.00 0.00 36.50 1.98
1576 1880 4.095932 TGCACAACGAGTACCTACTAGATG 59.904 45.833 0.00 1.51 37.59 2.90
1577 1881 4.096081 GCACAACGAGTACCTACTAGATGT 59.904 45.833 0.00 3.62 42.41 3.06
1578 1882 5.730010 GCACAACGAGTACCTACTAGATGTC 60.730 48.000 0.00 0.62 40.78 3.06
1579 1883 5.353400 CACAACGAGTACCTACTAGATGTCA 59.647 44.000 0.00 0.00 40.78 3.58
1580 1884 5.942236 ACAACGAGTACCTACTAGATGTCAA 59.058 40.000 0.00 0.00 39.42 3.18
1582 1886 7.040201 ACAACGAGTACCTACTAGATGTCAAAA 60.040 37.037 0.00 0.00 39.42 2.44
1583 1887 7.458409 ACGAGTACCTACTAGATGTCAAAAA 57.542 36.000 0.00 0.00 36.50 1.94
1613 1945 9.384849 TCTCATTATCTATCTGGAAAATCAGGA 57.615 33.333 0.00 0.00 35.58 3.86
1632 1964 5.418840 TCAGGATTTAAGATTGTTTCCTGCC 59.581 40.000 11.08 0.00 46.32 4.85
1641 1973 3.788227 TTGTTTCCTGCCAGTACTGAT 57.212 42.857 24.68 0.00 0.00 2.90
1643 1975 1.740025 GTTTCCTGCCAGTACTGATGC 59.260 52.381 24.68 19.24 0.00 3.91
1644 1976 1.279496 TTCCTGCCAGTACTGATGCT 58.721 50.000 24.68 0.00 0.00 3.79
1651 1983 3.273434 GCCAGTACTGATGCTGATGAAA 58.727 45.455 24.68 0.00 40.79 2.69
1652 1984 3.311871 GCCAGTACTGATGCTGATGAAAG 59.688 47.826 24.68 3.62 40.79 2.62
1653 1985 4.763073 CCAGTACTGATGCTGATGAAAGA 58.237 43.478 24.68 0.00 40.79 2.52
1654 1986 4.809958 CCAGTACTGATGCTGATGAAAGAG 59.190 45.833 24.68 0.00 40.79 2.85
1655 1987 4.270566 CAGTACTGATGCTGATGAAAGAGC 59.729 45.833 18.45 0.00 40.79 4.09
1666 1998 5.191727 TGATGAAAGAGCAAAATCCCCTA 57.808 39.130 0.00 0.00 0.00 3.53
1672 2004 2.041620 AGAGCAAAATCCCCTAGTGCAA 59.958 45.455 0.00 0.00 37.68 4.08
1676 2008 2.215942 AAATCCCCTAGTGCAACCAC 57.784 50.000 0.00 0.00 42.39 4.16
1677 2009 0.331616 AATCCCCTAGTGCAACCACC 59.668 55.000 0.00 0.00 43.09 4.61
1683 2015 1.135083 CCTAGTGCAACCACCGTAGAG 60.135 57.143 0.00 0.00 43.09 2.43
1686 2018 1.414919 AGTGCAACCACCGTAGAGAAA 59.585 47.619 0.00 0.00 43.09 2.52
1687 2019 2.038557 AGTGCAACCACCGTAGAGAAAT 59.961 45.455 0.00 0.00 43.09 2.17
1688 2020 2.159627 GTGCAACCACCGTAGAGAAATG 59.840 50.000 0.00 0.00 35.92 2.32
1689 2021 1.130561 GCAACCACCGTAGAGAAATGC 59.869 52.381 0.00 0.00 0.00 3.56
1692 2024 1.349688 ACCACCGTAGAGAAATGCCAA 59.650 47.619 0.00 0.00 0.00 4.52
1693 2025 2.009774 CCACCGTAGAGAAATGCCAAG 58.990 52.381 0.00 0.00 0.00 3.61
1694 2026 2.615493 CCACCGTAGAGAAATGCCAAGT 60.615 50.000 0.00 0.00 0.00 3.16
1695 2027 2.673368 CACCGTAGAGAAATGCCAAGTC 59.327 50.000 0.00 0.00 0.00 3.01
1696 2028 1.927174 CCGTAGAGAAATGCCAAGTCG 59.073 52.381 0.00 0.00 0.00 4.18
1706 2045 2.689553 TGCCAAGTCGATAAGCATCA 57.310 45.000 0.00 0.00 0.00 3.07
1714 2053 1.889170 TCGATAAGCATCATCTCGGCT 59.111 47.619 0.00 0.00 40.14 5.52
1717 2056 2.808523 TAAGCATCATCTCGGCTCAG 57.191 50.000 0.00 0.00 36.76 3.35
1732 2071 3.795623 GCTCAGCCAATGTTTGATCAT 57.204 42.857 0.00 0.00 0.00 2.45
1738 2077 2.961062 GCCAATGTTTGATCATAGGGCT 59.039 45.455 0.00 0.00 41.23 5.19
1739 2078 3.005155 GCCAATGTTTGATCATAGGGCTC 59.995 47.826 0.00 0.00 41.23 4.70
1740 2079 3.251729 CCAATGTTTGATCATAGGGCTCG 59.748 47.826 0.00 0.00 0.00 5.03
1746 2089 1.069204 TGATCATAGGGCTCGAGCAAC 59.931 52.381 36.27 27.64 44.36 4.17
1751 2094 1.605058 TAGGGCTCGAGCAACTCACC 61.605 60.000 36.27 26.31 44.36 4.02
1754 2097 1.739562 GCTCGAGCAACTCACCTGG 60.740 63.158 31.91 0.00 41.59 4.45
1774 2117 0.042448 GCGTGTTCACGTTGAGTTCC 60.042 55.000 22.85 3.95 35.26 3.62
1775 2118 0.580104 CGTGTTCACGTTGAGTTCCC 59.420 55.000 15.81 0.00 0.00 3.97
1776 2119 1.805120 CGTGTTCACGTTGAGTTCCCT 60.805 52.381 15.81 0.00 0.00 4.20
1777 2120 2.285977 GTGTTCACGTTGAGTTCCCTT 58.714 47.619 0.00 0.00 0.00 3.95
1778 2121 2.031683 GTGTTCACGTTGAGTTCCCTTG 59.968 50.000 0.00 0.00 0.00 3.61
1779 2122 1.602377 GTTCACGTTGAGTTCCCTTGG 59.398 52.381 0.00 0.00 0.00 3.61
1780 2123 1.124780 TCACGTTGAGTTCCCTTGGA 58.875 50.000 0.00 0.00 0.00 3.53
1781 2124 1.697432 TCACGTTGAGTTCCCTTGGAT 59.303 47.619 0.00 0.00 0.00 3.41
1782 2125 1.806542 CACGTTGAGTTCCCTTGGATG 59.193 52.381 0.00 0.00 0.00 3.51
1783 2126 1.420138 ACGTTGAGTTCCCTTGGATGT 59.580 47.619 0.00 0.00 0.00 3.06
1784 2127 2.635915 ACGTTGAGTTCCCTTGGATGTA 59.364 45.455 0.00 0.00 0.00 2.29
1785 2128 3.263425 ACGTTGAGTTCCCTTGGATGTAT 59.737 43.478 0.00 0.00 0.00 2.29
1786 2129 4.468510 ACGTTGAGTTCCCTTGGATGTATA 59.531 41.667 0.00 0.00 0.00 1.47
1787 2130 5.046159 ACGTTGAGTTCCCTTGGATGTATAA 60.046 40.000 0.00 0.00 0.00 0.98
1788 2131 6.055588 CGTTGAGTTCCCTTGGATGTATAAT 58.944 40.000 0.00 0.00 0.00 1.28
1789 2132 6.017934 CGTTGAGTTCCCTTGGATGTATAATG 60.018 42.308 0.00 0.00 0.00 1.90
1790 2133 5.376625 TGAGTTCCCTTGGATGTATAATGC 58.623 41.667 0.00 0.00 0.00 3.56
1791 2134 5.132648 TGAGTTCCCTTGGATGTATAATGCT 59.867 40.000 0.00 0.00 0.00 3.79
1792 2135 6.328934 TGAGTTCCCTTGGATGTATAATGCTA 59.671 38.462 0.00 0.00 0.00 3.49
1793 2136 6.534634 AGTTCCCTTGGATGTATAATGCTAC 58.465 40.000 0.00 0.00 0.00 3.58
1794 2137 6.330250 AGTTCCCTTGGATGTATAATGCTACT 59.670 38.462 0.00 0.00 0.00 2.57
1795 2138 6.763715 TCCCTTGGATGTATAATGCTACTT 57.236 37.500 0.00 0.00 0.00 2.24
1796 2139 7.149202 TCCCTTGGATGTATAATGCTACTTT 57.851 36.000 0.00 0.00 0.00 2.66
1797 2140 7.582719 TCCCTTGGATGTATAATGCTACTTTT 58.417 34.615 0.00 0.00 0.00 2.27
1798 2141 8.058847 TCCCTTGGATGTATAATGCTACTTTTT 58.941 33.333 0.00 0.00 0.00 1.94
1820 2163 8.688747 TTTTTATTTCAAGGAAATGTGGCAAT 57.311 26.923 13.03 0.00 41.55 3.56
1821 2164 9.784531 TTTTTATTTCAAGGAAATGTGGCAATA 57.215 25.926 13.03 0.00 41.55 1.90
1822 2165 9.784531 TTTTATTTCAAGGAAATGTGGCAATAA 57.215 25.926 13.03 0.00 41.55 1.40
1823 2166 8.770438 TTATTTCAAGGAAATGTGGCAATAAC 57.230 30.769 13.03 0.00 41.55 1.89
1824 2167 6.418057 TTTCAAGGAAATGTGGCAATAACT 57.582 33.333 0.00 0.00 0.00 2.24
1825 2168 6.418057 TTCAAGGAAATGTGGCAATAACTT 57.582 33.333 0.00 0.00 0.00 2.66
1826 2169 6.418057 TCAAGGAAATGTGGCAATAACTTT 57.582 33.333 0.00 0.00 0.00 2.66
1827 2170 6.222389 TCAAGGAAATGTGGCAATAACTTTG 58.778 36.000 0.00 0.00 0.00 2.77
1828 2171 4.568956 AGGAAATGTGGCAATAACTTTGC 58.431 39.130 1.76 1.76 44.22 3.68
1829 2172 4.284234 AGGAAATGTGGCAATAACTTTGCT 59.716 37.500 9.86 0.00 44.36 3.91
1830 2173 4.627035 GGAAATGTGGCAATAACTTTGCTC 59.373 41.667 9.86 5.12 44.36 4.26
1831 2174 4.870123 AATGTGGCAATAACTTTGCTCA 57.130 36.364 9.86 9.70 44.36 4.26
1832 2175 3.641437 TGTGGCAATAACTTTGCTCAC 57.359 42.857 17.42 17.42 44.36 3.51
1833 2176 2.295909 TGTGGCAATAACTTTGCTCACC 59.704 45.455 19.58 4.39 44.36 4.02
1834 2177 2.295909 GTGGCAATAACTTTGCTCACCA 59.704 45.455 9.86 0.00 44.36 4.17
1835 2178 2.961741 TGGCAATAACTTTGCTCACCAA 59.038 40.909 9.86 0.00 44.36 3.67
1836 2179 3.005684 TGGCAATAACTTTGCTCACCAAG 59.994 43.478 9.86 0.00 44.36 3.61
1837 2180 3.578688 GCAATAACTTTGCTCACCAAGG 58.421 45.455 3.18 0.00 41.87 3.61
1838 2181 3.255642 GCAATAACTTTGCTCACCAAGGA 59.744 43.478 3.18 0.00 41.87 3.36
1839 2182 4.798574 CAATAACTTTGCTCACCAAGGAC 58.201 43.478 0.00 0.00 34.82 3.85
1840 2183 1.308998 AACTTTGCTCACCAAGGACG 58.691 50.000 0.00 0.00 34.82 4.79
1841 2184 0.468226 ACTTTGCTCACCAAGGACGA 59.532 50.000 0.00 0.00 34.82 4.20
1842 2185 1.134220 ACTTTGCTCACCAAGGACGAA 60.134 47.619 0.00 0.00 34.82 3.85
1843 2186 2.154462 CTTTGCTCACCAAGGACGAAT 58.846 47.619 0.00 0.00 32.65 3.34
1844 2187 3.244422 ACTTTGCTCACCAAGGACGAATA 60.244 43.478 0.00 0.00 34.82 1.75
1845 2188 3.410631 TTGCTCACCAAGGACGAATAA 57.589 42.857 0.00 0.00 0.00 1.40
1846 2189 3.410631 TGCTCACCAAGGACGAATAAA 57.589 42.857 0.00 0.00 0.00 1.40
1847 2190 3.071479 TGCTCACCAAGGACGAATAAAC 58.929 45.455 0.00 0.00 0.00 2.01
1848 2191 3.071479 GCTCACCAAGGACGAATAAACA 58.929 45.455 0.00 0.00 0.00 2.83
1849 2192 3.125316 GCTCACCAAGGACGAATAAACAG 59.875 47.826 0.00 0.00 0.00 3.16
1850 2193 4.315803 CTCACCAAGGACGAATAAACAGT 58.684 43.478 0.00 0.00 0.00 3.55
1851 2194 4.710324 TCACCAAGGACGAATAAACAGTT 58.290 39.130 0.00 0.00 0.00 3.16
1852 2195 5.127491 TCACCAAGGACGAATAAACAGTTT 58.873 37.500 3.49 3.49 0.00 2.66
1853 2196 5.008217 TCACCAAGGACGAATAAACAGTTTG 59.992 40.000 8.93 0.00 0.00 2.93
1854 2197 4.885325 ACCAAGGACGAATAAACAGTTTGT 59.115 37.500 8.93 0.00 0.00 2.83
1855 2198 5.358725 ACCAAGGACGAATAAACAGTTTGTT 59.641 36.000 8.93 8.28 43.41 2.83
1856 2199 5.912955 CCAAGGACGAATAAACAGTTTGTTC 59.087 40.000 20.28 20.28 40.14 3.18
1857 2200 6.459024 CCAAGGACGAATAAACAGTTTGTTCA 60.459 38.462 26.19 3.04 40.14 3.18
1858 2201 6.056428 AGGACGAATAAACAGTTTGTTCAC 57.944 37.500 26.19 20.32 40.14 3.18
1859 2202 5.820947 AGGACGAATAAACAGTTTGTTCACT 59.179 36.000 26.19 19.68 40.14 3.41
1860 2203 6.987992 AGGACGAATAAACAGTTTGTTCACTA 59.012 34.615 26.19 1.41 40.14 2.74
1861 2204 7.496591 AGGACGAATAAACAGTTTGTTCACTAA 59.503 33.333 26.19 0.75 40.14 2.24
1862 2205 7.797123 GGACGAATAAACAGTTTGTTCACTAAG 59.203 37.037 26.19 16.14 40.14 2.18
1863 2206 7.130269 ACGAATAAACAGTTTGTTCACTAAGC 58.870 34.615 26.19 7.03 40.14 3.09
1864 2207 7.129622 CGAATAAACAGTTTGTTCACTAAGCA 58.870 34.615 26.19 0.00 40.14 3.91
1865 2208 7.642194 CGAATAAACAGTTTGTTCACTAAGCAA 59.358 33.333 26.19 0.00 40.14 3.91
1866 2209 8.856490 AATAAACAGTTTGTTCACTAAGCAAG 57.144 30.769 8.93 0.00 40.14 4.01
1867 2210 4.900635 ACAGTTTGTTCACTAAGCAAGG 57.099 40.909 0.00 0.00 0.00 3.61
1868 2211 4.270008 ACAGTTTGTTCACTAAGCAAGGT 58.730 39.130 0.00 0.00 0.00 3.50
1869 2212 4.705023 ACAGTTTGTTCACTAAGCAAGGTT 59.295 37.500 0.00 0.00 0.00 3.50
1870 2213 5.163652 ACAGTTTGTTCACTAAGCAAGGTTC 60.164 40.000 0.00 0.00 0.00 3.62
1871 2214 4.035208 AGTTTGTTCACTAAGCAAGGTTCG 59.965 41.667 0.00 0.00 0.00 3.95
1872 2215 3.462483 TGTTCACTAAGCAAGGTTCGA 57.538 42.857 0.00 0.00 0.00 3.71
1873 2216 4.002906 TGTTCACTAAGCAAGGTTCGAT 57.997 40.909 0.00 0.00 0.00 3.59
1874 2217 5.142061 TGTTCACTAAGCAAGGTTCGATA 57.858 39.130 0.00 0.00 0.00 2.92
1875 2218 4.927425 TGTTCACTAAGCAAGGTTCGATAC 59.073 41.667 0.00 0.00 0.00 2.24
1876 2219 4.794278 TCACTAAGCAAGGTTCGATACA 57.206 40.909 0.00 0.00 0.00 2.29
1877 2220 5.142061 TCACTAAGCAAGGTTCGATACAA 57.858 39.130 0.00 0.00 0.00 2.41
1878 2221 4.927425 TCACTAAGCAAGGTTCGATACAAC 59.073 41.667 0.00 0.00 0.00 3.32
1879 2222 4.092968 CACTAAGCAAGGTTCGATACAACC 59.907 45.833 0.00 0.00 45.66 3.77
1880 2223 2.109425 AGCAAGGTTCGATACAACCC 57.891 50.000 0.28 0.00 46.39 4.11
1881 2224 1.628846 AGCAAGGTTCGATACAACCCT 59.371 47.619 0.28 0.00 46.39 4.34
1882 2225 2.039879 AGCAAGGTTCGATACAACCCTT 59.960 45.455 0.28 0.00 46.39 3.95
1883 2226 3.262405 AGCAAGGTTCGATACAACCCTTA 59.738 43.478 0.28 0.00 46.39 2.69
1884 2227 3.621715 GCAAGGTTCGATACAACCCTTAG 59.378 47.826 0.28 0.00 46.39 2.18
1885 2228 3.538634 AGGTTCGATACAACCCTTAGC 57.461 47.619 0.28 0.00 46.39 3.09
1886 2229 3.105283 AGGTTCGATACAACCCTTAGCT 58.895 45.455 0.28 0.00 46.39 3.32
1887 2230 3.518303 AGGTTCGATACAACCCTTAGCTT 59.482 43.478 0.00 0.00 46.39 3.74
1888 2231 4.713321 AGGTTCGATACAACCCTTAGCTTA 59.287 41.667 0.00 0.00 46.39 3.09
1889 2232 5.048507 GGTTCGATACAACCCTTAGCTTAG 58.951 45.833 0.00 0.00 40.18 2.18
1890 2233 4.931661 TCGATACAACCCTTAGCTTAGG 57.068 45.455 11.99 11.99 34.92 2.69
1900 2243 4.779993 CCTTAGCTTAGGGGTTCAGAAT 57.220 45.455 11.10 0.00 0.00 2.40
1901 2244 5.888982 CCTTAGCTTAGGGGTTCAGAATA 57.111 43.478 11.10 0.00 0.00 1.75
1902 2245 5.859495 CCTTAGCTTAGGGGTTCAGAATAG 58.141 45.833 11.10 0.00 0.00 1.73
1903 2246 5.602978 CCTTAGCTTAGGGGTTCAGAATAGA 59.397 44.000 11.10 0.00 0.00 1.98
1904 2247 6.099845 CCTTAGCTTAGGGGTTCAGAATAGAA 59.900 42.308 11.10 0.00 0.00 2.10
1905 2248 5.360649 AGCTTAGGGGTTCAGAATAGAAC 57.639 43.478 0.00 0.00 45.50 3.01
1929 2272 9.705290 AACATACCAAAAATCAACTTCATTACC 57.295 29.630 0.00 0.00 0.00 2.85
1930 2273 9.088987 ACATACCAAAAATCAACTTCATTACCT 57.911 29.630 0.00 0.00 0.00 3.08
1931 2274 9.357652 CATACCAAAAATCAACTTCATTACCTG 57.642 33.333 0.00 0.00 0.00 4.00
1932 2275 6.758254 ACCAAAAATCAACTTCATTACCTGG 58.242 36.000 0.00 0.00 0.00 4.45
1933 2276 5.639082 CCAAAAATCAACTTCATTACCTGGC 59.361 40.000 0.00 0.00 0.00 4.85
1934 2277 5.405935 AAAATCAACTTCATTACCTGGCC 57.594 39.130 0.00 0.00 0.00 5.36
1935 2278 2.507407 TCAACTTCATTACCTGGCCC 57.493 50.000 0.00 0.00 0.00 5.80
1936 2279 1.707989 TCAACTTCATTACCTGGCCCA 59.292 47.619 0.00 0.00 0.00 5.36
1937 2280 2.311542 TCAACTTCATTACCTGGCCCAT 59.688 45.455 0.00 0.00 0.00 4.00
1938 2281 3.525609 TCAACTTCATTACCTGGCCCATA 59.474 43.478 0.00 0.00 0.00 2.74
1939 2282 4.017958 TCAACTTCATTACCTGGCCCATAA 60.018 41.667 0.00 0.00 0.00 1.90
1940 2283 4.170468 ACTTCATTACCTGGCCCATAAG 57.830 45.455 0.00 0.00 0.00 1.73
1941 2284 2.656947 TCATTACCTGGCCCATAAGC 57.343 50.000 0.00 0.00 0.00 3.09
1942 2285 1.849692 TCATTACCTGGCCCATAAGCA 59.150 47.619 0.00 0.00 0.00 3.91
1943 2286 2.446666 TCATTACCTGGCCCATAAGCAT 59.553 45.455 0.00 0.00 0.00 3.79
1944 2287 2.656947 TTACCTGGCCCATAAGCATC 57.343 50.000 0.00 0.00 0.00 3.91
1945 2288 1.517238 TACCTGGCCCATAAGCATCA 58.483 50.000 0.00 0.00 0.00 3.07
1946 2289 0.855598 ACCTGGCCCATAAGCATCAT 59.144 50.000 0.00 0.00 0.00 2.45
1947 2290 1.202976 ACCTGGCCCATAAGCATCATC 60.203 52.381 0.00 0.00 0.00 2.92
1948 2291 1.075050 CCTGGCCCATAAGCATCATCT 59.925 52.381 0.00 0.00 0.00 2.90
1949 2292 2.490351 CCTGGCCCATAAGCATCATCTT 60.490 50.000 0.00 0.00 0.00 2.40
1950 2293 2.557056 CTGGCCCATAAGCATCATCTTG 59.443 50.000 0.00 0.00 0.00 3.02
1951 2294 1.891150 GGCCCATAAGCATCATCTTGG 59.109 52.381 0.00 0.00 0.00 3.61
1952 2295 1.271656 GCCCATAAGCATCATCTTGGC 59.728 52.381 0.00 0.00 0.00 4.52
1953 2296 1.891150 CCCATAAGCATCATCTTGGCC 59.109 52.381 0.00 0.00 0.00 5.36
1954 2297 1.891150 CCATAAGCATCATCTTGGCCC 59.109 52.381 0.00 0.00 0.00 5.80
1955 2298 2.589720 CATAAGCATCATCTTGGCCCA 58.410 47.619 0.00 0.00 0.00 5.36
1956 2299 3.162666 CATAAGCATCATCTTGGCCCAT 58.837 45.455 0.00 0.00 0.00 4.00
1957 2300 1.410004 AAGCATCATCTTGGCCCATG 58.590 50.000 0.00 0.00 0.00 3.66
1958 2301 1.113517 AGCATCATCTTGGCCCATGC 61.114 55.000 0.00 4.55 40.20 4.06
1959 2302 1.396607 GCATCATCTTGGCCCATGCA 61.397 55.000 0.00 0.00 39.76 3.96
1960 2303 0.673985 CATCATCTTGGCCCATGCAG 59.326 55.000 0.00 0.00 40.13 4.41
1961 2304 0.260816 ATCATCTTGGCCCATGCAGT 59.739 50.000 0.00 0.00 40.13 4.40
1962 2305 0.681887 TCATCTTGGCCCATGCAGTG 60.682 55.000 0.00 0.00 40.13 3.66
1963 2306 2.056223 ATCTTGGCCCATGCAGTGC 61.056 57.895 8.58 8.58 40.13 4.40
1964 2307 2.509931 ATCTTGGCCCATGCAGTGCT 62.510 55.000 17.60 0.00 40.13 4.40
1965 2308 2.677524 TTGGCCCATGCAGTGCTC 60.678 61.111 17.60 0.31 40.13 4.26
1966 2309 3.510559 TTGGCCCATGCAGTGCTCA 62.511 57.895 17.60 0.00 40.13 4.26
1967 2310 3.446570 GGCCCATGCAGTGCTCAC 61.447 66.667 17.60 1.25 40.13 3.51
1968 2311 2.360852 GCCCATGCAGTGCTCACT 60.361 61.111 17.60 0.00 43.61 3.41
1969 2312 2.404995 GCCCATGCAGTGCTCACTC 61.405 63.158 17.60 0.00 40.20 3.51
1970 2313 1.002990 CCCATGCAGTGCTCACTCA 60.003 57.895 17.60 0.00 40.20 3.41
1971 2314 0.393944 CCCATGCAGTGCTCACTCAT 60.394 55.000 17.60 0.00 40.20 2.90
1972 2315 1.134310 CCCATGCAGTGCTCACTCATA 60.134 52.381 17.60 0.00 40.20 2.15
1973 2316 2.210961 CCATGCAGTGCTCACTCATAG 58.789 52.381 17.60 0.00 40.20 2.23
1974 2317 2.210961 CATGCAGTGCTCACTCATAGG 58.789 52.381 17.60 0.00 40.20 2.57
1975 2318 0.538584 TGCAGTGCTCACTCATAGGG 59.461 55.000 17.60 0.00 40.20 3.53
1976 2319 0.813210 GCAGTGCTCACTCATAGGGC 60.813 60.000 8.18 0.00 40.20 5.19
1977 2320 0.829333 CAGTGCTCACTCATAGGGCT 59.171 55.000 0.00 0.00 40.20 5.19
1978 2321 0.829333 AGTGCTCACTCATAGGGCTG 59.171 55.000 0.00 0.00 36.92 4.85
1979 2322 0.826715 GTGCTCACTCATAGGGCTGA 59.173 55.000 0.00 0.00 0.00 4.26
1980 2323 1.208052 GTGCTCACTCATAGGGCTGAA 59.792 52.381 0.00 0.00 0.00 3.02
1981 2324 1.483827 TGCTCACTCATAGGGCTGAAG 59.516 52.381 0.00 0.00 0.00 3.02
1982 2325 1.809651 GCTCACTCATAGGGCTGAAGC 60.810 57.143 0.00 0.00 41.14 3.86
1983 2326 1.761784 CTCACTCATAGGGCTGAAGCT 59.238 52.381 1.74 0.00 41.70 3.74
1984 2327 2.961741 CTCACTCATAGGGCTGAAGCTA 59.038 50.000 1.74 0.00 41.70 3.32
1985 2328 2.961741 TCACTCATAGGGCTGAAGCTAG 59.038 50.000 1.74 0.00 41.70 3.42
1986 2329 2.961741 CACTCATAGGGCTGAAGCTAGA 59.038 50.000 1.74 0.00 41.70 2.43
1987 2330 3.386078 CACTCATAGGGCTGAAGCTAGAA 59.614 47.826 1.74 0.00 41.70 2.10
1988 2331 4.033709 ACTCATAGGGCTGAAGCTAGAAA 58.966 43.478 1.74 0.00 41.70 2.52
1989 2332 4.471386 ACTCATAGGGCTGAAGCTAGAAAA 59.529 41.667 1.74 0.00 41.70 2.29
1990 2333 5.131809 ACTCATAGGGCTGAAGCTAGAAAAT 59.868 40.000 1.74 0.00 41.70 1.82
1991 2334 5.615289 TCATAGGGCTGAAGCTAGAAAATC 58.385 41.667 1.74 0.00 41.70 2.17
1992 2335 5.130975 TCATAGGGCTGAAGCTAGAAAATCA 59.869 40.000 1.74 0.00 41.70 2.57
1993 2336 3.615155 AGGGCTGAAGCTAGAAAATCAC 58.385 45.455 1.74 0.00 41.70 3.06
1994 2337 3.009473 AGGGCTGAAGCTAGAAAATCACA 59.991 43.478 1.74 0.00 41.70 3.58
1995 2338 3.950395 GGGCTGAAGCTAGAAAATCACAT 59.050 43.478 1.74 0.00 41.70 3.21
1996 2339 4.201990 GGGCTGAAGCTAGAAAATCACATG 60.202 45.833 1.74 0.00 41.70 3.21
1997 2340 4.201990 GGCTGAAGCTAGAAAATCACATGG 60.202 45.833 1.74 0.00 41.70 3.66
1998 2341 4.637534 GCTGAAGCTAGAAAATCACATGGA 59.362 41.667 0.00 0.00 38.21 3.41
1999 2342 5.124457 GCTGAAGCTAGAAAATCACATGGAA 59.876 40.000 0.00 0.00 38.21 3.53
2000 2343 6.349611 GCTGAAGCTAGAAAATCACATGGAAA 60.350 38.462 0.00 0.00 38.21 3.13
2001 2344 6.913170 TGAAGCTAGAAAATCACATGGAAAC 58.087 36.000 0.00 0.00 0.00 2.78
2002 2345 5.551760 AGCTAGAAAATCACATGGAAACG 57.448 39.130 0.00 0.00 0.00 3.60
2003 2346 5.003804 AGCTAGAAAATCACATGGAAACGT 58.996 37.500 0.00 0.00 0.00 3.99
2004 2347 5.473504 AGCTAGAAAATCACATGGAAACGTT 59.526 36.000 0.00 0.00 0.00 3.99
2005 2348 6.016276 AGCTAGAAAATCACATGGAAACGTTT 60.016 34.615 14.57 14.57 0.00 3.60
2006 2349 6.088085 GCTAGAAAATCACATGGAAACGTTTG 59.912 38.462 20.10 7.25 0.00 2.93
2007 2350 6.142818 AGAAAATCACATGGAAACGTTTGA 57.857 33.333 20.10 9.51 40.13 2.69
2008 2351 6.208644 AGAAAATCACATGGAAACGTTTGAG 58.791 36.000 20.10 7.59 39.27 3.02
2009 2352 5.514274 AAATCACATGGAAACGTTTGAGT 57.486 34.783 20.10 5.34 39.27 3.41
2010 2353 5.514274 AATCACATGGAAACGTTTGAGTT 57.486 34.783 20.10 0.00 39.27 3.01
2011 2354 4.285807 TCACATGGAAACGTTTGAGTTG 57.714 40.909 20.10 12.41 31.30 3.16
2012 2355 3.066064 TCACATGGAAACGTTTGAGTTGG 59.934 43.478 20.10 5.45 31.30 3.77
2013 2356 3.066064 CACATGGAAACGTTTGAGTTGGA 59.934 43.478 20.10 0.00 34.14 3.53
2014 2357 3.888930 ACATGGAAACGTTTGAGTTGGAT 59.111 39.130 20.10 0.00 34.14 3.41
2015 2358 4.340950 ACATGGAAACGTTTGAGTTGGATT 59.659 37.500 20.10 0.00 34.14 3.01
2016 2359 4.561735 TGGAAACGTTTGAGTTGGATTC 57.438 40.909 20.10 0.00 34.14 2.52
2022 2365 4.641396 ACGTTTGAGTTGGATTCAGATCA 58.359 39.130 0.00 0.00 33.77 2.92
2024 2367 6.406370 ACGTTTGAGTTGGATTCAGATCATA 58.594 36.000 0.00 0.00 33.77 2.15
2027 2370 7.440556 CGTTTGAGTTGGATTCAGATCATATCT 59.559 37.037 0.00 0.00 41.15 1.98
2033 2376 6.864151 TGGATTCAGATCATATCTACCTGG 57.136 41.667 0.00 0.00 37.58 4.45
2036 2379 7.513781 TGGATTCAGATCATATCTACCTGGAAA 59.486 37.037 0.00 0.00 37.58 3.13
2037 2380 8.547173 GGATTCAGATCATATCTACCTGGAAAT 58.453 37.037 0.00 0.00 37.58 2.17
2038 2381 9.956640 GATTCAGATCATATCTACCTGGAAATT 57.043 33.333 0.00 0.00 37.58 1.82
2056 2400 7.839907 TGGAAATTTGATGATTTACTTCAGGG 58.160 34.615 0.00 0.00 34.86 4.45
2057 2401 6.758416 GGAAATTTGATGATTTACTTCAGGGC 59.242 38.462 0.00 0.00 34.86 5.19
2059 2403 8.593945 AAATTTGATGATTTACTTCAGGGCTA 57.406 30.769 0.00 0.00 34.86 3.93
2068 2412 2.412591 ACTTCAGGGCTACCATATGCT 58.587 47.619 0.00 0.00 40.13 3.79
2070 2414 3.203040 ACTTCAGGGCTACCATATGCTTT 59.797 43.478 0.00 0.00 40.13 3.51
2077 2421 4.515567 GGGCTACCATATGCTTTCTTGTAC 59.484 45.833 0.00 0.00 36.50 2.90
2083 2427 5.192927 CCATATGCTTTCTTGTACCTTGGA 58.807 41.667 0.00 0.00 0.00 3.53
2125 2469 7.281991 CATTTTAAGGAAATGTGCTGCTAAC 57.718 36.000 0.00 0.00 46.16 2.34
2126 2470 6.398234 TTTTAAGGAAATGTGCTGCTAACA 57.602 33.333 0.00 0.00 0.00 2.41
2140 2484 4.093556 GCTGCTAACATTGTTCACTAGGAC 59.906 45.833 5.07 0.00 0.00 3.85
2143 2487 6.631016 TGCTAACATTGTTCACTAGGACTAG 58.369 40.000 5.07 4.86 39.04 2.57
2145 2489 6.127423 GCTAACATTGTTCACTAGGACTAGGA 60.127 42.308 5.07 3.11 37.49 2.94
2147 2491 6.875972 ACATTGTTCACTAGGACTAGGAAT 57.124 37.500 10.81 0.00 37.49 3.01
2148 2492 7.973048 ACATTGTTCACTAGGACTAGGAATA 57.027 36.000 10.81 6.99 37.49 1.75
2149 2493 8.375493 ACATTGTTCACTAGGACTAGGAATAA 57.625 34.615 10.81 13.47 37.49 1.40
2150 2494 8.822805 ACATTGTTCACTAGGACTAGGAATAAA 58.177 33.333 10.81 9.58 37.49 1.40
2151 2495 9.099454 CATTGTTCACTAGGACTAGGAATAAAC 57.901 37.037 10.81 7.58 37.49 2.01
2158 2502 7.064728 CACTAGGACTAGGAATAAACAGTTTGC 59.935 40.741 8.93 0.00 37.49 3.68
2159 2503 6.128138 AGGACTAGGAATAAACAGTTTGCT 57.872 37.500 8.93 0.00 0.00 3.91
2161 2505 7.686434 AGGACTAGGAATAAACAGTTTGCTTA 58.314 34.615 8.93 0.00 0.00 3.09
2163 2507 7.606839 GGACTAGGAATAAACAGTTTGCTTACT 59.393 37.037 8.93 10.17 0.00 2.24
2165 2509 9.350951 ACTAGGAATAAACAGTTTGCTTACTTT 57.649 29.630 8.93 0.00 0.00 2.66
2166 2510 9.612620 CTAGGAATAAACAGTTTGCTTACTTTG 57.387 33.333 8.93 2.56 0.00 2.77
2167 2511 8.007405 AGGAATAAACAGTTTGCTTACTTTGT 57.993 30.769 8.93 0.00 0.00 2.83
2168 2512 9.127277 AGGAATAAACAGTTTGCTTACTTTGTA 57.873 29.630 8.93 0.00 0.00 2.41
2174 2518 8.446599 AACAGTTTGCTTACTTTGTATGTAGT 57.553 30.769 0.00 0.00 0.00 2.73
2176 2520 8.985805 ACAGTTTGCTTACTTTGTATGTAGTAC 58.014 33.333 0.00 0.00 0.00 2.73
2179 2523 8.440833 GTTTGCTTACTTTGTATGTAGTACCAG 58.559 37.037 0.00 0.00 32.03 4.00
2183 2527 7.063074 GCTTACTTTGTATGTAGTACCAGTGTG 59.937 40.741 0.00 0.00 31.61 3.82
2187 2531 8.248945 ACTTTGTATGTAGTACCAGTGTGATAC 58.751 37.037 0.00 0.00 32.03 2.24
2188 2532 6.367686 TGTATGTAGTACCAGTGTGATACG 57.632 41.667 0.00 0.00 32.03 3.06
2189 2533 3.770263 TGTAGTACCAGTGTGATACGC 57.230 47.619 0.00 0.00 0.00 4.42
2190 2534 3.349927 TGTAGTACCAGTGTGATACGCT 58.650 45.455 0.00 0.00 39.99 5.07
2201 2645 6.590234 AGTGTGATACGCTGATGGATATAA 57.410 37.500 0.00 0.00 37.59 0.98
2204 2648 6.868864 GTGTGATACGCTGATGGATATAAACT 59.131 38.462 0.00 0.00 0.00 2.66
2214 2658 9.672673 GCTGATGGATATAAACTATATGGTGTT 57.327 33.333 0.00 0.00 31.74 3.32
2231 2675 5.804639 TGGTGTTTTATAGTGCAGATGTCT 58.195 37.500 0.00 0.00 0.00 3.41
2258 2702 7.362056 GCTGCACAGATTATTACTTTTCTTCCA 60.362 37.037 0.81 0.00 0.00 3.53
2260 2704 7.665559 TGCACAGATTATTACTTTTCTTCCAGT 59.334 33.333 0.00 0.00 0.00 4.00
2271 2715 7.323052 ACTTTTCTTCCAGTTTCCTCTCTAT 57.677 36.000 0.00 0.00 0.00 1.98
2281 2725 9.877222 TCCAGTTTCCTCTCTATACAATATGTA 57.123 33.333 0.00 0.00 37.24 2.29
2303 2747 8.352752 TGTAGTAATATCTTGTTGCTGATTCG 57.647 34.615 0.00 0.00 0.00 3.34
2316 2760 3.557185 TGCTGATTCGCACATTGTCTATC 59.443 43.478 0.00 0.00 34.44 2.08
2318 2762 3.123050 TGATTCGCACATTGTCTATCCG 58.877 45.455 0.00 0.00 0.00 4.18
2320 2764 3.786516 TTCGCACATTGTCTATCCGTA 57.213 42.857 0.00 0.00 0.00 4.02
2321 2765 3.074504 TCGCACATTGTCTATCCGTAC 57.925 47.619 0.00 0.00 0.00 3.67
2323 2767 2.223735 CGCACATTGTCTATCCGTACCT 60.224 50.000 0.00 0.00 0.00 3.08
2324 2768 3.737047 CGCACATTGTCTATCCGTACCTT 60.737 47.826 0.00 0.00 0.00 3.50
2327 2771 5.634020 GCACATTGTCTATCCGTACCTTATC 59.366 44.000 0.00 0.00 0.00 1.75
2328 2772 6.157211 CACATTGTCTATCCGTACCTTATCC 58.843 44.000 0.00 0.00 0.00 2.59
2329 2773 5.836898 ACATTGTCTATCCGTACCTTATCCA 59.163 40.000 0.00 0.00 0.00 3.41
2330 2774 6.325545 ACATTGTCTATCCGTACCTTATCCAA 59.674 38.462 0.00 0.00 0.00 3.53
2331 2775 5.779529 TGTCTATCCGTACCTTATCCAAC 57.220 43.478 0.00 0.00 0.00 3.77
2332 2776 5.452255 TGTCTATCCGTACCTTATCCAACT 58.548 41.667 0.00 0.00 0.00 3.16
2333 2777 5.895534 TGTCTATCCGTACCTTATCCAACTT 59.104 40.000 0.00 0.00 0.00 2.66
2334 2778 7.062322 TGTCTATCCGTACCTTATCCAACTTA 58.938 38.462 0.00 0.00 0.00 2.24
2348 2792 9.449719 CTTATCCAACTTACTTATTCCTGTGTT 57.550 33.333 0.00 0.00 0.00 3.32
2408 2858 9.774413 TTTAGTTAGTTCTTCTAAGTTCCAAGG 57.226 33.333 0.00 0.00 41.11 3.61
2442 2892 1.539388 TGCATCATCCGTGTTTGGAAC 59.461 47.619 0.00 0.00 42.46 3.62
2484 2934 1.805428 GCAAGTGTCCCATTTGCCGT 61.805 55.000 11.92 0.00 46.43 5.68
2589 3039 8.743085 AGATTCAGCACTACAATCACATATTT 57.257 30.769 0.00 0.00 0.00 1.40
2613 3063 3.431725 GCACCACGCAGCCTAACC 61.432 66.667 0.00 0.00 41.79 2.85
2637 3087 4.631813 CAGGTTTATACTCTGTTCTGCCAC 59.368 45.833 0.00 0.00 0.00 5.01
2646 3097 0.179059 TGTTCTGCCACGAAAGCTGA 60.179 50.000 0.00 0.00 36.55 4.26
2774 3225 9.884814 ATATTACTCCCTCTGTACTGAAATAGT 57.115 33.333 3.89 9.07 43.56 2.12
2775 3226 8.611051 ATTACTCCCTCTGTACTGAAATAGTT 57.389 34.615 12.58 0.00 40.89 2.24
2776 3227 6.287589 ACTCCCTCTGTACTGAAATAGTTG 57.712 41.667 3.89 0.00 40.89 3.16
2777 3228 5.780793 ACTCCCTCTGTACTGAAATAGTTGT 59.219 40.000 3.89 0.00 40.89 3.32
2778 3229 6.071278 ACTCCCTCTGTACTGAAATAGTTGTC 60.071 42.308 3.89 0.00 40.89 3.18
2779 3230 5.103000 CCCTCTGTACTGAAATAGTTGTCG 58.897 45.833 3.89 0.00 40.89 4.35
2780 3231 4.563184 CCTCTGTACTGAAATAGTTGTCGC 59.437 45.833 3.89 0.00 40.89 5.19
2781 3232 5.386958 TCTGTACTGAAATAGTTGTCGCT 57.613 39.130 0.00 0.00 40.89 4.93
2782 3233 5.161358 TCTGTACTGAAATAGTTGTCGCTG 58.839 41.667 0.00 0.00 40.89 5.18
2783 3234 4.242475 TGTACTGAAATAGTTGTCGCTGG 58.758 43.478 0.00 0.00 40.89 4.85
2784 3235 3.678056 ACTGAAATAGTTGTCGCTGGA 57.322 42.857 0.00 0.00 35.67 3.86
2785 3236 3.589988 ACTGAAATAGTTGTCGCTGGAG 58.410 45.455 0.00 0.00 35.67 3.86
2786 3237 3.006967 ACTGAAATAGTTGTCGCTGGAGT 59.993 43.478 0.00 0.00 35.67 3.85
2787 3238 4.219944 ACTGAAATAGTTGTCGCTGGAGTA 59.780 41.667 0.00 0.00 35.67 2.59
2788 3239 4.744570 TGAAATAGTTGTCGCTGGAGTAG 58.255 43.478 0.00 0.00 0.00 2.57
2789 3240 8.987253 ACTGAAATAGTTGTCGCTGGAGTAGC 62.987 46.154 0.00 0.00 42.41 3.58
2817 3268 2.873133 GCTACTCCAGCGACAACTAT 57.127 50.000 0.00 0.00 41.37 2.12
2818 3269 3.166489 GCTACTCCAGCGACAACTATT 57.834 47.619 0.00 0.00 41.37 1.73
2819 3270 3.522553 GCTACTCCAGCGACAACTATTT 58.477 45.455 0.00 0.00 41.37 1.40
2820 3271 3.552294 GCTACTCCAGCGACAACTATTTC 59.448 47.826 0.00 0.00 41.37 2.17
2821 3272 2.607187 ACTCCAGCGACAACTATTTCG 58.393 47.619 0.00 0.00 38.31 3.46
2822 3273 1.927174 CTCCAGCGACAACTATTTCGG 59.073 52.381 0.00 0.00 35.73 4.30
2823 3274 1.274167 TCCAGCGACAACTATTTCGGT 59.726 47.619 0.00 0.00 46.29 4.69
2824 3275 2.492881 TCCAGCGACAACTATTTCGGTA 59.507 45.455 0.00 0.00 43.70 4.02
2825 3276 2.601763 CCAGCGACAACTATTTCGGTAC 59.398 50.000 0.00 0.00 43.70 3.34
2826 3277 3.247442 CAGCGACAACTATTTCGGTACA 58.753 45.455 0.00 0.00 43.70 2.90
2827 3278 3.303495 CAGCGACAACTATTTCGGTACAG 59.697 47.826 0.00 0.00 43.70 2.74
2828 3279 3.192001 AGCGACAACTATTTCGGTACAGA 59.808 43.478 0.00 0.00 43.71 3.41
2829 3280 3.546670 GCGACAACTATTTCGGTACAGAG 59.453 47.826 0.00 0.00 35.73 3.35
2830 3281 4.103357 CGACAACTATTTCGGTACAGAGG 58.897 47.826 0.00 0.00 0.00 3.69
2831 3282 4.430908 GACAACTATTTCGGTACAGAGGG 58.569 47.826 0.00 0.00 0.00 4.30
2832 3283 4.091549 ACAACTATTTCGGTACAGAGGGA 58.908 43.478 0.00 0.00 0.00 4.20
2833 3284 4.159879 ACAACTATTTCGGTACAGAGGGAG 59.840 45.833 0.00 0.00 0.00 4.30
2834 3285 3.978610 ACTATTTCGGTACAGAGGGAGT 58.021 45.455 0.00 0.00 0.00 3.85
2835 3286 5.121380 ACTATTTCGGTACAGAGGGAGTA 57.879 43.478 0.00 0.00 0.00 2.59
2836 3287 4.886489 ACTATTTCGGTACAGAGGGAGTAC 59.114 45.833 0.00 0.00 40.78 2.73
2843 3294 4.677250 CGGTACAGAGGGAGTACAATTGAC 60.677 50.000 13.59 6.20 42.73 3.18
2935 3388 3.934068 TCTTGTAGGCTAAAACTTCCCG 58.066 45.455 0.00 0.00 0.00 5.14
2979 3432 7.069986 AGGGAAATAGTTCTAGAGCATCACTA 58.930 38.462 9.43 6.54 33.45 2.74
3020 3473 7.636259 TGAACATTGCAAATTGCTTAGTTAC 57.364 32.000 19.34 12.97 45.31 2.50
3286 3747 5.464389 GGTACGTATGTTGTAGGCCATTAAG 59.536 44.000 5.01 0.00 0.00 1.85
3384 3845 6.303970 CGCTGTTTGTTACTTCATTCATCTTG 59.696 38.462 0.00 0.00 0.00 3.02
3460 3926 1.585214 GTAAATACGAACCTGACGCGG 59.415 52.381 12.47 0.00 0.00 6.46
3474 3940 1.225376 ACGCGGTTGCTGATTCGAAA 61.225 50.000 12.47 0.00 39.65 3.46
3493 3959 5.833667 TCGAAATATGTAGGTGATCCTGAGT 59.166 40.000 0.00 0.00 44.81 3.41
3496 3962 1.866015 TGTAGGTGATCCTGAGTGGG 58.134 55.000 0.00 0.00 44.81 4.61
3529 3995 2.758327 CCGGTCGACATCCTCCCA 60.758 66.667 18.91 0.00 0.00 4.37
3543 4025 1.550976 CCTCCCAGAAAGTAAGCGAGT 59.449 52.381 0.00 0.00 0.00 4.18
3545 4027 3.254892 CTCCCAGAAAGTAAGCGAGTTC 58.745 50.000 0.00 0.00 0.00 3.01
3556 4038 3.923017 AAGCGAGTTCATTTCCCTTTG 57.077 42.857 0.00 0.00 0.00 2.77
3557 4039 2.162681 AGCGAGTTCATTTCCCTTTGG 58.837 47.619 0.00 0.00 0.00 3.28
3570 4052 1.133792 CCCTTTGGAAGTCAGTGGTGT 60.134 52.381 0.00 0.00 0.00 4.16
3581 4063 0.110688 CAGTGGTGTCGTTTGATGCG 60.111 55.000 0.00 0.00 0.00 4.73
3592 4074 2.135139 GTTTGATGCGTCAGTCAGTCA 58.865 47.619 8.93 0.00 35.39 3.41
3594 4076 0.961753 TGATGCGTCAGTCAGTCAGT 59.038 50.000 3.97 0.00 0.00 3.41
3595 4077 1.336240 TGATGCGTCAGTCAGTCAGTG 60.336 52.381 3.97 0.00 0.00 3.66
3596 4078 0.961753 ATGCGTCAGTCAGTCAGTGA 59.038 50.000 0.00 0.00 31.38 3.41
3597 4079 0.744281 TGCGTCAGTCAGTCAGTGAA 59.256 50.000 0.00 0.00 36.13 3.18
3598 4080 1.132588 GCGTCAGTCAGTCAGTGAAC 58.867 55.000 0.00 0.00 36.13 3.18
3599 4081 1.772182 CGTCAGTCAGTCAGTGAACC 58.228 55.000 0.00 0.00 36.13 3.62
3600 4082 1.772182 GTCAGTCAGTCAGTGAACCG 58.228 55.000 0.00 0.00 36.13 4.44
3601 4083 1.337071 GTCAGTCAGTCAGTGAACCGA 59.663 52.381 0.00 0.00 36.13 4.69
3602 4084 1.609072 TCAGTCAGTCAGTGAACCGAG 59.391 52.381 0.00 0.00 36.74 4.63
3603 4085 1.338337 CAGTCAGTCAGTGAACCGAGT 59.662 52.381 0.00 0.00 36.74 4.18
3604 4086 1.338337 AGTCAGTCAGTGAACCGAGTG 59.662 52.381 0.00 0.00 36.74 3.51
3696 4178 0.895530 TGATCGTGTTCCTCCACCTC 59.104 55.000 0.00 0.00 31.47 3.85
3732 4214 2.903357 CTGCTCCTGTACCGCCAT 59.097 61.111 0.00 0.00 0.00 4.40
3747 4229 2.903855 CATGGCGGCCACTGATCC 60.904 66.667 26.48 0.00 35.80 3.36
3841 4323 1.454539 CCGGTGGGAGTTTGAGGTT 59.545 57.895 0.00 0.00 34.06 3.50
3870 4352 8.065473 TCTGTACTGTACGGGAATTAAATGTA 57.935 34.615 22.87 0.60 35.74 2.29
3973 4455 5.174395 ACTTTAGCTCATTGTCAGTGCTAG 58.826 41.667 0.00 0.00 38.72 3.42
3974 4456 4.808414 TTAGCTCATTGTCAGTGCTAGT 57.192 40.909 0.00 0.00 38.72 2.57
3975 4457 3.692257 AGCTCATTGTCAGTGCTAGTT 57.308 42.857 0.00 0.00 34.42 2.24
3976 4458 3.332919 AGCTCATTGTCAGTGCTAGTTG 58.667 45.455 0.00 0.00 34.42 3.16
3977 4459 3.007290 AGCTCATTGTCAGTGCTAGTTGA 59.993 43.478 0.00 0.00 34.42 3.18
3978 4460 3.937706 GCTCATTGTCAGTGCTAGTTGAT 59.062 43.478 0.00 0.00 0.00 2.57
3979 4461 4.394300 GCTCATTGTCAGTGCTAGTTGATT 59.606 41.667 0.00 0.00 0.00 2.57
3980 4462 5.447010 GCTCATTGTCAGTGCTAGTTGATTC 60.447 44.000 0.00 0.00 0.00 2.52
3981 4463 4.627035 TCATTGTCAGTGCTAGTTGATTCG 59.373 41.667 0.00 0.00 0.00 3.34
3982 4464 3.934457 TGTCAGTGCTAGTTGATTCGA 57.066 42.857 0.00 0.00 0.00 3.71
3983 4465 4.456280 TGTCAGTGCTAGTTGATTCGAT 57.544 40.909 0.00 0.00 0.00 3.59
3984 4466 4.424626 TGTCAGTGCTAGTTGATTCGATC 58.575 43.478 0.00 0.00 0.00 3.69
3985 4467 4.082245 TGTCAGTGCTAGTTGATTCGATCA 60.082 41.667 0.00 0.00 37.55 2.92
4038 4520 5.469084 ACAGGAAGTTGTTTATTCTCGTTCC 59.531 40.000 0.00 0.00 33.74 3.62
4046 4528 4.759693 TGTTTATTCTCGTTCCAATGCTGT 59.240 37.500 0.00 0.00 0.00 4.40
4057 4539 5.402398 GTTCCAATGCTGTTTGATACTTCC 58.598 41.667 0.00 0.00 0.00 3.46
4058 4540 4.922206 TCCAATGCTGTTTGATACTTCCT 58.078 39.130 0.00 0.00 0.00 3.36
4059 4541 5.324409 TCCAATGCTGTTTGATACTTCCTT 58.676 37.500 0.00 0.00 0.00 3.36
4060 4542 5.415701 TCCAATGCTGTTTGATACTTCCTTC 59.584 40.000 0.00 0.00 0.00 3.46
4061 4543 5.393461 CCAATGCTGTTTGATACTTCCTTCC 60.393 44.000 0.00 0.00 0.00 3.46
4062 4544 4.640771 TGCTGTTTGATACTTCCTTCCT 57.359 40.909 0.00 0.00 0.00 3.36
4063 4545 4.579869 TGCTGTTTGATACTTCCTTCCTC 58.420 43.478 0.00 0.00 0.00 3.71
4064 4546 3.942115 GCTGTTTGATACTTCCTTCCTCC 59.058 47.826 0.00 0.00 0.00 4.30
4065 4547 4.184629 CTGTTTGATACTTCCTTCCTCCG 58.815 47.826 0.00 0.00 0.00 4.63
4066 4548 3.581332 TGTTTGATACTTCCTTCCTCCGT 59.419 43.478 0.00 0.00 0.00 4.69
4067 4549 4.041198 TGTTTGATACTTCCTTCCTCCGTT 59.959 41.667 0.00 0.00 0.00 4.44
4068 4550 4.467198 TTGATACTTCCTTCCTCCGTTC 57.533 45.455 0.00 0.00 0.00 3.95
4069 4551 2.764572 TGATACTTCCTTCCTCCGTTCC 59.235 50.000 0.00 0.00 0.00 3.62
4070 4552 2.617840 TACTTCCTTCCTCCGTTCCT 57.382 50.000 0.00 0.00 0.00 3.36
4071 4553 2.617840 ACTTCCTTCCTCCGTTCCTA 57.382 50.000 0.00 0.00 0.00 2.94
4072 4554 2.898662 ACTTCCTTCCTCCGTTCCTAA 58.101 47.619 0.00 0.00 0.00 2.69
4073 4555 3.245441 ACTTCCTTCCTCCGTTCCTAAA 58.755 45.455 0.00 0.00 0.00 1.85
4074 4556 3.844804 ACTTCCTTCCTCCGTTCCTAAAT 59.155 43.478 0.00 0.00 0.00 1.40
4075 4557 5.028131 ACTTCCTTCCTCCGTTCCTAAATA 58.972 41.667 0.00 0.00 0.00 1.40
4076 4558 5.666265 ACTTCCTTCCTCCGTTCCTAAATAT 59.334 40.000 0.00 0.00 0.00 1.28
4077 4559 6.842807 ACTTCCTTCCTCCGTTCCTAAATATA 59.157 38.462 0.00 0.00 0.00 0.86
4078 4560 7.346436 ACTTCCTTCCTCCGTTCCTAAATATAA 59.654 37.037 0.00 0.00 0.00 0.98
4079 4561 7.299246 TCCTTCCTCCGTTCCTAAATATAAG 57.701 40.000 0.00 0.00 0.00 1.73
4080 4562 6.842807 TCCTTCCTCCGTTCCTAAATATAAGT 59.157 38.462 0.00 0.00 0.00 2.24
4081 4563 7.015001 TCCTTCCTCCGTTCCTAAATATAAGTC 59.985 40.741 0.00 0.00 0.00 3.01
4082 4564 7.015389 CCTTCCTCCGTTCCTAAATATAAGTCT 59.985 40.741 0.00 0.00 0.00 3.24
4083 4565 7.909485 TCCTCCGTTCCTAAATATAAGTCTT 57.091 36.000 0.00 0.00 0.00 3.01
4084 4566 8.315220 TCCTCCGTTCCTAAATATAAGTCTTT 57.685 34.615 0.00 0.00 0.00 2.52
4085 4567 9.425248 TCCTCCGTTCCTAAATATAAGTCTTTA 57.575 33.333 0.00 0.00 0.00 1.85
4163 4645 9.671279 TTTAGAGCATAGATTCACTCATTTTGA 57.329 29.630 0.00 0.00 0.00 2.69
4164 4646 9.842775 TTAGAGCATAGATTCACTCATTTTGAT 57.157 29.630 0.00 0.00 0.00 2.57
4165 4647 8.749026 AGAGCATAGATTCACTCATTTTGATT 57.251 30.769 0.00 0.00 0.00 2.57
4166 4648 8.838365 AGAGCATAGATTCACTCATTTTGATTC 58.162 33.333 0.00 0.00 0.00 2.52
4167 4649 7.637229 AGCATAGATTCACTCATTTTGATTCG 58.363 34.615 0.00 0.00 31.51 3.34
4168 4650 7.281774 AGCATAGATTCACTCATTTTGATTCGT 59.718 33.333 0.00 0.00 31.51 3.85
4169 4651 8.551205 GCATAGATTCACTCATTTTGATTCGTA 58.449 33.333 0.00 0.00 31.51 3.43
4172 4654 8.498054 AGATTCACTCATTTTGATTCGTATGT 57.502 30.769 0.00 0.00 31.51 2.29
4173 4655 9.599866 AGATTCACTCATTTTGATTCGTATGTA 57.400 29.630 0.00 0.00 31.51 2.29
4174 4656 9.855361 GATTCACTCATTTTGATTCGTATGTAG 57.145 33.333 0.00 0.00 0.00 2.74
4175 4657 8.771920 TTCACTCATTTTGATTCGTATGTAGT 57.228 30.769 0.00 0.00 0.00 2.73
4176 4658 8.407457 TCACTCATTTTGATTCGTATGTAGTC 57.593 34.615 0.00 0.00 0.00 2.59
4177 4659 7.491372 TCACTCATTTTGATTCGTATGTAGTCC 59.509 37.037 0.00 0.00 0.00 3.85
4178 4660 7.277760 CACTCATTTTGATTCGTATGTAGTCCA 59.722 37.037 0.00 0.00 0.00 4.02
4179 4661 7.987458 ACTCATTTTGATTCGTATGTAGTCCAT 59.013 33.333 0.00 0.00 37.58 3.41
4180 4662 9.476202 CTCATTTTGATTCGTATGTAGTCCATA 57.524 33.333 0.00 0.00 34.86 2.74
4181 4663 9.996554 TCATTTTGATTCGTATGTAGTCCATAT 57.003 29.630 0.00 0.00 38.29 1.78
4184 4666 9.825109 TTTTGATTCGTATGTAGTCCATATTGA 57.175 29.630 0.00 0.00 38.29 2.57
4185 4667 9.825109 TTTGATTCGTATGTAGTCCATATTGAA 57.175 29.630 0.00 0.00 38.29 2.69
4186 4668 9.825109 TTGATTCGTATGTAGTCCATATTGAAA 57.175 29.630 0.00 0.00 38.29 2.69
4187 4669 9.476202 TGATTCGTATGTAGTCCATATTGAAAG 57.524 33.333 0.00 0.00 38.29 2.62
4188 4670 9.692749 GATTCGTATGTAGTCCATATTGAAAGA 57.307 33.333 0.00 0.00 38.29 2.52
4189 4671 9.698309 ATTCGTATGTAGTCCATATTGAAAGAG 57.302 33.333 0.00 0.00 38.29 2.85
4190 4672 8.234136 TCGTATGTAGTCCATATTGAAAGAGT 57.766 34.615 0.00 0.00 38.29 3.24
4191 4673 8.135529 TCGTATGTAGTCCATATTGAAAGAGTG 58.864 37.037 0.00 0.00 38.29 3.51
4192 4674 7.096023 CGTATGTAGTCCATATTGAAAGAGTGC 60.096 40.741 0.00 0.00 38.29 4.40
4193 4675 5.109210 TGTAGTCCATATTGAAAGAGTGCG 58.891 41.667 0.00 0.00 0.00 5.34
4194 4676 3.535561 AGTCCATATTGAAAGAGTGCGG 58.464 45.455 0.00 0.00 0.00 5.69
4195 4677 2.032178 GTCCATATTGAAAGAGTGCGGC 59.968 50.000 0.00 0.00 0.00 6.53
4196 4678 1.003545 CCATATTGAAAGAGTGCGGCG 60.004 52.381 0.51 0.51 0.00 6.46
4197 4679 1.665679 CATATTGAAAGAGTGCGGCGT 59.334 47.619 9.37 0.00 0.00 5.68
4198 4680 1.803334 TATTGAAAGAGTGCGGCGTT 58.197 45.000 9.37 0.00 0.00 4.84
4199 4681 0.951558 ATTGAAAGAGTGCGGCGTTT 59.048 45.000 9.37 0.00 0.00 3.60
4200 4682 0.306533 TTGAAAGAGTGCGGCGTTTC 59.693 50.000 9.37 10.73 0.00 2.78
4201 4683 1.154654 GAAAGAGTGCGGCGTTTCG 60.155 57.895 9.37 0.00 0.00 3.46
4202 4684 2.494504 GAAAGAGTGCGGCGTTTCGG 62.495 60.000 9.37 0.00 0.00 4.30
4203 4685 3.802418 AAGAGTGCGGCGTTTCGGT 62.802 57.895 9.37 0.00 0.00 4.69
4204 4686 4.072088 GAGTGCGGCGTTTCGGTG 62.072 66.667 9.37 0.00 0.00 4.94
4211 4693 3.497031 GCGTTTCGGTGCCTAGGC 61.497 66.667 27.71 27.71 42.35 3.93
4212 4694 2.264794 CGTTTCGGTGCCTAGGCT 59.735 61.111 33.07 0.00 42.51 4.58
4213 4695 1.810030 CGTTTCGGTGCCTAGGCTC 60.810 63.158 33.07 28.77 42.51 4.70
4214 4696 1.295423 GTTTCGGTGCCTAGGCTCA 59.705 57.895 33.07 12.84 42.51 4.26
4215 4697 0.107654 GTTTCGGTGCCTAGGCTCAT 60.108 55.000 33.07 0.00 42.51 2.90
4216 4698 0.618458 TTTCGGTGCCTAGGCTCATT 59.382 50.000 33.07 0.00 42.51 2.57
4217 4699 0.618458 TTCGGTGCCTAGGCTCATTT 59.382 50.000 33.07 0.00 42.51 2.32
4218 4700 0.107703 TCGGTGCCTAGGCTCATTTG 60.108 55.000 33.07 19.42 42.51 2.32
4219 4701 1.718757 CGGTGCCTAGGCTCATTTGC 61.719 60.000 33.07 15.63 42.51 3.68
4220 4702 0.680921 GGTGCCTAGGCTCATTTGCA 60.681 55.000 33.07 8.77 42.51 4.08
4221 4703 0.453390 GTGCCTAGGCTCATTTGCAC 59.547 55.000 33.07 17.16 41.75 4.57
4222 4704 0.680921 TGCCTAGGCTCATTTGCACC 60.681 55.000 33.07 1.38 42.51 5.01
4223 4705 1.387295 GCCTAGGCTCATTTGCACCC 61.387 60.000 27.17 0.00 38.26 4.61
4224 4706 0.034186 CCTAGGCTCATTTGCACCCA 60.034 55.000 0.00 0.00 34.04 4.51
4225 4707 1.386533 CTAGGCTCATTTGCACCCAG 58.613 55.000 0.00 0.00 34.04 4.45
4226 4708 0.698238 TAGGCTCATTTGCACCCAGT 59.302 50.000 0.00 0.00 34.04 4.00
4227 4709 0.610232 AGGCTCATTTGCACCCAGTC 60.610 55.000 0.00 0.00 34.04 3.51
4228 4710 0.895100 GGCTCATTTGCACCCAGTCA 60.895 55.000 0.00 0.00 34.04 3.41
4229 4711 0.524862 GCTCATTTGCACCCAGTCAG 59.475 55.000 0.00 0.00 0.00 3.51
4230 4712 1.901591 CTCATTTGCACCCAGTCAGT 58.098 50.000 0.00 0.00 0.00 3.41
4231 4713 2.875672 GCTCATTTGCACCCAGTCAGTA 60.876 50.000 0.00 0.00 0.00 2.74
4232 4714 3.411446 CTCATTTGCACCCAGTCAGTAA 58.589 45.455 0.00 0.00 0.00 2.24
4233 4715 3.820467 CTCATTTGCACCCAGTCAGTAAA 59.180 43.478 0.00 0.00 0.00 2.01
4234 4716 4.211125 TCATTTGCACCCAGTCAGTAAAA 58.789 39.130 0.00 0.00 0.00 1.52
4235 4717 4.646945 TCATTTGCACCCAGTCAGTAAAAA 59.353 37.500 0.00 0.00 0.00 1.94
4301 4783 8.755696 TTTTTGTGTGATAGATAATTTGGTGC 57.244 30.769 0.00 0.00 0.00 5.01
4302 4784 5.733226 TGTGTGATAGATAATTTGGTGCG 57.267 39.130 0.00 0.00 0.00 5.34
4303 4785 5.182487 TGTGTGATAGATAATTTGGTGCGT 58.818 37.500 0.00 0.00 0.00 5.24
4304 4786 5.064579 TGTGTGATAGATAATTTGGTGCGTG 59.935 40.000 0.00 0.00 0.00 5.34
4305 4787 5.064707 GTGTGATAGATAATTTGGTGCGTGT 59.935 40.000 0.00 0.00 0.00 4.49
4306 4788 5.064579 TGTGATAGATAATTTGGTGCGTGTG 59.935 40.000 0.00 0.00 0.00 3.82
4307 4789 4.574421 TGATAGATAATTTGGTGCGTGTGG 59.426 41.667 0.00 0.00 0.00 4.17
4308 4790 2.790433 AGATAATTTGGTGCGTGTGGT 58.210 42.857 0.00 0.00 0.00 4.16
4309 4791 3.153919 AGATAATTTGGTGCGTGTGGTT 58.846 40.909 0.00 0.00 0.00 3.67
4310 4792 3.190535 AGATAATTTGGTGCGTGTGGTTC 59.809 43.478 0.00 0.00 0.00 3.62
4311 4793 0.030101 AATTTGGTGCGTGTGGTTCG 59.970 50.000 0.00 0.00 0.00 3.95
4320 4802 2.399396 CGTGTGGTTCGCTTCAATTT 57.601 45.000 0.00 0.00 0.00 1.82
4321 4803 2.726633 CGTGTGGTTCGCTTCAATTTT 58.273 42.857 0.00 0.00 0.00 1.82
4322 4804 3.879427 CGTGTGGTTCGCTTCAATTTTA 58.121 40.909 0.00 0.00 0.00 1.52
4323 4805 4.283678 CGTGTGGTTCGCTTCAATTTTAA 58.716 39.130 0.00 0.00 0.00 1.52
4324 4806 4.378616 CGTGTGGTTCGCTTCAATTTTAAG 59.621 41.667 0.00 0.00 0.00 1.85
4325 4807 5.516090 GTGTGGTTCGCTTCAATTTTAAGA 58.484 37.500 2.17 0.00 0.00 2.10
4326 4808 6.149633 GTGTGGTTCGCTTCAATTTTAAGAT 58.850 36.000 2.17 0.00 0.00 2.40
4327 4809 6.305638 GTGTGGTTCGCTTCAATTTTAAGATC 59.694 38.462 2.17 0.00 0.00 2.75
4328 4810 6.016693 TGTGGTTCGCTTCAATTTTAAGATCA 60.017 34.615 0.00 0.00 0.00 2.92
4329 4811 7.029563 GTGGTTCGCTTCAATTTTAAGATCAT 58.970 34.615 0.00 0.00 0.00 2.45
4330 4812 7.542130 GTGGTTCGCTTCAATTTTAAGATCATT 59.458 33.333 0.00 0.00 0.00 2.57
4331 4813 8.087750 TGGTTCGCTTCAATTTTAAGATCATTT 58.912 29.630 0.00 0.00 0.00 2.32
4332 4814 8.375465 GGTTCGCTTCAATTTTAAGATCATTTG 58.625 33.333 0.00 0.00 0.00 2.32
4333 4815 9.128107 GTTCGCTTCAATTTTAAGATCATTTGA 57.872 29.630 0.00 0.00 0.00 2.69
4334 4816 9.689976 TTCGCTTCAATTTTAAGATCATTTGAA 57.310 25.926 0.00 0.00 33.47 2.69
4335 4817 9.128107 TCGCTTCAATTTTAAGATCATTTGAAC 57.872 29.630 0.00 0.00 31.78 3.18
4336 4818 8.914654 CGCTTCAATTTTAAGATCATTTGAACA 58.085 29.630 0.00 0.00 31.78 3.18
4339 4821 9.487790 TTCAATTTTAAGATCATTTGAACACCC 57.512 29.630 0.00 0.00 30.52 4.61
4340 4822 8.093927 TCAATTTTAAGATCATTTGAACACCCC 58.906 33.333 0.00 0.00 0.00 4.95
4341 4823 6.985653 TTTTAAGATCATTTGAACACCCCA 57.014 33.333 0.00 0.00 0.00 4.96
4342 4824 6.588719 TTTAAGATCATTTGAACACCCCAG 57.411 37.500 0.00 0.00 0.00 4.45
4343 4825 4.387026 AAGATCATTTGAACACCCCAGA 57.613 40.909 0.00 0.00 0.00 3.86
4344 4826 4.598036 AGATCATTTGAACACCCCAGAT 57.402 40.909 0.00 0.00 0.00 2.90
4345 4827 4.939255 AGATCATTTGAACACCCCAGATT 58.061 39.130 0.00 0.00 0.00 2.40
4346 4828 5.336102 AGATCATTTGAACACCCCAGATTT 58.664 37.500 0.00 0.00 0.00 2.17
4347 4829 4.870123 TCATTTGAACACCCCAGATTTG 57.130 40.909 0.00 0.00 0.00 2.32
4348 4830 4.222336 TCATTTGAACACCCCAGATTTGT 58.778 39.130 0.00 0.00 0.00 2.83
4349 4831 4.280677 TCATTTGAACACCCCAGATTTGTC 59.719 41.667 0.00 0.00 0.00 3.18
4350 4832 3.593442 TTGAACACCCCAGATTTGTCT 57.407 42.857 0.00 0.00 0.00 3.41
4351 4833 3.593442 TGAACACCCCAGATTTGTCTT 57.407 42.857 0.00 0.00 0.00 3.01
4352 4834 3.909732 TGAACACCCCAGATTTGTCTTT 58.090 40.909 0.00 0.00 0.00 2.52
4353 4835 4.285863 TGAACACCCCAGATTTGTCTTTT 58.714 39.130 0.00 0.00 0.00 2.27
4354 4836 4.714308 TGAACACCCCAGATTTGTCTTTTT 59.286 37.500 0.00 0.00 0.00 1.94
4370 4852 2.490328 TTTTTGCCAAGAACTGCTCG 57.510 45.000 0.00 0.00 0.00 5.03
4371 4853 0.667993 TTTTGCCAAGAACTGCTCGG 59.332 50.000 0.00 0.00 0.00 4.63
4372 4854 0.179032 TTTGCCAAGAACTGCTCGGA 60.179 50.000 0.00 0.00 0.00 4.55
4373 4855 0.036732 TTGCCAAGAACTGCTCGGAT 59.963 50.000 0.00 0.00 0.00 4.18
4374 4856 0.674581 TGCCAAGAACTGCTCGGATG 60.675 55.000 0.00 0.00 0.00 3.51
4375 4857 0.674895 GCCAAGAACTGCTCGGATGT 60.675 55.000 0.00 0.00 0.00 3.06
4376 4858 1.363744 CCAAGAACTGCTCGGATGTC 58.636 55.000 0.00 0.00 0.00 3.06
4377 4859 1.363744 CAAGAACTGCTCGGATGTCC 58.636 55.000 0.00 0.00 0.00 4.02
4378 4860 0.976641 AAGAACTGCTCGGATGTCCA 59.023 50.000 0.00 0.00 35.14 4.02
4379 4861 0.976641 AGAACTGCTCGGATGTCCAA 59.023 50.000 0.00 0.00 35.14 3.53
4380 4862 1.347707 AGAACTGCTCGGATGTCCAAA 59.652 47.619 0.00 0.00 35.14 3.28
4381 4863 2.026822 AGAACTGCTCGGATGTCCAAAT 60.027 45.455 0.00 0.00 35.14 2.32
4382 4864 1.742761 ACTGCTCGGATGTCCAAATG 58.257 50.000 0.00 0.00 35.14 2.32
4383 4865 1.278985 ACTGCTCGGATGTCCAAATGA 59.721 47.619 0.00 0.00 35.14 2.57
4384 4866 2.092753 ACTGCTCGGATGTCCAAATGAT 60.093 45.455 0.00 0.00 35.14 2.45
4385 4867 2.947652 CTGCTCGGATGTCCAAATGATT 59.052 45.455 0.00 0.00 35.14 2.57
4386 4868 3.355378 TGCTCGGATGTCCAAATGATTT 58.645 40.909 0.00 0.00 35.14 2.17
4387 4869 3.129113 TGCTCGGATGTCCAAATGATTTG 59.871 43.478 10.84 10.84 40.32 2.32
4388 4870 3.378112 GCTCGGATGTCCAAATGATTTGA 59.622 43.478 18.82 0.00 43.26 2.69
4389 4871 4.142403 GCTCGGATGTCCAAATGATTTGAA 60.142 41.667 18.82 0.00 43.26 2.69
4390 4872 5.622007 GCTCGGATGTCCAAATGATTTGAAA 60.622 40.000 18.82 4.37 43.26 2.69
4391 4873 6.338214 TCGGATGTCCAAATGATTTGAAAA 57.662 33.333 18.82 0.00 43.26 2.29
4392 4874 6.934056 TCGGATGTCCAAATGATTTGAAAAT 58.066 32.000 18.82 0.00 43.26 1.82
4393 4875 7.385267 TCGGATGTCCAAATGATTTGAAAATT 58.615 30.769 18.82 0.50 43.26 1.82
4394 4876 7.331440 TCGGATGTCCAAATGATTTGAAAATTG 59.669 33.333 18.82 1.75 43.26 2.32
4395 4877 7.413219 CGGATGTCCAAATGATTTGAAAATTGG 60.413 37.037 18.82 1.54 43.26 3.16
4396 4878 7.607223 GGATGTCCAAATGATTTGAAAATTGGA 59.393 33.333 18.82 4.03 43.26 3.53
4397 4879 7.966246 TGTCCAAATGATTTGAAAATTGGAG 57.034 32.000 18.82 0.00 43.26 3.86
4398 4880 6.427547 TGTCCAAATGATTTGAAAATTGGAGC 59.572 34.615 18.82 11.06 43.26 4.70
4399 4881 5.638657 TCCAAATGATTTGAAAATTGGAGCG 59.361 36.000 18.82 0.00 43.26 5.03
4400 4882 5.638657 CCAAATGATTTGAAAATTGGAGCGA 59.361 36.000 18.82 0.00 43.26 4.93
4401 4883 6.147492 CCAAATGATTTGAAAATTGGAGCGAA 59.853 34.615 18.82 0.00 43.26 4.70
4402 4884 6.710692 AATGATTTGAAAATTGGAGCGAAC 57.289 33.333 0.00 0.00 0.00 3.95
4403 4885 4.555262 TGATTTGAAAATTGGAGCGAACC 58.445 39.130 0.00 0.00 0.00 3.62
4404 4886 4.280677 TGATTTGAAAATTGGAGCGAACCT 59.719 37.500 0.00 0.00 0.00 3.50
4405 4887 3.915437 TTGAAAATTGGAGCGAACCTC 57.085 42.857 0.00 0.00 39.98 3.85
4406 4888 2.857483 TGAAAATTGGAGCGAACCTCA 58.143 42.857 0.00 0.00 42.62 3.86
4407 4889 3.420893 TGAAAATTGGAGCGAACCTCAT 58.579 40.909 0.00 0.00 42.62 2.90
4408 4890 3.191162 TGAAAATTGGAGCGAACCTCATG 59.809 43.478 0.00 0.00 42.62 3.07
4409 4891 1.098050 AATTGGAGCGAACCTCATGC 58.902 50.000 0.00 0.00 42.62 4.06
4410 4892 0.035152 ATTGGAGCGAACCTCATGCA 60.035 50.000 0.00 0.00 42.62 3.96
4411 4893 0.035152 TTGGAGCGAACCTCATGCAT 60.035 50.000 0.00 0.00 42.62 3.96
4412 4894 0.462581 TGGAGCGAACCTCATGCATC 60.463 55.000 0.00 0.00 42.62 3.91
4413 4895 0.462581 GGAGCGAACCTCATGCATCA 60.463 55.000 0.00 0.00 42.62 3.07
4414 4896 1.372582 GAGCGAACCTCATGCATCAA 58.627 50.000 0.00 0.00 40.45 2.57
4415 4897 1.739466 GAGCGAACCTCATGCATCAAA 59.261 47.619 0.00 0.00 40.45 2.69
4416 4898 2.161855 AGCGAACCTCATGCATCAAAA 58.838 42.857 0.00 0.00 0.00 2.44
4417 4899 2.756760 AGCGAACCTCATGCATCAAAAT 59.243 40.909 0.00 0.00 0.00 1.82
4418 4900 3.947196 AGCGAACCTCATGCATCAAAATA 59.053 39.130 0.00 0.00 0.00 1.40
4419 4901 4.581824 AGCGAACCTCATGCATCAAAATAT 59.418 37.500 0.00 0.00 0.00 1.28
4420 4902 4.913924 GCGAACCTCATGCATCAAAATATC 59.086 41.667 0.00 0.00 0.00 1.63
4421 4903 5.278169 GCGAACCTCATGCATCAAAATATCT 60.278 40.000 0.00 0.00 0.00 1.98
4422 4904 6.073058 GCGAACCTCATGCATCAAAATATCTA 60.073 38.462 0.00 0.00 0.00 1.98
4423 4905 7.361542 GCGAACCTCATGCATCAAAATATCTAT 60.362 37.037 0.00 0.00 0.00 1.98
4424 4906 8.173775 CGAACCTCATGCATCAAAATATCTATC 58.826 37.037 0.00 0.00 0.00 2.08
4425 4907 8.929260 AACCTCATGCATCAAAATATCTATCA 57.071 30.769 0.00 0.00 0.00 2.15
4426 4908 8.332996 ACCTCATGCATCAAAATATCTATCAC 57.667 34.615 0.00 0.00 0.00 3.06
4427 4909 7.940688 ACCTCATGCATCAAAATATCTATCACA 59.059 33.333 0.00 0.00 0.00 3.58
4428 4910 8.235226 CCTCATGCATCAAAATATCTATCACAC 58.765 37.037 0.00 0.00 0.00 3.82
4429 4911 8.680039 TCATGCATCAAAATATCTATCACACA 57.320 30.769 0.00 0.00 0.00 3.72
4430 4912 9.122779 TCATGCATCAAAATATCTATCACACAA 57.877 29.630 0.00 0.00 0.00 3.33
4431 4913 9.738832 CATGCATCAAAATATCTATCACACAAA 57.261 29.630 0.00 0.00 0.00 2.83
4485 4967 9.119329 TGTATTTGTTTTGATTTTATTCGTCGG 57.881 29.630 0.00 0.00 0.00 4.79
4486 4968 6.994868 TTTGTTTTGATTTTATTCGTCGGG 57.005 33.333 0.00 0.00 0.00 5.14
4487 4969 5.049398 TGTTTTGATTTTATTCGTCGGGG 57.951 39.130 0.00 0.00 0.00 5.73
4488 4970 4.519730 TGTTTTGATTTTATTCGTCGGGGT 59.480 37.500 0.00 0.00 0.00 4.95
4489 4971 4.688511 TTTGATTTTATTCGTCGGGGTG 57.311 40.909 0.00 0.00 0.00 4.61
4490 4972 2.634600 TGATTTTATTCGTCGGGGTGG 58.365 47.619 0.00 0.00 0.00 4.61
4491 4973 2.027007 TGATTTTATTCGTCGGGGTGGT 60.027 45.455 0.00 0.00 0.00 4.16
4492 4974 1.810959 TTTTATTCGTCGGGGTGGTG 58.189 50.000 0.00 0.00 0.00 4.17
4493 4975 0.674269 TTTATTCGTCGGGGTGGTGC 60.674 55.000 0.00 0.00 0.00 5.01
4494 4976 1.828461 TTATTCGTCGGGGTGGTGCA 61.828 55.000 0.00 0.00 0.00 4.57
4495 4977 2.233605 TATTCGTCGGGGTGGTGCAG 62.234 60.000 0.00 0.00 0.00 4.41
4503 4985 4.341783 GGTGGTGCAGCTGAGCCT 62.342 66.667 20.43 0.00 0.00 4.58
4504 4986 2.665000 GTGGTGCAGCTGAGCCTA 59.335 61.111 20.43 6.48 0.00 3.93
4505 4987 1.449246 GTGGTGCAGCTGAGCCTAG 60.449 63.158 20.43 0.00 0.00 3.02
4506 4988 2.188994 GGTGCAGCTGAGCCTAGG 59.811 66.667 20.43 3.67 0.00 3.02
4507 4989 2.513435 GTGCAGCTGAGCCTAGGC 60.513 66.667 27.19 27.19 42.33 3.93
4519 5001 2.947127 GCCTAGGCTCAGAAATGGAT 57.053 50.000 27.17 0.00 38.26 3.41
4520 5002 3.220674 GCCTAGGCTCAGAAATGGATT 57.779 47.619 27.17 0.00 38.26 3.01
4521 5003 4.357918 GCCTAGGCTCAGAAATGGATTA 57.642 45.455 27.17 0.00 38.26 1.75
4522 5004 4.068599 GCCTAGGCTCAGAAATGGATTAC 58.931 47.826 27.17 0.00 38.26 1.89
4523 5005 4.646572 CCTAGGCTCAGAAATGGATTACC 58.353 47.826 0.00 0.00 0.00 2.85
4524 5006 3.199880 AGGCTCAGAAATGGATTACCG 57.800 47.619 0.00 0.00 39.42 4.02
4525 5007 2.771943 AGGCTCAGAAATGGATTACCGA 59.228 45.455 0.00 0.00 39.42 4.69
4526 5008 3.392616 AGGCTCAGAAATGGATTACCGAT 59.607 43.478 0.00 0.00 39.42 4.18
4527 5009 4.593206 AGGCTCAGAAATGGATTACCGATA 59.407 41.667 0.00 0.00 39.42 2.92
4528 5010 5.249393 AGGCTCAGAAATGGATTACCGATAT 59.751 40.000 0.00 0.00 39.42 1.63
4529 5011 5.940470 GGCTCAGAAATGGATTACCGATATT 59.060 40.000 0.00 0.00 39.42 1.28
4530 5012 6.128172 GGCTCAGAAATGGATTACCGATATTG 60.128 42.308 0.00 0.00 39.42 1.90
4531 5013 6.650807 GCTCAGAAATGGATTACCGATATTGA 59.349 38.462 0.00 0.00 39.42 2.57
4532 5014 7.173218 GCTCAGAAATGGATTACCGATATTGAA 59.827 37.037 0.00 0.00 39.42 2.69
4533 5015 8.972458 TCAGAAATGGATTACCGATATTGAAA 57.028 30.769 0.00 0.00 39.42 2.69
4534 5016 9.573166 TCAGAAATGGATTACCGATATTGAAAT 57.427 29.630 0.00 0.00 39.42 2.17
4561 5043 7.136119 TCTAAAAACACTTGCATTTAGGAACG 58.864 34.615 12.84 0.00 36.48 3.95
4562 5044 5.508200 AAAACACTTGCATTTAGGAACGA 57.492 34.783 0.00 0.00 0.00 3.85
4563 5045 5.508200 AAACACTTGCATTTAGGAACGAA 57.492 34.783 0.00 0.00 0.00 3.85
4564 5046 4.749245 ACACTTGCATTTAGGAACGAAG 57.251 40.909 0.00 0.00 0.00 3.79
4565 5047 3.502211 ACACTTGCATTTAGGAACGAAGG 59.498 43.478 0.00 0.00 0.00 3.46
4566 5048 3.081804 ACTTGCATTTAGGAACGAAGGG 58.918 45.455 0.00 0.00 0.00 3.95
4567 5049 3.244770 ACTTGCATTTAGGAACGAAGGGA 60.245 43.478 0.00 0.00 0.00 4.20
4568 5050 2.985896 TGCATTTAGGAACGAAGGGAG 58.014 47.619 0.00 0.00 0.00 4.30
4569 5051 2.304761 TGCATTTAGGAACGAAGGGAGT 59.695 45.455 0.00 0.00 0.00 3.85
4570 5052 3.516300 TGCATTTAGGAACGAAGGGAGTA 59.484 43.478 0.00 0.00 0.00 2.59
4571 5053 3.869832 GCATTTAGGAACGAAGGGAGTAC 59.130 47.826 0.00 0.00 0.00 2.73
4572 5054 4.382793 GCATTTAGGAACGAAGGGAGTACT 60.383 45.833 0.00 0.00 0.00 2.73
4573 5055 5.163478 GCATTTAGGAACGAAGGGAGTACTA 60.163 44.000 0.00 0.00 0.00 1.82
4574 5056 5.904362 TTTAGGAACGAAGGGAGTACTAC 57.096 43.478 0.00 0.00 0.00 2.73
4575 5057 2.732763 AGGAACGAAGGGAGTACTACC 58.267 52.381 17.30 17.30 0.00 3.18
4576 5058 2.042162 AGGAACGAAGGGAGTACTACCA 59.958 50.000 26.49 0.00 35.45 3.25
4577 5059 2.165234 GGAACGAAGGGAGTACTACCAC 59.835 54.545 26.49 17.46 35.45 4.16
4578 5060 2.592102 ACGAAGGGAGTACTACCACA 57.408 50.000 26.49 0.00 35.45 4.17
4579 5061 3.097342 ACGAAGGGAGTACTACCACAT 57.903 47.619 26.49 11.73 35.45 3.21
4580 5062 3.022406 ACGAAGGGAGTACTACCACATC 58.978 50.000 26.49 18.42 35.45 3.06
4581 5063 3.021695 CGAAGGGAGTACTACCACATCA 58.978 50.000 26.49 0.00 35.45 3.07
4582 5064 3.066900 CGAAGGGAGTACTACCACATCAG 59.933 52.174 26.49 12.59 35.45 2.90
4583 5065 4.279145 GAAGGGAGTACTACCACATCAGA 58.721 47.826 26.49 0.00 35.45 3.27
4584 5066 3.633418 AGGGAGTACTACCACATCAGAC 58.367 50.000 26.49 0.00 35.45 3.51
4585 5067 2.694109 GGGAGTACTACCACATCAGACC 59.306 54.545 20.12 0.00 32.35 3.85
4586 5068 2.694109 GGAGTACTACCACATCAGACCC 59.306 54.545 0.00 0.00 0.00 4.46
4587 5069 3.627747 GGAGTACTACCACATCAGACCCT 60.628 52.174 0.00 0.00 0.00 4.34
4588 5070 4.386088 GGAGTACTACCACATCAGACCCTA 60.386 50.000 0.00 0.00 0.00 3.53
4589 5071 4.534797 AGTACTACCACATCAGACCCTAC 58.465 47.826 0.00 0.00 0.00 3.18
4590 5072 3.759815 ACTACCACATCAGACCCTACT 57.240 47.619 0.00 0.00 0.00 2.57
4591 5073 4.875578 ACTACCACATCAGACCCTACTA 57.124 45.455 0.00 0.00 0.00 1.82
4592 5074 5.405063 ACTACCACATCAGACCCTACTAT 57.595 43.478 0.00 0.00 0.00 2.12
4593 5075 5.386924 ACTACCACATCAGACCCTACTATC 58.613 45.833 0.00 0.00 0.00 2.08
4594 5076 3.577919 ACCACATCAGACCCTACTATCC 58.422 50.000 0.00 0.00 0.00 2.59
4595 5077 3.207777 ACCACATCAGACCCTACTATCCT 59.792 47.826 0.00 0.00 0.00 3.24
4596 5078 4.227197 CCACATCAGACCCTACTATCCTT 58.773 47.826 0.00 0.00 0.00 3.36
4597 5079 4.282195 CCACATCAGACCCTACTATCCTTC 59.718 50.000 0.00 0.00 0.00 3.46
4598 5080 4.282195 CACATCAGACCCTACTATCCTTCC 59.718 50.000 0.00 0.00 0.00 3.46
4599 5081 4.171044 ACATCAGACCCTACTATCCTTCCT 59.829 45.833 0.00 0.00 0.00 3.36
4600 5082 4.186077 TCAGACCCTACTATCCTTCCTG 57.814 50.000 0.00 0.00 0.00 3.86
4601 5083 3.532232 TCAGACCCTACTATCCTTCCTGT 59.468 47.826 0.00 0.00 0.00 4.00
4602 5084 4.016479 TCAGACCCTACTATCCTTCCTGTT 60.016 45.833 0.00 0.00 0.00 3.16
4603 5085 4.717280 CAGACCCTACTATCCTTCCTGTTT 59.283 45.833 0.00 0.00 0.00 2.83
4604 5086 4.963628 AGACCCTACTATCCTTCCTGTTTC 59.036 45.833 0.00 0.00 0.00 2.78
4605 5087 4.038633 ACCCTACTATCCTTCCTGTTTCC 58.961 47.826 0.00 0.00 0.00 3.13
4606 5088 4.265353 ACCCTACTATCCTTCCTGTTTCCT 60.265 45.833 0.00 0.00 0.00 3.36
4607 5089 4.101741 CCCTACTATCCTTCCTGTTTCCTG 59.898 50.000 0.00 0.00 0.00 3.86
4608 5090 4.717280 CCTACTATCCTTCCTGTTTCCTGT 59.283 45.833 0.00 0.00 0.00 4.00
4609 5091 4.559862 ACTATCCTTCCTGTTTCCTGTG 57.440 45.455 0.00 0.00 0.00 3.66
4610 5092 2.887151 ATCCTTCCTGTTTCCTGTGG 57.113 50.000 0.00 0.00 0.00 4.17
4611 5093 1.814429 TCCTTCCTGTTTCCTGTGGA 58.186 50.000 0.00 0.00 0.00 4.02
4612 5094 2.131854 TCCTTCCTGTTTCCTGTGGAA 58.868 47.619 0.00 0.00 40.27 3.53
4613 5095 2.716424 TCCTTCCTGTTTCCTGTGGAAT 59.284 45.455 0.00 0.00 41.71 3.01
4614 5096 3.140144 TCCTTCCTGTTTCCTGTGGAATT 59.860 43.478 0.00 0.00 41.71 2.17
4615 5097 4.352595 TCCTTCCTGTTTCCTGTGGAATTA 59.647 41.667 0.00 0.00 41.71 1.40
4616 5098 4.702131 CCTTCCTGTTTCCTGTGGAATTAG 59.298 45.833 0.00 2.50 41.71 1.73
4617 5099 4.993705 TCCTGTTTCCTGTGGAATTAGT 57.006 40.909 0.00 0.00 41.71 2.24
4618 5100 4.651778 TCCTGTTTCCTGTGGAATTAGTG 58.348 43.478 0.00 0.00 41.71 2.74
4619 5101 3.758554 CCTGTTTCCTGTGGAATTAGTGG 59.241 47.826 0.00 0.00 41.71 4.00
4620 5102 3.758554 CTGTTTCCTGTGGAATTAGTGGG 59.241 47.826 0.00 0.00 41.71 4.61
4621 5103 3.089284 GTTTCCTGTGGAATTAGTGGGG 58.911 50.000 0.00 0.00 41.71 4.96
4622 5104 2.053747 TCCTGTGGAATTAGTGGGGT 57.946 50.000 0.00 0.00 0.00 4.95
4623 5105 1.633432 TCCTGTGGAATTAGTGGGGTG 59.367 52.381 0.00 0.00 0.00 4.61
4624 5106 1.340991 CCTGTGGAATTAGTGGGGTGG 60.341 57.143 0.00 0.00 0.00 4.61
4625 5107 1.354368 CTGTGGAATTAGTGGGGTGGT 59.646 52.381 0.00 0.00 0.00 4.16
4626 5108 1.783979 TGTGGAATTAGTGGGGTGGTT 59.216 47.619 0.00 0.00 0.00 3.67
4627 5109 2.178106 TGTGGAATTAGTGGGGTGGTTT 59.822 45.455 0.00 0.00 0.00 3.27
4628 5110 3.236047 GTGGAATTAGTGGGGTGGTTTT 58.764 45.455 0.00 0.00 0.00 2.43
4629 5111 3.644265 GTGGAATTAGTGGGGTGGTTTTT 59.356 43.478 0.00 0.00 0.00 1.94
4645 5127 0.306533 TTTTTCGAGCACCGTTGAGC 59.693 50.000 0.00 0.00 39.75 4.26
4646 5128 0.812014 TTTTCGAGCACCGTTGAGCA 60.812 50.000 0.00 0.00 39.75 4.26
4647 5129 0.812014 TTTCGAGCACCGTTGAGCAA 60.812 50.000 0.00 0.00 39.75 3.91
4648 5130 0.812014 TTCGAGCACCGTTGAGCAAA 60.812 50.000 0.00 0.00 39.75 3.68
4649 5131 0.602638 TCGAGCACCGTTGAGCAAAT 60.603 50.000 0.00 0.00 39.75 2.32
4650 5132 0.453282 CGAGCACCGTTGAGCAAATG 60.453 55.000 0.00 0.00 0.00 2.32
4651 5133 0.730494 GAGCACCGTTGAGCAAATGC 60.730 55.000 0.00 0.00 42.49 3.56
4664 5146 3.900388 GCAAATGCTGGCAAAAATTCA 57.100 38.095 0.00 0.00 38.21 2.57
4665 5147 4.226113 GCAAATGCTGGCAAAAATTCAA 57.774 36.364 0.00 0.00 38.21 2.69
4666 5148 3.976306 GCAAATGCTGGCAAAAATTCAAC 59.024 39.130 0.00 0.00 38.21 3.18
4667 5149 4.497674 GCAAATGCTGGCAAAAATTCAACA 60.498 37.500 0.00 0.00 38.21 3.33
4668 5150 5.764131 CAAATGCTGGCAAAAATTCAACAT 58.236 33.333 0.00 0.00 0.00 2.71
4669 5151 5.616488 AATGCTGGCAAAAATTCAACATC 57.384 34.783 0.00 0.00 0.00 3.06
4670 5152 4.339872 TGCTGGCAAAAATTCAACATCT 57.660 36.364 0.00 0.00 0.00 2.90
4671 5153 5.465532 TGCTGGCAAAAATTCAACATCTA 57.534 34.783 0.00 0.00 0.00 1.98
4672 5154 5.851720 TGCTGGCAAAAATTCAACATCTAA 58.148 33.333 0.00 0.00 0.00 2.10
4673 5155 5.927689 TGCTGGCAAAAATTCAACATCTAAG 59.072 36.000 0.00 0.00 0.00 2.18
4674 5156 5.349543 GCTGGCAAAAATTCAACATCTAAGG 59.650 40.000 0.00 0.00 0.00 2.69
4675 5157 5.792741 TGGCAAAAATTCAACATCTAAGGG 58.207 37.500 0.00 0.00 0.00 3.95
4676 5158 4.631377 GGCAAAAATTCAACATCTAAGGGC 59.369 41.667 0.00 0.00 0.00 5.19
4677 5159 5.237048 GCAAAAATTCAACATCTAAGGGCA 58.763 37.500 0.00 0.00 0.00 5.36
4678 5160 5.876460 GCAAAAATTCAACATCTAAGGGCAT 59.124 36.000 0.00 0.00 0.00 4.40
4679 5161 6.183360 GCAAAAATTCAACATCTAAGGGCATG 60.183 38.462 0.00 0.00 0.00 4.06
4680 5162 6.610075 AAAATTCAACATCTAAGGGCATGT 57.390 33.333 0.00 0.00 34.58 3.21
4681 5163 7.716799 AAAATTCAACATCTAAGGGCATGTA 57.283 32.000 0.00 0.00 32.74 2.29
4682 5164 6.699575 AATTCAACATCTAAGGGCATGTAC 57.300 37.500 0.00 0.00 32.74 2.90
4683 5165 4.835284 TCAACATCTAAGGGCATGTACA 57.165 40.909 0.00 0.00 32.74 2.90
4684 5166 5.172687 TCAACATCTAAGGGCATGTACAA 57.827 39.130 0.00 0.00 32.74 2.41
4685 5167 5.754782 TCAACATCTAAGGGCATGTACAAT 58.245 37.500 0.00 0.00 32.74 2.71
4686 5168 5.589855 TCAACATCTAAGGGCATGTACAATG 59.410 40.000 0.00 0.00 32.74 2.82
4687 5169 4.464008 ACATCTAAGGGCATGTACAATGG 58.536 43.478 0.00 0.00 31.20 3.16
4688 5170 4.079787 ACATCTAAGGGCATGTACAATGGT 60.080 41.667 0.00 0.00 31.20 3.55
4689 5171 4.584638 TCTAAGGGCATGTACAATGGTT 57.415 40.909 0.00 0.00 0.00 3.67
4690 5172 4.269183 TCTAAGGGCATGTACAATGGTTG 58.731 43.478 0.00 0.00 0.00 3.77
4692 5174 3.730215 AGGGCATGTACAATGGTTGTA 57.270 42.857 0.00 0.00 43.27 2.41
4693 5175 4.040936 AGGGCATGTACAATGGTTGTAA 57.959 40.909 0.00 0.00 46.72 2.41
4694 5176 4.016444 AGGGCATGTACAATGGTTGTAAG 58.984 43.478 0.00 0.58 46.72 2.34
4695 5177 4.013728 GGGCATGTACAATGGTTGTAAGA 58.986 43.478 0.00 0.00 46.72 2.10
4696 5178 4.644685 GGGCATGTACAATGGTTGTAAGAT 59.355 41.667 0.00 0.00 46.72 2.40
4697 5179 5.825679 GGGCATGTACAATGGTTGTAAGATA 59.174 40.000 0.00 0.00 46.72 1.98
4698 5180 6.017109 GGGCATGTACAATGGTTGTAAGATAG 60.017 42.308 0.00 0.00 46.72 2.08
4699 5181 6.542370 GGCATGTACAATGGTTGTAAGATAGT 59.458 38.462 0.00 0.00 46.72 2.12
4700 5182 7.067008 GGCATGTACAATGGTTGTAAGATAGTT 59.933 37.037 0.00 0.00 46.72 2.24
4701 5183 8.458843 GCATGTACAATGGTTGTAAGATAGTTT 58.541 33.333 0.00 0.00 46.72 2.66
4734 5216 8.430801 AGTCTTGCATGTAATTTAGAGATGAC 57.569 34.615 0.00 0.00 0.00 3.06
4735 5217 8.043113 AGTCTTGCATGTAATTTAGAGATGACA 58.957 33.333 0.00 0.00 0.00 3.58
4736 5218 8.668353 GTCTTGCATGTAATTTAGAGATGACAA 58.332 33.333 0.00 0.00 0.00 3.18
4737 5219 9.230122 TCTTGCATGTAATTTAGAGATGACAAA 57.770 29.630 0.00 0.00 0.00 2.83
4738 5220 9.844790 CTTGCATGTAATTTAGAGATGACAAAA 57.155 29.630 0.00 0.00 0.00 2.44
4759 5241 4.345859 AAAAGACGTCTACAATGGGTCA 57.654 40.909 20.39 0.00 0.00 4.02
4760 5242 4.553330 AAAGACGTCTACAATGGGTCAT 57.447 40.909 20.39 0.00 0.00 3.06
4761 5243 3.526931 AGACGTCTACAATGGGTCATG 57.473 47.619 18.46 0.00 0.00 3.07
4762 5244 1.933853 GACGTCTACAATGGGTCATGC 59.066 52.381 8.70 0.00 0.00 4.06
4763 5245 1.299541 CGTCTACAATGGGTCATGCC 58.700 55.000 0.00 0.00 0.00 4.40
4764 5246 1.134401 CGTCTACAATGGGTCATGCCT 60.134 52.381 6.20 0.00 37.43 4.75
4765 5247 2.680805 CGTCTACAATGGGTCATGCCTT 60.681 50.000 6.20 0.00 37.43 4.35
4766 5248 3.431626 CGTCTACAATGGGTCATGCCTTA 60.432 47.826 6.20 0.00 37.43 2.69
4767 5249 4.130118 GTCTACAATGGGTCATGCCTTAG 58.870 47.826 6.20 1.80 37.43 2.18
4768 5250 3.780294 TCTACAATGGGTCATGCCTTAGT 59.220 43.478 6.20 3.87 37.43 2.24
4769 5251 3.004752 ACAATGGGTCATGCCTTAGTC 57.995 47.619 6.20 0.00 37.43 2.59
4770 5252 2.578021 ACAATGGGTCATGCCTTAGTCT 59.422 45.455 6.20 0.00 37.43 3.24
4771 5253 3.010584 ACAATGGGTCATGCCTTAGTCTT 59.989 43.478 6.20 0.00 37.43 3.01
4772 5254 4.227300 ACAATGGGTCATGCCTTAGTCTTA 59.773 41.667 6.20 0.00 37.43 2.10
4773 5255 5.103940 ACAATGGGTCATGCCTTAGTCTTAT 60.104 40.000 6.20 0.00 37.43 1.73
4774 5256 4.689612 TGGGTCATGCCTTAGTCTTATC 57.310 45.455 6.20 0.00 37.43 1.75
4775 5257 4.298626 TGGGTCATGCCTTAGTCTTATCT 58.701 43.478 6.20 0.00 37.43 1.98
4776 5258 4.721776 TGGGTCATGCCTTAGTCTTATCTT 59.278 41.667 6.20 0.00 37.43 2.40
4777 5259 5.163301 TGGGTCATGCCTTAGTCTTATCTTC 60.163 44.000 6.20 0.00 37.43 2.87
4778 5260 5.163301 GGGTCATGCCTTAGTCTTATCTTCA 60.163 44.000 6.20 0.00 37.43 3.02
4779 5261 6.349300 GGTCATGCCTTAGTCTTATCTTCAA 58.651 40.000 0.00 0.00 0.00 2.69
4780 5262 6.995091 GGTCATGCCTTAGTCTTATCTTCAAT 59.005 38.462 0.00 0.00 0.00 2.57
4781 5263 8.150945 GGTCATGCCTTAGTCTTATCTTCAATA 58.849 37.037 0.00 0.00 0.00 1.90
4782 5264 9.547753 GTCATGCCTTAGTCTTATCTTCAATAA 57.452 33.333 0.00 0.00 0.00 1.40
4783 5265 9.547753 TCATGCCTTAGTCTTATCTTCAATAAC 57.452 33.333 0.00 0.00 0.00 1.89
4784 5266 9.553064 CATGCCTTAGTCTTATCTTCAATAACT 57.447 33.333 0.00 0.00 0.00 2.24
4787 5269 9.198837 GCCTTAGTCTTATCTTCAATAACTAGC 57.801 37.037 0.00 0.00 0.00 3.42
4802 5284 9.880157 TCAATAACTAGCTATTCCTAAAAACGT 57.120 29.630 0.00 0.00 0.00 3.99
4803 5285 9.916397 CAATAACTAGCTATTCCTAAAAACGTG 57.084 33.333 0.00 0.00 0.00 4.49
4804 5286 6.980051 AACTAGCTATTCCTAAAAACGTGG 57.020 37.500 0.00 0.00 0.00 4.94
4805 5287 6.046290 ACTAGCTATTCCTAAAAACGTGGT 57.954 37.500 0.00 0.00 0.00 4.16
4806 5288 5.873164 ACTAGCTATTCCTAAAAACGTGGTG 59.127 40.000 0.00 0.00 0.00 4.17
4807 5289 4.901868 AGCTATTCCTAAAAACGTGGTGA 58.098 39.130 0.00 0.00 0.00 4.02
4808 5290 4.935808 AGCTATTCCTAAAAACGTGGTGAG 59.064 41.667 0.00 0.00 0.00 3.51
4809 5291 4.933400 GCTATTCCTAAAAACGTGGTGAGA 59.067 41.667 0.00 0.00 0.00 3.27
4810 5292 5.163884 GCTATTCCTAAAAACGTGGTGAGAC 60.164 44.000 0.00 0.00 0.00 3.36
4811 5293 3.823281 TCCTAAAAACGTGGTGAGACA 57.177 42.857 0.00 0.00 0.00 3.41
4812 5294 4.345859 TCCTAAAAACGTGGTGAGACAT 57.654 40.909 0.00 0.00 0.00 3.06
4813 5295 5.471556 TCCTAAAAACGTGGTGAGACATA 57.528 39.130 0.00 0.00 0.00 2.29
4814 5296 6.045072 TCCTAAAAACGTGGTGAGACATAT 57.955 37.500 0.00 0.00 0.00 1.78
4815 5297 6.469410 TCCTAAAAACGTGGTGAGACATATT 58.531 36.000 0.00 0.00 0.00 1.28
4816 5298 6.370442 TCCTAAAAACGTGGTGAGACATATTG 59.630 38.462 0.00 0.00 0.00 1.90
4817 5299 6.148811 CCTAAAAACGTGGTGAGACATATTGT 59.851 38.462 0.00 0.00 0.00 2.71
4818 5300 7.332430 CCTAAAAACGTGGTGAGACATATTGTA 59.668 37.037 0.00 0.00 0.00 2.41
4819 5301 6.476243 AAAACGTGGTGAGACATATTGTAC 57.524 37.500 0.00 0.00 0.00 2.90
4820 5302 5.401531 AACGTGGTGAGACATATTGTACT 57.598 39.130 0.00 0.00 0.00 2.73
4821 5303 6.519679 AACGTGGTGAGACATATTGTACTA 57.480 37.500 0.00 0.00 0.00 1.82
4822 5304 6.519679 ACGTGGTGAGACATATTGTACTAA 57.480 37.500 0.00 0.00 0.00 2.24
4823 5305 6.561614 ACGTGGTGAGACATATTGTACTAAG 58.438 40.000 0.00 0.00 0.00 2.18
4824 5306 6.376299 ACGTGGTGAGACATATTGTACTAAGA 59.624 38.462 0.00 0.00 0.00 2.10
4825 5307 6.913132 CGTGGTGAGACATATTGTACTAAGAG 59.087 42.308 0.00 0.00 0.00 2.85
4826 5308 7.201705 CGTGGTGAGACATATTGTACTAAGAGA 60.202 40.741 0.00 0.00 0.00 3.10
4827 5309 8.634444 GTGGTGAGACATATTGTACTAAGAGAT 58.366 37.037 0.00 0.00 0.00 2.75
4828 5310 8.851145 TGGTGAGACATATTGTACTAAGAGATC 58.149 37.037 0.00 0.00 0.00 2.75
4829 5311 8.851145 GGTGAGACATATTGTACTAAGAGATCA 58.149 37.037 0.00 0.00 0.00 2.92
4874 5356 6.846325 AGAGAAGACAAACCTTTTCTTACG 57.154 37.500 0.00 0.00 35.01 3.18
4875 5357 6.579865 AGAGAAGACAAACCTTTTCTTACGA 58.420 36.000 0.00 0.00 35.01 3.43
4876 5358 6.702282 AGAGAAGACAAACCTTTTCTTACGAG 59.298 38.462 0.00 0.00 35.01 4.18
4877 5359 6.346896 AGAAGACAAACCTTTTCTTACGAGT 58.653 36.000 0.00 0.00 29.54 4.18
4878 5360 6.822170 AGAAGACAAACCTTTTCTTACGAGTT 59.178 34.615 0.00 0.00 29.54 3.01
4879 5361 6.600246 AGACAAACCTTTTCTTACGAGTTC 57.400 37.500 0.00 0.00 0.00 3.01
4880 5362 6.346896 AGACAAACCTTTTCTTACGAGTTCT 58.653 36.000 0.00 0.00 0.00 3.01
4881 5363 6.822170 AGACAAACCTTTTCTTACGAGTTCTT 59.178 34.615 0.00 0.00 0.00 2.52
4882 5364 7.336176 AGACAAACCTTTTCTTACGAGTTCTTT 59.664 33.333 0.00 0.00 0.00 2.52
4883 5365 7.470079 ACAAACCTTTTCTTACGAGTTCTTTC 58.530 34.615 0.00 0.00 0.00 2.62
4884 5366 7.336176 ACAAACCTTTTCTTACGAGTTCTTTCT 59.664 33.333 0.00 0.00 0.00 2.52
4885 5367 7.479897 AACCTTTTCTTACGAGTTCTTTCTC 57.520 36.000 0.00 0.00 0.00 2.87
4886 5368 6.818233 ACCTTTTCTTACGAGTTCTTTCTCT 58.182 36.000 0.00 0.00 32.83 3.10
4887 5369 7.273712 ACCTTTTCTTACGAGTTCTTTCTCTT 58.726 34.615 0.00 0.00 32.83 2.85
4888 5370 7.438757 ACCTTTTCTTACGAGTTCTTTCTCTTC 59.561 37.037 0.00 0.00 32.83 2.87
4889 5371 7.095565 CCTTTTCTTACGAGTTCTTTCTCTTCC 60.096 40.741 0.00 0.00 32.83 3.46
4890 5372 6.401047 TTCTTACGAGTTCTTTCTCTTCCA 57.599 37.500 0.00 0.00 32.83 3.53
4891 5373 5.770417 TCTTACGAGTTCTTTCTCTTCCAC 58.230 41.667 0.00 0.00 32.83 4.02
4892 5374 3.388345 ACGAGTTCTTTCTCTTCCACC 57.612 47.619 0.00 0.00 32.83 4.61
4893 5375 2.966516 ACGAGTTCTTTCTCTTCCACCT 59.033 45.455 0.00 0.00 32.83 4.00
4894 5376 3.006003 ACGAGTTCTTTCTCTTCCACCTC 59.994 47.826 0.00 0.00 32.83 3.85
4895 5377 3.005897 CGAGTTCTTTCTCTTCCACCTCA 59.994 47.826 0.00 0.00 32.83 3.86
4896 5378 4.322349 CGAGTTCTTTCTCTTCCACCTCAT 60.322 45.833 0.00 0.00 32.83 2.90
4897 5379 5.159273 AGTTCTTTCTCTTCCACCTCATC 57.841 43.478 0.00 0.00 0.00 2.92
4898 5380 4.594920 AGTTCTTTCTCTTCCACCTCATCA 59.405 41.667 0.00 0.00 0.00 3.07
4899 5381 5.250313 AGTTCTTTCTCTTCCACCTCATCAT 59.750 40.000 0.00 0.00 0.00 2.45
4900 5382 5.768980 TCTTTCTCTTCCACCTCATCATT 57.231 39.130 0.00 0.00 0.00 2.57
4901 5383 6.131972 TCTTTCTCTTCCACCTCATCATTT 57.868 37.500 0.00 0.00 0.00 2.32
4902 5384 7.257790 TCTTTCTCTTCCACCTCATCATTTA 57.742 36.000 0.00 0.00 0.00 1.40
4903 5385 7.865820 TCTTTCTCTTCCACCTCATCATTTAT 58.134 34.615 0.00 0.00 0.00 1.40
4904 5386 7.989741 TCTTTCTCTTCCACCTCATCATTTATC 59.010 37.037 0.00 0.00 0.00 1.75
4905 5387 6.179906 TCTCTTCCACCTCATCATTTATCC 57.820 41.667 0.00 0.00 0.00 2.59
4906 5388 5.907662 TCTCTTCCACCTCATCATTTATCCT 59.092 40.000 0.00 0.00 0.00 3.24
4907 5389 7.075797 TCTCTTCCACCTCATCATTTATCCTA 58.924 38.462 0.00 0.00 0.00 2.94
4908 5390 7.015682 TCTCTTCCACCTCATCATTTATCCTAC 59.984 40.741 0.00 0.00 0.00 3.18
4909 5391 5.468540 TCCACCTCATCATTTATCCTACG 57.531 43.478 0.00 0.00 0.00 3.51
4910 5392 4.899457 TCCACCTCATCATTTATCCTACGT 59.101 41.667 0.00 0.00 0.00 3.57
4911 5393 4.991056 CCACCTCATCATTTATCCTACGTG 59.009 45.833 0.00 0.00 0.00 4.49
4912 5394 4.991056 CACCTCATCATTTATCCTACGTGG 59.009 45.833 0.00 0.00 37.10 4.94
4913 5395 3.997021 CCTCATCATTTATCCTACGTGGC 59.003 47.826 0.00 0.00 35.26 5.01
4914 5396 4.503123 CCTCATCATTTATCCTACGTGGCA 60.503 45.833 0.00 0.00 35.26 4.92
4915 5397 4.377021 TCATCATTTATCCTACGTGGCAC 58.623 43.478 7.79 7.79 35.26 5.01
4916 5398 4.100963 TCATCATTTATCCTACGTGGCACT 59.899 41.667 16.72 5.47 35.26 4.40
4917 5399 4.054780 TCATTTATCCTACGTGGCACTC 57.945 45.455 16.72 0.00 35.26 3.51
4918 5400 2.973694 TTTATCCTACGTGGCACTCC 57.026 50.000 16.72 0.00 35.26 3.85
4919 5401 2.154567 TTATCCTACGTGGCACTCCT 57.845 50.000 16.72 0.21 35.26 3.69
4920 5402 3.301794 TTATCCTACGTGGCACTCCTA 57.698 47.619 16.72 1.46 35.26 2.94
4921 5403 2.154567 ATCCTACGTGGCACTCCTAA 57.845 50.000 16.72 0.00 35.26 2.69
4922 5404 1.471119 TCCTACGTGGCACTCCTAAG 58.529 55.000 16.72 0.92 35.26 2.18
4923 5405 1.005097 TCCTACGTGGCACTCCTAAGA 59.995 52.381 16.72 2.12 35.26 2.10
4924 5406 2.032620 CCTACGTGGCACTCCTAAGAT 58.967 52.381 16.72 0.00 0.00 2.40
4925 5407 3.117776 TCCTACGTGGCACTCCTAAGATA 60.118 47.826 16.72 0.00 35.26 1.98
4926 5408 3.635373 CCTACGTGGCACTCCTAAGATAA 59.365 47.826 16.72 0.00 0.00 1.75
4927 5409 3.521947 ACGTGGCACTCCTAAGATAAC 57.478 47.619 16.72 0.00 0.00 1.89
4928 5410 2.829720 ACGTGGCACTCCTAAGATAACA 59.170 45.455 16.72 0.00 0.00 2.41
4929 5411 3.187700 CGTGGCACTCCTAAGATAACAC 58.812 50.000 16.72 0.00 0.00 3.32
4930 5412 3.119101 CGTGGCACTCCTAAGATAACACT 60.119 47.826 16.72 0.00 0.00 3.55
4931 5413 4.097437 CGTGGCACTCCTAAGATAACACTA 59.903 45.833 16.72 0.00 0.00 2.74
4932 5414 5.221263 CGTGGCACTCCTAAGATAACACTAT 60.221 44.000 16.72 0.00 0.00 2.12
4933 5415 6.583562 GTGGCACTCCTAAGATAACACTATT 58.416 40.000 11.13 0.00 0.00 1.73
4934 5416 6.480320 GTGGCACTCCTAAGATAACACTATTG 59.520 42.308 11.13 0.00 0.00 1.90
4935 5417 6.156256 TGGCACTCCTAAGATAACACTATTGT 59.844 38.462 0.00 0.00 37.67 2.71
4936 5418 7.343574 TGGCACTCCTAAGATAACACTATTGTA 59.656 37.037 0.00 0.00 33.55 2.41
4937 5419 7.652507 GGCACTCCTAAGATAACACTATTGTAC 59.347 40.741 0.00 0.00 33.55 2.90
4938 5420 8.195436 GCACTCCTAAGATAACACTATTGTACA 58.805 37.037 0.00 0.00 33.55 2.90
4941 5423 9.197694 CTCCTAAGATAACACTATTGTACATGC 57.802 37.037 0.00 0.00 33.55 4.06
4942 5424 8.148351 TCCTAAGATAACACTATTGTACATGCC 58.852 37.037 0.00 0.00 33.55 4.40
4943 5425 7.387948 CCTAAGATAACACTATTGTACATGCCC 59.612 40.741 0.00 0.00 33.55 5.36
4944 5426 6.500589 AGATAACACTATTGTACATGCCCT 57.499 37.500 0.00 0.00 33.55 5.19
4945 5427 7.612065 AGATAACACTATTGTACATGCCCTA 57.388 36.000 0.00 0.00 33.55 3.53
4946 5428 8.029782 AGATAACACTATTGTACATGCCCTAA 57.970 34.615 0.00 0.00 33.55 2.69
4947 5429 8.491134 AGATAACACTATTGTACATGCCCTAAA 58.509 33.333 0.00 0.00 33.55 1.85
4948 5430 6.753107 AACACTATTGTACATGCCCTAAAC 57.247 37.500 0.00 0.00 33.55 2.01
4949 5431 4.873827 ACACTATTGTACATGCCCTAAACG 59.126 41.667 0.00 0.00 32.60 3.60
4950 5432 4.873827 CACTATTGTACATGCCCTAAACGT 59.126 41.667 0.00 0.00 0.00 3.99
4951 5433 5.353123 CACTATTGTACATGCCCTAAACGTT 59.647 40.000 0.00 0.00 0.00 3.99
4952 5434 4.695217 ATTGTACATGCCCTAAACGTTG 57.305 40.909 0.00 0.00 0.00 4.10
4953 5435 3.128852 TGTACATGCCCTAAACGTTGT 57.871 42.857 0.00 0.00 0.00 3.32
4954 5436 3.478509 TGTACATGCCCTAAACGTTGTT 58.521 40.909 0.00 0.00 0.00 2.83
4955 5437 3.884091 TGTACATGCCCTAAACGTTGTTT 59.116 39.130 0.00 0.22 0.00 2.83
4956 5438 5.061853 TGTACATGCCCTAAACGTTGTTTA 58.938 37.500 0.00 2.52 0.00 2.01
4957 5439 5.706369 TGTACATGCCCTAAACGTTGTTTAT 59.294 36.000 0.00 0.00 0.00 1.40
4958 5440 5.305139 ACATGCCCTAAACGTTGTTTATC 57.695 39.130 0.00 0.00 0.00 1.75
4959 5441 5.007682 ACATGCCCTAAACGTTGTTTATCT 58.992 37.500 0.00 0.00 0.00 1.98
4960 5442 5.123344 ACATGCCCTAAACGTTGTTTATCTC 59.877 40.000 0.00 0.00 0.00 2.75
4961 5443 4.004982 TGCCCTAAACGTTGTTTATCTCC 58.995 43.478 0.00 0.00 0.00 3.71
4962 5444 3.376234 GCCCTAAACGTTGTTTATCTCCC 59.624 47.826 0.00 0.00 0.00 4.30
4963 5445 4.840271 CCCTAAACGTTGTTTATCTCCCT 58.160 43.478 0.00 0.00 0.00 4.20
4964 5446 4.634443 CCCTAAACGTTGTTTATCTCCCTG 59.366 45.833 0.00 0.00 0.00 4.45
4965 5447 5.243207 CCTAAACGTTGTTTATCTCCCTGT 58.757 41.667 0.00 0.00 0.00 4.00
4966 5448 6.400568 CCTAAACGTTGTTTATCTCCCTGTA 58.599 40.000 0.00 0.00 0.00 2.74
4967 5449 7.046033 CCTAAACGTTGTTTATCTCCCTGTAT 58.954 38.462 0.00 0.00 0.00 2.29
4968 5450 6.980051 AAACGTTGTTTATCTCCCTGTATC 57.020 37.500 0.00 0.00 0.00 2.24
4969 5451 4.679662 ACGTTGTTTATCTCCCTGTATCG 58.320 43.478 0.00 0.00 0.00 2.92
4970 5452 4.159135 ACGTTGTTTATCTCCCTGTATCGT 59.841 41.667 0.00 0.00 0.00 3.73
4971 5453 5.107133 CGTTGTTTATCTCCCTGTATCGTT 58.893 41.667 0.00 0.00 0.00 3.85
4972 5454 5.005394 CGTTGTTTATCTCCCTGTATCGTTG 59.995 44.000 0.00 0.00 0.00 4.10
4973 5455 4.439057 TGTTTATCTCCCTGTATCGTTGC 58.561 43.478 0.00 0.00 0.00 4.17
4974 5456 4.161565 TGTTTATCTCCCTGTATCGTTGCT 59.838 41.667 0.00 0.00 0.00 3.91
4975 5457 5.116882 GTTTATCTCCCTGTATCGTTGCTT 58.883 41.667 0.00 0.00 0.00 3.91
4976 5458 2.961526 TCTCCCTGTATCGTTGCTTC 57.038 50.000 0.00 0.00 0.00 3.86
4977 5459 1.480954 TCTCCCTGTATCGTTGCTTCC 59.519 52.381 0.00 0.00 0.00 3.46
4978 5460 1.207089 CTCCCTGTATCGTTGCTTCCA 59.793 52.381 0.00 0.00 0.00 3.53
4979 5461 1.837439 TCCCTGTATCGTTGCTTCCAT 59.163 47.619 0.00 0.00 0.00 3.41
4980 5462 2.238646 TCCCTGTATCGTTGCTTCCATT 59.761 45.455 0.00 0.00 0.00 3.16
4981 5463 2.355756 CCCTGTATCGTTGCTTCCATTG 59.644 50.000 0.00 0.00 0.00 2.82
4982 5464 2.355756 CCTGTATCGTTGCTTCCATTGG 59.644 50.000 0.00 0.00 0.00 3.16
4983 5465 1.742831 TGTATCGTTGCTTCCATTGGC 59.257 47.619 0.00 0.00 0.00 4.52
4984 5466 2.017049 GTATCGTTGCTTCCATTGGCT 58.983 47.619 0.00 0.00 0.00 4.75
4985 5467 0.813184 ATCGTTGCTTCCATTGGCTG 59.187 50.000 0.00 0.00 0.00 4.85
4986 5468 0.250684 TCGTTGCTTCCATTGGCTGA 60.251 50.000 0.00 0.00 0.00 4.26
4987 5469 0.169672 CGTTGCTTCCATTGGCTGAG 59.830 55.000 0.00 0.00 0.00 3.35
4988 5470 0.108945 GTTGCTTCCATTGGCTGAGC 60.109 55.000 14.74 14.74 0.00 4.26
4989 5471 0.251474 TTGCTTCCATTGGCTGAGCT 60.251 50.000 19.40 0.00 34.56 4.09
4990 5472 0.620030 TGCTTCCATTGGCTGAGCTA 59.380 50.000 19.40 0.00 34.56 3.32
4991 5473 1.004628 TGCTTCCATTGGCTGAGCTAA 59.995 47.619 5.51 5.51 34.56 3.09
4992 5474 2.305009 GCTTCCATTGGCTGAGCTAAT 58.695 47.619 10.41 10.41 40.22 1.73
4993 5475 3.117926 TGCTTCCATTGGCTGAGCTAATA 60.118 43.478 15.74 0.00 37.63 0.98
4994 5476 3.251972 GCTTCCATTGGCTGAGCTAATAC 59.748 47.826 15.74 0.63 37.63 1.89
4995 5477 4.712476 CTTCCATTGGCTGAGCTAATACT 58.288 43.478 15.74 0.00 37.63 2.12
4996 5478 5.743130 GCTTCCATTGGCTGAGCTAATACTA 60.743 44.000 15.74 2.02 37.63 1.82
4997 5479 6.439636 TTCCATTGGCTGAGCTAATACTAT 57.560 37.500 15.74 0.00 37.63 2.12
4998 5480 6.439636 TCCATTGGCTGAGCTAATACTATT 57.560 37.500 15.74 0.00 37.63 1.73
4999 5481 7.553504 TCCATTGGCTGAGCTAATACTATTA 57.446 36.000 15.74 0.00 37.63 0.98
5000 5482 7.386851 TCCATTGGCTGAGCTAATACTATTAC 58.613 38.462 15.74 0.00 37.63 1.89
5001 5483 7.016170 TCCATTGGCTGAGCTAATACTATTACA 59.984 37.037 15.74 0.00 37.63 2.41
5002 5484 7.118390 CCATTGGCTGAGCTAATACTATTACAC 59.882 40.741 15.74 0.00 37.63 2.90
5003 5485 5.769367 TGGCTGAGCTAATACTATTACACG 58.231 41.667 3.72 0.00 0.00 4.49
5004 5486 4.621886 GGCTGAGCTAATACTATTACACGC 59.378 45.833 3.72 0.00 0.00 5.34
5005 5487 5.462405 GCTGAGCTAATACTATTACACGCT 58.538 41.667 0.00 2.25 0.00 5.07
5006 5488 6.349115 GGCTGAGCTAATACTATTACACGCTA 60.349 42.308 3.72 0.00 0.00 4.26
5007 5489 7.251994 GCTGAGCTAATACTATTACACGCTAT 58.748 38.462 0.00 0.00 0.00 2.97
5008 5490 7.755822 GCTGAGCTAATACTATTACACGCTATT 59.244 37.037 0.00 0.00 0.00 1.73
5009 5491 9.627395 CTGAGCTAATACTATTACACGCTATTT 57.373 33.333 0.00 0.00 0.00 1.40
5010 5492 9.406828 TGAGCTAATACTATTACACGCTATTTG 57.593 33.333 0.00 0.00 0.00 2.32
5011 5493 8.758633 AGCTAATACTATTACACGCTATTTGG 57.241 34.615 0.00 0.00 0.00 3.28
5012 5494 8.365647 AGCTAATACTATTACACGCTATTTGGT 58.634 33.333 0.00 0.00 0.00 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
354 355 2.588877 CGCCCGTTCCTATGCAGG 60.589 66.667 0.00 0.00 44.17 4.85
355 356 2.588877 CCGCCCGTTCCTATGCAG 60.589 66.667 0.00 0.00 0.00 4.41
356 357 4.849310 GCCGCCCGTTCCTATGCA 62.849 66.667 0.00 0.00 0.00 3.96
357 358 4.547367 AGCCGCCCGTTCCTATGC 62.547 66.667 0.00 0.00 0.00 3.14
358 359 2.280186 GAGCCGCCCGTTCCTATG 60.280 66.667 0.00 0.00 0.00 2.23
359 360 3.912907 CGAGCCGCCCGTTCCTAT 61.913 66.667 0.00 0.00 0.00 2.57
403 404 1.749258 GCATTCTCCCCGGTGAACC 60.749 63.158 0.00 0.00 31.71 3.62
404 405 0.394352 ATGCATTCTCCCCGGTGAAC 60.394 55.000 0.00 0.00 31.71 3.18
405 406 0.394216 CATGCATTCTCCCCGGTGAA 60.394 55.000 0.00 2.21 33.14 3.18
406 407 1.224315 CATGCATTCTCCCCGGTGA 59.776 57.895 0.00 0.00 0.00 4.02
407 408 1.825191 CCATGCATTCTCCCCGGTG 60.825 63.158 0.00 0.00 0.00 4.94
408 409 2.597340 CCATGCATTCTCCCCGGT 59.403 61.111 0.00 0.00 0.00 5.28
409 410 2.908940 GCCATGCATTCTCCCCGG 60.909 66.667 0.00 0.00 0.00 5.73
410 411 3.282157 CGCCATGCATTCTCCCCG 61.282 66.667 0.00 0.00 0.00 5.73
411 412 1.895707 CTCGCCATGCATTCTCCCC 60.896 63.158 0.00 0.00 0.00 4.81
412 413 1.895707 CCTCGCCATGCATTCTCCC 60.896 63.158 0.00 0.00 0.00 4.30
413 414 2.550101 GCCTCGCCATGCATTCTCC 61.550 63.158 0.00 0.00 0.00 3.71
414 415 2.890109 CGCCTCGCCATGCATTCTC 61.890 63.158 0.00 0.00 0.00 2.87
415 416 2.898840 CGCCTCGCCATGCATTCT 60.899 61.111 0.00 0.00 0.00 2.40
416 417 3.957535 CCGCCTCGCCATGCATTC 61.958 66.667 0.00 0.00 0.00 2.67
431 432 4.069232 TCCTCCTGAACGCTGCCG 62.069 66.667 0.00 0.00 41.14 5.69
432 433 2.435059 GTCCTCCTGAACGCTGCC 60.435 66.667 0.00 0.00 0.00 4.85
433 434 2.435059 GGTCCTCCTGAACGCTGC 60.435 66.667 0.00 0.00 0.00 5.25
438 439 1.305046 TCCTCCGGTCCTCCTGAAC 60.305 63.158 0.00 0.00 0.00 3.18
439 440 1.000486 CTCCTCCGGTCCTCCTGAA 60.000 63.158 0.00 0.00 0.00 3.02
440 441 2.684104 CTCCTCCGGTCCTCCTGA 59.316 66.667 0.00 0.00 0.00 3.86
441 442 2.443016 CCTCCTCCGGTCCTCCTG 60.443 72.222 0.00 0.00 0.00 3.86
442 443 4.467107 GCCTCCTCCGGTCCTCCT 62.467 72.222 0.00 0.00 0.00 3.69
443 444 4.779733 TGCCTCCTCCGGTCCTCC 62.780 72.222 0.00 0.00 0.00 4.30
444 445 2.444895 ATGCCTCCTCCGGTCCTC 60.445 66.667 0.00 0.00 0.00 3.71
445 446 2.765807 CATGCCTCCTCCGGTCCT 60.766 66.667 0.00 0.00 0.00 3.85
446 447 2.764128 TCATGCCTCCTCCGGTCC 60.764 66.667 0.00 0.00 0.00 4.46
447 448 2.501610 GTCATGCCTCCTCCGGTC 59.498 66.667 0.00 0.00 0.00 4.79
448 449 3.461773 CGTCATGCCTCCTCCGGT 61.462 66.667 0.00 0.00 0.00 5.28
449 450 3.144120 CTCGTCATGCCTCCTCCGG 62.144 68.421 0.00 0.00 0.00 5.14
450 451 2.415010 CTCGTCATGCCTCCTCCG 59.585 66.667 0.00 0.00 0.00 4.63
451 452 2.818132 CCTCGTCATGCCTCCTCC 59.182 66.667 0.00 0.00 0.00 4.30
452 453 2.107953 GCCTCGTCATGCCTCCTC 59.892 66.667 0.00 0.00 0.00 3.71
453 454 2.685017 TGCCTCGTCATGCCTCCT 60.685 61.111 0.00 0.00 0.00 3.69
454 455 2.202987 CTGCCTCGTCATGCCTCC 60.203 66.667 0.00 0.00 0.00 4.30
455 456 2.894387 GCTGCCTCGTCATGCCTC 60.894 66.667 0.00 0.00 0.00 4.70
456 457 4.827087 CGCTGCCTCGTCATGCCT 62.827 66.667 0.00 0.00 0.00 4.75
469 470 0.097674 GATAAAGCAGTGTGCCGCTG 59.902 55.000 10.35 10.35 46.52 5.18
470 471 0.036010 AGATAAAGCAGTGTGCCGCT 60.036 50.000 0.00 0.00 46.52 5.52
471 472 1.651987 TAGATAAAGCAGTGTGCCGC 58.348 50.000 0.00 0.00 46.52 6.53
472 473 4.882671 AAATAGATAAAGCAGTGTGCCG 57.117 40.909 0.00 0.00 46.52 5.69
473 474 7.442364 TGAGATAAATAGATAAAGCAGTGTGCC 59.558 37.037 0.00 0.00 46.52 5.01
474 475 8.370493 TGAGATAAATAGATAAAGCAGTGTGC 57.630 34.615 0.00 0.00 45.46 4.57
478 479 9.499479 CCACATGAGATAAATAGATAAAGCAGT 57.501 33.333 0.00 0.00 0.00 4.40
479 480 9.716531 TCCACATGAGATAAATAGATAAAGCAG 57.283 33.333 0.00 0.00 0.00 4.24
486 487 9.597170 CGATGAATCCACATGAGATAAATAGAT 57.403 33.333 0.00 0.00 0.00 1.98
487 488 8.588472 ACGATGAATCCACATGAGATAAATAGA 58.412 33.333 0.00 0.00 0.00 1.98
488 489 8.768957 ACGATGAATCCACATGAGATAAATAG 57.231 34.615 0.00 2.71 0.00 1.73
489 490 9.559732 AAACGATGAATCCACATGAGATAAATA 57.440 29.630 0.00 0.00 0.00 1.40
490 491 8.455903 AAACGATGAATCCACATGAGATAAAT 57.544 30.769 0.00 0.00 0.00 1.40
491 492 7.552330 TGAAACGATGAATCCACATGAGATAAA 59.448 33.333 0.00 0.00 0.00 1.40
492 493 7.047271 TGAAACGATGAATCCACATGAGATAA 58.953 34.615 0.00 0.00 0.00 1.75
493 494 6.581712 TGAAACGATGAATCCACATGAGATA 58.418 36.000 0.00 0.00 0.00 1.98
494 495 5.430886 TGAAACGATGAATCCACATGAGAT 58.569 37.500 0.00 0.00 0.00 2.75
495 496 4.831107 TGAAACGATGAATCCACATGAGA 58.169 39.130 0.00 0.00 0.00 3.27
496 497 5.746307 ATGAAACGATGAATCCACATGAG 57.254 39.130 0.00 0.00 0.00 2.90
497 498 7.011389 GTCTTATGAAACGATGAATCCACATGA 59.989 37.037 0.00 0.00 0.00 3.07
498 499 7.128331 GTCTTATGAAACGATGAATCCACATG 58.872 38.462 0.00 0.00 0.00 3.21
499 500 6.260936 GGTCTTATGAAACGATGAATCCACAT 59.739 38.462 0.00 0.00 0.00 3.21
500 501 5.584649 GGTCTTATGAAACGATGAATCCACA 59.415 40.000 0.00 0.00 0.00 4.17
501 502 5.584649 TGGTCTTATGAAACGATGAATCCAC 59.415 40.000 0.00 0.00 0.00 4.02
502 503 5.739959 TGGTCTTATGAAACGATGAATCCA 58.260 37.500 0.00 0.00 0.00 3.41
503 504 5.237344 CCTGGTCTTATGAAACGATGAATCC 59.763 44.000 0.00 0.00 0.00 3.01
504 505 6.049149 TCCTGGTCTTATGAAACGATGAATC 58.951 40.000 0.00 0.00 0.00 2.52
505 506 5.989477 TCCTGGTCTTATGAAACGATGAAT 58.011 37.500 0.00 0.00 0.00 2.57
506 507 5.414789 TCCTGGTCTTATGAAACGATGAA 57.585 39.130 0.00 0.00 0.00 2.57
507 508 5.414789 TTCCTGGTCTTATGAAACGATGA 57.585 39.130 0.00 0.00 0.00 2.92
508 509 5.065218 CCTTTCCTGGTCTTATGAAACGATG 59.935 44.000 0.00 0.00 0.00 3.84
509 510 5.186198 CCTTTCCTGGTCTTATGAAACGAT 58.814 41.667 0.00 0.00 0.00 3.73
510 511 4.041198 ACCTTTCCTGGTCTTATGAAACGA 59.959 41.667 0.00 0.00 34.86 3.85
511 512 4.324267 ACCTTTCCTGGTCTTATGAAACG 58.676 43.478 0.00 0.00 34.86 3.60
512 513 5.106673 CGAACCTTTCCTGGTCTTATGAAAC 60.107 44.000 0.00 0.00 39.83 2.78
513 514 5.001232 CGAACCTTTCCTGGTCTTATGAAA 58.999 41.667 0.00 0.00 39.83 2.69
514 515 4.285003 TCGAACCTTTCCTGGTCTTATGAA 59.715 41.667 0.00 0.00 39.83 2.57
515 516 3.835978 TCGAACCTTTCCTGGTCTTATGA 59.164 43.478 0.00 0.00 39.83 2.15
516 517 4.202245 TCGAACCTTTCCTGGTCTTATG 57.798 45.455 0.00 0.00 39.83 1.90
517 518 4.384208 CCATCGAACCTTTCCTGGTCTTAT 60.384 45.833 0.00 0.00 39.83 1.73
518 519 3.055385 CCATCGAACCTTTCCTGGTCTTA 60.055 47.826 0.00 0.00 39.83 2.10
519 520 2.290323 CCATCGAACCTTTCCTGGTCTT 60.290 50.000 0.00 0.00 39.83 3.01
520 521 1.279271 CCATCGAACCTTTCCTGGTCT 59.721 52.381 0.00 0.00 39.83 3.85
521 522 1.278127 TCCATCGAACCTTTCCTGGTC 59.722 52.381 0.00 0.00 39.83 4.02
522 523 1.358152 TCCATCGAACCTTTCCTGGT 58.642 50.000 0.00 0.00 43.11 4.00
523 524 2.488153 GTTTCCATCGAACCTTTCCTGG 59.512 50.000 0.00 0.00 32.84 4.45
524 525 2.159627 CGTTTCCATCGAACCTTTCCTG 59.840 50.000 0.00 0.00 0.00 3.86
525 526 2.038033 TCGTTTCCATCGAACCTTTCCT 59.962 45.455 0.00 0.00 34.36 3.36
526 527 2.159037 GTCGTTTCCATCGAACCTTTCC 59.841 50.000 0.00 0.00 39.01 3.13
527 528 3.064931 AGTCGTTTCCATCGAACCTTTC 58.935 45.455 0.00 0.00 39.01 2.62
528 529 3.064931 GAGTCGTTTCCATCGAACCTTT 58.935 45.455 0.00 0.00 39.01 3.11
529 530 2.685100 GAGTCGTTTCCATCGAACCTT 58.315 47.619 0.00 0.00 39.01 3.50
530 531 1.402456 CGAGTCGTTTCCATCGAACCT 60.402 52.381 3.82 0.00 39.01 3.50
531 532 0.989890 CGAGTCGTTTCCATCGAACC 59.010 55.000 3.82 0.00 39.01 3.62
532 533 0.989890 CCGAGTCGTTTCCATCGAAC 59.010 55.000 12.31 0.00 39.01 3.95
533 534 0.883153 TCCGAGTCGTTTCCATCGAA 59.117 50.000 12.31 0.00 39.01 3.71
534 535 0.450583 CTCCGAGTCGTTTCCATCGA 59.549 55.000 12.31 0.00 37.35 3.59
535 536 0.525668 CCTCCGAGTCGTTTCCATCG 60.526 60.000 12.31 0.00 35.02 3.84
536 537 0.179108 CCCTCCGAGTCGTTTCCATC 60.179 60.000 12.31 0.00 0.00 3.51
537 538 1.898154 CCCTCCGAGTCGTTTCCAT 59.102 57.895 12.31 0.00 0.00 3.41
538 539 2.939261 GCCCTCCGAGTCGTTTCCA 61.939 63.158 12.31 0.00 0.00 3.53
539 540 2.125633 GCCCTCCGAGTCGTTTCC 60.126 66.667 12.31 0.00 0.00 3.13
540 541 0.601841 TTTGCCCTCCGAGTCGTTTC 60.602 55.000 12.31 0.00 0.00 2.78
541 542 0.036306 ATTTGCCCTCCGAGTCGTTT 59.964 50.000 12.31 0.00 0.00 3.60
542 543 0.391263 GATTTGCCCTCCGAGTCGTT 60.391 55.000 12.31 0.00 0.00 3.85
543 544 1.218316 GATTTGCCCTCCGAGTCGT 59.782 57.895 12.31 0.00 0.00 4.34
544 545 1.521681 GGATTTGCCCTCCGAGTCG 60.522 63.158 5.29 5.29 0.00 4.18
545 546 4.542075 GGATTTGCCCTCCGAGTC 57.458 61.111 0.00 0.00 0.00 3.36
550 551 2.640316 ATAAGACGGATTTGCCCTCC 57.360 50.000 0.00 0.00 0.00 4.30
551 552 6.565999 CGATTTTATAAGACGGATTTGCCCTC 60.566 42.308 0.00 0.00 0.00 4.30
552 553 5.238650 CGATTTTATAAGACGGATTTGCCCT 59.761 40.000 0.00 0.00 0.00 5.19
553 554 5.237779 TCGATTTTATAAGACGGATTTGCCC 59.762 40.000 0.00 0.00 0.00 5.36
554 555 6.295039 TCGATTTTATAAGACGGATTTGCC 57.705 37.500 0.00 0.00 0.00 4.52
560 561 9.419297 CCTTCATATTCGATTTTATAAGACGGA 57.581 33.333 0.00 0.00 0.00 4.69
561 562 8.656849 CCCTTCATATTCGATTTTATAAGACGG 58.343 37.037 0.00 0.00 0.00 4.79
562 563 9.204570 ACCCTTCATATTCGATTTTATAAGACG 57.795 33.333 0.00 0.00 0.00 4.18
564 565 9.502091 CCACCCTTCATATTCGATTTTATAAGA 57.498 33.333 0.00 0.00 0.00 2.10
565 566 8.730680 CCCACCCTTCATATTCGATTTTATAAG 58.269 37.037 0.00 0.00 0.00 1.73
566 567 8.221944 ACCCACCCTTCATATTCGATTTTATAA 58.778 33.333 0.00 0.00 0.00 0.98
567 568 7.751646 ACCCACCCTTCATATTCGATTTTATA 58.248 34.615 0.00 0.00 0.00 0.98
568 569 6.610830 ACCCACCCTTCATATTCGATTTTAT 58.389 36.000 0.00 0.00 0.00 1.40
569 570 6.008696 ACCCACCCTTCATATTCGATTTTA 57.991 37.500 0.00 0.00 0.00 1.52
570 571 4.867086 ACCCACCCTTCATATTCGATTTT 58.133 39.130 0.00 0.00 0.00 1.82
571 572 4.166144 AGACCCACCCTTCATATTCGATTT 59.834 41.667 0.00 0.00 0.00 2.17
572 573 3.716872 AGACCCACCCTTCATATTCGATT 59.283 43.478 0.00 0.00 0.00 3.34
573 574 3.071602 CAGACCCACCCTTCATATTCGAT 59.928 47.826 0.00 0.00 0.00 3.59
574 575 2.434336 CAGACCCACCCTTCATATTCGA 59.566 50.000 0.00 0.00 0.00 3.71
575 576 2.485479 CCAGACCCACCCTTCATATTCG 60.485 54.545 0.00 0.00 0.00 3.34
576 577 2.777692 TCCAGACCCACCCTTCATATTC 59.222 50.000 0.00 0.00 0.00 1.75
577 578 2.509964 GTCCAGACCCACCCTTCATATT 59.490 50.000 0.00 0.00 0.00 1.28
578 579 2.127708 GTCCAGACCCACCCTTCATAT 58.872 52.381 0.00 0.00 0.00 1.78
579 580 1.580059 GTCCAGACCCACCCTTCATA 58.420 55.000 0.00 0.00 0.00 2.15
580 581 1.553690 CGTCCAGACCCACCCTTCAT 61.554 60.000 0.00 0.00 0.00 2.57
581 582 2.214216 CGTCCAGACCCACCCTTCA 61.214 63.158 0.00 0.00 0.00 3.02
582 583 2.214920 ACGTCCAGACCCACCCTTC 61.215 63.158 0.00 0.00 0.00 3.46
583 584 2.122547 ACGTCCAGACCCACCCTT 60.123 61.111 0.00 0.00 0.00 3.95
584 585 2.923035 CACGTCCAGACCCACCCT 60.923 66.667 0.00 0.00 0.00 4.34
585 586 4.016706 CCACGTCCAGACCCACCC 62.017 72.222 0.00 0.00 0.00 4.61
586 587 2.047213 TTTCCACGTCCAGACCCACC 62.047 60.000 0.00 0.00 0.00 4.61
587 588 0.883370 GTTTCCACGTCCAGACCCAC 60.883 60.000 0.00 0.00 0.00 4.61
588 589 1.448497 GTTTCCACGTCCAGACCCA 59.552 57.895 0.00 0.00 0.00 4.51
589 590 1.666872 CGTTTCCACGTCCAGACCC 60.667 63.158 0.00 0.00 41.84 4.46
590 591 3.946907 CGTTTCCACGTCCAGACC 58.053 61.111 0.00 0.00 41.84 3.85
620 621 8.665685 GGTAACTAGATAAAACACCACAGAATG 58.334 37.037 0.00 0.00 46.00 2.67
621 622 8.380099 TGGTAACTAGATAAAACACCACAGAAT 58.620 33.333 0.00 0.00 37.61 2.40
622 623 7.737869 TGGTAACTAGATAAAACACCACAGAA 58.262 34.615 0.00 0.00 37.61 3.02
623 624 7.305813 TGGTAACTAGATAAAACACCACAGA 57.694 36.000 0.00 0.00 37.61 3.41
624 625 7.972832 TTGGTAACTAGATAAAACACCACAG 57.027 36.000 0.00 0.00 34.46 3.66
644 645 9.920946 AGATTGAATACCACACTTTATATTGGT 57.079 29.630 0.43 0.43 44.69 3.67
663 664 9.638239 GCACACCTTTCATTTTATTAGATTGAA 57.362 29.630 0.00 0.00 0.00 2.69
664 665 9.023962 AGCACACCTTTCATTTTATTAGATTGA 57.976 29.630 0.00 0.00 0.00 2.57
671 672 9.125026 CTCCTATAGCACACCTTTCATTTTATT 57.875 33.333 0.00 0.00 0.00 1.40
672 673 8.682936 CTCCTATAGCACACCTTTCATTTTAT 57.317 34.615 0.00 0.00 0.00 1.40
689 690 5.871396 TTCCTGGTACTTTGCTCCTATAG 57.129 43.478 0.00 0.00 0.00 1.31
690 691 6.214819 ACTTTTCCTGGTACTTTGCTCCTATA 59.785 38.462 0.00 0.00 0.00 1.31
691 692 5.014228 ACTTTTCCTGGTACTTTGCTCCTAT 59.986 40.000 0.00 0.00 0.00 2.57
692 693 4.349930 ACTTTTCCTGGTACTTTGCTCCTA 59.650 41.667 0.00 0.00 0.00 2.94
693 694 3.138468 ACTTTTCCTGGTACTTTGCTCCT 59.862 43.478 0.00 0.00 0.00 3.69
694 695 3.253432 CACTTTTCCTGGTACTTTGCTCC 59.747 47.826 0.00 0.00 0.00 4.70
695 696 3.883489 ACACTTTTCCTGGTACTTTGCTC 59.117 43.478 0.00 0.00 0.00 4.26
696 697 3.632145 CACACTTTTCCTGGTACTTTGCT 59.368 43.478 0.00 0.00 0.00 3.91
697 698 3.243401 CCACACTTTTCCTGGTACTTTGC 60.243 47.826 0.00 0.00 0.00 3.68
698 699 3.243401 GCCACACTTTTCCTGGTACTTTG 60.243 47.826 0.00 0.00 0.00 2.77
699 700 2.956333 GCCACACTTTTCCTGGTACTTT 59.044 45.455 0.00 0.00 0.00 2.66
700 701 2.092103 TGCCACACTTTTCCTGGTACTT 60.092 45.455 0.00 0.00 0.00 2.24
701 702 1.493022 TGCCACACTTTTCCTGGTACT 59.507 47.619 0.00 0.00 0.00 2.73
702 703 1.975660 TGCCACACTTTTCCTGGTAC 58.024 50.000 0.00 0.00 0.00 3.34
703 704 2.969821 ATGCCACACTTTTCCTGGTA 57.030 45.000 0.00 0.00 0.00 3.25
704 705 2.086610 AATGCCACACTTTTCCTGGT 57.913 45.000 0.00 0.00 0.00 4.00
705 706 3.030668 GAAATGCCACACTTTTCCTGG 57.969 47.619 0.00 0.00 36.76 4.45
709 710 2.552315 TCGAGGAAATGCCACACTTTTC 59.448 45.455 0.00 0.00 40.17 2.29
710 711 2.582052 TCGAGGAAATGCCACACTTTT 58.418 42.857 0.00 0.00 40.02 2.27
711 712 2.270352 TCGAGGAAATGCCACACTTT 57.730 45.000 0.00 0.00 40.02 2.66
712 713 2.270352 TTCGAGGAAATGCCACACTT 57.730 45.000 0.00 0.00 40.02 3.16
713 714 2.489329 CAATTCGAGGAAATGCCACACT 59.511 45.455 0.00 0.00 40.02 3.55
714 715 2.867429 CAATTCGAGGAAATGCCACAC 58.133 47.619 0.00 0.00 40.02 3.82
715 716 1.202114 GCAATTCGAGGAAATGCCACA 59.798 47.619 7.06 0.00 41.09 4.17
716 717 1.913317 GCAATTCGAGGAAATGCCAC 58.087 50.000 7.06 0.00 41.09 5.01
719 720 0.817013 TGGGCAATTCGAGGAAATGC 59.183 50.000 9.34 9.34 44.71 3.56
720 721 3.806625 AATGGGCAATTCGAGGAAATG 57.193 42.857 0.00 0.00 0.00 2.32
721 722 4.824479 AAAATGGGCAATTCGAGGAAAT 57.176 36.364 0.00 0.00 0.00 2.17
722 723 4.615588 AAAAATGGGCAATTCGAGGAAA 57.384 36.364 0.00 0.00 0.00 3.13
754 755 1.609061 CGAACTGATCACTGGCCAAGT 60.609 52.381 7.01 2.65 40.93 3.16
755 756 1.081892 CGAACTGATCACTGGCCAAG 58.918 55.000 7.01 1.86 0.00 3.61
756 757 0.396435 ACGAACTGATCACTGGCCAA 59.604 50.000 7.01 0.00 0.00 4.52
757 758 0.037326 GACGAACTGATCACTGGCCA 60.037 55.000 4.71 4.71 0.00 5.36
769 770 3.069586 TCAAACATCTGGACAGACGAACT 59.930 43.478 3.82 0.00 40.75 3.01
772 773 2.029020 CCTCAAACATCTGGACAGACGA 60.029 50.000 3.82 0.00 40.75 4.20
777 778 4.574674 AATAGCCTCAAACATCTGGACA 57.425 40.909 0.00 0.00 0.00 4.02
780 781 5.649395 TCTCAAAATAGCCTCAAACATCTGG 59.351 40.000 0.00 0.00 0.00 3.86
781 782 6.549952 GTCTCAAAATAGCCTCAAACATCTG 58.450 40.000 0.00 0.00 0.00 2.90
797 798 0.462225 TGCACCCGAACGTCTCAAAA 60.462 50.000 0.00 0.00 0.00 2.44
809 810 0.464036 TAGGTTAGCATCTGCACCCG 59.536 55.000 4.79 0.00 45.16 5.28
845 846 2.604174 CCCCACACGAAGCAACGAC 61.604 63.158 9.33 0.00 37.03 4.34
1205 1239 1.759299 CGGGATCGGGGGAACAGTA 60.759 63.158 0.00 0.00 0.00 2.74
1217 1251 2.491693 TCCAAACAATTTGAGCGGGATC 59.508 45.455 2.79 0.00 43.26 3.36
1218 1252 2.493278 CTCCAAACAATTTGAGCGGGAT 59.507 45.455 2.79 0.00 43.26 3.85
1219 1253 1.885887 CTCCAAACAATTTGAGCGGGA 59.114 47.619 2.79 3.98 43.26 5.14
1221 1255 1.613437 ACCTCCAAACAATTTGAGCGG 59.387 47.619 2.79 0.33 43.26 5.52
1223 1257 2.289010 CCCACCTCCAAACAATTTGAGC 60.289 50.000 2.79 0.00 43.26 4.26
1225 1272 3.230134 CTCCCACCTCCAAACAATTTGA 58.770 45.455 2.79 0.00 43.26 2.69
1234 1281 2.852075 AACCGCTCCCACCTCCAA 60.852 61.111 0.00 0.00 0.00 3.53
1236 1283 2.523453 GAAGAACCGCTCCCACCTCC 62.523 65.000 0.00 0.00 0.00 4.30
1241 1288 1.278127 CTTAAGGAAGAACCGCTCCCA 59.722 52.381 0.00 0.00 44.74 4.37
1257 1329 1.641552 CCCCTTCCCCGCATCCTTAA 61.642 60.000 0.00 0.00 0.00 1.85
1259 1331 3.420482 CCCCTTCCCCGCATCCTT 61.420 66.667 0.00 0.00 0.00 3.36
1260 1332 4.760220 ACCCCTTCCCCGCATCCT 62.760 66.667 0.00 0.00 0.00 3.24
1277 1453 4.696402 GGCAATTTTGATCAATCCAAAGCA 59.304 37.500 9.40 0.00 35.29 3.91
1281 1457 4.493547 GTCGGCAATTTTGATCAATCCAA 58.506 39.130 9.40 0.88 0.00 3.53
1289 1589 2.151202 ACACTCGTCGGCAATTTTGAT 58.849 42.857 0.00 0.00 0.00 2.57
1310 1610 4.329801 TCGGAACAATCGAATGAATCTGTG 59.670 41.667 7.64 1.18 33.42 3.66
1311 1611 4.503910 TCGGAACAATCGAATGAATCTGT 58.496 39.130 7.64 0.00 33.42 3.41
1319 1619 3.003689 GCCATTGATCGGAACAATCGAAT 59.996 43.478 10.16 0.00 40.15 3.34
1331 1631 0.249197 TCTCAGCTCGCCATTGATCG 60.249 55.000 0.00 0.00 0.00 3.69
1348 1648 1.474677 CGATCTGGGCATTCAGCTTCT 60.475 52.381 0.00 0.00 44.79 2.85
1350 1650 0.543277 TCGATCTGGGCATTCAGCTT 59.457 50.000 0.00 0.00 44.79 3.74
1354 1654 1.833630 AGTTCTCGATCTGGGCATTCA 59.166 47.619 0.00 0.00 0.00 2.57
1356 1656 1.134280 CCAGTTCTCGATCTGGGCATT 60.134 52.381 17.95 0.00 45.11 3.56
1388 1688 3.470888 ATCCTGGGCGAACTCCGG 61.471 66.667 0.00 0.00 39.04 5.14
1390 1690 1.450312 CACATCCTGGGCGAACTCC 60.450 63.158 0.00 0.00 0.00 3.85
1391 1691 0.321653 AACACATCCTGGGCGAACTC 60.322 55.000 0.00 0.00 0.00 3.01
1396 1696 1.926511 GAGCAAACACATCCTGGGCG 61.927 60.000 0.00 0.00 0.00 6.13
1398 1698 1.619654 TTGAGCAAACACATCCTGGG 58.380 50.000 0.00 0.00 0.00 4.45
1400 1700 3.189080 TCGATTTGAGCAAACACATCCTG 59.811 43.478 0.00 0.00 32.51 3.86
1405 1705 2.159430 CGGATCGATTTGAGCAAACACA 59.841 45.455 0.00 0.00 33.60 3.72
1409 1709 4.394610 TCATTTCGGATCGATTTGAGCAAA 59.605 37.500 0.00 0.00 35.23 3.68
1416 1716 3.560636 ACCCTCATTTCGGATCGATTT 57.439 42.857 0.00 0.00 35.23 2.17
1451 1751 0.471591 TTCACCCCCAAGCAAGCAAT 60.472 50.000 0.00 0.00 0.00 3.56
1459 1759 4.352893 AGTTCCAATATTTCACCCCCAAG 58.647 43.478 0.00 0.00 0.00 3.61
1460 1760 4.202727 TGAGTTCCAATATTTCACCCCCAA 60.203 41.667 0.00 0.00 0.00 4.12
1461 1761 3.335183 TGAGTTCCAATATTTCACCCCCA 59.665 43.478 0.00 0.00 0.00 4.96
1462 1762 3.976015 TGAGTTCCAATATTTCACCCCC 58.024 45.455 0.00 0.00 0.00 5.40
1463 1763 4.956075 ACATGAGTTCCAATATTTCACCCC 59.044 41.667 0.00 0.00 0.00 4.95
1485 1785 2.094545 CCCGTTACACACTACCAGGTAC 60.095 54.545 0.00 0.00 0.00 3.34
1486 1786 2.170166 CCCGTTACACACTACCAGGTA 58.830 52.381 0.00 0.00 0.00 3.08
1487 1787 0.971386 CCCGTTACACACTACCAGGT 59.029 55.000 0.00 0.00 0.00 4.00
1488 1788 1.259609 TCCCGTTACACACTACCAGG 58.740 55.000 0.00 0.00 0.00 4.45
1489 1789 2.494471 TCATCCCGTTACACACTACCAG 59.506 50.000 0.00 0.00 0.00 4.00
1490 1790 2.231964 GTCATCCCGTTACACACTACCA 59.768 50.000 0.00 0.00 0.00 3.25
1491 1791 2.231964 TGTCATCCCGTTACACACTACC 59.768 50.000 0.00 0.00 0.00 3.18
1492 1792 3.508762 CTGTCATCCCGTTACACACTAC 58.491 50.000 0.00 0.00 0.00 2.73
1523 1827 3.317993 GGTGGTGCACAAACATTCTAGTT 59.682 43.478 20.43 0.00 35.86 2.24
1532 1836 1.203523 TCAAACAGGTGGTGCACAAAC 59.796 47.619 20.43 10.97 35.86 2.93
1534 1838 1.408340 CATCAAACAGGTGGTGCACAA 59.592 47.619 20.43 3.78 35.86 3.33
1554 1858 4.096081 ACATCTAGTAGGTACTCGTTGTGC 59.904 45.833 0.00 0.00 41.75 4.57
1555 1859 5.353400 TGACATCTAGTAGGTACTCGTTGTG 59.647 44.000 9.09 2.21 41.75 3.33
1556 1860 5.494724 TGACATCTAGTAGGTACTCGTTGT 58.505 41.667 0.00 5.51 41.75 3.32
1557 1861 6.432607 TTGACATCTAGTAGGTACTCGTTG 57.567 41.667 0.00 0.00 41.75 4.10
1558 1862 7.458409 TTTTGACATCTAGTAGGTACTCGTT 57.542 36.000 0.00 0.00 41.75 3.85
1559 1863 7.458409 TTTTTGACATCTAGTAGGTACTCGT 57.542 36.000 0.00 0.00 41.75 4.18
1598 1930 9.484806 ACAATCTTAAATCCTGATTTTCCAGAT 57.515 29.630 10.15 11.20 40.99 2.90
1599 1931 8.884124 ACAATCTTAAATCCTGATTTTCCAGA 57.116 30.769 10.15 9.74 40.99 3.86
1600 1932 9.933723 AAACAATCTTAAATCCTGATTTTCCAG 57.066 29.630 10.15 5.47 40.99 3.86
1601 1933 9.927668 GAAACAATCTTAAATCCTGATTTTCCA 57.072 29.630 10.15 0.00 40.99 3.53
1602 1934 9.371136 GGAAACAATCTTAAATCCTGATTTTCC 57.629 33.333 10.15 4.87 40.99 3.13
1610 1942 5.332743 TGGCAGGAAACAATCTTAAATCCT 58.667 37.500 0.00 0.00 37.79 3.24
1611 1943 5.185828 ACTGGCAGGAAACAATCTTAAATCC 59.814 40.000 20.34 0.00 0.00 3.01
1612 1944 6.272822 ACTGGCAGGAAACAATCTTAAATC 57.727 37.500 20.34 0.00 0.00 2.17
1613 1945 6.948309 AGTACTGGCAGGAAACAATCTTAAAT 59.052 34.615 20.34 0.00 0.00 1.40
1619 1951 3.674997 TCAGTACTGGCAGGAAACAATC 58.325 45.455 22.48 0.00 0.00 2.67
1632 1964 4.270566 GCTCTTTCATCAGCATCAGTACTG 59.729 45.833 17.17 17.17 35.56 2.74
1641 1973 3.194116 GGGATTTTGCTCTTTCATCAGCA 59.806 43.478 0.00 0.00 44.02 4.41
1643 1975 4.021916 AGGGGATTTTGCTCTTTCATCAG 58.978 43.478 0.00 0.00 0.00 2.90
1644 1976 4.051661 AGGGGATTTTGCTCTTTCATCA 57.948 40.909 0.00 0.00 0.00 3.07
1651 1983 1.635487 TGCACTAGGGGATTTTGCTCT 59.365 47.619 0.00 0.00 34.18 4.09
1652 1984 2.128771 TGCACTAGGGGATTTTGCTC 57.871 50.000 0.00 0.00 34.18 4.26
1653 1985 2.171003 GTTGCACTAGGGGATTTTGCT 58.829 47.619 0.00 0.00 34.18 3.91
1654 1986 1.204704 GGTTGCACTAGGGGATTTTGC 59.795 52.381 0.00 0.00 0.00 3.68
1655 1987 2.231235 GTGGTTGCACTAGGGGATTTTG 59.769 50.000 0.00 0.00 0.00 2.44
1656 1988 2.525368 GTGGTTGCACTAGGGGATTTT 58.475 47.619 0.00 0.00 0.00 1.82
1657 1989 1.272480 GGTGGTTGCACTAGGGGATTT 60.272 52.381 0.00 0.00 0.00 2.17
1658 1990 0.331616 GGTGGTTGCACTAGGGGATT 59.668 55.000 0.00 0.00 0.00 3.01
1666 1998 1.045407 TTCTCTACGGTGGTTGCACT 58.955 50.000 0.00 0.00 0.00 4.40
1672 2004 0.981183 TGGCATTTCTCTACGGTGGT 59.019 50.000 0.00 0.00 0.00 4.16
1676 2008 1.927174 CGACTTGGCATTTCTCTACGG 59.073 52.381 0.00 0.00 0.00 4.02
1677 2009 2.876091 TCGACTTGGCATTTCTCTACG 58.124 47.619 0.00 0.00 0.00 3.51
1683 2015 4.035558 TGATGCTTATCGACTTGGCATTTC 59.964 41.667 14.86 7.75 42.57 2.17
1686 2018 3.198409 TGATGCTTATCGACTTGGCAT 57.802 42.857 14.00 14.00 44.73 4.40
1687 2019 2.689553 TGATGCTTATCGACTTGGCA 57.310 45.000 6.64 6.64 37.32 4.92
1688 2020 3.397482 AGATGATGCTTATCGACTTGGC 58.603 45.455 0.00 0.00 0.00 4.52
1689 2021 3.672397 CGAGATGATGCTTATCGACTTGG 59.328 47.826 0.00 0.00 35.47 3.61
1692 2024 2.352225 GCCGAGATGATGCTTATCGACT 60.352 50.000 0.00 0.00 35.47 4.18
1693 2025 1.989165 GCCGAGATGATGCTTATCGAC 59.011 52.381 0.00 0.00 35.47 4.20
1694 2026 1.889170 AGCCGAGATGATGCTTATCGA 59.111 47.619 0.00 0.00 35.47 3.59
1695 2027 2.257894 GAGCCGAGATGATGCTTATCG 58.742 52.381 0.00 0.00 34.99 2.92
1696 2028 3.252400 CTGAGCCGAGATGATGCTTATC 58.748 50.000 0.00 0.00 34.99 1.75
1714 2053 4.209538 CCCTATGATCAAACATTGGCTGA 58.790 43.478 0.00 0.00 40.14 4.26
1717 2056 2.961062 AGCCCTATGATCAAACATTGGC 59.039 45.455 0.00 6.71 42.20 4.52
1725 2064 1.413118 TGCTCGAGCCCTATGATCAA 58.587 50.000 33.23 8.85 41.18 2.57
1726 2065 1.069204 GTTGCTCGAGCCCTATGATCA 59.931 52.381 33.23 9.65 41.18 2.92
1728 2067 1.342819 GAGTTGCTCGAGCCCTATGAT 59.657 52.381 33.23 12.90 41.18 2.45
1732 2071 1.605058 GGTGAGTTGCTCGAGCCCTA 61.605 60.000 33.23 16.64 41.18 3.53
1738 2077 3.059982 CCCAGGTGAGTTGCTCGA 58.940 61.111 0.00 0.00 32.35 4.04
1739 2078 2.743928 GCCCAGGTGAGTTGCTCG 60.744 66.667 0.00 0.00 32.35 5.03
1740 2079 2.743928 CGCCCAGGTGAGTTGCTC 60.744 66.667 0.00 0.00 0.00 4.26
1746 2089 1.961277 GTGAACACGCCCAGGTGAG 60.961 63.158 3.80 0.00 40.38 3.51
1795 2138 8.688747 ATTGCCACATTTCCTTGAAATAAAAA 57.311 26.923 2.01 0.00 39.82 1.94
1796 2139 9.784531 TTATTGCCACATTTCCTTGAAATAAAA 57.215 25.926 2.01 0.00 39.82 1.52
1797 2140 9.213799 GTTATTGCCACATTTCCTTGAAATAAA 57.786 29.630 2.01 0.00 39.82 1.40
1798 2141 8.592809 AGTTATTGCCACATTTCCTTGAAATAA 58.407 29.630 2.01 0.00 39.82 1.40
1799 2142 8.133024 AGTTATTGCCACATTTCCTTGAAATA 57.867 30.769 2.01 0.00 39.82 1.40
1800 2143 7.008021 AGTTATTGCCACATTTCCTTGAAAT 57.992 32.000 0.00 0.00 42.14 2.17
1801 2144 6.418057 AGTTATTGCCACATTTCCTTGAAA 57.582 33.333 0.00 0.00 35.94 2.69
1802 2145 6.418057 AAGTTATTGCCACATTTCCTTGAA 57.582 33.333 0.00 0.00 0.00 2.69
1803 2146 6.222389 CAAAGTTATTGCCACATTTCCTTGA 58.778 36.000 0.00 0.00 0.00 3.02
1804 2147 5.106987 GCAAAGTTATTGCCACATTTCCTTG 60.107 40.000 1.80 0.00 39.38 3.61
1805 2148 4.996758 GCAAAGTTATTGCCACATTTCCTT 59.003 37.500 1.80 0.00 39.38 3.36
1806 2149 4.284234 AGCAAAGTTATTGCCACATTTCCT 59.716 37.500 9.37 0.00 45.98 3.36
1807 2150 4.568956 AGCAAAGTTATTGCCACATTTCC 58.431 39.130 9.37 0.00 45.98 3.13
1808 2151 5.119125 GTGAGCAAAGTTATTGCCACATTTC 59.881 40.000 20.04 9.13 45.98 2.17
1809 2152 4.990426 GTGAGCAAAGTTATTGCCACATTT 59.010 37.500 20.04 1.60 45.98 2.32
1810 2153 4.559153 GTGAGCAAAGTTATTGCCACATT 58.441 39.130 20.04 2.17 45.98 2.71
1811 2154 3.056607 GGTGAGCAAAGTTATTGCCACAT 60.057 43.478 23.31 5.24 45.98 3.21
1812 2155 2.295909 GGTGAGCAAAGTTATTGCCACA 59.704 45.455 23.31 16.05 45.98 4.17
1813 2156 2.295909 TGGTGAGCAAAGTTATTGCCAC 59.704 45.455 18.24 18.24 45.98 5.01
1814 2157 2.591923 TGGTGAGCAAAGTTATTGCCA 58.408 42.857 9.37 5.18 45.98 4.92
1815 2158 3.578688 CTTGGTGAGCAAAGTTATTGCC 58.421 45.455 9.37 2.84 45.98 4.52
1816 2159 3.255642 TCCTTGGTGAGCAAAGTTATTGC 59.744 43.478 5.06 5.06 45.22 3.56
1817 2160 4.613622 CGTCCTTGGTGAGCAAAGTTATTG 60.614 45.833 0.00 0.00 0.00 1.90
1818 2161 3.502211 CGTCCTTGGTGAGCAAAGTTATT 59.498 43.478 0.00 0.00 0.00 1.40
1819 2162 3.074412 CGTCCTTGGTGAGCAAAGTTAT 58.926 45.455 0.00 0.00 0.00 1.89
1820 2163 2.103432 TCGTCCTTGGTGAGCAAAGTTA 59.897 45.455 0.00 0.00 0.00 2.24
1821 2164 1.134220 TCGTCCTTGGTGAGCAAAGTT 60.134 47.619 0.00 0.00 0.00 2.66
1822 2165 0.468226 TCGTCCTTGGTGAGCAAAGT 59.532 50.000 0.00 0.00 0.00 2.66
1823 2166 1.593196 TTCGTCCTTGGTGAGCAAAG 58.407 50.000 0.00 0.00 0.00 2.77
1824 2167 2.270352 ATTCGTCCTTGGTGAGCAAA 57.730 45.000 0.00 0.00 0.00 3.68
1825 2168 3.410631 TTATTCGTCCTTGGTGAGCAA 57.589 42.857 0.00 0.00 0.00 3.91
1826 2169 3.071479 GTTTATTCGTCCTTGGTGAGCA 58.929 45.455 0.00 0.00 0.00 4.26
1827 2170 3.071479 TGTTTATTCGTCCTTGGTGAGC 58.929 45.455 0.00 0.00 0.00 4.26
1828 2171 4.315803 ACTGTTTATTCGTCCTTGGTGAG 58.684 43.478 0.00 0.00 0.00 3.51
1829 2172 4.345859 ACTGTTTATTCGTCCTTGGTGA 57.654 40.909 0.00 0.00 0.00 4.02
1830 2173 5.212194 CAAACTGTTTATTCGTCCTTGGTG 58.788 41.667 5.31 0.00 0.00 4.17
1831 2174 4.885325 ACAAACTGTTTATTCGTCCTTGGT 59.115 37.500 5.31 0.00 0.00 3.67
1832 2175 5.432885 ACAAACTGTTTATTCGTCCTTGG 57.567 39.130 5.31 0.00 0.00 3.61
1833 2176 6.413818 GTGAACAAACTGTTTATTCGTCCTTG 59.586 38.462 16.73 0.91 41.28 3.61
1834 2177 6.317893 AGTGAACAAACTGTTTATTCGTCCTT 59.682 34.615 16.73 1.54 41.28 3.36
1835 2178 5.820947 AGTGAACAAACTGTTTATTCGTCCT 59.179 36.000 16.73 10.80 41.28 3.85
1836 2179 6.056428 AGTGAACAAACTGTTTATTCGTCC 57.944 37.500 16.73 9.12 41.28 4.79
1837 2180 7.320560 GCTTAGTGAACAAACTGTTTATTCGTC 59.679 37.037 16.73 12.85 41.28 4.20
1838 2181 7.130269 GCTTAGTGAACAAACTGTTTATTCGT 58.870 34.615 16.73 10.59 41.28 3.85
1839 2182 7.129622 TGCTTAGTGAACAAACTGTTTATTCG 58.870 34.615 16.73 5.98 41.28 3.34
1840 2183 8.850454 TTGCTTAGTGAACAAACTGTTTATTC 57.150 30.769 15.44 15.44 41.28 1.75
1841 2184 7.920682 CCTTGCTTAGTGAACAAACTGTTTATT 59.079 33.333 5.31 0.17 41.28 1.40
1842 2185 7.068226 ACCTTGCTTAGTGAACAAACTGTTTAT 59.932 33.333 5.31 0.00 41.28 1.40
1843 2186 6.376018 ACCTTGCTTAGTGAACAAACTGTTTA 59.624 34.615 5.31 0.00 41.28 2.01
1844 2187 5.185056 ACCTTGCTTAGTGAACAAACTGTTT 59.815 36.000 0.00 0.00 41.28 2.83
1845 2188 4.705023 ACCTTGCTTAGTGAACAAACTGTT 59.295 37.500 0.00 0.00 44.37 3.16
1846 2189 4.270008 ACCTTGCTTAGTGAACAAACTGT 58.730 39.130 0.00 0.00 0.00 3.55
1847 2190 4.900635 ACCTTGCTTAGTGAACAAACTG 57.099 40.909 0.00 0.00 0.00 3.16
1848 2191 4.035208 CGAACCTTGCTTAGTGAACAAACT 59.965 41.667 0.00 0.00 0.00 2.66
1849 2192 4.034742 TCGAACCTTGCTTAGTGAACAAAC 59.965 41.667 0.00 0.00 0.00 2.93
1850 2193 4.193090 TCGAACCTTGCTTAGTGAACAAA 58.807 39.130 0.00 0.00 0.00 2.83
1851 2194 3.799366 TCGAACCTTGCTTAGTGAACAA 58.201 40.909 0.00 0.00 0.00 2.83
1852 2195 3.462483 TCGAACCTTGCTTAGTGAACA 57.538 42.857 0.00 0.00 0.00 3.18
1853 2196 4.927425 TGTATCGAACCTTGCTTAGTGAAC 59.073 41.667 0.00 0.00 0.00 3.18
1854 2197 5.142061 TGTATCGAACCTTGCTTAGTGAA 57.858 39.130 0.00 0.00 0.00 3.18
1855 2198 4.794278 TGTATCGAACCTTGCTTAGTGA 57.206 40.909 0.00 0.00 0.00 3.41
1856 2199 4.092968 GGTTGTATCGAACCTTGCTTAGTG 59.907 45.833 0.00 0.00 42.03 2.74
1857 2200 4.251268 GGTTGTATCGAACCTTGCTTAGT 58.749 43.478 0.00 0.00 42.03 2.24
1858 2201 3.621715 GGGTTGTATCGAACCTTGCTTAG 59.378 47.826 4.10 0.00 44.35 2.18
1859 2202 3.262405 AGGGTTGTATCGAACCTTGCTTA 59.738 43.478 4.10 0.00 44.35 3.09
1860 2203 2.039879 AGGGTTGTATCGAACCTTGCTT 59.960 45.455 4.10 0.00 44.35 3.91
1861 2204 1.628846 AGGGTTGTATCGAACCTTGCT 59.371 47.619 4.10 0.00 44.35 3.91
1862 2205 2.109425 AGGGTTGTATCGAACCTTGC 57.891 50.000 4.10 0.00 44.35 4.01
1863 2206 3.621715 GCTAAGGGTTGTATCGAACCTTG 59.378 47.826 14.52 7.41 44.35 3.61
1864 2207 3.518303 AGCTAAGGGTTGTATCGAACCTT 59.482 43.478 10.63 10.63 44.35 3.50
1865 2208 3.105283 AGCTAAGGGTTGTATCGAACCT 58.895 45.455 4.10 0.00 44.35 3.50
1866 2209 3.538634 AGCTAAGGGTTGTATCGAACC 57.461 47.619 0.00 0.00 44.22 3.62
1867 2210 5.048507 CCTAAGCTAAGGGTTGTATCGAAC 58.951 45.833 0.00 0.00 34.76 3.95
1868 2211 5.272283 CCTAAGCTAAGGGTTGTATCGAA 57.728 43.478 0.00 0.00 34.76 3.71
1869 2212 4.931661 CCTAAGCTAAGGGTTGTATCGA 57.068 45.455 0.00 0.00 34.76 3.59
1879 2222 4.779993 ATTCTGAACCCCTAAGCTAAGG 57.220 45.455 0.00 0.00 36.30 2.69
1880 2223 6.732896 TCTATTCTGAACCCCTAAGCTAAG 57.267 41.667 0.00 0.00 0.00 2.18
1881 2224 6.442564 TGTTCTATTCTGAACCCCTAAGCTAA 59.557 38.462 0.00 0.00 43.96 3.09
1882 2225 5.962031 TGTTCTATTCTGAACCCCTAAGCTA 59.038 40.000 0.00 0.00 43.96 3.32
1883 2226 4.783227 TGTTCTATTCTGAACCCCTAAGCT 59.217 41.667 0.00 0.00 43.96 3.74
1884 2227 5.099042 TGTTCTATTCTGAACCCCTAAGC 57.901 43.478 0.00 0.00 43.96 3.09
1885 2228 7.147549 TGGTATGTTCTATTCTGAACCCCTAAG 60.148 40.741 0.00 0.00 43.96 2.18
1886 2229 6.674861 TGGTATGTTCTATTCTGAACCCCTAA 59.325 38.462 0.00 0.00 43.96 2.69
1887 2230 6.206787 TGGTATGTTCTATTCTGAACCCCTA 58.793 40.000 0.00 0.00 43.96 3.53
1888 2231 5.036916 TGGTATGTTCTATTCTGAACCCCT 58.963 41.667 0.00 0.00 43.96 4.79
1889 2232 5.367945 TGGTATGTTCTATTCTGAACCCC 57.632 43.478 0.00 3.85 43.96 4.95
1890 2233 7.696992 TTTTGGTATGTTCTATTCTGAACCC 57.303 36.000 0.00 1.01 43.96 4.11
1891 2234 9.788960 GATTTTTGGTATGTTCTATTCTGAACC 57.211 33.333 0.00 0.00 43.96 3.62
1903 2246 9.705290 GGTAATGAAGTTGATTTTTGGTATGTT 57.295 29.630 0.00 0.00 0.00 2.71
1904 2247 9.088987 AGGTAATGAAGTTGATTTTTGGTATGT 57.911 29.630 0.00 0.00 0.00 2.29
1905 2248 9.357652 CAGGTAATGAAGTTGATTTTTGGTATG 57.642 33.333 0.00 0.00 0.00 2.39
1906 2249 8.531146 CCAGGTAATGAAGTTGATTTTTGGTAT 58.469 33.333 0.00 0.00 0.00 2.73
1907 2250 7.524698 GCCAGGTAATGAAGTTGATTTTTGGTA 60.525 37.037 11.12 0.00 0.00 3.25
1908 2251 6.741240 GCCAGGTAATGAAGTTGATTTTTGGT 60.741 38.462 11.12 0.00 0.00 3.67
1909 2252 5.639082 GCCAGGTAATGAAGTTGATTTTTGG 59.361 40.000 0.00 1.22 0.00 3.28
1910 2253 5.639082 GGCCAGGTAATGAAGTTGATTTTTG 59.361 40.000 0.00 0.00 0.00 2.44
1911 2254 5.279960 GGGCCAGGTAATGAAGTTGATTTTT 60.280 40.000 4.39 0.00 0.00 1.94
1912 2255 4.222810 GGGCCAGGTAATGAAGTTGATTTT 59.777 41.667 4.39 0.00 0.00 1.82
1913 2256 3.769300 GGGCCAGGTAATGAAGTTGATTT 59.231 43.478 4.39 0.00 0.00 2.17
1914 2257 3.245586 TGGGCCAGGTAATGAAGTTGATT 60.246 43.478 0.00 0.00 0.00 2.57
1915 2258 2.311542 TGGGCCAGGTAATGAAGTTGAT 59.688 45.455 0.00 0.00 0.00 2.57
1916 2259 1.707989 TGGGCCAGGTAATGAAGTTGA 59.292 47.619 0.00 0.00 0.00 3.18
1917 2260 2.214376 TGGGCCAGGTAATGAAGTTG 57.786 50.000 0.00 0.00 0.00 3.16
1918 2261 4.536765 CTTATGGGCCAGGTAATGAAGTT 58.463 43.478 13.78 0.00 0.00 2.66
1919 2262 3.688414 GCTTATGGGCCAGGTAATGAAGT 60.688 47.826 13.78 0.00 0.00 3.01
1920 2263 2.887152 GCTTATGGGCCAGGTAATGAAG 59.113 50.000 13.78 7.52 0.00 3.02
1921 2264 2.243478 TGCTTATGGGCCAGGTAATGAA 59.757 45.455 13.78 0.00 0.00 2.57
1922 2265 1.849692 TGCTTATGGGCCAGGTAATGA 59.150 47.619 13.78 0.00 0.00 2.57
1923 2266 2.363306 TGCTTATGGGCCAGGTAATG 57.637 50.000 13.78 2.67 0.00 1.90
1924 2267 2.446666 TGATGCTTATGGGCCAGGTAAT 59.553 45.455 13.78 1.46 0.00 1.89
1925 2268 1.849692 TGATGCTTATGGGCCAGGTAA 59.150 47.619 13.78 5.85 0.00 2.85
1926 2269 1.517238 TGATGCTTATGGGCCAGGTA 58.483 50.000 13.78 4.73 0.00 3.08
1927 2270 0.855598 ATGATGCTTATGGGCCAGGT 59.144 50.000 13.78 0.00 0.00 4.00
1928 2271 1.075050 AGATGATGCTTATGGGCCAGG 59.925 52.381 13.78 5.95 0.00 4.45
1929 2272 2.557056 CAAGATGATGCTTATGGGCCAG 59.443 50.000 13.78 0.00 0.00 4.85
1930 2273 2.589720 CAAGATGATGCTTATGGGCCA 58.410 47.619 9.61 9.61 0.00 5.36
1931 2274 1.891150 CCAAGATGATGCTTATGGGCC 59.109 52.381 0.00 0.00 0.00 5.80
1932 2275 1.271656 GCCAAGATGATGCTTATGGGC 59.728 52.381 0.00 0.00 30.49 5.36
1933 2276 1.891150 GGCCAAGATGATGCTTATGGG 59.109 52.381 0.00 0.00 0.00 4.00
1934 2277 1.891150 GGGCCAAGATGATGCTTATGG 59.109 52.381 4.39 0.00 0.00 2.74
1935 2278 2.589720 TGGGCCAAGATGATGCTTATG 58.410 47.619 2.13 0.00 0.00 1.90
1936 2279 3.162666 CATGGGCCAAGATGATGCTTAT 58.837 45.455 11.89 0.00 0.00 1.73
1937 2280 2.589720 CATGGGCCAAGATGATGCTTA 58.410 47.619 11.89 0.00 0.00 3.09
1938 2281 1.410004 CATGGGCCAAGATGATGCTT 58.590 50.000 11.89 0.00 0.00 3.91
1939 2282 1.113517 GCATGGGCCAAGATGATGCT 61.114 55.000 11.89 0.00 37.13 3.79
1940 2283 1.366366 GCATGGGCCAAGATGATGC 59.634 57.895 11.89 11.59 33.23 3.91
1941 2284 0.673985 CTGCATGGGCCAAGATGATG 59.326 55.000 11.89 3.82 40.13 3.07
1942 2285 0.260816 ACTGCATGGGCCAAGATGAT 59.739 50.000 11.89 0.00 40.13 2.45
1943 2286 0.681887 CACTGCATGGGCCAAGATGA 60.682 55.000 11.89 0.00 40.13 2.92
1944 2287 1.813859 CACTGCATGGGCCAAGATG 59.186 57.895 11.89 5.62 40.13 2.90
1945 2288 2.056223 GCACTGCATGGGCCAAGAT 61.056 57.895 11.89 0.00 39.71 2.40
1946 2289 2.677524 GCACTGCATGGGCCAAGA 60.678 61.111 11.89 0.00 39.71 3.02
1952 2295 0.393944 ATGAGTGAGCACTGCATGGG 60.394 55.000 8.03 0.00 42.66 4.00
1953 2296 2.210961 CTATGAGTGAGCACTGCATGG 58.789 52.381 8.03 9.22 42.66 3.66
1954 2297 2.210961 CCTATGAGTGAGCACTGCATG 58.789 52.381 8.03 0.00 42.66 4.06
1955 2298 1.140452 CCCTATGAGTGAGCACTGCAT 59.860 52.381 8.03 12.60 42.66 3.96
1956 2299 0.538584 CCCTATGAGTGAGCACTGCA 59.461 55.000 8.03 6.55 42.66 4.41
1957 2300 0.813210 GCCCTATGAGTGAGCACTGC 60.813 60.000 8.03 0.37 42.66 4.40
1958 2301 0.829333 AGCCCTATGAGTGAGCACTG 59.171 55.000 8.03 0.00 42.66 3.66
1959 2302 0.829333 CAGCCCTATGAGTGAGCACT 59.171 55.000 2.20 2.20 45.84 4.40
1960 2303 0.826715 TCAGCCCTATGAGTGAGCAC 59.173 55.000 0.00 0.00 0.00 4.40
1961 2304 1.483827 CTTCAGCCCTATGAGTGAGCA 59.516 52.381 0.00 0.00 0.00 4.26
1962 2305 1.809651 GCTTCAGCCCTATGAGTGAGC 60.810 57.143 0.00 0.00 34.31 4.26
1963 2306 1.761784 AGCTTCAGCCCTATGAGTGAG 59.238 52.381 0.00 0.00 43.38 3.51
1964 2307 1.871418 AGCTTCAGCCCTATGAGTGA 58.129 50.000 0.00 0.00 43.38 3.41
1965 2308 2.961741 TCTAGCTTCAGCCCTATGAGTG 59.038 50.000 0.00 0.00 43.38 3.51
1966 2309 3.320610 TCTAGCTTCAGCCCTATGAGT 57.679 47.619 0.00 0.00 43.38 3.41
1967 2310 4.679373 TTTCTAGCTTCAGCCCTATGAG 57.321 45.455 0.00 0.00 43.38 2.90
1968 2311 5.130975 TGATTTTCTAGCTTCAGCCCTATGA 59.869 40.000 0.00 0.00 43.38 2.15
1969 2312 5.238214 GTGATTTTCTAGCTTCAGCCCTATG 59.762 44.000 0.00 0.00 43.38 2.23
1970 2313 5.104360 TGTGATTTTCTAGCTTCAGCCCTAT 60.104 40.000 0.00 0.00 43.38 2.57
1971 2314 4.225042 TGTGATTTTCTAGCTTCAGCCCTA 59.775 41.667 0.00 0.00 43.38 3.53
1972 2315 3.009473 TGTGATTTTCTAGCTTCAGCCCT 59.991 43.478 0.00 0.00 43.38 5.19
1973 2316 3.347216 TGTGATTTTCTAGCTTCAGCCC 58.653 45.455 0.00 0.00 43.38 5.19
1974 2317 4.201990 CCATGTGATTTTCTAGCTTCAGCC 60.202 45.833 0.00 0.00 43.38 4.85
1975 2318 4.637534 TCCATGTGATTTTCTAGCTTCAGC 59.362 41.667 0.00 0.00 42.49 4.26
1976 2319 6.748333 TTCCATGTGATTTTCTAGCTTCAG 57.252 37.500 0.00 0.00 0.00 3.02
1977 2320 6.348458 CGTTTCCATGTGATTTTCTAGCTTCA 60.348 38.462 0.00 0.00 0.00 3.02
1978 2321 6.024049 CGTTTCCATGTGATTTTCTAGCTTC 58.976 40.000 0.00 0.00 0.00 3.86
1979 2322 5.473504 ACGTTTCCATGTGATTTTCTAGCTT 59.526 36.000 0.00 0.00 0.00 3.74
1980 2323 5.003804 ACGTTTCCATGTGATTTTCTAGCT 58.996 37.500 0.00 0.00 0.00 3.32
1981 2324 5.296813 ACGTTTCCATGTGATTTTCTAGC 57.703 39.130 0.00 0.00 0.00 3.42
1982 2325 7.359595 TCAAACGTTTCCATGTGATTTTCTAG 58.640 34.615 11.37 0.00 0.00 2.43
1983 2326 7.012894 ACTCAAACGTTTCCATGTGATTTTCTA 59.987 33.333 11.37 0.00 0.00 2.10
1984 2327 6.142818 TCAAACGTTTCCATGTGATTTTCT 57.857 33.333 11.37 0.00 0.00 2.52
1985 2328 5.977129 ACTCAAACGTTTCCATGTGATTTTC 59.023 36.000 11.37 0.00 0.00 2.29
1986 2329 5.901552 ACTCAAACGTTTCCATGTGATTTT 58.098 33.333 11.37 0.00 0.00 1.82
1987 2330 5.514274 ACTCAAACGTTTCCATGTGATTT 57.486 34.783 11.37 0.00 0.00 2.17
1988 2331 5.280945 CAACTCAAACGTTTCCATGTGATT 58.719 37.500 11.37 0.00 0.00 2.57
1989 2332 4.261572 CCAACTCAAACGTTTCCATGTGAT 60.262 41.667 11.37 0.00 0.00 3.06
1990 2333 3.066064 CCAACTCAAACGTTTCCATGTGA 59.934 43.478 11.37 4.18 0.00 3.58
1991 2334 3.066064 TCCAACTCAAACGTTTCCATGTG 59.934 43.478 11.37 4.44 0.00 3.21
1992 2335 3.283751 TCCAACTCAAACGTTTCCATGT 58.716 40.909 11.37 4.86 0.00 3.21
1993 2336 3.980646 TCCAACTCAAACGTTTCCATG 57.019 42.857 11.37 7.95 0.00 3.66
1994 2337 4.582656 TGAATCCAACTCAAACGTTTCCAT 59.417 37.500 11.37 0.00 0.00 3.41
1995 2338 3.948473 TGAATCCAACTCAAACGTTTCCA 59.052 39.130 11.37 0.00 0.00 3.53
1996 2339 4.274950 TCTGAATCCAACTCAAACGTTTCC 59.725 41.667 11.37 0.00 0.00 3.13
1997 2340 5.418310 TCTGAATCCAACTCAAACGTTTC 57.582 39.130 11.37 0.00 0.00 2.78
1998 2341 5.530915 TGATCTGAATCCAACTCAAACGTTT 59.469 36.000 7.96 7.96 0.00 3.60
1999 2342 5.063204 TGATCTGAATCCAACTCAAACGTT 58.937 37.500 0.00 0.00 0.00 3.99
2000 2343 4.641396 TGATCTGAATCCAACTCAAACGT 58.359 39.130 0.00 0.00 0.00 3.99
2001 2344 5.808042 ATGATCTGAATCCAACTCAAACG 57.192 39.130 0.00 0.00 0.00 3.60
2002 2345 8.674263 AGATATGATCTGAATCCAACTCAAAC 57.326 34.615 0.00 0.00 38.44 2.93
2003 2346 9.770097 GTAGATATGATCTGAATCCAACTCAAA 57.230 33.333 0.00 0.00 40.51 2.69
2004 2347 8.370940 GGTAGATATGATCTGAATCCAACTCAA 58.629 37.037 0.00 0.00 40.51 3.02
2005 2348 7.732140 AGGTAGATATGATCTGAATCCAACTCA 59.268 37.037 0.00 0.00 40.51 3.41
2006 2349 8.034215 CAGGTAGATATGATCTGAATCCAACTC 58.966 40.741 0.00 0.00 40.51 3.01
2007 2350 7.038445 CCAGGTAGATATGATCTGAATCCAACT 60.038 40.741 0.00 0.00 40.51 3.16
2008 2351 7.038729 TCCAGGTAGATATGATCTGAATCCAAC 60.039 40.741 0.00 0.00 40.51 3.77
2009 2352 7.018769 TCCAGGTAGATATGATCTGAATCCAA 58.981 38.462 0.00 0.00 40.51 3.53
2010 2353 6.565036 TCCAGGTAGATATGATCTGAATCCA 58.435 40.000 0.00 0.00 40.51 3.41
2011 2354 7.487822 TTCCAGGTAGATATGATCTGAATCC 57.512 40.000 0.00 0.00 40.51 3.01
2012 2355 9.956640 AATTTCCAGGTAGATATGATCTGAATC 57.043 33.333 0.00 0.00 40.51 2.52
2014 2357 9.565090 CAAATTTCCAGGTAGATATGATCTGAA 57.435 33.333 0.00 0.00 40.51 3.02
2015 2358 8.937835 TCAAATTTCCAGGTAGATATGATCTGA 58.062 33.333 0.00 0.00 40.51 3.27
2016 2359 9.736414 ATCAAATTTCCAGGTAGATATGATCTG 57.264 33.333 0.00 0.00 40.51 2.90
2024 2367 9.927081 AGTAAATCATCAAATTTCCAGGTAGAT 57.073 29.630 0.00 0.00 31.50 1.98
2027 2370 9.527157 TGAAGTAAATCATCAAATTTCCAGGTA 57.473 29.630 0.00 0.00 31.50 3.08
2033 2376 7.550712 AGCCCTGAAGTAAATCATCAAATTTC 58.449 34.615 0.00 0.00 31.50 2.17
2036 2379 6.547510 GGTAGCCCTGAAGTAAATCATCAAAT 59.452 38.462 0.00 0.00 0.00 2.32
2037 2380 5.885912 GGTAGCCCTGAAGTAAATCATCAAA 59.114 40.000 0.00 0.00 0.00 2.69
2038 2381 5.045213 TGGTAGCCCTGAAGTAAATCATCAA 60.045 40.000 0.00 0.00 0.00 2.57
2045 2389 4.412199 AGCATATGGTAGCCCTGAAGTAAA 59.588 41.667 5.40 0.00 0.00 2.01
2056 2400 5.368989 AGGTACAAGAAAGCATATGGTAGC 58.631 41.667 8.04 7.37 0.00 3.58
2057 2401 6.260936 CCAAGGTACAAGAAAGCATATGGTAG 59.739 42.308 8.04 0.00 0.00 3.18
2059 2403 4.949856 CCAAGGTACAAGAAAGCATATGGT 59.050 41.667 0.40 0.40 0.00 3.55
2118 2462 5.482908 AGTCCTAGTGAACAATGTTAGCAG 58.517 41.667 0.00 0.00 0.00 4.24
2119 2463 5.483685 AGTCCTAGTGAACAATGTTAGCA 57.516 39.130 0.00 0.00 0.00 3.49
2125 2469 9.099454 GTTTATTCCTAGTCCTAGTGAACAATG 57.901 37.037 0.96 0.00 30.73 2.82
2126 2470 8.822805 TGTTTATTCCTAGTCCTAGTGAACAAT 58.177 33.333 0.96 0.00 30.73 2.71
2140 2484 9.612620 CAAAGTAAGCAAACTGTTTATTCCTAG 57.387 33.333 5.31 0.00 0.00 3.02
2143 2487 9.908152 ATACAAAGTAAGCAAACTGTTTATTCC 57.092 29.630 5.31 0.00 0.00 3.01
2148 2492 8.899771 ACTACATACAAAGTAAGCAAACTGTTT 58.100 29.630 0.00 0.00 0.00 2.83
2149 2493 8.446599 ACTACATACAAAGTAAGCAAACTGTT 57.553 30.769 0.00 0.00 0.00 3.16
2150 2494 8.985805 GTACTACATACAAAGTAAGCAAACTGT 58.014 33.333 0.00 0.00 33.54 3.55
2151 2495 8.440833 GGTACTACATACAAAGTAAGCAAACTG 58.559 37.037 0.00 0.00 35.23 3.16
2158 2502 8.301720 TCACACTGGTACTACATACAAAGTAAG 58.698 37.037 0.00 0.00 32.96 2.34
2159 2503 8.180706 TCACACTGGTACTACATACAAAGTAA 57.819 34.615 0.00 0.00 32.96 2.24
2161 2505 6.659745 TCACACTGGTACTACATACAAAGT 57.340 37.500 0.00 0.00 35.23 2.66
2163 2507 7.252708 CGTATCACACTGGTACTACATACAAA 58.747 38.462 0.00 0.00 31.94 2.83
2165 2509 5.220912 GCGTATCACACTGGTACTACATACA 60.221 44.000 0.00 0.00 31.94 2.29
2166 2510 5.008415 AGCGTATCACACTGGTACTACATAC 59.992 44.000 0.00 0.00 31.94 2.39
2167 2511 5.008316 CAGCGTATCACACTGGTACTACATA 59.992 44.000 0.00 0.00 31.94 2.29
2168 2512 3.952323 AGCGTATCACACTGGTACTACAT 59.048 43.478 0.00 0.00 31.94 2.29
2173 2517 2.933495 TCAGCGTATCACACTGGTAC 57.067 50.000 0.00 0.00 29.74 3.34
2174 2518 2.100749 CCATCAGCGTATCACACTGGTA 59.899 50.000 0.00 0.00 29.74 3.25
2176 2520 1.136891 TCCATCAGCGTATCACACTGG 59.863 52.381 0.00 0.00 29.74 4.00
2179 2523 6.868864 AGTTTATATCCATCAGCGTATCACAC 59.131 38.462 0.00 0.00 0.00 3.82
2187 2531 7.981789 ACACCATATAGTTTATATCCATCAGCG 59.018 37.037 0.00 0.00 0.00 5.18
2188 2532 9.672673 AACACCATATAGTTTATATCCATCAGC 57.327 33.333 0.00 0.00 0.00 4.26
2204 2648 9.489084 GACATCTGCACTATAAAACACCATATA 57.511 33.333 0.00 0.00 0.00 0.86
2231 2675 7.362056 GGAAGAAAAGTAATAATCTGTGCAGCA 60.362 37.037 0.00 0.00 0.00 4.41
2248 2692 8.314751 TGTATAGAGAGGAAACTGGAAGAAAAG 58.685 37.037 0.00 0.00 44.43 2.27
2251 2695 7.792364 TTGTATAGAGAGGAAACTGGAAGAA 57.208 36.000 0.00 0.00 44.43 2.52
2281 2725 5.817296 TGCGAATCAGCAACAAGATATTACT 59.183 36.000 0.00 0.00 45.06 2.24
2303 2747 3.454371 AGGTACGGATAGACAATGTGC 57.546 47.619 0.00 0.00 0.00 4.57
2316 2760 7.654923 GGAATAAGTAAGTTGGATAAGGTACGG 59.345 40.741 0.00 0.00 0.00 4.02
2318 2762 9.543783 CAGGAATAAGTAAGTTGGATAAGGTAC 57.456 37.037 0.00 0.00 0.00 3.34
2320 2764 8.047310 CACAGGAATAAGTAAGTTGGATAAGGT 58.953 37.037 0.00 0.00 0.00 3.50
2321 2765 8.047310 ACACAGGAATAAGTAAGTTGGATAAGG 58.953 37.037 0.00 0.00 0.00 2.69
2323 2767 9.226606 CAACACAGGAATAAGTAAGTTGGATAA 57.773 33.333 0.00 0.00 33.44 1.75
2324 2768 8.786826 CAACACAGGAATAAGTAAGTTGGATA 57.213 34.615 0.00 0.00 33.44 2.59
2327 2771 6.254281 CCAACACAGGAATAAGTAAGTTGG 57.746 41.667 0.00 0.00 45.75 3.77
2328 2772 5.768164 ACCCAACACAGGAATAAGTAAGTTG 59.232 40.000 0.00 0.00 35.97 3.16
2329 2773 5.948842 ACCCAACACAGGAATAAGTAAGTT 58.051 37.500 0.00 0.00 0.00 2.66
2330 2774 5.578157 ACCCAACACAGGAATAAGTAAGT 57.422 39.130 0.00 0.00 0.00 2.24
2331 2775 6.708285 AGTACCCAACACAGGAATAAGTAAG 58.292 40.000 0.00 0.00 0.00 2.34
2332 2776 6.691255 AGTACCCAACACAGGAATAAGTAA 57.309 37.500 0.00 0.00 0.00 2.24
2333 2777 7.842743 AGATAGTACCCAACACAGGAATAAGTA 59.157 37.037 0.00 0.00 0.00 2.24
2334 2778 6.672657 AGATAGTACCCAACACAGGAATAAGT 59.327 38.462 0.00 0.00 0.00 2.24
2442 2892 3.076104 CTGTACAGCAGCTCCATGG 57.924 57.895 10.54 4.97 38.52 3.66
2484 2934 3.838244 ACCAGCAGATTTATAAGGCGA 57.162 42.857 0.00 0.00 0.00 5.54
2613 3063 4.192317 GGCAGAACAGAGTATAAACCTGG 58.808 47.826 0.00 0.00 31.75 4.45
2637 3087 7.521529 TCTGAAATAAATGAAGTCAGCTTTCG 58.478 34.615 0.00 0.00 36.48 3.46
2665 3116 6.209589 TGGCTATATCTCTTGTGTCCACTATC 59.790 42.308 0.00 0.00 0.00 2.08
2672 3123 7.877097 AGATCATTTGGCTATATCTCTTGTGTC 59.123 37.037 0.00 0.00 0.00 3.67
2702 3153 3.130340 GTCTTCTTGTGGTGGCTGAAAAA 59.870 43.478 0.00 0.00 0.00 1.94
2755 3206 5.105877 CGACAACTATTTCAGTACAGAGGGA 60.106 44.000 0.00 0.00 36.04 4.20
2756 3207 5.103000 CGACAACTATTTCAGTACAGAGGG 58.897 45.833 0.00 0.00 36.04 4.30
2757 3208 4.563184 GCGACAACTATTTCAGTACAGAGG 59.437 45.833 0.00 0.00 36.04 3.69
2758 3209 5.287274 CAGCGACAACTATTTCAGTACAGAG 59.713 44.000 0.00 0.00 36.04 3.35
2759 3210 5.161358 CAGCGACAACTATTTCAGTACAGA 58.839 41.667 0.00 0.00 36.04 3.41
2760 3211 4.327357 CCAGCGACAACTATTTCAGTACAG 59.673 45.833 0.00 0.00 36.04 2.74
2761 3212 4.021807 TCCAGCGACAACTATTTCAGTACA 60.022 41.667 0.00 0.00 36.04 2.90
2762 3213 4.491676 TCCAGCGACAACTATTTCAGTAC 58.508 43.478 0.00 0.00 36.04 2.73
2763 3214 4.219944 ACTCCAGCGACAACTATTTCAGTA 59.780 41.667 0.00 0.00 36.04 2.74
2764 3215 3.006967 ACTCCAGCGACAACTATTTCAGT 59.993 43.478 0.00 0.00 40.05 3.41
2765 3216 3.589988 ACTCCAGCGACAACTATTTCAG 58.410 45.455 0.00 0.00 0.00 3.02
2766 3217 3.678056 ACTCCAGCGACAACTATTTCA 57.322 42.857 0.00 0.00 0.00 2.69
2767 3218 3.552294 GCTACTCCAGCGACAACTATTTC 59.448 47.826 0.00 0.00 41.37 2.17
2768 3219 3.522553 GCTACTCCAGCGACAACTATTT 58.477 45.455 0.00 0.00 41.37 1.40
2769 3220 3.166489 GCTACTCCAGCGACAACTATT 57.834 47.619 0.00 0.00 41.37 1.73
2770 3221 2.873133 GCTACTCCAGCGACAACTAT 57.127 50.000 0.00 0.00 41.37 2.12
2799 3250 3.791887 CGAAATAGTTGTCGCTGGAGTAG 59.208 47.826 0.00 0.00 0.00 2.57
2800 3251 3.428452 CCGAAATAGTTGTCGCTGGAGTA 60.428 47.826 0.00 0.00 35.93 2.59
2801 3252 2.607187 CGAAATAGTTGTCGCTGGAGT 58.393 47.619 0.00 0.00 0.00 3.85
2802 3253 1.927174 CCGAAATAGTTGTCGCTGGAG 59.073 52.381 0.00 0.00 35.93 3.86
2803 3254 1.274167 ACCGAAATAGTTGTCGCTGGA 59.726 47.619 0.00 0.00 35.93 3.86
2804 3255 1.722011 ACCGAAATAGTTGTCGCTGG 58.278 50.000 0.00 0.00 35.93 4.85
2805 3256 3.247442 TGTACCGAAATAGTTGTCGCTG 58.753 45.455 0.00 0.00 35.93 5.18
2806 3257 3.192001 TCTGTACCGAAATAGTTGTCGCT 59.808 43.478 0.00 0.00 35.93 4.93
2807 3258 3.504863 TCTGTACCGAAATAGTTGTCGC 58.495 45.455 0.00 0.00 35.93 5.19
2808 3259 4.103357 CCTCTGTACCGAAATAGTTGTCG 58.897 47.826 0.00 0.00 37.01 4.35
2809 3260 4.159135 TCCCTCTGTACCGAAATAGTTGTC 59.841 45.833 0.00 0.00 0.00 3.18
2810 3261 4.091549 TCCCTCTGTACCGAAATAGTTGT 58.908 43.478 0.00 0.00 0.00 3.32
2811 3262 4.159879 ACTCCCTCTGTACCGAAATAGTTG 59.840 45.833 0.00 0.00 0.00 3.16
2812 3263 4.351127 ACTCCCTCTGTACCGAAATAGTT 58.649 43.478 0.00 0.00 0.00 2.24
2813 3264 3.978610 ACTCCCTCTGTACCGAAATAGT 58.021 45.455 0.00 0.00 0.00 2.12
2814 3265 4.885907 TGTACTCCCTCTGTACCGAAATAG 59.114 45.833 0.00 0.00 39.42 1.73
2815 3266 4.858850 TGTACTCCCTCTGTACCGAAATA 58.141 43.478 0.00 0.00 39.42 1.40
2816 3267 3.705051 TGTACTCCCTCTGTACCGAAAT 58.295 45.455 0.00 0.00 39.42 2.17
2817 3268 3.159213 TGTACTCCCTCTGTACCGAAA 57.841 47.619 0.00 0.00 39.42 3.46
2818 3269 2.885135 TGTACTCCCTCTGTACCGAA 57.115 50.000 0.00 0.00 39.42 4.30
2819 3270 2.885135 TTGTACTCCCTCTGTACCGA 57.115 50.000 0.00 0.00 39.42 4.69
2820 3271 3.446161 TCAATTGTACTCCCTCTGTACCG 59.554 47.826 5.13 0.00 39.42 4.02
2821 3272 4.222145 TGTCAATTGTACTCCCTCTGTACC 59.778 45.833 5.13 0.00 39.42 3.34
2822 3273 5.401531 TGTCAATTGTACTCCCTCTGTAC 57.598 43.478 5.13 0.00 40.27 2.90
2823 3274 6.620877 AATGTCAATTGTACTCCCTCTGTA 57.379 37.500 5.13 0.00 0.00 2.74
2824 3275 5.505181 AATGTCAATTGTACTCCCTCTGT 57.495 39.130 5.13 0.00 0.00 3.41
2825 3276 5.939883 TCAAATGTCAATTGTACTCCCTCTG 59.060 40.000 5.13 0.00 0.00 3.35
2826 3277 6.126863 TCAAATGTCAATTGTACTCCCTCT 57.873 37.500 5.13 0.00 0.00 3.69
2827 3278 7.253422 CAATCAAATGTCAATTGTACTCCCTC 58.747 38.462 5.13 0.00 0.00 4.30
2828 3279 6.153340 CCAATCAAATGTCAATTGTACTCCCT 59.847 38.462 5.13 0.00 0.00 4.20
2829 3280 6.332630 CCAATCAAATGTCAATTGTACTCCC 58.667 40.000 5.13 0.00 0.00 4.30
2830 3281 5.807011 GCCAATCAAATGTCAATTGTACTCC 59.193 40.000 5.13 0.00 0.00 3.85
2831 3282 5.807011 GGCCAATCAAATGTCAATTGTACTC 59.193 40.000 5.13 0.00 0.00 2.59
2832 3283 5.245751 TGGCCAATCAAATGTCAATTGTACT 59.754 36.000 0.61 0.00 0.00 2.73
2833 3284 5.477510 TGGCCAATCAAATGTCAATTGTAC 58.522 37.500 0.61 3.42 0.00 2.90
2834 3285 5.735285 TGGCCAATCAAATGTCAATTGTA 57.265 34.783 0.61 0.00 0.00 2.41
2835 3286 4.620589 TGGCCAATCAAATGTCAATTGT 57.379 36.364 0.61 0.00 0.00 2.71
2836 3287 5.943706 TTTGGCCAATCAAATGTCAATTG 57.056 34.783 21.26 0.00 32.39 2.32
2843 3294 5.247084 TCAGGAATTTTGGCCAATCAAATG 58.753 37.500 21.26 13.99 36.63 2.32
2935 3388 4.224370 TCCCTTCCCTACAGTCATTAACAC 59.776 45.833 0.00 0.00 0.00 3.32
3053 3506 8.181573 ACAGCCAATTCATTTACAATACTAACG 58.818 33.333 0.00 0.00 0.00 3.18
3152 3609 3.009473 AGGTCTTGCAGCCTCTGAAAATA 59.991 43.478 0.00 0.00 32.44 1.40
3153 3610 2.165998 GGTCTTGCAGCCTCTGAAAAT 58.834 47.619 0.00 0.00 32.44 1.82
3175 3632 1.467342 AGCCTTCGTATGAAAAACGGC 59.533 47.619 14.79 14.79 40.32 5.68
3460 3926 6.257849 TCACCTACATATTTCGAATCAGCAAC 59.742 38.462 0.00 0.00 0.00 4.17
3474 3940 4.163427 CCCACTCAGGATCACCTACATAT 58.837 47.826 0.00 0.00 45.94 1.78
3493 3959 2.280552 GCTCAGGACGTACACCCCA 61.281 63.158 0.00 0.00 0.00 4.96
3496 3962 2.577593 GGGCTCAGGACGTACACC 59.422 66.667 0.00 0.00 0.00 4.16
3529 3995 4.695928 GGGAAATGAACTCGCTTACTTTCT 59.304 41.667 0.00 0.00 0.00 2.52
3556 4038 1.597663 CAAACGACACCACTGACTTCC 59.402 52.381 0.00 0.00 0.00 3.46
3557 4039 2.546778 TCAAACGACACCACTGACTTC 58.453 47.619 0.00 0.00 0.00 3.01
3563 4045 0.531974 ACGCATCAAACGACACCACT 60.532 50.000 0.00 0.00 0.00 4.00
3564 4046 0.110823 GACGCATCAAACGACACCAC 60.111 55.000 0.00 0.00 0.00 4.16
3570 4052 1.269569 ACTGACTGACGCATCAAACGA 60.270 47.619 0.00 0.00 33.30 3.85
3581 4063 1.337071 TCGGTTCACTGACTGACTGAC 59.663 52.381 0.00 0.00 30.19 3.51
3592 4074 2.878406 CCATCAAAACACTCGGTTCACT 59.122 45.455 0.00 0.00 39.29 3.41
3594 4076 2.226330 CCCATCAAAACACTCGGTTCA 58.774 47.619 0.00 0.00 39.29 3.18
3595 4077 2.031157 CACCCATCAAAACACTCGGTTC 60.031 50.000 0.00 0.00 39.29 3.62
3596 4078 1.953686 CACCCATCAAAACACTCGGTT 59.046 47.619 0.00 0.00 42.98 4.44
3597 4079 1.133915 ACACCCATCAAAACACTCGGT 60.134 47.619 0.00 0.00 0.00 4.69
3598 4080 1.604604 ACACCCATCAAAACACTCGG 58.395 50.000 0.00 0.00 0.00 4.63
3599 4081 2.858260 GCAACACCCATCAAAACACTCG 60.858 50.000 0.00 0.00 0.00 4.18
3600 4082 2.362077 AGCAACACCCATCAAAACACTC 59.638 45.455 0.00 0.00 0.00 3.51
3601 4083 2.101249 CAGCAACACCCATCAAAACACT 59.899 45.455 0.00 0.00 0.00 3.55
3602 4084 2.472816 CAGCAACACCCATCAAAACAC 58.527 47.619 0.00 0.00 0.00 3.32
3603 4085 1.411977 CCAGCAACACCCATCAAAACA 59.588 47.619 0.00 0.00 0.00 2.83
3604 4086 1.686052 TCCAGCAACACCCATCAAAAC 59.314 47.619 0.00 0.00 0.00 2.43
3758 4240 0.604780 ACTATGCATCATCAGCGGCC 60.605 55.000 0.19 0.00 33.85 6.13
3798 4280 3.475774 GGAGCACGTACAACCGCG 61.476 66.667 0.00 0.00 0.00 6.46
3799 4281 3.116531 GGGAGCACGTACAACCGC 61.117 66.667 0.00 0.00 0.00 5.68
3800 4282 2.025418 GTGGGAGCACGTACAACCG 61.025 63.158 0.00 0.00 0.00 4.44
3801 4283 2.025418 CGTGGGAGCACGTACAACC 61.025 63.158 0.00 0.00 42.91 3.77
3823 4305 0.179001 AAACCTCAAACTCCCACCGG 60.179 55.000 0.00 0.00 0.00 5.28
3824 4306 0.951558 CAAACCTCAAACTCCCACCG 59.048 55.000 0.00 0.00 0.00 4.94
3827 4309 3.138283 ACAGATCAAACCTCAAACTCCCA 59.862 43.478 0.00 0.00 0.00 4.37
3831 4313 5.930135 ACAGTACAGATCAAACCTCAAACT 58.070 37.500 0.00 0.00 0.00 2.66
3833 4315 5.924254 CGTACAGTACAGATCAAACCTCAAA 59.076 40.000 11.37 0.00 0.00 2.69
3834 4316 5.466819 CGTACAGTACAGATCAAACCTCAA 58.533 41.667 11.37 0.00 0.00 3.02
3835 4317 4.082408 CCGTACAGTACAGATCAAACCTCA 60.082 45.833 11.37 0.00 0.00 3.86
3841 4323 5.670792 AATTCCCGTACAGTACAGATCAA 57.329 39.130 11.37 0.00 0.00 2.57
3870 4352 0.615331 ACCCTCATCAACACAGCGAT 59.385 50.000 0.00 0.00 0.00 4.58
3976 4458 7.530010 TCTTTTCTTGGTTGATTGATCGAATC 58.470 34.615 0.00 9.59 40.99 2.52
3977 4459 7.452880 TCTTTTCTTGGTTGATTGATCGAAT 57.547 32.000 0.00 0.00 0.00 3.34
3978 4460 6.875948 TCTTTTCTTGGTTGATTGATCGAA 57.124 33.333 0.00 0.00 0.00 3.71
3979 4461 6.875948 TTCTTTTCTTGGTTGATTGATCGA 57.124 33.333 0.00 0.00 0.00 3.59
3980 4462 7.928908 TTTTCTTTTCTTGGTTGATTGATCG 57.071 32.000 0.00 0.00 0.00 3.69
3981 4463 8.768019 CCTTTTTCTTTTCTTGGTTGATTGATC 58.232 33.333 0.00 0.00 0.00 2.92
3982 4464 7.227314 GCCTTTTTCTTTTCTTGGTTGATTGAT 59.773 33.333 0.00 0.00 0.00 2.57
3983 4465 6.538381 GCCTTTTTCTTTTCTTGGTTGATTGA 59.462 34.615 0.00 0.00 0.00 2.57
3984 4466 6.315891 TGCCTTTTTCTTTTCTTGGTTGATTG 59.684 34.615 0.00 0.00 0.00 2.67
3985 4467 6.413892 TGCCTTTTTCTTTTCTTGGTTGATT 58.586 32.000 0.00 0.00 0.00 2.57
3991 4473 4.512484 TGGTTGCCTTTTTCTTTTCTTGG 58.488 39.130 0.00 0.00 0.00 3.61
4038 4520 5.416952 AGGAAGGAAGTATCAAACAGCATTG 59.583 40.000 0.00 0.00 0.00 2.82
4046 4528 4.323257 GGAACGGAGGAAGGAAGTATCAAA 60.323 45.833 0.00 0.00 0.00 2.69
4057 4539 7.953752 AGACTTATATTTAGGAACGGAGGAAG 58.046 38.462 0.00 0.00 0.00 3.46
4058 4540 7.909485 AGACTTATATTTAGGAACGGAGGAA 57.091 36.000 0.00 0.00 0.00 3.36
4059 4541 7.909485 AAGACTTATATTTAGGAACGGAGGA 57.091 36.000 0.00 0.00 0.00 3.71
4137 4619 9.671279 TCAAAATGAGTGAATCTATGCTCTAAA 57.329 29.630 0.00 0.00 0.00 1.85
4138 4620 9.842775 ATCAAAATGAGTGAATCTATGCTCTAA 57.157 29.630 0.00 0.00 0.00 2.10
4139 4621 9.842775 AATCAAAATGAGTGAATCTATGCTCTA 57.157 29.630 0.00 0.00 0.00 2.43
4140 4622 8.749026 AATCAAAATGAGTGAATCTATGCTCT 57.251 30.769 0.00 0.00 0.00 4.09
4141 4623 7.797587 CGAATCAAAATGAGTGAATCTATGCTC 59.202 37.037 0.00 0.00 0.00 4.26
4142 4624 7.281774 ACGAATCAAAATGAGTGAATCTATGCT 59.718 33.333 0.00 0.00 0.00 3.79
4143 4625 7.412853 ACGAATCAAAATGAGTGAATCTATGC 58.587 34.615 0.00 0.00 0.00 3.14
4146 4628 9.599866 ACATACGAATCAAAATGAGTGAATCTA 57.400 29.630 0.00 0.00 0.00 1.98
4147 4629 8.498054 ACATACGAATCAAAATGAGTGAATCT 57.502 30.769 0.00 0.00 0.00 2.40
4148 4630 9.855361 CTACATACGAATCAAAATGAGTGAATC 57.145 33.333 0.00 0.00 0.00 2.52
4149 4631 9.383519 ACTACATACGAATCAAAATGAGTGAAT 57.616 29.630 0.00 0.00 0.00 2.57
4150 4632 8.771920 ACTACATACGAATCAAAATGAGTGAA 57.228 30.769 0.00 0.00 0.00 3.18
4151 4633 7.491372 GGACTACATACGAATCAAAATGAGTGA 59.509 37.037 0.00 0.00 0.00 3.41
4152 4634 7.277760 TGGACTACATACGAATCAAAATGAGTG 59.722 37.037 0.00 0.00 0.00 3.51
4153 4635 7.327975 TGGACTACATACGAATCAAAATGAGT 58.672 34.615 0.00 0.00 0.00 3.41
4154 4636 7.770801 TGGACTACATACGAATCAAAATGAG 57.229 36.000 0.00 0.00 0.00 2.90
4155 4637 9.996554 ATATGGACTACATACGAATCAAAATGA 57.003 29.630 0.00 0.00 44.41 2.57
4158 4640 9.825109 TCAATATGGACTACATACGAATCAAAA 57.175 29.630 0.00 0.00 44.41 2.44
4159 4641 9.825109 TTCAATATGGACTACATACGAATCAAA 57.175 29.630 0.00 0.00 44.41 2.69
4160 4642 9.825109 TTTCAATATGGACTACATACGAATCAA 57.175 29.630 0.00 0.00 44.41 2.57
4161 4643 9.476202 CTTTCAATATGGACTACATACGAATCA 57.524 33.333 0.00 0.00 44.41 2.57
4162 4644 9.692749 TCTTTCAATATGGACTACATACGAATC 57.307 33.333 0.00 0.00 44.41 2.52
4163 4645 9.698309 CTCTTTCAATATGGACTACATACGAAT 57.302 33.333 0.00 0.00 44.41 3.34
4164 4646 8.692710 ACTCTTTCAATATGGACTACATACGAA 58.307 33.333 0.00 0.00 44.41 3.85
4165 4647 8.135529 CACTCTTTCAATATGGACTACATACGA 58.864 37.037 0.00 0.00 44.41 3.43
4166 4648 7.096023 GCACTCTTTCAATATGGACTACATACG 60.096 40.741 0.00 0.00 44.41 3.06
4167 4649 7.096023 CGCACTCTTTCAATATGGACTACATAC 60.096 40.741 0.00 0.00 44.41 2.39
4168 4650 6.923508 CGCACTCTTTCAATATGGACTACATA 59.076 38.462 0.00 0.00 45.60 2.29
4169 4651 5.755375 CGCACTCTTTCAATATGGACTACAT 59.245 40.000 0.00 0.00 43.68 2.29
4170 4652 5.109210 CGCACTCTTTCAATATGGACTACA 58.891 41.667 0.00 0.00 0.00 2.74
4171 4653 4.508124 CCGCACTCTTTCAATATGGACTAC 59.492 45.833 0.00 0.00 0.00 2.73
4172 4654 4.693283 CCGCACTCTTTCAATATGGACTA 58.307 43.478 0.00 0.00 0.00 2.59
4173 4655 3.535561 CCGCACTCTTTCAATATGGACT 58.464 45.455 0.00 0.00 0.00 3.85
4174 4656 2.032178 GCCGCACTCTTTCAATATGGAC 59.968 50.000 0.00 0.00 0.00 4.02
4175 4657 2.288666 GCCGCACTCTTTCAATATGGA 58.711 47.619 0.00 0.00 0.00 3.41
4176 4658 1.003545 CGCCGCACTCTTTCAATATGG 60.004 52.381 0.00 0.00 0.00 2.74
4177 4659 1.665679 ACGCCGCACTCTTTCAATATG 59.334 47.619 0.00 0.00 0.00 1.78
4178 4660 2.024176 ACGCCGCACTCTTTCAATAT 57.976 45.000 0.00 0.00 0.00 1.28
4179 4661 1.803334 AACGCCGCACTCTTTCAATA 58.197 45.000 0.00 0.00 0.00 1.90
4180 4662 0.951558 AAACGCCGCACTCTTTCAAT 59.048 45.000 0.00 0.00 0.00 2.57
4181 4663 0.306533 GAAACGCCGCACTCTTTCAA 59.693 50.000 0.00 0.00 0.00 2.69
4182 4664 1.827315 CGAAACGCCGCACTCTTTCA 61.827 55.000 0.00 0.00 0.00 2.69
4183 4665 1.154654 CGAAACGCCGCACTCTTTC 60.155 57.895 0.00 0.00 0.00 2.62
4184 4666 2.604174 CCGAAACGCCGCACTCTTT 61.604 57.895 0.00 0.00 0.00 2.52
4185 4667 3.041940 CCGAAACGCCGCACTCTT 61.042 61.111 0.00 0.00 0.00 2.85
4186 4668 4.295119 ACCGAAACGCCGCACTCT 62.295 61.111 0.00 0.00 0.00 3.24
4187 4669 4.072088 CACCGAAACGCCGCACTC 62.072 66.667 0.00 0.00 0.00 3.51
4194 4676 3.497031 GCCTAGGCACCGAAACGC 61.497 66.667 29.33 0.00 41.49 4.84
4195 4677 1.810030 GAGCCTAGGCACCGAAACG 60.810 63.158 34.70 0.00 44.88 3.60
4196 4678 0.107654 ATGAGCCTAGGCACCGAAAC 60.108 55.000 34.70 16.10 44.88 2.78
4197 4679 0.618458 AATGAGCCTAGGCACCGAAA 59.382 50.000 34.70 13.72 44.88 3.46
4198 4680 0.618458 AAATGAGCCTAGGCACCGAA 59.382 50.000 34.70 14.09 44.88 4.30
4199 4681 0.107703 CAAATGAGCCTAGGCACCGA 60.108 55.000 34.70 14.85 44.88 4.69
4200 4682 1.718757 GCAAATGAGCCTAGGCACCG 61.719 60.000 34.70 17.40 44.88 4.94
4201 4683 0.680921 TGCAAATGAGCCTAGGCACC 60.681 55.000 34.70 24.85 44.88 5.01
4202 4684 0.453390 GTGCAAATGAGCCTAGGCAC 59.547 55.000 34.70 28.76 43.78 5.01
4203 4685 0.680921 GGTGCAAATGAGCCTAGGCA 60.681 55.000 34.70 16.70 44.88 4.75
4204 4686 1.387295 GGGTGCAAATGAGCCTAGGC 61.387 60.000 27.19 27.19 42.33 3.93
4205 4687 0.034186 TGGGTGCAAATGAGCCTAGG 60.034 55.000 3.67 3.67 31.85 3.02
4206 4688 1.340405 ACTGGGTGCAAATGAGCCTAG 60.340 52.381 0.00 0.00 35.97 3.02
4207 4689 0.698238 ACTGGGTGCAAATGAGCCTA 59.302 50.000 0.00 0.00 31.85 3.93
4208 4690 0.610232 GACTGGGTGCAAATGAGCCT 60.610 55.000 0.00 0.00 31.85 4.58
4209 4691 0.895100 TGACTGGGTGCAAATGAGCC 60.895 55.000 0.00 0.00 0.00 4.70
4210 4692 0.524862 CTGACTGGGTGCAAATGAGC 59.475 55.000 0.00 0.00 0.00 4.26
4211 4693 1.901591 ACTGACTGGGTGCAAATGAG 58.098 50.000 0.00 0.00 0.00 2.90
4212 4694 3.500448 TTACTGACTGGGTGCAAATGA 57.500 42.857 0.00 0.00 0.00 2.57
4213 4695 4.582701 TTTTACTGACTGGGTGCAAATG 57.417 40.909 0.00 0.00 0.00 2.32
4276 4758 7.540400 CGCACCAAATTATCTATCACACAAAAA 59.460 33.333 0.00 0.00 0.00 1.94
4277 4759 7.026562 CGCACCAAATTATCTATCACACAAAA 58.973 34.615 0.00 0.00 0.00 2.44
4278 4760 6.150307 ACGCACCAAATTATCTATCACACAAA 59.850 34.615 0.00 0.00 0.00 2.83
4279 4761 5.645929 ACGCACCAAATTATCTATCACACAA 59.354 36.000 0.00 0.00 0.00 3.33
4280 4762 5.064579 CACGCACCAAATTATCTATCACACA 59.935 40.000 0.00 0.00 0.00 3.72
4281 4763 5.064707 ACACGCACCAAATTATCTATCACAC 59.935 40.000 0.00 0.00 0.00 3.82
4282 4764 5.064579 CACACGCACCAAATTATCTATCACA 59.935 40.000 0.00 0.00 0.00 3.58
4283 4765 5.501715 CACACGCACCAAATTATCTATCAC 58.498 41.667 0.00 0.00 0.00 3.06
4284 4766 4.574421 CCACACGCACCAAATTATCTATCA 59.426 41.667 0.00 0.00 0.00 2.15
4285 4767 4.574828 ACCACACGCACCAAATTATCTATC 59.425 41.667 0.00 0.00 0.00 2.08
4286 4768 4.523083 ACCACACGCACCAAATTATCTAT 58.477 39.130 0.00 0.00 0.00 1.98
4287 4769 3.945346 ACCACACGCACCAAATTATCTA 58.055 40.909 0.00 0.00 0.00 1.98
4288 4770 2.790433 ACCACACGCACCAAATTATCT 58.210 42.857 0.00 0.00 0.00 1.98
4289 4771 3.498082 GAACCACACGCACCAAATTATC 58.502 45.455 0.00 0.00 0.00 1.75
4290 4772 2.095466 CGAACCACACGCACCAAATTAT 60.095 45.455 0.00 0.00 0.00 1.28
4291 4773 1.264557 CGAACCACACGCACCAAATTA 59.735 47.619 0.00 0.00 0.00 1.40
4292 4774 0.030101 CGAACCACACGCACCAAATT 59.970 50.000 0.00 0.00 0.00 1.82
4293 4775 1.652012 CGAACCACACGCACCAAAT 59.348 52.632 0.00 0.00 0.00 2.32
4294 4776 3.102985 CGAACCACACGCACCAAA 58.897 55.556 0.00 0.00 0.00 3.28
4301 4783 2.399396 AAATTGAAGCGAACCACACG 57.601 45.000 0.00 0.00 0.00 4.49
4302 4784 5.516090 TCTTAAAATTGAAGCGAACCACAC 58.484 37.500 0.00 0.00 0.00 3.82
4303 4785 5.759506 TCTTAAAATTGAAGCGAACCACA 57.240 34.783 0.00 0.00 0.00 4.17
4304 4786 6.378582 TGATCTTAAAATTGAAGCGAACCAC 58.621 36.000 0.00 0.00 0.00 4.16
4305 4787 6.567687 TGATCTTAAAATTGAAGCGAACCA 57.432 33.333 0.00 0.00 0.00 3.67
4306 4788 8.375465 CAAATGATCTTAAAATTGAAGCGAACC 58.625 33.333 0.00 0.00 0.00 3.62
4307 4789 9.128107 TCAAATGATCTTAAAATTGAAGCGAAC 57.872 29.630 0.00 0.00 0.00 3.95
4308 4790 9.689976 TTCAAATGATCTTAAAATTGAAGCGAA 57.310 25.926 0.00 0.00 33.32 4.70
4309 4791 9.128107 GTTCAAATGATCTTAAAATTGAAGCGA 57.872 29.630 6.48 0.00 37.43 4.93
4310 4792 8.914654 TGTTCAAATGATCTTAAAATTGAAGCG 58.085 29.630 6.48 0.00 37.43 4.68
4313 4795 9.487790 GGGTGTTCAAATGATCTTAAAATTGAA 57.512 29.630 0.00 0.00 35.20 2.69
4314 4796 8.093927 GGGGTGTTCAAATGATCTTAAAATTGA 58.906 33.333 0.00 0.00 0.00 2.57
4315 4797 7.877097 TGGGGTGTTCAAATGATCTTAAAATTG 59.123 33.333 0.00 0.00 0.00 2.32
4316 4798 7.972301 TGGGGTGTTCAAATGATCTTAAAATT 58.028 30.769 0.00 0.00 0.00 1.82
4317 4799 7.454380 TCTGGGGTGTTCAAATGATCTTAAAAT 59.546 33.333 0.00 0.00 0.00 1.82
4318 4800 6.780031 TCTGGGGTGTTCAAATGATCTTAAAA 59.220 34.615 0.00 0.00 0.00 1.52
4319 4801 6.310941 TCTGGGGTGTTCAAATGATCTTAAA 58.689 36.000 0.00 0.00 0.00 1.52
4320 4802 5.886609 TCTGGGGTGTTCAAATGATCTTAA 58.113 37.500 0.00 0.00 0.00 1.85
4321 4803 5.512942 TCTGGGGTGTTCAAATGATCTTA 57.487 39.130 0.00 0.00 0.00 2.10
4322 4804 4.387026 TCTGGGGTGTTCAAATGATCTT 57.613 40.909 0.00 0.00 0.00 2.40
4323 4805 4.598036 ATCTGGGGTGTTCAAATGATCT 57.402 40.909 0.00 0.00 0.00 2.75
4324 4806 5.047092 ACAAATCTGGGGTGTTCAAATGATC 60.047 40.000 0.00 0.00 0.00 2.92
4325 4807 4.840115 ACAAATCTGGGGTGTTCAAATGAT 59.160 37.500 0.00 0.00 0.00 2.45
4326 4808 4.222336 ACAAATCTGGGGTGTTCAAATGA 58.778 39.130 0.00 0.00 0.00 2.57
4327 4809 4.281688 AGACAAATCTGGGGTGTTCAAATG 59.718 41.667 0.00 0.00 32.29 2.32
4328 4810 4.482990 AGACAAATCTGGGGTGTTCAAAT 58.517 39.130 0.00 0.00 32.29 2.32
4329 4811 3.909732 AGACAAATCTGGGGTGTTCAAA 58.090 40.909 0.00 0.00 32.29 2.69
4330 4812 3.593442 AGACAAATCTGGGGTGTTCAA 57.407 42.857 0.00 0.00 32.29 2.69
4331 4813 3.593442 AAGACAAATCTGGGGTGTTCA 57.407 42.857 0.00 0.00 34.48 3.18
4332 4814 4.937201 AAAAGACAAATCTGGGGTGTTC 57.063 40.909 0.00 0.00 34.48 3.18
4351 4833 1.066908 CCGAGCAGTTCTTGGCAAAAA 59.933 47.619 0.00 0.00 39.44 1.94
4352 4834 0.667993 CCGAGCAGTTCTTGGCAAAA 59.332 50.000 0.00 0.00 39.44 2.44
4353 4835 0.179032 TCCGAGCAGTTCTTGGCAAA 60.179 50.000 0.00 0.00 44.68 3.68
4354 4836 0.036732 ATCCGAGCAGTTCTTGGCAA 59.963 50.000 0.00 0.00 44.68 4.52
4355 4837 0.674581 CATCCGAGCAGTTCTTGGCA 60.675 55.000 0.00 0.00 44.68 4.92
4356 4838 0.674895 ACATCCGAGCAGTTCTTGGC 60.675 55.000 0.00 0.00 44.68 4.52
4357 4839 1.363744 GACATCCGAGCAGTTCTTGG 58.636 55.000 0.00 0.00 46.14 3.61
4358 4840 1.338105 TGGACATCCGAGCAGTTCTTG 60.338 52.381 0.00 0.00 39.43 3.02
4359 4841 0.976641 TGGACATCCGAGCAGTTCTT 59.023 50.000 0.00 0.00 39.43 2.52
4360 4842 0.976641 TTGGACATCCGAGCAGTTCT 59.023 50.000 0.00 0.00 39.43 3.01
4361 4843 1.808411 TTTGGACATCCGAGCAGTTC 58.192 50.000 0.00 0.00 39.43 3.01
4362 4844 2.086869 CATTTGGACATCCGAGCAGTT 58.913 47.619 0.00 0.00 39.43 3.16
4363 4845 1.278985 TCATTTGGACATCCGAGCAGT 59.721 47.619 0.00 0.00 39.43 4.40
4364 4846 2.028420 TCATTTGGACATCCGAGCAG 57.972 50.000 0.00 0.00 39.43 4.24
4365 4847 2.715749 ATCATTTGGACATCCGAGCA 57.284 45.000 0.00 0.00 39.43 4.26
4366 4848 3.378112 TCAAATCATTTGGACATCCGAGC 59.622 43.478 10.30 0.00 40.98 5.03
4367 4849 5.565592 TTCAAATCATTTGGACATCCGAG 57.434 39.130 10.30 0.00 40.98 4.63
4368 4850 5.973899 TTTCAAATCATTTGGACATCCGA 57.026 34.783 10.30 0.00 40.98 4.55
4369 4851 7.413219 CCAATTTTCAAATCATTTGGACATCCG 60.413 37.037 10.30 0.00 40.98 4.18
4370 4852 7.607223 TCCAATTTTCAAATCATTTGGACATCC 59.393 33.333 10.30 0.00 40.98 3.51
4371 4853 8.550710 TCCAATTTTCAAATCATTTGGACATC 57.449 30.769 10.30 0.00 40.98 3.06
4372 4854 7.120138 GCTCCAATTTTCAAATCATTTGGACAT 59.880 33.333 10.30 0.00 40.98 3.06
4373 4855 6.427547 GCTCCAATTTTCAAATCATTTGGACA 59.572 34.615 10.30 0.00 40.98 4.02
4374 4856 6.401367 CGCTCCAATTTTCAAATCATTTGGAC 60.401 38.462 10.30 0.00 40.98 4.02
4375 4857 5.638657 CGCTCCAATTTTCAAATCATTTGGA 59.361 36.000 10.30 0.00 40.98 3.53
4376 4858 5.638657 TCGCTCCAATTTTCAAATCATTTGG 59.361 36.000 10.30 0.00 40.98 3.28
4377 4859 6.709145 TCGCTCCAATTTTCAAATCATTTG 57.291 33.333 3.46 3.46 41.96 2.32
4378 4860 6.147656 GGTTCGCTCCAATTTTCAAATCATTT 59.852 34.615 0.00 0.00 0.00 2.32
4379 4861 5.639082 GGTTCGCTCCAATTTTCAAATCATT 59.361 36.000 0.00 0.00 0.00 2.57
4380 4862 5.047092 AGGTTCGCTCCAATTTTCAAATCAT 60.047 36.000 0.00 0.00 0.00 2.45
4381 4863 4.280677 AGGTTCGCTCCAATTTTCAAATCA 59.719 37.500 0.00 0.00 0.00 2.57
4382 4864 4.809673 AGGTTCGCTCCAATTTTCAAATC 58.190 39.130 0.00 0.00 0.00 2.17
4383 4865 4.280677 TGAGGTTCGCTCCAATTTTCAAAT 59.719 37.500 0.00 0.00 0.00 2.32
4384 4866 3.634448 TGAGGTTCGCTCCAATTTTCAAA 59.366 39.130 0.00 0.00 0.00 2.69
4385 4867 3.218453 TGAGGTTCGCTCCAATTTTCAA 58.782 40.909 0.00 0.00 0.00 2.69
4386 4868 2.857483 TGAGGTTCGCTCCAATTTTCA 58.143 42.857 0.00 0.00 0.00 2.69
4387 4869 3.762779 CATGAGGTTCGCTCCAATTTTC 58.237 45.455 0.00 0.00 0.00 2.29
4388 4870 2.094545 GCATGAGGTTCGCTCCAATTTT 60.095 45.455 0.00 0.00 0.00 1.82
4389 4871 1.474077 GCATGAGGTTCGCTCCAATTT 59.526 47.619 0.00 0.00 0.00 1.82
4390 4872 1.098050 GCATGAGGTTCGCTCCAATT 58.902 50.000 0.00 0.00 0.00 2.32
4391 4873 0.035152 TGCATGAGGTTCGCTCCAAT 60.035 50.000 0.00 0.00 0.00 3.16
4392 4874 0.035152 ATGCATGAGGTTCGCTCCAA 60.035 50.000 0.00 0.00 0.00 3.53
4393 4875 0.462581 GATGCATGAGGTTCGCTCCA 60.463 55.000 2.46 0.00 0.00 3.86
4394 4876 0.462581 TGATGCATGAGGTTCGCTCC 60.463 55.000 2.46 0.00 0.00 4.70
4395 4877 1.372582 TTGATGCATGAGGTTCGCTC 58.627 50.000 2.46 0.00 0.00 5.03
4396 4878 1.825090 TTTGATGCATGAGGTTCGCT 58.175 45.000 2.46 0.00 0.00 4.93
4397 4879 2.634982 TTTTGATGCATGAGGTTCGC 57.365 45.000 2.46 0.00 0.00 4.70
4398 4880 6.309712 AGATATTTTGATGCATGAGGTTCG 57.690 37.500 2.46 0.00 0.00 3.95
4399 4881 9.006839 TGATAGATATTTTGATGCATGAGGTTC 57.993 33.333 2.46 0.00 0.00 3.62
4400 4882 8.790718 GTGATAGATATTTTGATGCATGAGGTT 58.209 33.333 2.46 0.00 0.00 3.50
4401 4883 7.940688 TGTGATAGATATTTTGATGCATGAGGT 59.059 33.333 2.46 0.00 0.00 3.85
4402 4884 8.235226 GTGTGATAGATATTTTGATGCATGAGG 58.765 37.037 2.46 0.00 0.00 3.86
4403 4885 8.780249 TGTGTGATAGATATTTTGATGCATGAG 58.220 33.333 2.46 0.00 0.00 2.90
4404 4886 8.680039 TGTGTGATAGATATTTTGATGCATGA 57.320 30.769 2.46 0.00 0.00 3.07
4405 4887 9.738832 TTTGTGTGATAGATATTTTGATGCATG 57.261 29.630 2.46 0.00 0.00 4.06
4459 4941 9.119329 CCGACGAATAAAATCAAAACAAATACA 57.881 29.630 0.00 0.00 0.00 2.29
4460 4942 8.580431 CCCGACGAATAAAATCAAAACAAATAC 58.420 33.333 0.00 0.00 0.00 1.89
4461 4943 7.755822 CCCCGACGAATAAAATCAAAACAAATA 59.244 33.333 0.00 0.00 0.00 1.40
4462 4944 6.588373 CCCCGACGAATAAAATCAAAACAAAT 59.412 34.615 0.00 0.00 0.00 2.32
4463 4945 5.921408 CCCCGACGAATAAAATCAAAACAAA 59.079 36.000 0.00 0.00 0.00 2.83
4464 4946 5.009811 ACCCCGACGAATAAAATCAAAACAA 59.990 36.000 0.00 0.00 0.00 2.83
4465 4947 4.519730 ACCCCGACGAATAAAATCAAAACA 59.480 37.500 0.00 0.00 0.00 2.83
4466 4948 4.854839 CACCCCGACGAATAAAATCAAAAC 59.145 41.667 0.00 0.00 0.00 2.43
4467 4949 4.082679 CCACCCCGACGAATAAAATCAAAA 60.083 41.667 0.00 0.00 0.00 2.44
4468 4950 3.440872 CCACCCCGACGAATAAAATCAAA 59.559 43.478 0.00 0.00 0.00 2.69
4469 4951 3.011119 CCACCCCGACGAATAAAATCAA 58.989 45.455 0.00 0.00 0.00 2.57
4470 4952 2.027007 ACCACCCCGACGAATAAAATCA 60.027 45.455 0.00 0.00 0.00 2.57
4471 4953 2.353579 CACCACCCCGACGAATAAAATC 59.646 50.000 0.00 0.00 0.00 2.17
4472 4954 2.361789 CACCACCCCGACGAATAAAAT 58.638 47.619 0.00 0.00 0.00 1.82
4473 4955 1.810959 CACCACCCCGACGAATAAAA 58.189 50.000 0.00 0.00 0.00 1.52
4474 4956 0.674269 GCACCACCCCGACGAATAAA 60.674 55.000 0.00 0.00 0.00 1.40
4475 4957 1.078988 GCACCACCCCGACGAATAA 60.079 57.895 0.00 0.00 0.00 1.40
4476 4958 2.233605 CTGCACCACCCCGACGAATA 62.234 60.000 0.00 0.00 0.00 1.75
4477 4959 3.605749 CTGCACCACCCCGACGAAT 62.606 63.158 0.00 0.00 0.00 3.34
4478 4960 4.308458 CTGCACCACCCCGACGAA 62.308 66.667 0.00 0.00 0.00 3.85
4486 4968 2.866085 CTAGGCTCAGCTGCACCACC 62.866 65.000 22.26 13.00 34.04 4.61
4487 4969 1.449246 CTAGGCTCAGCTGCACCAC 60.449 63.158 22.26 6.61 34.04 4.16
4488 4970 2.663075 CCTAGGCTCAGCTGCACCA 61.663 63.158 22.26 10.58 34.04 4.17
4489 4971 2.188994 CCTAGGCTCAGCTGCACC 59.811 66.667 9.47 12.84 34.04 5.01
4490 4972 2.513435 GCCTAGGCTCAGCTGCAC 60.513 66.667 27.17 2.69 38.26 4.57
4500 4982 2.947127 ATCCATTTCTGAGCCTAGGC 57.053 50.000 27.19 27.19 42.33 3.93
4501 4983 4.646572 GGTAATCCATTTCTGAGCCTAGG 58.353 47.826 3.67 3.67 0.00 3.02
4502 4984 4.039245 TCGGTAATCCATTTCTGAGCCTAG 59.961 45.833 0.00 0.00 0.00 3.02
4503 4985 3.964688 TCGGTAATCCATTTCTGAGCCTA 59.035 43.478 0.00 0.00 0.00 3.93
4504 4986 2.771943 TCGGTAATCCATTTCTGAGCCT 59.228 45.455 0.00 0.00 0.00 4.58
4505 4987 3.194005 TCGGTAATCCATTTCTGAGCC 57.806 47.619 0.00 0.00 0.00 4.70
4506 4988 6.650807 TCAATATCGGTAATCCATTTCTGAGC 59.349 38.462 0.00 0.00 0.00 4.26
4507 4989 8.607441 TTCAATATCGGTAATCCATTTCTGAG 57.393 34.615 0.00 0.00 0.00 3.35
4508 4990 8.972458 TTTCAATATCGGTAATCCATTTCTGA 57.028 30.769 0.00 0.00 0.00 3.27
4535 5017 7.807907 CGTTCCTAAATGCAAGTGTTTTTAGAT 59.192 33.333 14.10 0.00 34.90 1.98
4536 5018 7.012515 TCGTTCCTAAATGCAAGTGTTTTTAGA 59.987 33.333 14.10 1.97 34.90 2.10
4537 5019 7.136119 TCGTTCCTAAATGCAAGTGTTTTTAG 58.864 34.615 7.85 7.85 33.47 1.85
4538 5020 7.028926 TCGTTCCTAAATGCAAGTGTTTTTA 57.971 32.000 0.00 0.00 0.00 1.52
4539 5021 5.897050 TCGTTCCTAAATGCAAGTGTTTTT 58.103 33.333 0.00 0.00 0.00 1.94
4540 5022 5.508200 TCGTTCCTAAATGCAAGTGTTTT 57.492 34.783 0.00 0.00 0.00 2.43
4541 5023 5.507315 CCTTCGTTCCTAAATGCAAGTGTTT 60.507 40.000 0.00 0.00 0.00 2.83
4542 5024 4.023193 CCTTCGTTCCTAAATGCAAGTGTT 60.023 41.667 0.00 0.00 0.00 3.32
4543 5025 3.502211 CCTTCGTTCCTAAATGCAAGTGT 59.498 43.478 0.00 0.00 0.00 3.55
4544 5026 3.119849 CCCTTCGTTCCTAAATGCAAGTG 60.120 47.826 0.00 0.00 0.00 3.16
4545 5027 3.081804 CCCTTCGTTCCTAAATGCAAGT 58.918 45.455 0.00 0.00 0.00 3.16
4546 5028 3.343617 TCCCTTCGTTCCTAAATGCAAG 58.656 45.455 0.00 0.00 0.00 4.01
4547 5029 3.244770 ACTCCCTTCGTTCCTAAATGCAA 60.245 43.478 0.00 0.00 0.00 4.08
4548 5030 2.304761 ACTCCCTTCGTTCCTAAATGCA 59.695 45.455 0.00 0.00 0.00 3.96
4549 5031 2.987232 ACTCCCTTCGTTCCTAAATGC 58.013 47.619 0.00 0.00 0.00 3.56
4550 5032 5.340439 AGTACTCCCTTCGTTCCTAAATG 57.660 43.478 0.00 0.00 0.00 2.32
4551 5033 5.362143 GGTAGTACTCCCTTCGTTCCTAAAT 59.638 44.000 0.00 0.00 0.00 1.40
4552 5034 4.706962 GGTAGTACTCCCTTCGTTCCTAAA 59.293 45.833 0.00 0.00 0.00 1.85
4553 5035 4.263905 TGGTAGTACTCCCTTCGTTCCTAA 60.264 45.833 6.02 0.00 0.00 2.69
4554 5036 3.266772 TGGTAGTACTCCCTTCGTTCCTA 59.733 47.826 6.02 0.00 0.00 2.94
4555 5037 2.042162 TGGTAGTACTCCCTTCGTTCCT 59.958 50.000 6.02 0.00 0.00 3.36
4556 5038 2.165234 GTGGTAGTACTCCCTTCGTTCC 59.835 54.545 6.02 0.00 0.00 3.62
4557 5039 2.821969 TGTGGTAGTACTCCCTTCGTTC 59.178 50.000 6.02 0.00 0.00 3.95
4558 5040 2.880443 TGTGGTAGTACTCCCTTCGTT 58.120 47.619 6.02 0.00 0.00 3.85
4559 5041 2.592102 TGTGGTAGTACTCCCTTCGT 57.408 50.000 6.02 0.00 0.00 3.85
4560 5042 3.021695 TGATGTGGTAGTACTCCCTTCG 58.978 50.000 6.02 0.00 0.00 3.79
4561 5043 4.098196 GTCTGATGTGGTAGTACTCCCTTC 59.902 50.000 6.02 1.61 0.00 3.46
4562 5044 4.024670 GTCTGATGTGGTAGTACTCCCTT 58.975 47.826 6.02 0.00 0.00 3.95
4563 5045 3.627747 GGTCTGATGTGGTAGTACTCCCT 60.628 52.174 6.02 0.00 0.00 4.20
4564 5046 2.694109 GGTCTGATGTGGTAGTACTCCC 59.306 54.545 0.00 0.00 0.00 4.30
4565 5047 2.694109 GGGTCTGATGTGGTAGTACTCC 59.306 54.545 0.00 1.20 0.00 3.85
4566 5048 3.633418 AGGGTCTGATGTGGTAGTACTC 58.367 50.000 0.00 0.00 0.00 2.59
4567 5049 3.759815 AGGGTCTGATGTGGTAGTACT 57.240 47.619 0.00 0.00 0.00 2.73
4568 5050 4.534797 AGTAGGGTCTGATGTGGTAGTAC 58.465 47.826 0.00 0.00 0.00 2.73
4569 5051 4.875578 AGTAGGGTCTGATGTGGTAGTA 57.124 45.455 0.00 0.00 0.00 1.82
4570 5052 3.759815 AGTAGGGTCTGATGTGGTAGT 57.240 47.619 0.00 0.00 0.00 2.73
4571 5053 4.767928 GGATAGTAGGGTCTGATGTGGTAG 59.232 50.000 0.00 0.00 0.00 3.18
4572 5054 4.419200 AGGATAGTAGGGTCTGATGTGGTA 59.581 45.833 0.00 0.00 0.00 3.25
4573 5055 3.207777 AGGATAGTAGGGTCTGATGTGGT 59.792 47.826 0.00 0.00 0.00 4.16
4574 5056 3.850752 AGGATAGTAGGGTCTGATGTGG 58.149 50.000 0.00 0.00 0.00 4.17
4575 5057 4.282195 GGAAGGATAGTAGGGTCTGATGTG 59.718 50.000 0.00 0.00 0.00 3.21
4576 5058 4.171044 AGGAAGGATAGTAGGGTCTGATGT 59.829 45.833 0.00 0.00 0.00 3.06
4577 5059 4.526262 CAGGAAGGATAGTAGGGTCTGATG 59.474 50.000 0.00 0.00 0.00 3.07
4578 5060 4.171044 ACAGGAAGGATAGTAGGGTCTGAT 59.829 45.833 0.00 0.00 0.00 2.90
4579 5061 3.532232 ACAGGAAGGATAGTAGGGTCTGA 59.468 47.826 0.00 0.00 0.00 3.27
4580 5062 3.917300 ACAGGAAGGATAGTAGGGTCTG 58.083 50.000 0.00 0.00 0.00 3.51
4581 5063 4.628661 AACAGGAAGGATAGTAGGGTCT 57.371 45.455 0.00 0.00 0.00 3.85
4582 5064 4.101274 GGAAACAGGAAGGATAGTAGGGTC 59.899 50.000 0.00 0.00 0.00 4.46
4583 5065 4.038633 GGAAACAGGAAGGATAGTAGGGT 58.961 47.826 0.00 0.00 0.00 4.34
4584 5066 4.101741 CAGGAAACAGGAAGGATAGTAGGG 59.898 50.000 0.00 0.00 0.00 3.53
4585 5067 4.717280 ACAGGAAACAGGAAGGATAGTAGG 59.283 45.833 0.00 0.00 0.00 3.18
4586 5068 5.395768 CCACAGGAAACAGGAAGGATAGTAG 60.396 48.000 0.00 0.00 0.00 2.57
4587 5069 4.469945 CCACAGGAAACAGGAAGGATAGTA 59.530 45.833 0.00 0.00 0.00 1.82
4588 5070 3.264450 CCACAGGAAACAGGAAGGATAGT 59.736 47.826 0.00 0.00 0.00 2.12
4589 5071 3.519510 TCCACAGGAAACAGGAAGGATAG 59.480 47.826 0.00 0.00 0.00 2.08
4590 5072 3.526899 TCCACAGGAAACAGGAAGGATA 58.473 45.455 0.00 0.00 0.00 2.59
4591 5073 2.348472 TCCACAGGAAACAGGAAGGAT 58.652 47.619 0.00 0.00 0.00 3.24
4592 5074 1.814429 TCCACAGGAAACAGGAAGGA 58.186 50.000 0.00 0.00