Multiple sequence alignment - TraesCS5B01G516600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G516600 chr5B 100.000 4241 0 0 1 4241 680615539 680611299 0.000000e+00 7832
1 TraesCS5B01G516600 chr5B 92.722 316 23 0 691 1006 268502011 268502326 1.390000e-124 457
2 TraesCS5B01G516600 chr5B 94.502 291 16 0 1885 2175 703170468 703170178 2.330000e-122 449
3 TraesCS5B01G516600 chr4A 89.395 1669 123 27 2595 4241 629467777 629469413 0.000000e+00 2052
4 TraesCS5B01G516600 chr4A 86.339 915 72 28 1000 1881 629466670 629467564 0.000000e+00 948
5 TraesCS5B01G516600 chr4A 95.517 290 13 0 1885 2174 448377269 448377558 8.310000e-127 464
6 TraesCS5B01G516600 chr4A 95.161 62 3 0 634 695 629466606 629466667 9.700000e-17 99
7 TraesCS5B01G516600 chr5D 87.414 1311 89 34 2586 3861 539034766 539033497 0.000000e+00 1437
8 TraesCS5B01G516600 chr5D 90.340 559 45 4 1008 1558 539035738 539035181 0.000000e+00 725
9 TraesCS5B01G516600 chr5D 94.481 308 16 1 696 1002 520896802 520897109 1.380000e-129 473
10 TraesCS5B01G516600 chr5D 92.429 317 20 3 695 1008 44832660 44832345 2.330000e-122 449
11 TraesCS5B01G516600 chr5D 93.333 300 20 0 3942 4241 539033485 539033186 1.080000e-120 444
12 TraesCS5B01G516600 chr5D 91.085 258 21 2 267 524 395941506 395941761 8.730000e-92 348
13 TraesCS5B01G516600 chr5D 83.621 232 33 4 3 232 495360908 495361136 3.320000e-51 213
14 TraesCS5B01G516600 chr5D 81.853 259 37 7 6 262 463970608 463970358 4.300000e-50 209
15 TraesCS5B01G516600 chr4B 94.194 310 18 0 692 1001 92021455 92021764 1.380000e-129 473
16 TraesCS5B01G516600 chr4B 94.932 296 14 1 1885 2179 565483945 565484240 2.990000e-126 462
17 TraesCS5B01G516600 chr4B 82.158 241 39 4 2 240 447360092 447359854 2.000000e-48 204
18 TraesCS5B01G516600 chr7B 94.949 297 14 1 1881 2177 80070488 80070783 8.310000e-127 464
19 TraesCS5B01G516600 chr7B 89.961 259 21 2 269 527 638420170 638419917 3.160000e-86 329
20 TraesCS5B01G516600 chr3B 95.517 290 13 0 1883 2172 319466767 319466478 8.310000e-127 464
21 TraesCS5B01G516600 chr3B 93.333 315 20 1 695 1008 463459887 463460201 8.310000e-127 464
22 TraesCS5B01G516600 chr3B 89.266 354 31 7 2905 3255 618434987 618434638 1.810000e-118 436
23 TraesCS5B01G516600 chr3B 93.033 244 15 2 270 513 510052484 510052243 5.220000e-94 355
24 TraesCS5B01G516600 chr3B 92.308 247 18 1 267 513 391567440 391567685 2.430000e-92 350
25 TraesCS5B01G516600 chr3D 93.831 308 17 2 695 1001 559080772 559081078 2.990000e-126 462
26 TraesCS5B01G516600 chr3D 89.459 351 31 6 2905 3252 465022088 465021741 5.030000e-119 438
27 TraesCS5B01G516600 chr3D 93.061 245 15 2 274 518 583710273 583710031 1.450000e-94 357
28 TraesCS5B01G516600 chr3D 93.033 244 15 2 274 517 583762413 583762172 5.220000e-94 355
29 TraesCS5B01G516600 chr3D 92.653 245 16 2 274 518 583664756 583664514 6.750000e-93 351
30 TraesCS5B01G516600 chr2B 94.595 296 15 1 1885 2179 382156894 382156599 1.390000e-124 457
31 TraesCS5B01G516600 chrUn 93.204 309 21 0 694 1002 42685120 42685428 5.000000e-124 455
32 TraesCS5B01G516600 chrUn 93.204 309 21 0 694 1002 451740823 451740515 5.000000e-124 455
33 TraesCS5B01G516600 chrUn 90.157 254 23 2 260 512 94453637 94453385 3.160000e-86 329
34 TraesCS5B01G516600 chrUn 90.157 254 23 2 260 512 284303453 284303201 3.160000e-86 329
35 TraesCS5B01G516600 chrUn 90.157 254 23 2 260 512 384732294 384732546 3.160000e-86 329
36 TraesCS5B01G516600 chrUn 89.764 254 23 3 260 512 94313108 94312857 5.290000e-84 322
37 TraesCS5B01G516600 chr7D 92.971 313 21 1 691 1002 637091534 637091222 5.000000e-124 455
38 TraesCS5B01G516600 chr6B 94.218 294 17 0 1885 2178 124745124 124744831 2.330000e-122 449
39 TraesCS5B01G516600 chr6B 93.919 296 16 2 1885 2179 85569025 85569319 3.010000e-121 446
40 TraesCS5B01G516600 chr6A 94.483 290 16 0 1885 2174 187564609 187564898 8.360000e-122 448
41 TraesCS5B01G516600 chr3A 89.174 351 32 6 2905 3252 608340655 608340308 2.340000e-117 433
42 TraesCS5B01G516600 chr3A 79.167 264 47 5 3 262 468656932 468657191 4.360000e-40 176
43 TraesCS5B01G516600 chr1B 93.117 247 16 1 265 511 334234279 334234524 1.120000e-95 361
44 TraesCS5B01G516600 chr1D 90.661 257 23 1 265 521 425321240 425320985 1.460000e-89 340
45 TraesCS5B01G516600 chr1D 79.775 267 43 8 1 262 355127255 355126995 2.600000e-42 183
46 TraesCS5B01G516600 chr4D 82.576 264 42 4 1 262 346145914 346145653 3.300000e-56 230
47 TraesCS5B01G516600 chr4D 80.534 262 45 6 2 261 473986846 473986589 3.350000e-46 196
48 TraesCS5B01G516600 chr2D 84.034 238 35 3 1 237 36438277 36438512 4.270000e-55 226
49 TraesCS5B01G516600 chr2A 81.481 270 38 8 1 261 416912342 416912076 1.190000e-50 211


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G516600 chr5B 680611299 680615539 4240 True 7832.000000 7832 100.000000 1 4241 1 chr5B.!!$R1 4240
1 TraesCS5B01G516600 chr4A 629466606 629469413 2807 False 1033.000000 2052 90.298333 634 4241 3 chr4A.!!$F2 3607
2 TraesCS5B01G516600 chr5D 539033186 539035738 2552 True 868.666667 1437 90.362333 1008 4241 3 chr5D.!!$R3 3233


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
226 227 0.031721 GTTTCACGTGTCCGGACTCT 59.968 55.0 33.39 17.30 38.78 3.24 F
1136 1141 0.103208 CACAGATCGCCAGAGGTACC 59.897 60.0 2.73 2.73 0.00 3.34 F
2602 2671 0.034896 TCTGAAAGTGAACCGGAGGC 59.965 55.0 9.46 0.00 45.77 4.70 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2008 2048 0.106769 TCACCTTGAAGCTTGTGCCA 60.107 50.0 2.10 0.00 40.8 4.92 R
2611 2680 0.032952 TTGGTGTGTGGTCGACTAGC 59.967 55.0 16.46 6.01 0.0 3.42 R
3791 3912 0.180406 ATACATGTTCACCCTCGGCC 59.820 55.0 2.30 0.00 0.0 6.13 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
17 18 2.105128 GGCTCCATCTCCGACACG 59.895 66.667 0.00 0.00 0.00 4.49
18 19 2.711922 GGCTCCATCTCCGACACGT 61.712 63.158 0.00 0.00 0.00 4.49
19 20 1.215647 GCTCCATCTCCGACACGTT 59.784 57.895 0.00 0.00 0.00 3.99
20 21 0.802607 GCTCCATCTCCGACACGTTC 60.803 60.000 0.00 0.00 0.00 3.95
21 22 0.811915 CTCCATCTCCGACACGTTCT 59.188 55.000 0.00 0.00 0.00 3.01
22 23 0.809385 TCCATCTCCGACACGTTCTC 59.191 55.000 0.00 0.00 0.00 2.87
23 24 0.179134 CCATCTCCGACACGTTCTCC 60.179 60.000 0.00 0.00 0.00 3.71
24 25 0.523546 CATCTCCGACACGTTCTCCG 60.524 60.000 0.00 0.00 44.03 4.63
25 26 0.675837 ATCTCCGACACGTTCTCCGA 60.676 55.000 0.00 0.00 40.70 4.55
26 27 1.154263 CTCCGACACGTTCTCCGAC 60.154 63.158 0.00 0.00 40.70 4.79
28 29 2.501222 CGACACGTTCTCCGACGG 60.501 66.667 7.84 7.84 46.77 4.79
29 30 2.641559 GACACGTTCTCCGACGGT 59.358 61.111 14.79 0.00 46.77 4.83
30 31 1.008079 GACACGTTCTCCGACGGTT 60.008 57.895 14.79 0.00 46.77 4.44
31 32 1.000736 GACACGTTCTCCGACGGTTC 61.001 60.000 14.79 2.36 46.77 3.62
32 33 1.731969 CACGTTCTCCGACGGTTCC 60.732 63.158 14.79 0.00 46.77 3.62
33 34 2.195567 ACGTTCTCCGACGGTTCCA 61.196 57.895 14.79 0.00 46.77 3.53
34 35 1.214589 CGTTCTCCGACGGTTCCAT 59.785 57.895 14.79 0.00 39.27 3.41
35 36 1.076533 CGTTCTCCGACGGTTCCATG 61.077 60.000 14.79 0.00 39.27 3.66
36 37 1.079405 TTCTCCGACGGTTCCATGC 60.079 57.895 14.79 0.00 0.00 4.06
37 38 2.829043 TTCTCCGACGGTTCCATGCG 62.829 60.000 14.79 0.00 0.00 4.73
38 39 3.642778 CTCCGACGGTTCCATGCGT 62.643 63.158 14.79 0.00 0.00 5.24
39 40 3.186047 CCGACGGTTCCATGCGTC 61.186 66.667 5.48 11.99 0.00 5.19
40 41 3.541831 CGACGGTTCCATGCGTCG 61.542 66.667 24.22 24.22 45.70 5.12
41 42 3.186047 GACGGTTCCATGCGTCGG 61.186 66.667 7.65 0.00 0.00 4.79
45 46 3.849953 GTTCCATGCGTCGGCGAC 61.850 66.667 29.06 29.06 44.10 5.19
58 59 4.430765 GCGACGGAAGGAAGGCGA 62.431 66.667 0.00 0.00 0.00 5.54
59 60 2.202623 CGACGGAAGGAAGGCGAG 60.203 66.667 0.00 0.00 0.00 5.03
60 61 2.697761 CGACGGAAGGAAGGCGAGA 61.698 63.158 0.00 0.00 0.00 4.04
61 62 1.139947 GACGGAAGGAAGGCGAGAG 59.860 63.158 0.00 0.00 0.00 3.20
62 63 1.596895 GACGGAAGGAAGGCGAGAGT 61.597 60.000 0.00 0.00 0.00 3.24
63 64 1.153745 CGGAAGGAAGGCGAGAGTG 60.154 63.158 0.00 0.00 0.00 3.51
64 65 1.595993 CGGAAGGAAGGCGAGAGTGA 61.596 60.000 0.00 0.00 0.00 3.41
65 66 0.608640 GGAAGGAAGGCGAGAGTGAA 59.391 55.000 0.00 0.00 0.00 3.18
66 67 1.002087 GGAAGGAAGGCGAGAGTGAAA 59.998 52.381 0.00 0.00 0.00 2.69
67 68 2.342179 GAAGGAAGGCGAGAGTGAAAG 58.658 52.381 0.00 0.00 0.00 2.62
68 69 1.633774 AGGAAGGCGAGAGTGAAAGA 58.366 50.000 0.00 0.00 0.00 2.52
69 70 1.971357 AGGAAGGCGAGAGTGAAAGAA 59.029 47.619 0.00 0.00 0.00 2.52
70 71 2.368875 AGGAAGGCGAGAGTGAAAGAAA 59.631 45.455 0.00 0.00 0.00 2.52
71 72 3.139077 GGAAGGCGAGAGTGAAAGAAAA 58.861 45.455 0.00 0.00 0.00 2.29
72 73 3.187432 GGAAGGCGAGAGTGAAAGAAAAG 59.813 47.826 0.00 0.00 0.00 2.27
73 74 3.753294 AGGCGAGAGTGAAAGAAAAGA 57.247 42.857 0.00 0.00 0.00 2.52
74 75 3.658709 AGGCGAGAGTGAAAGAAAAGAG 58.341 45.455 0.00 0.00 0.00 2.85
75 76 2.158645 GGCGAGAGTGAAAGAAAAGAGC 59.841 50.000 0.00 0.00 0.00 4.09
76 77 2.159907 GCGAGAGTGAAAGAAAAGAGCG 60.160 50.000 0.00 0.00 0.00 5.03
77 78 2.410053 CGAGAGTGAAAGAAAAGAGCGG 59.590 50.000 0.00 0.00 0.00 5.52
78 79 2.739379 GAGAGTGAAAGAAAAGAGCGGG 59.261 50.000 0.00 0.00 0.00 6.13
79 80 2.368875 AGAGTGAAAGAAAAGAGCGGGA 59.631 45.455 0.00 0.00 0.00 5.14
80 81 3.139077 GAGTGAAAGAAAAGAGCGGGAA 58.861 45.455 0.00 0.00 0.00 3.97
81 82 3.753797 GAGTGAAAGAAAAGAGCGGGAAT 59.246 43.478 0.00 0.00 0.00 3.01
82 83 4.145052 AGTGAAAGAAAAGAGCGGGAATT 58.855 39.130 0.00 0.00 0.00 2.17
83 84 5.313712 AGTGAAAGAAAAGAGCGGGAATTA 58.686 37.500 0.00 0.00 0.00 1.40
84 85 5.412904 AGTGAAAGAAAAGAGCGGGAATTAG 59.587 40.000 0.00 0.00 0.00 1.73
85 86 4.700213 TGAAAGAAAAGAGCGGGAATTAGG 59.300 41.667 0.00 0.00 0.00 2.69
86 87 2.644676 AGAAAAGAGCGGGAATTAGGC 58.355 47.619 0.00 0.00 0.00 3.93
87 88 2.026262 AGAAAAGAGCGGGAATTAGGCA 60.026 45.455 0.00 0.00 0.00 4.75
88 89 2.044123 AAAGAGCGGGAATTAGGCAG 57.956 50.000 0.00 0.00 0.00 4.85
89 90 1.204146 AAGAGCGGGAATTAGGCAGA 58.796 50.000 0.00 0.00 0.00 4.26
90 91 0.755686 AGAGCGGGAATTAGGCAGAG 59.244 55.000 0.00 0.00 0.00 3.35
91 92 0.753262 GAGCGGGAATTAGGCAGAGA 59.247 55.000 0.00 0.00 0.00 3.10
92 93 0.755686 AGCGGGAATTAGGCAGAGAG 59.244 55.000 0.00 0.00 0.00 3.20
93 94 0.882484 GCGGGAATTAGGCAGAGAGC 60.882 60.000 0.00 0.00 44.65 4.09
102 103 3.005539 GCAGAGAGCACTGGGGGA 61.006 66.667 0.00 0.00 44.79 4.81
103 104 2.373707 GCAGAGAGCACTGGGGGAT 61.374 63.158 0.00 0.00 44.79 3.85
104 105 1.525923 CAGAGAGCACTGGGGGATG 59.474 63.158 0.00 0.00 34.64 3.51
105 106 1.692042 AGAGAGCACTGGGGGATGG 60.692 63.158 0.00 0.00 0.00 3.51
106 107 1.690633 GAGAGCACTGGGGGATGGA 60.691 63.158 0.00 0.00 0.00 3.41
107 108 1.229951 AGAGCACTGGGGGATGGAA 60.230 57.895 0.00 0.00 0.00 3.53
108 109 1.225704 GAGCACTGGGGGATGGAAG 59.774 63.158 0.00 0.00 0.00 3.46
109 110 1.229951 AGCACTGGGGGATGGAAGA 60.230 57.895 0.00 0.00 0.00 2.87
110 111 0.846427 AGCACTGGGGGATGGAAGAA 60.846 55.000 0.00 0.00 0.00 2.52
111 112 0.394899 GCACTGGGGGATGGAAGAAG 60.395 60.000 0.00 0.00 0.00 2.85
112 113 1.289160 CACTGGGGGATGGAAGAAGA 58.711 55.000 0.00 0.00 0.00 2.87
113 114 1.211457 CACTGGGGGATGGAAGAAGAG 59.789 57.143 0.00 0.00 0.00 2.85
114 115 1.081174 ACTGGGGGATGGAAGAAGAGA 59.919 52.381 0.00 0.00 0.00 3.10
115 116 1.767681 CTGGGGGATGGAAGAAGAGAG 59.232 57.143 0.00 0.00 0.00 3.20
116 117 1.081174 TGGGGGATGGAAGAAGAGAGT 59.919 52.381 0.00 0.00 0.00 3.24
117 118 1.488393 GGGGGATGGAAGAAGAGAGTG 59.512 57.143 0.00 0.00 0.00 3.51
118 119 1.488393 GGGGATGGAAGAAGAGAGTGG 59.512 57.143 0.00 0.00 0.00 4.00
119 120 1.488393 GGGATGGAAGAAGAGAGTGGG 59.512 57.143 0.00 0.00 0.00 4.61
120 121 1.488393 GGATGGAAGAAGAGAGTGGGG 59.512 57.143 0.00 0.00 0.00 4.96
121 122 1.488393 GATGGAAGAAGAGAGTGGGGG 59.512 57.143 0.00 0.00 0.00 5.40
122 123 0.491823 TGGAAGAAGAGAGTGGGGGA 59.508 55.000 0.00 0.00 0.00 4.81
123 124 1.081174 TGGAAGAAGAGAGTGGGGGAT 59.919 52.381 0.00 0.00 0.00 3.85
124 125 2.200955 GGAAGAAGAGAGTGGGGGATT 58.799 52.381 0.00 0.00 0.00 3.01
125 126 2.578480 GGAAGAAGAGAGTGGGGGATTT 59.422 50.000 0.00 0.00 0.00 2.17
126 127 3.010696 GGAAGAAGAGAGTGGGGGATTTT 59.989 47.826 0.00 0.00 0.00 1.82
127 128 3.728385 AGAAGAGAGTGGGGGATTTTG 57.272 47.619 0.00 0.00 0.00 2.44
128 129 2.310052 AGAAGAGAGTGGGGGATTTTGG 59.690 50.000 0.00 0.00 0.00 3.28
129 130 0.332972 AGAGAGTGGGGGATTTTGGC 59.667 55.000 0.00 0.00 0.00 4.52
130 131 0.039618 GAGAGTGGGGGATTTTGGCA 59.960 55.000 0.00 0.00 0.00 4.92
131 132 0.251787 AGAGTGGGGGATTTTGGCAC 60.252 55.000 0.00 0.00 0.00 5.01
132 133 1.595093 GAGTGGGGGATTTTGGCACG 61.595 60.000 0.00 0.00 0.00 5.34
133 134 1.605165 GTGGGGGATTTTGGCACGA 60.605 57.895 0.00 0.00 0.00 4.35
134 135 1.153989 TGGGGGATTTTGGCACGAA 59.846 52.632 0.00 0.00 0.00 3.85
135 136 0.470080 TGGGGGATTTTGGCACGAAA 60.470 50.000 0.00 0.00 0.00 3.46
136 137 0.682292 GGGGGATTTTGGCACGAAAA 59.318 50.000 0.00 0.00 0.00 2.29
137 138 1.277842 GGGGGATTTTGGCACGAAAAT 59.722 47.619 3.41 3.41 38.07 1.82
138 139 2.498078 GGGGGATTTTGGCACGAAAATA 59.502 45.455 3.73 0.00 36.00 1.40
139 140 3.430236 GGGGGATTTTGGCACGAAAATAG 60.430 47.826 3.73 0.00 36.00 1.73
140 141 3.194755 GGGGATTTTGGCACGAAAATAGT 59.805 43.478 3.73 0.00 36.00 2.12
141 142 4.173256 GGGATTTTGGCACGAAAATAGTG 58.827 43.478 3.73 0.00 42.15 2.74
142 143 4.321675 GGGATTTTGGCACGAAAATAGTGT 60.322 41.667 3.73 0.00 41.36 3.55
143 144 4.621034 GGATTTTGGCACGAAAATAGTGTG 59.379 41.667 3.73 0.00 41.36 3.82
144 145 3.634568 TTTGGCACGAAAATAGTGTGG 57.365 42.857 0.00 0.00 41.36 4.17
145 146 1.529226 TGGCACGAAAATAGTGTGGG 58.471 50.000 0.00 0.00 41.36 4.61
146 147 1.072489 TGGCACGAAAATAGTGTGGGA 59.928 47.619 0.00 0.00 41.36 4.37
147 148 2.290641 TGGCACGAAAATAGTGTGGGAT 60.291 45.455 0.00 0.00 41.36 3.85
148 149 2.752903 GGCACGAAAATAGTGTGGGATT 59.247 45.455 0.00 0.00 41.36 3.01
149 150 3.181500 GGCACGAAAATAGTGTGGGATTC 60.181 47.826 0.00 0.00 41.36 2.52
150 151 3.689649 GCACGAAAATAGTGTGGGATTCT 59.310 43.478 0.00 0.00 41.36 2.40
151 152 4.873827 GCACGAAAATAGTGTGGGATTCTA 59.126 41.667 0.00 0.00 41.36 2.10
152 153 5.220605 GCACGAAAATAGTGTGGGATTCTAC 60.221 44.000 0.00 0.00 41.36 2.59
153 154 5.872617 CACGAAAATAGTGTGGGATTCTACA 59.127 40.000 0.00 0.00 35.08 2.74
154 155 6.370442 CACGAAAATAGTGTGGGATTCTACAA 59.630 38.462 0.00 0.00 36.14 2.41
155 156 6.938030 ACGAAAATAGTGTGGGATTCTACAAA 59.062 34.615 0.00 0.00 36.14 2.83
156 157 7.446013 ACGAAAATAGTGTGGGATTCTACAAAA 59.554 33.333 0.00 0.00 36.14 2.44
157 158 7.962918 CGAAAATAGTGTGGGATTCTACAAAAG 59.037 37.037 0.00 0.00 36.14 2.27
158 159 8.934023 AAAATAGTGTGGGATTCTACAAAAGA 57.066 30.769 0.00 0.00 36.14 2.52
159 160 8.567285 AAATAGTGTGGGATTCTACAAAAGAG 57.433 34.615 0.00 0.00 36.14 2.85
160 161 5.568620 AGTGTGGGATTCTACAAAAGAGT 57.431 39.130 0.00 0.00 36.14 3.24
161 162 5.308825 AGTGTGGGATTCTACAAAAGAGTG 58.691 41.667 0.00 0.00 36.14 3.51
162 163 4.455877 GTGTGGGATTCTACAAAAGAGTGG 59.544 45.833 0.00 0.00 36.14 4.00
163 164 4.010349 GTGGGATTCTACAAAAGAGTGGG 58.990 47.826 0.00 0.00 35.05 4.61
164 165 3.017442 GGGATTCTACAAAAGAGTGGGC 58.983 50.000 0.00 0.00 35.05 5.36
165 166 3.308473 GGGATTCTACAAAAGAGTGGGCT 60.308 47.826 0.00 0.00 35.05 5.19
166 167 3.942115 GGATTCTACAAAAGAGTGGGCTC 59.058 47.826 0.00 0.00 41.94 4.70
181 182 0.605083 GGCTCTGCCTTTCTTTTGGG 59.395 55.000 0.73 0.00 46.69 4.12
182 183 1.332195 GCTCTGCCTTTCTTTTGGGT 58.668 50.000 0.00 0.00 0.00 4.51
183 184 1.000171 GCTCTGCCTTTCTTTTGGGTG 60.000 52.381 0.00 0.00 0.00 4.61
184 185 1.615392 CTCTGCCTTTCTTTTGGGTGG 59.385 52.381 0.00 0.00 0.00 4.61
185 186 1.216678 TCTGCCTTTCTTTTGGGTGGA 59.783 47.619 0.00 0.00 0.00 4.02
186 187 1.341209 CTGCCTTTCTTTTGGGTGGAC 59.659 52.381 0.00 0.00 0.00 4.02
187 188 0.679505 GCCTTTCTTTTGGGTGGACC 59.320 55.000 0.00 0.00 40.81 4.46
188 189 0.958822 CCTTTCTTTTGGGTGGACCG 59.041 55.000 0.00 0.00 44.64 4.79
189 190 0.958822 CTTTCTTTTGGGTGGACCGG 59.041 55.000 0.00 0.00 44.64 5.28
190 191 0.468400 TTTCTTTTGGGTGGACCGGG 60.468 55.000 6.32 0.00 44.64 5.73
191 192 2.282887 CTTTTGGGTGGACCGGGG 60.283 66.667 6.32 0.00 44.64 5.73
192 193 2.777400 TTTTGGGTGGACCGGGGA 60.777 61.111 6.32 0.00 44.64 4.81
193 194 2.764637 CTTTTGGGTGGACCGGGGAG 62.765 65.000 6.32 0.00 44.64 4.30
202 203 4.787280 ACCGGGGAGGGCAGAGAG 62.787 72.222 6.32 0.00 46.96 3.20
214 215 2.238245 GCAGAGAGCAATGTTTCACG 57.762 50.000 0.00 0.00 44.79 4.35
215 216 1.532868 GCAGAGAGCAATGTTTCACGT 59.467 47.619 0.00 0.00 44.79 4.49
216 217 2.663879 GCAGAGAGCAATGTTTCACGTG 60.664 50.000 9.94 9.94 44.79 4.49
217 218 2.545526 CAGAGAGCAATGTTTCACGTGT 59.454 45.455 16.51 0.00 0.00 4.49
218 219 2.802816 AGAGAGCAATGTTTCACGTGTC 59.197 45.455 16.51 8.18 0.00 3.67
219 220 1.873591 AGAGCAATGTTTCACGTGTCC 59.126 47.619 16.51 5.23 0.00 4.02
220 221 0.586319 AGCAATGTTTCACGTGTCCG 59.414 50.000 16.51 0.00 40.83 4.79
221 222 0.385473 GCAATGTTTCACGTGTCCGG 60.385 55.000 16.51 0.00 38.78 5.14
222 223 1.222300 CAATGTTTCACGTGTCCGGA 58.778 50.000 16.51 0.00 38.78 5.14
223 224 1.070175 CAATGTTTCACGTGTCCGGAC 60.070 52.381 28.17 28.17 38.78 4.79
224 225 0.391597 ATGTTTCACGTGTCCGGACT 59.608 50.000 33.39 12.78 38.78 3.85
225 226 0.249155 TGTTTCACGTGTCCGGACTC 60.249 55.000 33.39 28.39 38.78 3.36
226 227 0.031721 GTTTCACGTGTCCGGACTCT 59.968 55.000 33.39 17.30 38.78 3.24
227 228 0.313043 TTTCACGTGTCCGGACTCTC 59.687 55.000 33.39 21.72 38.78 3.20
228 229 1.848932 TTCACGTGTCCGGACTCTCG 61.849 60.000 33.39 31.30 38.78 4.04
229 230 3.735029 ACGTGTCCGGACTCTCGC 61.735 66.667 33.39 14.29 38.78 5.03
230 231 3.733960 CGTGTCCGGACTCTCGCA 61.734 66.667 33.39 11.24 0.00 5.10
231 232 2.649034 GTGTCCGGACTCTCGCAA 59.351 61.111 33.39 10.38 0.00 4.85
232 233 1.006571 GTGTCCGGACTCTCGCAAA 60.007 57.895 33.39 9.59 0.00 3.68
233 234 1.009389 GTGTCCGGACTCTCGCAAAG 61.009 60.000 33.39 0.00 0.00 2.77
234 235 2.095252 GTCCGGACTCTCGCAAAGC 61.095 63.158 27.64 0.00 0.00 3.51
235 236 2.815647 CCGGACTCTCGCAAAGCC 60.816 66.667 0.00 0.00 0.00 4.35
236 237 2.815647 CGGACTCTCGCAAAGCCC 60.816 66.667 0.00 0.00 0.00 5.19
237 238 2.665603 GGACTCTCGCAAAGCCCT 59.334 61.111 0.00 0.00 0.00 5.19
238 239 1.448717 GGACTCTCGCAAAGCCCTC 60.449 63.158 0.00 0.00 0.00 4.30
239 240 1.448717 GACTCTCGCAAAGCCCTCC 60.449 63.158 0.00 0.00 0.00 4.30
240 241 2.172483 GACTCTCGCAAAGCCCTCCA 62.172 60.000 0.00 0.00 0.00 3.86
241 242 1.743252 CTCTCGCAAAGCCCTCCAC 60.743 63.158 0.00 0.00 0.00 4.02
242 243 3.121030 CTCGCAAAGCCCTCCACG 61.121 66.667 0.00 0.00 0.00 4.94
243 244 3.883744 CTCGCAAAGCCCTCCACGT 62.884 63.158 0.00 0.00 0.00 4.49
244 245 2.978010 CGCAAAGCCCTCCACGTT 60.978 61.111 0.00 0.00 0.00 3.99
245 246 2.551912 CGCAAAGCCCTCCACGTTT 61.552 57.895 0.00 0.00 0.00 3.60
246 247 1.739667 GCAAAGCCCTCCACGTTTT 59.260 52.632 0.00 0.00 0.00 2.43
247 248 0.104120 GCAAAGCCCTCCACGTTTTT 59.896 50.000 0.00 0.00 0.00 1.94
248 249 1.868109 GCAAAGCCCTCCACGTTTTTC 60.868 52.381 0.00 0.00 0.00 2.29
249 250 1.681264 CAAAGCCCTCCACGTTTTTCT 59.319 47.619 0.00 0.00 0.00 2.52
250 251 1.605753 AAGCCCTCCACGTTTTTCTC 58.394 50.000 0.00 0.00 0.00 2.87
251 252 0.602905 AGCCCTCCACGTTTTTCTCG 60.603 55.000 0.00 0.00 0.00 4.04
252 253 1.866925 CCCTCCACGTTTTTCTCGC 59.133 57.895 0.00 0.00 0.00 5.03
253 254 1.491563 CCTCCACGTTTTTCTCGCG 59.508 57.895 0.00 0.00 0.00 5.87
254 255 1.219522 CCTCCACGTTTTTCTCGCGT 61.220 55.000 5.77 0.00 39.59 6.01
255 256 0.580104 CTCCACGTTTTTCTCGCGTT 59.420 50.000 5.77 0.00 36.67 4.84
256 257 1.004292 CTCCACGTTTTTCTCGCGTTT 60.004 47.619 5.77 0.00 36.67 3.60
257 258 1.109296 CCACGTTTTTCTCGCGTTTG 58.891 50.000 5.77 0.00 36.67 2.93
258 259 0.492737 CACGTTTTTCTCGCGTTTGC 59.507 50.000 5.77 0.00 36.67 3.68
268 269 2.882132 GCGTTTGCGGGGCTATTT 59.118 55.556 0.00 0.00 38.78 1.40
269 270 1.214325 GCGTTTGCGGGGCTATTTT 59.786 52.632 0.00 0.00 38.78 1.82
270 271 0.452585 GCGTTTGCGGGGCTATTTTA 59.547 50.000 0.00 0.00 38.78 1.52
271 272 1.533129 GCGTTTGCGGGGCTATTTTAG 60.533 52.381 0.00 0.00 38.78 1.85
272 273 1.064952 CGTTTGCGGGGCTATTTTAGG 59.935 52.381 0.00 0.00 0.00 2.69
273 274 2.371306 GTTTGCGGGGCTATTTTAGGA 58.629 47.619 0.00 0.00 0.00 2.94
274 275 2.756207 GTTTGCGGGGCTATTTTAGGAA 59.244 45.455 0.00 0.00 0.00 3.36
275 276 3.306472 TTGCGGGGCTATTTTAGGAAT 57.694 42.857 0.00 0.00 0.00 3.01
276 277 2.858745 TGCGGGGCTATTTTAGGAATC 58.141 47.619 0.00 0.00 0.00 2.52
277 278 2.160205 GCGGGGCTATTTTAGGAATCC 58.840 52.381 0.00 0.00 0.00 3.01
278 279 2.488347 GCGGGGCTATTTTAGGAATCCA 60.488 50.000 0.61 0.00 0.00 3.41
279 280 3.827722 CGGGGCTATTTTAGGAATCCAA 58.172 45.455 0.61 0.00 0.00 3.53
280 281 4.407365 CGGGGCTATTTTAGGAATCCAAT 58.593 43.478 0.61 0.00 0.00 3.16
281 282 5.566469 CGGGGCTATTTTAGGAATCCAATA 58.434 41.667 0.61 0.00 0.00 1.90
282 283 6.007703 CGGGGCTATTTTAGGAATCCAATAA 58.992 40.000 0.61 0.00 0.00 1.40
283 284 6.072119 CGGGGCTATTTTAGGAATCCAATAAC 60.072 42.308 0.61 0.00 0.00 1.89
284 285 7.010771 GGGGCTATTTTAGGAATCCAATAACT 58.989 38.462 0.61 0.00 0.00 2.24
285 286 7.176865 GGGGCTATTTTAGGAATCCAATAACTC 59.823 40.741 0.61 0.00 0.00 3.01
286 287 7.176865 GGGCTATTTTAGGAATCCAATAACTCC 59.823 40.741 0.61 0.00 0.00 3.85
287 288 7.176865 GGCTATTTTAGGAATCCAATAACTCCC 59.823 40.741 0.61 0.00 0.00 4.30
288 289 7.094762 GCTATTTTAGGAATCCAATAACTCCCG 60.095 40.741 0.61 0.00 0.00 5.14
289 290 5.961398 TTTAGGAATCCAATAACTCCCGA 57.039 39.130 0.61 0.00 0.00 5.14
290 291 5.961398 TTAGGAATCCAATAACTCCCGAA 57.039 39.130 0.61 0.00 0.00 4.30
291 292 4.152284 AGGAATCCAATAACTCCCGAAC 57.848 45.455 0.61 0.00 0.00 3.95
292 293 2.870411 GGAATCCAATAACTCCCGAACG 59.130 50.000 0.00 0.00 0.00 3.95
293 294 3.528532 GAATCCAATAACTCCCGAACGT 58.471 45.455 0.00 0.00 0.00 3.99
294 295 2.373540 TCCAATAACTCCCGAACGTG 57.626 50.000 0.00 0.00 0.00 4.49
295 296 0.725117 CCAATAACTCCCGAACGTGC 59.275 55.000 0.00 0.00 0.00 5.34
296 297 0.368907 CAATAACTCCCGAACGTGCG 59.631 55.000 9.60 9.60 0.00 5.34
304 305 3.556625 CGAACGTGCGGGATTTGA 58.443 55.556 8.46 0.00 0.00 2.69
305 306 1.419922 CGAACGTGCGGGATTTGAG 59.580 57.895 8.46 0.00 0.00 3.02
306 307 1.134694 GAACGTGCGGGATTTGAGC 59.865 57.895 0.00 0.00 0.00 4.26
307 308 1.573829 GAACGTGCGGGATTTGAGCA 61.574 55.000 0.00 0.00 38.71 4.26
308 309 0.960364 AACGTGCGGGATTTGAGCAT 60.960 50.000 0.00 0.00 43.17 3.79
309 310 0.960364 ACGTGCGGGATTTGAGCATT 60.960 50.000 0.00 0.00 43.17 3.56
310 311 0.171007 CGTGCGGGATTTGAGCATTT 59.829 50.000 0.00 0.00 43.17 2.32
311 312 1.795162 CGTGCGGGATTTGAGCATTTC 60.795 52.381 0.00 0.00 43.17 2.17
312 313 0.451383 TGCGGGATTTGAGCATTTCG 59.549 50.000 0.00 0.00 35.81 3.46
313 314 0.451783 GCGGGATTTGAGCATTTCGT 59.548 50.000 0.00 0.00 0.00 3.85
314 315 1.531883 GCGGGATTTGAGCATTTCGTC 60.532 52.381 0.00 0.00 0.00 4.20
315 316 1.064060 CGGGATTTGAGCATTTCGTCC 59.936 52.381 0.00 0.00 0.00 4.79
316 317 1.405463 GGGATTTGAGCATTTCGTCCC 59.595 52.381 0.00 0.00 37.41 4.46
317 318 1.064060 GGATTTGAGCATTTCGTCCCG 59.936 52.381 0.00 0.00 0.00 5.14
318 319 2.006888 GATTTGAGCATTTCGTCCCGA 58.993 47.619 0.00 0.00 0.00 5.14
319 320 1.885560 TTTGAGCATTTCGTCCCGAA 58.114 45.000 0.00 0.00 44.28 4.30
320 321 1.153353 TTGAGCATTTCGTCCCGAAC 58.847 50.000 0.00 0.00 45.64 3.95
329 330 2.299562 CGTCCCGAACGTTTTGACA 58.700 52.632 19.20 0.00 46.42 3.58
330 331 0.863144 CGTCCCGAACGTTTTGACAT 59.137 50.000 19.20 0.00 46.42 3.06
331 332 1.397945 CGTCCCGAACGTTTTGACATG 60.398 52.381 19.20 0.00 46.42 3.21
332 333 1.069500 GTCCCGAACGTTTTGACATGG 60.069 52.381 16.23 5.53 0.00 3.66
333 334 0.386731 CCCGAACGTTTTGACATGGC 60.387 55.000 0.46 0.00 0.00 4.40
334 335 0.309302 CCGAACGTTTTGACATGGCA 59.691 50.000 0.00 0.00 0.00 4.92
335 336 1.268794 CCGAACGTTTTGACATGGCAA 60.269 47.619 10.79 10.79 0.00 4.52
336 337 1.778591 CGAACGTTTTGACATGGCAAC 59.221 47.619 15.21 2.86 0.00 4.17
337 338 2.540769 CGAACGTTTTGACATGGCAACT 60.541 45.455 15.21 0.00 37.61 3.16
338 339 3.443976 GAACGTTTTGACATGGCAACTT 58.556 40.909 15.21 2.85 37.61 2.66
339 340 3.518634 ACGTTTTGACATGGCAACTTT 57.481 38.095 15.21 0.00 37.61 2.66
340 341 4.640789 ACGTTTTGACATGGCAACTTTA 57.359 36.364 15.21 0.00 37.61 1.85
341 342 4.606961 ACGTTTTGACATGGCAACTTTAG 58.393 39.130 15.21 6.68 37.61 1.85
342 343 4.097286 ACGTTTTGACATGGCAACTTTAGT 59.903 37.500 15.21 7.34 37.61 2.24
343 344 5.040635 CGTTTTGACATGGCAACTTTAGTT 58.959 37.500 15.21 0.00 39.12 2.24
344 345 5.173131 CGTTTTGACATGGCAACTTTAGTTC 59.827 40.000 15.21 0.00 35.83 3.01
345 346 4.481930 TTGACATGGCAACTTTAGTTCG 57.518 40.909 10.79 0.00 35.83 3.95
346 347 3.472652 TGACATGGCAACTTTAGTTCGT 58.527 40.909 0.00 0.00 35.83 3.85
347 348 4.633175 TGACATGGCAACTTTAGTTCGTA 58.367 39.130 0.00 0.00 35.83 3.43
348 349 4.688879 TGACATGGCAACTTTAGTTCGTAG 59.311 41.667 0.00 0.00 35.83 3.51
349 350 4.000988 ACATGGCAACTTTAGTTCGTAGG 58.999 43.478 0.00 0.00 35.83 3.18
350 351 4.250464 CATGGCAACTTTAGTTCGTAGGA 58.750 43.478 0.00 0.00 35.83 2.94
351 352 3.921677 TGGCAACTTTAGTTCGTAGGAG 58.078 45.455 0.00 0.00 35.83 3.69
352 353 3.575256 TGGCAACTTTAGTTCGTAGGAGA 59.425 43.478 0.00 0.00 35.83 3.71
353 354 4.222145 TGGCAACTTTAGTTCGTAGGAGAT 59.778 41.667 0.00 0.00 35.83 2.75
354 355 4.567159 GGCAACTTTAGTTCGTAGGAGATG 59.433 45.833 0.00 0.00 35.83 2.90
355 356 4.567159 GCAACTTTAGTTCGTAGGAGATGG 59.433 45.833 0.00 0.00 35.83 3.51
356 357 4.388378 ACTTTAGTTCGTAGGAGATGGC 57.612 45.455 0.00 0.00 0.00 4.40
357 358 3.767673 ACTTTAGTTCGTAGGAGATGGCA 59.232 43.478 0.00 0.00 0.00 4.92
358 359 4.222145 ACTTTAGTTCGTAGGAGATGGCAA 59.778 41.667 0.00 0.00 0.00 4.52
359 360 2.674796 AGTTCGTAGGAGATGGCAAC 57.325 50.000 0.00 0.00 0.00 4.17
360 361 2.180276 AGTTCGTAGGAGATGGCAACT 58.820 47.619 0.00 0.00 37.61 3.16
361 362 2.567615 AGTTCGTAGGAGATGGCAACTT 59.432 45.455 0.00 0.00 37.61 2.66
362 363 3.008049 AGTTCGTAGGAGATGGCAACTTT 59.992 43.478 0.00 0.00 37.61 2.66
363 364 4.222145 AGTTCGTAGGAGATGGCAACTTTA 59.778 41.667 0.00 0.00 37.61 1.85
364 365 4.386867 TCGTAGGAGATGGCAACTTTAG 57.613 45.455 0.00 0.00 37.61 1.85
365 366 3.767673 TCGTAGGAGATGGCAACTTTAGT 59.232 43.478 0.00 0.00 37.61 2.24
366 367 4.222145 TCGTAGGAGATGGCAACTTTAGTT 59.778 41.667 0.00 0.00 39.12 2.24
380 381 4.793201 ACTTTAGTTGATAAGGGGATGGC 58.207 43.478 0.00 0.00 0.00 4.40
381 382 4.229582 ACTTTAGTTGATAAGGGGATGGCA 59.770 41.667 0.00 0.00 0.00 4.92
382 383 4.871871 TTAGTTGATAAGGGGATGGCAA 57.128 40.909 0.00 0.00 0.00 4.52
383 384 3.018423 AGTTGATAAGGGGATGGCAAC 57.982 47.619 0.00 0.00 36.72 4.17
384 385 2.582636 AGTTGATAAGGGGATGGCAACT 59.417 45.455 0.00 0.00 40.55 3.16
385 386 3.011708 AGTTGATAAGGGGATGGCAACTT 59.988 43.478 0.00 0.00 42.07 2.66
386 387 3.756082 TGATAAGGGGATGGCAACTTT 57.244 42.857 0.00 0.00 37.61 2.66
387 388 3.364549 TGATAAGGGGATGGCAACTTTG 58.635 45.455 0.00 0.00 37.61 2.77
388 389 2.990740 TAAGGGGATGGCAACTTTGT 57.009 45.000 0.00 0.00 37.61 2.83
389 390 1.632589 AAGGGGATGGCAACTTTGTC 58.367 50.000 0.00 0.00 37.61 3.18
390 391 0.251787 AGGGGATGGCAACTTTGTCC 60.252 55.000 0.00 0.00 37.61 4.02
391 392 0.251787 GGGGATGGCAACTTTGTCCT 60.252 55.000 0.00 0.00 37.61 3.85
392 393 1.632589 GGGATGGCAACTTTGTCCTT 58.367 50.000 0.00 0.00 37.61 3.36
393 394 1.970640 GGGATGGCAACTTTGTCCTTT 59.029 47.619 0.00 0.00 37.61 3.11
394 395 2.368548 GGGATGGCAACTTTGTCCTTTT 59.631 45.455 0.00 0.00 37.61 2.27
395 396 3.181455 GGGATGGCAACTTTGTCCTTTTT 60.181 43.478 0.00 0.00 37.61 1.94
396 397 4.058124 GGATGGCAACTTTGTCCTTTTTC 58.942 43.478 0.00 0.00 37.61 2.29
397 398 3.157932 TGGCAACTTTGTCCTTTTTCG 57.842 42.857 0.00 0.00 37.61 3.46
398 399 2.494073 TGGCAACTTTGTCCTTTTTCGT 59.506 40.909 0.00 0.00 37.61 3.85
399 400 3.056465 TGGCAACTTTGTCCTTTTTCGTT 60.056 39.130 0.00 0.00 37.61 3.85
400 401 3.930229 GGCAACTTTGTCCTTTTTCGTTT 59.070 39.130 0.00 0.00 0.00 3.60
401 402 4.390603 GGCAACTTTGTCCTTTTTCGTTTT 59.609 37.500 0.00 0.00 0.00 2.43
402 403 5.106869 GGCAACTTTGTCCTTTTTCGTTTTT 60.107 36.000 0.00 0.00 0.00 1.94
427 428 9.487790 TTTTATCAGAAAATTGTCATGTTTCCC 57.512 29.630 0.00 0.00 32.74 3.97
428 429 6.923199 ATCAGAAAATTGTCATGTTTCCCT 57.077 33.333 0.00 0.00 32.74 4.20
429 430 9.527157 TTATCAGAAAATTGTCATGTTTCCCTA 57.473 29.630 0.00 0.00 32.74 3.53
430 431 7.831691 TCAGAAAATTGTCATGTTTCCCTAA 57.168 32.000 0.00 0.00 32.74 2.69
431 432 8.421249 TCAGAAAATTGTCATGTTTCCCTAAT 57.579 30.769 0.00 0.00 32.74 1.73
432 433 8.522830 TCAGAAAATTGTCATGTTTCCCTAATC 58.477 33.333 0.00 0.00 32.74 1.75
433 434 8.526147 CAGAAAATTGTCATGTTTCCCTAATCT 58.474 33.333 0.00 0.00 32.74 2.40
434 435 8.743714 AGAAAATTGTCATGTTTCCCTAATCTC 58.256 33.333 0.00 0.00 32.74 2.75
435 436 8.421249 AAAATTGTCATGTTTCCCTAATCTCA 57.579 30.769 0.00 0.00 0.00 3.27
436 437 7.396540 AATTGTCATGTTTCCCTAATCTCAC 57.603 36.000 0.00 0.00 0.00 3.51
437 438 4.503910 TGTCATGTTTCCCTAATCTCACG 58.496 43.478 0.00 0.00 0.00 4.35
438 439 3.309954 GTCATGTTTCCCTAATCTCACGC 59.690 47.826 0.00 0.00 0.00 5.34
439 440 3.055458 TCATGTTTCCCTAATCTCACGCA 60.055 43.478 0.00 0.00 0.00 5.24
440 441 3.410631 TGTTTCCCTAATCTCACGCAA 57.589 42.857 0.00 0.00 0.00 4.85
441 442 3.745799 TGTTTCCCTAATCTCACGCAAA 58.254 40.909 0.00 0.00 0.00 3.68
442 443 4.138290 TGTTTCCCTAATCTCACGCAAAA 58.862 39.130 0.00 0.00 0.00 2.44
443 444 4.764823 TGTTTCCCTAATCTCACGCAAAAT 59.235 37.500 0.00 0.00 0.00 1.82
444 445 5.941058 TGTTTCCCTAATCTCACGCAAAATA 59.059 36.000 0.00 0.00 0.00 1.40
445 446 6.431543 TGTTTCCCTAATCTCACGCAAAATAA 59.568 34.615 0.00 0.00 0.00 1.40
446 447 7.040340 TGTTTCCCTAATCTCACGCAAAATAAA 60.040 33.333 0.00 0.00 0.00 1.40
447 448 6.677781 TCCCTAATCTCACGCAAAATAAAG 57.322 37.500 0.00 0.00 0.00 1.85
448 449 6.177610 TCCCTAATCTCACGCAAAATAAAGT 58.822 36.000 0.00 0.00 0.00 2.66
449 450 6.657541 TCCCTAATCTCACGCAAAATAAAGTT 59.342 34.615 0.00 0.00 0.00 2.66
450 451 6.747280 CCCTAATCTCACGCAAAATAAAGTTG 59.253 38.462 0.00 0.00 0.00 3.16
451 452 7.305474 CCTAATCTCACGCAAAATAAAGTTGT 58.695 34.615 0.00 0.00 0.00 3.32
452 453 7.481798 CCTAATCTCACGCAAAATAAAGTTGTC 59.518 37.037 0.00 0.00 0.00 3.18
453 454 4.768145 TCTCACGCAAAATAAAGTTGTCG 58.232 39.130 0.00 0.00 34.17 4.35
454 455 4.271533 TCTCACGCAAAATAAAGTTGTCGT 59.728 37.500 0.00 0.00 38.40 4.34
455 456 4.520078 TCACGCAAAATAAAGTTGTCGTC 58.480 39.130 0.00 0.00 36.95 4.20
456 457 4.271533 TCACGCAAAATAAAGTTGTCGTCT 59.728 37.500 0.00 0.00 36.95 4.18
457 458 5.462729 TCACGCAAAATAAAGTTGTCGTCTA 59.537 36.000 0.00 0.00 36.95 2.59
458 459 6.018913 TCACGCAAAATAAAGTTGTCGTCTAA 60.019 34.615 0.00 0.00 36.95 2.10
459 460 6.629649 CACGCAAAATAAAGTTGTCGTCTAAA 59.370 34.615 0.00 0.00 36.95 1.85
460 461 7.164498 CACGCAAAATAAAGTTGTCGTCTAAAA 59.836 33.333 0.00 0.00 36.95 1.52
461 462 7.375017 ACGCAAAATAAAGTTGTCGTCTAAAAG 59.625 33.333 0.00 0.00 35.40 2.27
462 463 7.490868 GCAAAATAAAGTTGTCGTCTAAAAGC 58.509 34.615 0.00 0.00 0.00 3.51
463 464 7.614499 GCAAAATAAAGTTGTCGTCTAAAAGCG 60.614 37.037 0.00 0.00 0.00 4.68
464 465 6.535274 AATAAAGTTGTCGTCTAAAAGCGT 57.465 33.333 0.00 0.00 0.00 5.07
465 466 4.870221 AAAGTTGTCGTCTAAAAGCGTT 57.130 36.364 0.00 0.00 0.00 4.84
466 467 4.448363 AAGTTGTCGTCTAAAAGCGTTC 57.552 40.909 0.00 0.00 0.00 3.95
467 468 2.470257 AGTTGTCGTCTAAAAGCGTTCG 59.530 45.455 0.00 0.00 0.00 3.95
468 469 1.411394 TGTCGTCTAAAAGCGTTCGG 58.589 50.000 0.00 0.00 0.00 4.30
469 470 0.712222 GTCGTCTAAAAGCGTTCGGG 59.288 55.000 0.00 0.00 0.00 5.14
470 471 0.314935 TCGTCTAAAAGCGTTCGGGT 59.685 50.000 0.00 0.00 0.00 5.28
471 472 1.142474 CGTCTAAAAGCGTTCGGGTT 58.858 50.000 0.00 0.00 38.16 4.11
472 473 1.136446 CGTCTAAAAGCGTTCGGGTTG 60.136 52.381 0.00 0.00 36.26 3.77
473 474 0.869730 TCTAAAAGCGTTCGGGTTGC 59.130 50.000 0.00 0.00 36.26 4.17
474 475 0.109919 CTAAAAGCGTTCGGGTTGCC 60.110 55.000 0.00 0.00 36.26 4.52
475 476 0.818445 TAAAAGCGTTCGGGTTGCCA 60.818 50.000 0.00 0.00 36.26 4.92
476 477 1.460273 AAAAGCGTTCGGGTTGCCAT 61.460 50.000 0.00 0.00 36.26 4.40
477 478 2.141122 AAAGCGTTCGGGTTGCCATG 62.141 55.000 0.00 0.00 36.26 3.66
478 479 4.776647 GCGTTCGGGTTGCCATGC 62.777 66.667 0.00 0.00 0.00 4.06
479 480 3.055719 CGTTCGGGTTGCCATGCT 61.056 61.111 0.00 0.00 0.00 3.79
480 481 2.625823 CGTTCGGGTTGCCATGCTT 61.626 57.895 0.00 0.00 0.00 3.91
481 482 1.302383 CGTTCGGGTTGCCATGCTTA 61.302 55.000 0.00 0.00 0.00 3.09
482 483 0.885196 GTTCGGGTTGCCATGCTTAA 59.115 50.000 0.00 0.00 0.00 1.85
483 484 1.271102 GTTCGGGTTGCCATGCTTAAA 59.729 47.619 0.00 0.00 0.00 1.52
484 485 1.846007 TCGGGTTGCCATGCTTAAAT 58.154 45.000 0.00 0.00 0.00 1.40
485 486 1.748493 TCGGGTTGCCATGCTTAAATC 59.252 47.619 0.00 0.00 0.00 2.17
486 487 1.202405 CGGGTTGCCATGCTTAAATCC 60.202 52.381 0.00 0.00 0.00 3.01
487 488 2.110578 GGGTTGCCATGCTTAAATCCT 58.889 47.619 0.00 0.00 0.00 3.24
488 489 2.159057 GGGTTGCCATGCTTAAATCCTG 60.159 50.000 0.00 0.00 0.00 3.86
489 490 2.760092 GGTTGCCATGCTTAAATCCTGA 59.240 45.455 0.00 0.00 0.00 3.86
490 491 3.195396 GGTTGCCATGCTTAAATCCTGAA 59.805 43.478 0.00 0.00 0.00 3.02
491 492 4.176271 GTTGCCATGCTTAAATCCTGAAC 58.824 43.478 0.00 0.00 0.00 3.18
492 493 2.423185 TGCCATGCTTAAATCCTGAACG 59.577 45.455 0.00 0.00 0.00 3.95
493 494 2.423538 GCCATGCTTAAATCCTGAACGT 59.576 45.455 0.00 0.00 0.00 3.99
494 495 3.119495 GCCATGCTTAAATCCTGAACGTT 60.119 43.478 0.00 0.00 0.00 3.99
495 496 4.662145 CCATGCTTAAATCCTGAACGTTC 58.338 43.478 21.42 21.42 0.00 3.95
496 497 4.334443 CATGCTTAAATCCTGAACGTTCG 58.666 43.478 22.48 16.45 0.00 3.95
497 498 2.739913 TGCTTAAATCCTGAACGTTCGG 59.260 45.455 26.94 26.94 0.00 4.30
506 507 3.226346 CTGAACGTTCGGGAGTTATCA 57.774 47.619 26.35 4.25 0.00 2.15
507 508 3.782046 CTGAACGTTCGGGAGTTATCAT 58.218 45.455 26.35 0.00 0.00 2.45
508 509 4.181578 CTGAACGTTCGGGAGTTATCATT 58.818 43.478 26.35 0.00 0.00 2.57
509 510 5.327616 TGAACGTTCGGGAGTTATCATTA 57.672 39.130 22.48 0.00 0.00 1.90
510 511 5.104374 TGAACGTTCGGGAGTTATCATTAC 58.896 41.667 22.48 0.00 0.00 1.89
511 512 4.050852 ACGTTCGGGAGTTATCATTACC 57.949 45.455 0.00 0.00 0.00 2.85
512 513 3.047796 CGTTCGGGAGTTATCATTACCG 58.952 50.000 0.00 0.00 42.45 4.02
513 514 2.798847 GTTCGGGAGTTATCATTACCGC 59.201 50.000 0.00 0.00 40.99 5.68
514 515 2.313317 TCGGGAGTTATCATTACCGCT 58.687 47.619 0.00 0.00 40.99 5.52
515 516 3.489355 TCGGGAGTTATCATTACCGCTA 58.511 45.455 0.00 0.00 40.99 4.26
516 517 4.084287 TCGGGAGTTATCATTACCGCTAT 58.916 43.478 0.00 0.00 40.99 2.97
517 518 5.255687 TCGGGAGTTATCATTACCGCTATA 58.744 41.667 0.00 0.00 40.99 1.31
518 519 5.889853 TCGGGAGTTATCATTACCGCTATAT 59.110 40.000 0.00 0.00 40.99 0.86
519 520 6.379133 TCGGGAGTTATCATTACCGCTATATT 59.621 38.462 0.00 0.00 40.99 1.28
520 521 7.557358 TCGGGAGTTATCATTACCGCTATATTA 59.443 37.037 0.00 0.00 40.99 0.98
521 522 8.358148 CGGGAGTTATCATTACCGCTATATTAT 58.642 37.037 0.00 0.00 34.54 1.28
522 523 9.477484 GGGAGTTATCATTACCGCTATATTATG 57.523 37.037 0.00 0.00 0.00 1.90
523 524 9.477484 GGAGTTATCATTACCGCTATATTATGG 57.523 37.037 0.00 0.00 0.00 2.74
525 526 9.817809 AGTTATCATTACCGCTATATTATGGTG 57.182 33.333 3.46 0.00 35.93 4.17
526 527 8.548721 GTTATCATTACCGCTATATTATGGTGC 58.451 37.037 3.46 0.00 35.93 5.01
527 528 5.424757 TCATTACCGCTATATTATGGTGCC 58.575 41.667 3.46 0.00 35.93 5.01
528 529 5.188948 TCATTACCGCTATATTATGGTGCCT 59.811 40.000 3.46 0.00 35.93 4.75
529 530 5.492855 TTACCGCTATATTATGGTGCCTT 57.507 39.130 3.46 0.00 35.93 4.35
530 531 6.608539 TTACCGCTATATTATGGTGCCTTA 57.391 37.500 3.46 0.00 35.93 2.69
531 532 5.693769 ACCGCTATATTATGGTGCCTTAT 57.306 39.130 0.00 0.00 32.33 1.73
532 533 6.801718 ACCGCTATATTATGGTGCCTTATA 57.198 37.500 0.00 0.00 32.33 0.98
533 534 7.190335 ACCGCTATATTATGGTGCCTTATAA 57.810 36.000 0.00 0.00 32.33 0.98
534 535 7.626390 ACCGCTATATTATGGTGCCTTATAAA 58.374 34.615 0.00 0.00 32.33 1.40
535 536 7.551617 ACCGCTATATTATGGTGCCTTATAAAC 59.448 37.037 0.00 0.00 32.33 2.01
536 537 7.012044 CCGCTATATTATGGTGCCTTATAAACC 59.988 40.741 0.00 0.00 34.38 3.27
538 539 8.893727 GCTATATTATGGTGCCTTATAAACCAG 58.106 37.037 12.01 0.61 46.68 4.00
543 544 8.918202 TTATGGTGCCTTATAAACCAGATAAG 57.082 34.615 12.01 0.00 46.68 1.73
544 545 6.569127 TGGTGCCTTATAAACCAGATAAGA 57.431 37.500 3.78 0.00 39.05 2.10
545 546 6.591935 TGGTGCCTTATAAACCAGATAAGAG 58.408 40.000 3.78 0.00 39.05 2.85
546 547 5.998363 GGTGCCTTATAAACCAGATAAGAGG 59.002 44.000 4.36 0.00 38.60 3.69
547 548 5.998363 GTGCCTTATAAACCAGATAAGAGGG 59.002 44.000 4.36 0.00 38.60 4.30
548 549 5.073144 TGCCTTATAAACCAGATAAGAGGGG 59.927 44.000 4.36 0.00 38.60 4.79
549 550 5.561679 CCTTATAAACCAGATAAGAGGGGC 58.438 45.833 4.36 0.00 38.60 5.80
550 551 5.515008 CCTTATAAACCAGATAAGAGGGGCC 60.515 48.000 0.00 0.00 38.60 5.80
551 552 1.681229 AAACCAGATAAGAGGGGCCA 58.319 50.000 4.39 0.00 0.00 5.36
552 553 1.912862 AACCAGATAAGAGGGGCCAT 58.087 50.000 4.39 0.00 0.00 4.40
553 554 1.912862 ACCAGATAAGAGGGGCCATT 58.087 50.000 4.39 0.00 0.00 3.16
554 555 2.217776 ACCAGATAAGAGGGGCCATTT 58.782 47.619 4.39 0.00 0.00 2.32
555 556 2.587307 ACCAGATAAGAGGGGCCATTTT 59.413 45.455 4.39 1.52 0.00 1.82
556 557 3.791545 ACCAGATAAGAGGGGCCATTTTA 59.208 43.478 4.39 4.40 0.00 1.52
557 558 4.420214 ACCAGATAAGAGGGGCCATTTTAT 59.580 41.667 13.10 13.10 0.00 1.40
558 559 5.103086 ACCAGATAAGAGGGGCCATTTTATT 60.103 40.000 14.22 3.67 0.00 1.40
559 560 5.244626 CCAGATAAGAGGGGCCATTTTATTG 59.755 44.000 14.22 13.12 0.00 1.90
560 561 5.835280 CAGATAAGAGGGGCCATTTTATTGT 59.165 40.000 14.22 4.01 0.00 2.71
561 562 7.004086 CAGATAAGAGGGGCCATTTTATTGTA 58.996 38.462 14.22 0.00 0.00 2.41
562 563 7.175641 CAGATAAGAGGGGCCATTTTATTGTAG 59.824 40.741 14.22 3.24 0.00 2.74
563 564 5.466127 AAGAGGGGCCATTTTATTGTAGA 57.534 39.130 4.39 0.00 0.00 2.59
564 565 4.793201 AGAGGGGCCATTTTATTGTAGAC 58.207 43.478 4.39 0.00 0.00 2.59
565 566 3.551846 AGGGGCCATTTTATTGTAGACG 58.448 45.455 4.39 0.00 0.00 4.18
566 567 3.201266 AGGGGCCATTTTATTGTAGACGA 59.799 43.478 4.39 0.00 0.00 4.20
567 568 4.141251 AGGGGCCATTTTATTGTAGACGAT 60.141 41.667 4.39 0.00 0.00 3.73
568 569 4.215613 GGGGCCATTTTATTGTAGACGATC 59.784 45.833 4.39 0.00 0.00 3.69
569 570 5.063880 GGGCCATTTTATTGTAGACGATCT 58.936 41.667 4.39 0.00 0.00 2.75
570 571 5.179555 GGGCCATTTTATTGTAGACGATCTC 59.820 44.000 4.39 0.00 0.00 2.75
571 572 5.992217 GGCCATTTTATTGTAGACGATCTCT 59.008 40.000 0.00 0.00 0.00 3.10
572 573 6.146347 GGCCATTTTATTGTAGACGATCTCTC 59.854 42.308 0.00 0.00 0.00 3.20
573 574 6.926272 GCCATTTTATTGTAGACGATCTCTCT 59.074 38.462 0.00 0.00 0.00 3.10
574 575 7.439655 GCCATTTTATTGTAGACGATCTCTCTT 59.560 37.037 0.00 0.00 0.00 2.85
575 576 9.319143 CCATTTTATTGTAGACGATCTCTCTTT 57.681 33.333 0.00 0.00 0.00 2.52
604 605 7.925993 TGCCTACATTTTCTCCAAATATAACG 58.074 34.615 0.00 0.00 32.90 3.18
605 606 7.554835 TGCCTACATTTTCTCCAAATATAACGT 59.445 33.333 0.00 0.00 32.90 3.99
606 607 8.068380 GCCTACATTTTCTCCAAATATAACGTC 58.932 37.037 0.00 0.00 32.90 4.34
607 608 8.273557 CCTACATTTTCTCCAAATATAACGTCG 58.726 37.037 0.00 0.00 32.90 5.12
608 609 6.483687 ACATTTTCTCCAAATATAACGTCGC 58.516 36.000 0.00 0.00 32.90 5.19
609 610 6.092944 ACATTTTCTCCAAATATAACGTCGCA 59.907 34.615 0.00 0.00 32.90 5.10
610 611 6.671614 TTTTCTCCAAATATAACGTCGCAT 57.328 33.333 0.00 0.00 0.00 4.73
611 612 7.773864 TTTTCTCCAAATATAACGTCGCATA 57.226 32.000 0.00 0.00 0.00 3.14
612 613 7.956420 TTTCTCCAAATATAACGTCGCATAT 57.044 32.000 0.00 0.00 0.00 1.78
613 614 7.956420 TTCTCCAAATATAACGTCGCATATT 57.044 32.000 6.79 6.79 0.00 1.28
614 615 9.478768 TTTCTCCAAATATAACGTCGCATATTA 57.521 29.630 11.15 0.00 29.33 0.98
615 616 9.478768 TTCTCCAAATATAACGTCGCATATTAA 57.521 29.630 11.15 2.62 29.33 1.40
616 617 9.478768 TCTCCAAATATAACGTCGCATATTAAA 57.521 29.630 11.15 3.05 29.33 1.52
624 625 5.917541 ACGTCGCATATTAAAATAGGTGG 57.082 39.130 7.76 0.00 34.83 4.61
625 626 5.603596 ACGTCGCATATTAAAATAGGTGGA 58.396 37.500 7.76 0.00 34.83 4.02
626 627 6.050432 ACGTCGCATATTAAAATAGGTGGAA 58.950 36.000 7.76 0.00 34.83 3.53
627 628 6.202188 ACGTCGCATATTAAAATAGGTGGAAG 59.798 38.462 7.76 5.54 34.83 3.46
628 629 6.347402 CGTCGCATATTAAAATAGGTGGAAGG 60.347 42.308 7.76 0.00 34.83 3.46
629 630 5.472137 TCGCATATTAAAATAGGTGGAAGGC 59.528 40.000 7.76 0.00 34.83 4.35
630 631 5.240623 CGCATATTAAAATAGGTGGAAGGCA 59.759 40.000 1.08 0.00 31.60 4.75
631 632 6.238897 CGCATATTAAAATAGGTGGAAGGCAA 60.239 38.462 1.08 0.00 31.60 4.52
632 633 6.923508 GCATATTAAAATAGGTGGAAGGCAAC 59.076 38.462 0.00 0.00 0.00 4.17
666 667 0.666577 AACCAGTAGAGCGCACGAAC 60.667 55.000 11.47 7.76 0.00 3.95
695 696 6.071221 ACGGTAATGGCATTACGGAGATTATA 60.071 38.462 40.75 13.89 44.65 0.98
696 697 6.255020 CGGTAATGGCATTACGGAGATTATAC 59.745 42.308 35.70 21.26 44.65 1.47
697 698 7.328737 GGTAATGGCATTACGGAGATTATACT 58.671 38.462 32.66 3.73 44.65 2.12
698 699 7.491696 GGTAATGGCATTACGGAGATTATACTC 59.508 40.741 32.66 17.08 44.65 2.59
719 720 7.560796 ACTCCCTCCATTATCTTATACAAGG 57.439 40.000 0.00 0.00 32.22 3.61
720 721 6.013293 ACTCCCTCCATTATCTTATACAAGGC 60.013 42.308 0.00 0.00 32.22 4.35
721 722 5.250774 TCCCTCCATTATCTTATACAAGGCC 59.749 44.000 0.00 0.00 32.22 5.19
722 723 5.014123 CCCTCCATTATCTTATACAAGGCCA 59.986 44.000 5.01 0.00 32.22 5.36
723 724 5.940470 CCTCCATTATCTTATACAAGGCCAC 59.060 44.000 5.01 0.00 32.22 5.01
724 725 6.465751 CCTCCATTATCTTATACAAGGCCACA 60.466 42.308 5.01 0.00 32.22 4.17
725 726 6.905736 TCCATTATCTTATACAAGGCCACAA 58.094 36.000 5.01 0.00 32.22 3.33
726 727 7.350382 TCCATTATCTTATACAAGGCCACAAA 58.650 34.615 5.01 0.00 32.22 2.83
727 728 7.284489 TCCATTATCTTATACAAGGCCACAAAC 59.716 37.037 5.01 0.00 32.22 2.93
728 729 7.285401 CCATTATCTTATACAAGGCCACAAACT 59.715 37.037 5.01 0.00 32.22 2.66
729 730 7.859325 TTATCTTATACAAGGCCACAAACTC 57.141 36.000 5.01 0.00 32.22 3.01
730 731 5.235850 TCTTATACAAGGCCACAAACTCA 57.764 39.130 5.01 0.00 32.22 3.41
731 732 5.626142 TCTTATACAAGGCCACAAACTCAA 58.374 37.500 5.01 0.00 32.22 3.02
732 733 6.065374 TCTTATACAAGGCCACAAACTCAAA 58.935 36.000 5.01 0.00 32.22 2.69
733 734 6.719370 TCTTATACAAGGCCACAAACTCAAAT 59.281 34.615 5.01 0.00 32.22 2.32
734 735 5.806654 ATACAAGGCCACAAACTCAAATT 57.193 34.783 5.01 0.00 0.00 1.82
735 736 6.909550 ATACAAGGCCACAAACTCAAATTA 57.090 33.333 5.01 0.00 0.00 1.40
736 737 4.944048 ACAAGGCCACAAACTCAAATTAC 58.056 39.130 5.01 0.00 0.00 1.89
737 738 4.404073 ACAAGGCCACAAACTCAAATTACA 59.596 37.500 5.01 0.00 0.00 2.41
738 739 4.853924 AGGCCACAAACTCAAATTACAG 57.146 40.909 5.01 0.00 0.00 2.74
739 740 3.573967 AGGCCACAAACTCAAATTACAGG 59.426 43.478 5.01 0.00 0.00 4.00
740 741 3.320826 GGCCACAAACTCAAATTACAGGT 59.679 43.478 0.00 0.00 0.00 4.00
741 742 4.521256 GGCCACAAACTCAAATTACAGGTA 59.479 41.667 0.00 0.00 0.00 3.08
742 743 5.185056 GGCCACAAACTCAAATTACAGGTAT 59.815 40.000 0.00 0.00 0.00 2.73
743 744 6.322491 GCCACAAACTCAAATTACAGGTATC 58.678 40.000 0.00 0.00 0.00 2.24
744 745 6.151144 GCCACAAACTCAAATTACAGGTATCT 59.849 38.462 0.00 0.00 0.00 1.98
745 746 7.335924 GCCACAAACTCAAATTACAGGTATCTA 59.664 37.037 0.00 0.00 0.00 1.98
746 747 8.883731 CCACAAACTCAAATTACAGGTATCTAG 58.116 37.037 0.00 0.00 0.00 2.43
747 748 8.883731 CACAAACTCAAATTACAGGTATCTAGG 58.116 37.037 0.00 0.00 0.00 3.02
748 749 8.603304 ACAAACTCAAATTACAGGTATCTAGGT 58.397 33.333 0.00 0.00 0.00 3.08
775 776 7.775053 AATTTAATGACTAGTTTCCAAGCCA 57.225 32.000 0.00 0.00 0.00 4.75
776 777 7.775053 ATTTAATGACTAGTTTCCAAGCCAA 57.225 32.000 0.00 0.00 0.00 4.52
777 778 6.569179 TTAATGACTAGTTTCCAAGCCAAC 57.431 37.500 0.00 0.00 0.00 3.77
778 779 3.857157 TGACTAGTTTCCAAGCCAACT 57.143 42.857 0.00 0.00 37.08 3.16
779 780 4.164843 TGACTAGTTTCCAAGCCAACTT 57.835 40.909 0.00 0.00 34.92 2.66
780 781 4.532834 TGACTAGTTTCCAAGCCAACTTT 58.467 39.130 0.00 0.00 34.92 2.66
781 782 4.953579 TGACTAGTTTCCAAGCCAACTTTT 59.046 37.500 0.00 0.00 34.92 2.27
782 783 5.067283 TGACTAGTTTCCAAGCCAACTTTTC 59.933 40.000 0.00 0.00 34.92 2.29
783 784 5.201243 ACTAGTTTCCAAGCCAACTTTTCT 58.799 37.500 0.00 0.00 34.92 2.52
784 785 5.656859 ACTAGTTTCCAAGCCAACTTTTCTT 59.343 36.000 0.00 0.00 34.92 2.52
785 786 5.011090 AGTTTCCAAGCCAACTTTTCTTC 57.989 39.130 0.00 0.00 32.29 2.87
786 787 4.711846 AGTTTCCAAGCCAACTTTTCTTCT 59.288 37.500 0.00 0.00 32.29 2.85
787 788 5.187772 AGTTTCCAAGCCAACTTTTCTTCTT 59.812 36.000 0.00 0.00 32.29 2.52
788 789 4.654091 TCCAAGCCAACTTTTCTTCTTG 57.346 40.909 0.00 0.00 32.29 3.02
789 790 4.023291 TCCAAGCCAACTTTTCTTCTTGT 58.977 39.130 0.00 0.00 32.29 3.16
790 791 4.466015 TCCAAGCCAACTTTTCTTCTTGTT 59.534 37.500 0.00 0.00 32.29 2.83
791 792 5.654650 TCCAAGCCAACTTTTCTTCTTGTTA 59.345 36.000 0.00 0.00 32.29 2.41
792 793 6.323739 TCCAAGCCAACTTTTCTTCTTGTTAT 59.676 34.615 0.00 0.00 32.29 1.89
793 794 6.642540 CCAAGCCAACTTTTCTTCTTGTTATC 59.357 38.462 0.00 0.00 32.29 1.75
794 795 7.428826 CAAGCCAACTTTTCTTCTTGTTATCT 58.571 34.615 0.00 0.00 32.29 1.98
795 796 6.974965 AGCCAACTTTTCTTCTTGTTATCTG 58.025 36.000 0.00 0.00 0.00 2.90
796 797 6.015940 AGCCAACTTTTCTTCTTGTTATCTGG 60.016 38.462 0.00 0.00 0.00 3.86
797 798 6.681777 CCAACTTTTCTTCTTGTTATCTGGG 58.318 40.000 0.00 0.00 0.00 4.45
798 799 6.490040 CCAACTTTTCTTCTTGTTATCTGGGA 59.510 38.462 0.00 0.00 0.00 4.37
799 800 7.177392 CCAACTTTTCTTCTTGTTATCTGGGAT 59.823 37.037 0.00 0.00 0.00 3.85
800 801 7.929941 ACTTTTCTTCTTGTTATCTGGGATC 57.070 36.000 0.00 0.00 0.00 3.36
801 802 7.461749 ACTTTTCTTCTTGTTATCTGGGATCA 58.538 34.615 0.00 0.00 0.00 2.92
802 803 8.112183 ACTTTTCTTCTTGTTATCTGGGATCAT 58.888 33.333 0.00 0.00 0.00 2.45
803 804 8.884124 TTTTCTTCTTGTTATCTGGGATCATT 57.116 30.769 0.00 0.00 0.00 2.57
804 805 9.973661 TTTTCTTCTTGTTATCTGGGATCATTA 57.026 29.630 0.00 0.00 0.00 1.90
805 806 9.973661 TTTCTTCTTGTTATCTGGGATCATTAA 57.026 29.630 0.00 0.00 0.00 1.40
809 810 9.489084 TTCTTGTTATCTGGGATCATTAATACG 57.511 33.333 0.00 0.00 0.00 3.06
810 811 7.602644 TCTTGTTATCTGGGATCATTAATACGC 59.397 37.037 0.00 0.00 0.00 4.42
811 812 7.004555 TGTTATCTGGGATCATTAATACGCT 57.995 36.000 0.00 0.00 0.00 5.07
812 813 7.097192 TGTTATCTGGGATCATTAATACGCTC 58.903 38.462 0.00 0.00 0.00 5.03
813 814 4.174411 TCTGGGATCATTAATACGCTCG 57.826 45.455 0.00 0.00 0.00 5.03
814 815 2.668457 CTGGGATCATTAATACGCTCGC 59.332 50.000 0.00 0.00 0.00 5.03
815 816 2.036604 TGGGATCATTAATACGCTCGCA 59.963 45.455 0.00 0.00 0.00 5.10
816 817 3.262420 GGGATCATTAATACGCTCGCAT 58.738 45.455 0.00 0.00 0.00 4.73
817 818 3.062639 GGGATCATTAATACGCTCGCATG 59.937 47.826 0.00 0.00 0.00 4.06
818 819 3.484229 GGATCATTAATACGCTCGCATGC 60.484 47.826 7.91 7.91 0.00 4.06
819 820 2.478831 TCATTAATACGCTCGCATGCA 58.521 42.857 19.57 4.02 0.00 3.96
820 821 3.066380 TCATTAATACGCTCGCATGCAT 58.934 40.909 19.57 0.00 0.00 3.96
821 822 2.947754 TTAATACGCTCGCATGCATG 57.052 45.000 22.70 22.70 0.00 4.06
835 836 4.118093 CATGCATGCAAGGAAGAAATGA 57.882 40.909 26.68 0.00 0.00 2.57
836 837 4.500127 CATGCATGCAAGGAAGAAATGAA 58.500 39.130 26.68 0.00 0.00 2.57
837 838 4.603989 TGCATGCAAGGAAGAAATGAAA 57.396 36.364 20.30 0.00 0.00 2.69
838 839 4.958509 TGCATGCAAGGAAGAAATGAAAA 58.041 34.783 20.30 0.00 0.00 2.29
839 840 4.992319 TGCATGCAAGGAAGAAATGAAAAG 59.008 37.500 20.30 0.00 0.00 2.27
840 841 4.390909 GCATGCAAGGAAGAAATGAAAAGG 59.609 41.667 14.21 0.00 0.00 3.11
841 842 5.786311 CATGCAAGGAAGAAATGAAAAGGA 58.214 37.500 0.00 0.00 0.00 3.36
842 843 5.867903 TGCAAGGAAGAAATGAAAAGGAA 57.132 34.783 0.00 0.00 0.00 3.36
843 844 5.846203 TGCAAGGAAGAAATGAAAAGGAAG 58.154 37.500 0.00 0.00 0.00 3.46
844 845 5.363580 TGCAAGGAAGAAATGAAAAGGAAGT 59.636 36.000 0.00 0.00 0.00 3.01
845 846 6.549364 TGCAAGGAAGAAATGAAAAGGAAGTA 59.451 34.615 0.00 0.00 0.00 2.24
846 847 7.087007 GCAAGGAAGAAATGAAAAGGAAGTAG 58.913 38.462 0.00 0.00 0.00 2.57
847 848 6.825944 AGGAAGAAATGAAAAGGAAGTAGC 57.174 37.500 0.00 0.00 0.00 3.58
848 849 6.306987 AGGAAGAAATGAAAAGGAAGTAGCA 58.693 36.000 0.00 0.00 0.00 3.49
849 850 6.207614 AGGAAGAAATGAAAAGGAAGTAGCAC 59.792 38.462 0.00 0.00 0.00 4.40
850 851 6.016276 GGAAGAAATGAAAAGGAAGTAGCACA 60.016 38.462 0.00 0.00 0.00 4.57
851 852 6.566197 AGAAATGAAAAGGAAGTAGCACAG 57.434 37.500 0.00 0.00 0.00 3.66
852 853 6.064717 AGAAATGAAAAGGAAGTAGCACAGT 58.935 36.000 0.00 0.00 0.00 3.55
853 854 5.695851 AATGAAAAGGAAGTAGCACAGTG 57.304 39.130 0.00 0.00 0.00 3.66
854 855 4.150897 TGAAAAGGAAGTAGCACAGTGT 57.849 40.909 1.61 0.00 0.00 3.55
855 856 4.127171 TGAAAAGGAAGTAGCACAGTGTC 58.873 43.478 1.61 0.00 0.00 3.67
856 857 3.838244 AAAGGAAGTAGCACAGTGTCA 57.162 42.857 1.61 0.00 0.00 3.58
857 858 4.357918 AAAGGAAGTAGCACAGTGTCAT 57.642 40.909 1.61 0.00 0.00 3.06
858 859 4.357918 AAGGAAGTAGCACAGTGTCATT 57.642 40.909 1.61 0.00 0.00 2.57
859 860 5.483685 AAGGAAGTAGCACAGTGTCATTA 57.516 39.130 1.61 0.00 0.00 1.90
860 861 5.683876 AGGAAGTAGCACAGTGTCATTAT 57.316 39.130 1.61 0.00 0.00 1.28
861 862 5.423015 AGGAAGTAGCACAGTGTCATTATG 58.577 41.667 1.61 0.00 0.00 1.90
862 863 5.187772 AGGAAGTAGCACAGTGTCATTATGA 59.812 40.000 1.61 0.00 0.00 2.15
878 879 8.370493 GTCATTATGACTACATGCATGTAAGT 57.630 34.615 33.05 29.88 43.73 2.24
879 880 9.476202 GTCATTATGACTACATGCATGTAAGTA 57.524 33.333 33.05 23.37 43.73 2.24
886 887 9.660180 TGACTACATGCATGTAAGTATTAAACA 57.340 29.630 33.05 22.17 42.20 2.83
892 893 9.904647 CATGCATGTAAGTATTAAACAAATTGC 57.095 29.630 18.91 0.00 28.70 3.56
893 894 9.874205 ATGCATGTAAGTATTAAACAAATTGCT 57.126 25.926 0.00 0.00 28.70 3.91
902 903 9.865321 AGTATTAAACAAATTGCTAGTACGAGA 57.135 29.630 7.23 0.00 0.00 4.04
906 907 9.654417 TTAAACAAATTGCTAGTACGAGAAAAC 57.346 29.630 7.23 0.00 0.00 2.43
907 908 6.854496 ACAAATTGCTAGTACGAGAAAACA 57.146 33.333 7.23 0.00 0.00 2.83
908 909 7.435068 ACAAATTGCTAGTACGAGAAAACAT 57.565 32.000 7.23 0.00 0.00 2.71
909 910 7.519002 ACAAATTGCTAGTACGAGAAAACATC 58.481 34.615 7.23 0.00 0.00 3.06
910 911 7.172532 ACAAATTGCTAGTACGAGAAAACATCA 59.827 33.333 7.23 0.00 0.00 3.07
911 912 7.849804 AATTGCTAGTACGAGAAAACATCAT 57.150 32.000 7.23 0.00 0.00 2.45
912 913 7.849804 ATTGCTAGTACGAGAAAACATCATT 57.150 32.000 7.23 0.00 0.00 2.57
913 914 8.942338 ATTGCTAGTACGAGAAAACATCATTA 57.058 30.769 7.23 0.00 0.00 1.90
914 915 8.766000 TTGCTAGTACGAGAAAACATCATTAA 57.234 30.769 7.23 0.00 0.00 1.40
915 916 8.766000 TGCTAGTACGAGAAAACATCATTAAA 57.234 30.769 7.23 0.00 0.00 1.52
916 917 9.378551 TGCTAGTACGAGAAAACATCATTAAAT 57.621 29.630 7.23 0.00 0.00 1.40
921 922 9.937577 GTACGAGAAAACATCATTAAATTTTGC 57.062 29.630 0.00 0.00 0.00 3.68
922 923 8.017587 ACGAGAAAACATCATTAAATTTTGCC 57.982 30.769 0.00 0.00 0.00 4.52
923 924 7.872483 ACGAGAAAACATCATTAAATTTTGCCT 59.128 29.630 0.00 0.00 0.00 4.75
924 925 8.375465 CGAGAAAACATCATTAAATTTTGCCTC 58.625 33.333 0.00 0.00 0.00 4.70
925 926 8.243289 AGAAAACATCATTAAATTTTGCCTCG 57.757 30.769 0.00 0.00 0.00 4.63
926 927 6.966435 AAACATCATTAAATTTTGCCTCGG 57.034 33.333 0.00 0.00 0.00 4.63
927 928 5.659440 ACATCATTAAATTTTGCCTCGGT 57.341 34.783 0.00 0.00 0.00 4.69
928 929 6.036577 ACATCATTAAATTTTGCCTCGGTT 57.963 33.333 0.00 0.00 0.00 4.44
929 930 7.164230 ACATCATTAAATTTTGCCTCGGTTA 57.836 32.000 0.00 0.00 0.00 2.85
930 931 7.257722 ACATCATTAAATTTTGCCTCGGTTAG 58.742 34.615 0.00 0.00 0.00 2.34
931 932 6.827586 TCATTAAATTTTGCCTCGGTTAGT 57.172 33.333 0.00 0.00 0.00 2.24
932 933 6.616947 TCATTAAATTTTGCCTCGGTTAGTG 58.383 36.000 0.00 0.00 0.00 2.74
933 934 6.207810 TCATTAAATTTTGCCTCGGTTAGTGT 59.792 34.615 0.00 0.00 0.00 3.55
934 935 4.929819 AAATTTTGCCTCGGTTAGTGTT 57.070 36.364 0.00 0.00 0.00 3.32
935 936 7.507733 TTAAATTTTGCCTCGGTTAGTGTTA 57.492 32.000 0.00 0.00 0.00 2.41
936 937 5.622770 AATTTTGCCTCGGTTAGTGTTAG 57.377 39.130 0.00 0.00 0.00 2.34
937 938 3.756933 TTTGCCTCGGTTAGTGTTAGT 57.243 42.857 0.00 0.00 0.00 2.24
938 939 2.736144 TGCCTCGGTTAGTGTTAGTG 57.264 50.000 0.00 0.00 0.00 2.74
939 940 1.274167 TGCCTCGGTTAGTGTTAGTGG 59.726 52.381 0.00 0.00 0.00 4.00
940 941 2.005560 GCCTCGGTTAGTGTTAGTGGC 61.006 57.143 0.00 0.00 34.94 5.01
941 942 1.405121 CCTCGGTTAGTGTTAGTGGCC 60.405 57.143 0.00 0.00 0.00 5.36
942 943 1.549170 CTCGGTTAGTGTTAGTGGCCT 59.451 52.381 3.32 0.00 0.00 5.19
943 944 1.972795 TCGGTTAGTGTTAGTGGCCTT 59.027 47.619 3.32 0.00 0.00 4.35
944 945 2.073816 CGGTTAGTGTTAGTGGCCTTG 58.926 52.381 3.32 0.00 0.00 3.61
945 946 2.549349 CGGTTAGTGTTAGTGGCCTTGT 60.549 50.000 3.32 0.00 0.00 3.16
946 947 3.306225 CGGTTAGTGTTAGTGGCCTTGTA 60.306 47.826 3.32 0.00 0.00 2.41
947 948 4.622220 CGGTTAGTGTTAGTGGCCTTGTAT 60.622 45.833 3.32 0.00 0.00 2.29
948 949 5.394443 CGGTTAGTGTTAGTGGCCTTGTATA 60.394 44.000 3.32 0.00 0.00 1.47
949 950 6.589135 GGTTAGTGTTAGTGGCCTTGTATAT 58.411 40.000 3.32 0.00 0.00 0.86
950 951 7.470424 CGGTTAGTGTTAGTGGCCTTGTATATA 60.470 40.741 3.32 0.00 0.00 0.86
951 952 8.206189 GGTTAGTGTTAGTGGCCTTGTATATAA 58.794 37.037 3.32 0.00 0.00 0.98
952 953 9.257651 GTTAGTGTTAGTGGCCTTGTATATAAG 57.742 37.037 3.32 2.37 0.00 1.73
953 954 6.289064 AGTGTTAGTGGCCTTGTATATAAGC 58.711 40.000 3.32 0.51 0.00 3.09
954 955 6.053005 GTGTTAGTGGCCTTGTATATAAGCA 58.947 40.000 3.32 0.00 0.00 3.91
955 956 6.540914 GTGTTAGTGGCCTTGTATATAAGCAA 59.459 38.462 3.32 0.00 0.00 3.91
956 957 7.066525 GTGTTAGTGGCCTTGTATATAAGCAAA 59.933 37.037 3.32 0.00 0.00 3.68
957 958 7.612244 TGTTAGTGGCCTTGTATATAAGCAAAA 59.388 33.333 3.32 0.00 0.00 2.44
958 959 8.630037 GTTAGTGGCCTTGTATATAAGCAAAAT 58.370 33.333 3.32 0.00 0.00 1.82
959 960 7.042797 AGTGGCCTTGTATATAAGCAAAATG 57.957 36.000 3.32 0.00 0.00 2.32
960 961 6.607198 AGTGGCCTTGTATATAAGCAAAATGT 59.393 34.615 3.32 0.00 0.00 2.71
961 962 7.777910 AGTGGCCTTGTATATAAGCAAAATGTA 59.222 33.333 3.32 0.00 0.00 2.29
962 963 8.576442 GTGGCCTTGTATATAAGCAAAATGTAT 58.424 33.333 3.32 0.00 0.00 2.29
963 964 9.142014 TGGCCTTGTATATAAGCAAAATGTATT 57.858 29.630 3.32 0.00 0.00 1.89
964 965 9.981114 GGCCTTGTATATAAGCAAAATGTATTT 57.019 29.630 0.00 0.00 0.00 1.40
976 977 8.212317 AGCAAAATGTATTTTTCATAATGGCC 57.788 30.769 0.00 0.00 37.86 5.36
977 978 8.048514 AGCAAAATGTATTTTTCATAATGGCCT 58.951 29.630 3.32 0.00 37.86 5.19
978 979 8.676401 GCAAAATGTATTTTTCATAATGGCCTT 58.324 29.630 3.32 0.00 37.86 4.35
979 980 9.991388 CAAAATGTATTTTTCATAATGGCCTTG 57.009 29.630 3.32 0.00 37.86 3.61
980 981 9.737844 AAAATGTATTTTTCATAATGGCCTTGT 57.262 25.926 3.32 0.00 36.65 3.16
983 984 9.985730 ATGTATTTTTCATAATGGCCTTGTATG 57.014 29.630 3.32 9.27 0.00 2.39
984 985 9.194972 TGTATTTTTCATAATGGCCTTGTATGA 57.805 29.630 15.44 15.44 33.49 2.15
985 986 9.683069 GTATTTTTCATAATGGCCTTGTATGAG 57.317 33.333 17.46 0.00 36.05 2.90
986 987 6.713762 TTTTCATAATGGCCTTGTATGAGG 57.286 37.500 17.46 0.00 36.05 3.86
987 988 4.371624 TCATAATGGCCTTGTATGAGGG 57.628 45.455 15.44 0.00 37.29 4.30
988 989 3.980022 TCATAATGGCCTTGTATGAGGGA 59.020 43.478 15.44 0.16 37.29 4.20
989 990 4.415179 TCATAATGGCCTTGTATGAGGGAA 59.585 41.667 15.44 0.00 37.29 3.97
990 991 3.979501 AATGGCCTTGTATGAGGGAAT 57.020 42.857 3.32 0.00 37.29 3.01
991 992 2.734755 TGGCCTTGTATGAGGGAATG 57.265 50.000 3.32 0.00 37.29 2.67
992 993 1.215173 TGGCCTTGTATGAGGGAATGG 59.785 52.381 3.32 0.00 37.29 3.16
993 994 1.494721 GGCCTTGTATGAGGGAATGGA 59.505 52.381 0.00 0.00 37.29 3.41
994 995 2.487986 GGCCTTGTATGAGGGAATGGAG 60.488 54.545 0.00 0.00 37.29 3.86
995 996 2.487986 GCCTTGTATGAGGGAATGGAGG 60.488 54.545 0.00 0.00 37.29 4.30
996 997 2.107204 CCTTGTATGAGGGAATGGAGGG 59.893 54.545 0.00 0.00 32.94 4.30
997 998 2.887454 TGTATGAGGGAATGGAGGGA 57.113 50.000 0.00 0.00 0.00 4.20
998 999 2.694397 TGTATGAGGGAATGGAGGGAG 58.306 52.381 0.00 0.00 0.00 4.30
1018 1019 2.158914 AGTATGATCATCGTGCTTGCCA 60.159 45.455 12.53 0.00 0.00 4.92
1019 1020 1.306148 ATGATCATCGTGCTTGCCAG 58.694 50.000 1.18 0.00 0.00 4.85
1042 1044 3.439129 ACTAGTTTTCGCCTATTTGCACC 59.561 43.478 0.00 0.00 0.00 5.01
1049 1051 0.451783 GCCTATTTGCACCGGTCAAG 59.548 55.000 2.59 0.00 0.00 3.02
1082 1087 0.605083 TTGGGCATGCACGCAAATAA 59.395 45.000 21.36 1.41 39.26 1.40
1116 1121 3.056607 AGGGTGGCAAAGAAAATCATTCG 60.057 43.478 0.00 0.00 0.00 3.34
1120 1125 3.243670 TGGCAAAGAAAATCATTCGCACA 60.244 39.130 0.00 0.00 0.00 4.57
1136 1141 0.103208 CACAGATCGCCAGAGGTACC 59.897 60.000 2.73 2.73 0.00 3.34
1222 1231 0.106217 CCACTCAAAACCACACCCCT 60.106 55.000 0.00 0.00 0.00 4.79
1235 1247 2.576191 CACACCCCTTTCCATCCTTCTA 59.424 50.000 0.00 0.00 0.00 2.10
1258 1270 0.325110 CAGCCTCCCTCTCTTCCTCA 60.325 60.000 0.00 0.00 0.00 3.86
1392 1404 0.179163 GCTGCATTTCCGTACCTTGC 60.179 55.000 0.00 0.00 0.00 4.01
1441 1453 1.463444 GGTCACGTGTAATCAAGCACC 59.537 52.381 16.51 8.47 32.40 5.01
1473 1485 3.262151 GGGACTGGGATAGCCTAGAATTC 59.738 52.174 18.24 4.16 45.07 2.17
1521 1533 2.346803 ACGGTGCATCACATCAGTTAC 58.653 47.619 0.00 0.00 35.86 2.50
1549 1561 3.234630 GAGTGGGCGGTGTGCTACA 62.235 63.158 0.00 0.00 45.43 2.74
1575 1587 3.310307 TGGCTGCTAGGTGCGTGA 61.310 61.111 0.00 0.00 46.63 4.35
1610 1638 1.301293 CCACCTTCTTCCTCTGGGC 59.699 63.158 0.00 0.00 0.00 5.36
1673 1701 9.020813 CAATCTGCTTTTATTTCTGATGACATG 57.979 33.333 0.00 0.00 0.00 3.21
1695 1723 3.059665 GCCAAAGAAATTGAAGCAAACCG 60.060 43.478 0.00 0.00 41.85 4.44
1702 1730 2.748461 TTGAAGCAAACCGAAAGTCG 57.252 45.000 0.00 0.00 40.07 4.18
1760 1792 2.903357 GCCCTTCGCATCTCCTCA 59.097 61.111 0.00 0.00 37.47 3.86
1765 1797 1.110442 CTTCGCATCTCCTCACCTCT 58.890 55.000 0.00 0.00 0.00 3.69
1787 1819 2.418976 GGTGACGAAACCTTCTTATGCC 59.581 50.000 0.00 0.00 37.24 4.40
1788 1820 3.071479 GTGACGAAACCTTCTTATGCCA 58.929 45.455 0.00 0.00 0.00 4.92
1790 1822 4.156008 GTGACGAAACCTTCTTATGCCATT 59.844 41.667 0.00 0.00 0.00 3.16
1791 1823 4.394920 TGACGAAACCTTCTTATGCCATTC 59.605 41.667 0.00 0.00 0.00 2.67
1793 1825 4.636206 ACGAAACCTTCTTATGCCATTCTC 59.364 41.667 0.00 0.00 0.00 2.87
1794 1826 4.878397 CGAAACCTTCTTATGCCATTCTCT 59.122 41.667 0.00 0.00 0.00 3.10
1795 1827 6.049149 CGAAACCTTCTTATGCCATTCTCTA 58.951 40.000 0.00 0.00 0.00 2.43
1796 1828 6.708054 CGAAACCTTCTTATGCCATTCTCTAT 59.292 38.462 0.00 0.00 0.00 1.98
1797 1829 7.307632 CGAAACCTTCTTATGCCATTCTCTATG 60.308 40.741 0.00 0.00 0.00 2.23
1798 1830 6.753913 ACCTTCTTATGCCATTCTCTATGA 57.246 37.500 0.00 0.00 36.26 2.15
1828 1861 3.441496 TTCAAAAGAAGCACAGCCTTG 57.559 42.857 0.00 0.00 0.00 3.61
1839 1872 2.813754 GCACAGCCTTGATGTTTGTAGA 59.186 45.455 0.00 0.00 26.01 2.59
1847 1887 5.523188 GCCTTGATGTTTGTAGATCTCTGAG 59.477 44.000 0.00 0.00 0.00 3.35
1851 1891 9.212641 CTTGATGTTTGTAGATCTCTGAGAAAA 57.787 33.333 12.00 4.52 0.00 2.29
1852 1892 8.539770 TGATGTTTGTAGATCTCTGAGAAAAC 57.460 34.615 18.35 18.35 0.00 2.43
1870 1910 4.350368 AAACCAAGGTTTTGCTTATGGG 57.650 40.909 11.31 0.00 44.84 4.00
1872 1912 2.632512 ACCAAGGTTTTGCTTATGGGTG 59.367 45.455 0.00 0.00 32.79 4.61
1876 1916 3.773560 AGGTTTTGCTTATGGGTGCTTA 58.226 40.909 0.00 0.00 0.00 3.09
1881 1921 3.712016 TGCTTATGGGTGCTTAGTTCA 57.288 42.857 0.00 0.00 0.00 3.18
1884 1924 4.010349 GCTTATGGGTGCTTAGTTCAAGT 58.990 43.478 0.00 0.00 36.55 3.16
1885 1925 4.459337 GCTTATGGGTGCTTAGTTCAAGTT 59.541 41.667 0.00 0.00 36.55 2.66
1886 1926 5.646360 GCTTATGGGTGCTTAGTTCAAGTTA 59.354 40.000 0.00 0.00 36.55 2.24
1887 1927 6.183360 GCTTATGGGTGCTTAGTTCAAGTTAG 60.183 42.308 0.00 0.00 36.55 2.34
1888 1928 4.015872 TGGGTGCTTAGTTCAAGTTAGG 57.984 45.455 0.00 0.00 36.55 2.69
1889 1929 3.244770 TGGGTGCTTAGTTCAAGTTAGGG 60.245 47.826 0.00 0.00 36.55 3.53
1890 1930 2.747989 GGTGCTTAGTTCAAGTTAGGGC 59.252 50.000 0.00 0.00 36.55 5.19
1891 1931 3.408634 GTGCTTAGTTCAAGTTAGGGCA 58.591 45.455 0.00 0.00 36.55 5.36
1892 1932 4.010349 GTGCTTAGTTCAAGTTAGGGCAT 58.990 43.478 0.00 0.00 36.55 4.40
1893 1933 4.095036 GTGCTTAGTTCAAGTTAGGGCATC 59.905 45.833 0.00 0.00 36.55 3.91
1894 1934 4.019321 TGCTTAGTTCAAGTTAGGGCATCT 60.019 41.667 0.00 0.00 36.55 2.90
1895 1935 4.572795 GCTTAGTTCAAGTTAGGGCATCTC 59.427 45.833 0.00 0.00 36.55 2.75
1896 1936 3.636153 AGTTCAAGTTAGGGCATCTCC 57.364 47.619 0.00 0.00 0.00 3.71
1897 1937 2.912956 AGTTCAAGTTAGGGCATCTCCA 59.087 45.455 0.00 0.00 36.21 3.86
1898 1938 3.330701 AGTTCAAGTTAGGGCATCTCCAA 59.669 43.478 0.00 0.00 36.21 3.53
1899 1939 3.350219 TCAAGTTAGGGCATCTCCAAC 57.650 47.619 0.00 0.00 36.21 3.77
1900 1940 2.642311 TCAAGTTAGGGCATCTCCAACA 59.358 45.455 0.00 0.00 36.21 3.33
1901 1941 3.012518 CAAGTTAGGGCATCTCCAACAG 58.987 50.000 0.00 0.00 36.21 3.16
1902 1942 1.065126 AGTTAGGGCATCTCCAACAGC 60.065 52.381 0.00 0.00 36.21 4.40
1903 1943 0.255890 TTAGGGCATCTCCAACAGCC 59.744 55.000 0.00 0.00 46.28 4.85
1905 1945 2.045926 GGCATCTCCAACAGCCGT 60.046 61.111 0.00 0.00 37.41 5.68
1906 1946 1.220749 GGCATCTCCAACAGCCGTA 59.779 57.895 0.00 0.00 37.41 4.02
1907 1947 0.392461 GGCATCTCCAACAGCCGTAA 60.392 55.000 0.00 0.00 37.41 3.18
1908 1948 1.009829 GCATCTCCAACAGCCGTAAG 58.990 55.000 0.00 0.00 0.00 2.34
1909 1949 1.405526 GCATCTCCAACAGCCGTAAGA 60.406 52.381 0.00 0.00 43.02 2.10
1910 1950 2.743183 GCATCTCCAACAGCCGTAAGAT 60.743 50.000 0.00 0.00 43.02 2.40
1911 1951 3.492656 GCATCTCCAACAGCCGTAAGATA 60.493 47.826 0.00 0.00 43.02 1.98
1912 1952 4.302455 CATCTCCAACAGCCGTAAGATAG 58.698 47.826 0.00 0.00 43.02 2.08
1913 1953 2.693591 TCTCCAACAGCCGTAAGATAGG 59.306 50.000 0.00 0.00 43.02 2.57
1914 1954 2.431057 CTCCAACAGCCGTAAGATAGGT 59.569 50.000 0.00 0.00 43.02 3.08
1915 1955 2.167693 TCCAACAGCCGTAAGATAGGTG 59.832 50.000 0.00 0.00 43.02 4.00
1916 1956 2.093658 CCAACAGCCGTAAGATAGGTGT 60.094 50.000 0.00 0.00 43.02 4.16
1917 1957 3.596214 CAACAGCCGTAAGATAGGTGTT 58.404 45.455 1.30 1.30 43.02 3.32
1918 1958 3.247006 ACAGCCGTAAGATAGGTGTTG 57.753 47.619 0.00 0.00 43.02 3.33
1919 1959 2.093658 ACAGCCGTAAGATAGGTGTTGG 60.094 50.000 0.00 0.00 43.02 3.77
1920 1960 2.093658 CAGCCGTAAGATAGGTGTTGGT 60.094 50.000 0.00 0.00 43.02 3.67
1921 1961 3.131577 CAGCCGTAAGATAGGTGTTGGTA 59.868 47.826 0.00 0.00 43.02 3.25
1922 1962 3.770933 AGCCGTAAGATAGGTGTTGGTAA 59.229 43.478 0.00 0.00 43.02 2.85
1923 1963 4.223477 AGCCGTAAGATAGGTGTTGGTAAA 59.777 41.667 0.00 0.00 43.02 2.01
1924 1964 5.104652 AGCCGTAAGATAGGTGTTGGTAAAT 60.105 40.000 0.00 0.00 43.02 1.40
1925 1965 5.587443 GCCGTAAGATAGGTGTTGGTAAATT 59.413 40.000 0.00 0.00 43.02 1.82
1926 1966 6.094464 GCCGTAAGATAGGTGTTGGTAAATTT 59.906 38.462 0.00 0.00 43.02 1.82
1927 1967 7.469260 CCGTAAGATAGGTGTTGGTAAATTTG 58.531 38.462 0.00 0.00 43.02 2.32
1928 1968 6.964934 CGTAAGATAGGTGTTGGTAAATTTGC 59.035 38.462 0.00 0.00 43.02 3.68
1929 1969 5.914898 AGATAGGTGTTGGTAAATTTGCC 57.085 39.130 17.60 17.60 0.00 4.52
1930 1970 5.329399 AGATAGGTGTTGGTAAATTTGCCA 58.671 37.500 22.45 22.45 41.35 4.92
1931 1971 3.744238 AGGTGTTGGTAAATTTGCCAC 57.256 42.857 25.49 19.76 42.80 5.01
1932 1972 2.035321 AGGTGTTGGTAAATTTGCCACG 59.965 45.455 25.49 0.00 42.80 4.94
1933 1973 2.223852 GGTGTTGGTAAATTTGCCACGT 60.224 45.455 25.49 0.00 42.80 4.49
1934 1974 3.004524 GGTGTTGGTAAATTTGCCACGTA 59.995 43.478 25.49 10.46 42.80 3.57
1935 1975 4.223659 GTGTTGGTAAATTTGCCACGTAG 58.776 43.478 25.49 0.00 42.80 3.51
1936 1976 3.253677 TGTTGGTAAATTTGCCACGTAGG 59.746 43.478 25.49 0.00 42.80 3.18
1937 1977 3.420300 TGGTAAATTTGCCACGTAGGA 57.580 42.857 22.45 0.00 38.05 2.94
1938 1978 3.958018 TGGTAAATTTGCCACGTAGGAT 58.042 40.909 22.45 0.00 38.05 3.24
1939 1979 5.100344 TGGTAAATTTGCCACGTAGGATA 57.900 39.130 22.45 0.00 38.05 2.59
1940 1980 5.686753 TGGTAAATTTGCCACGTAGGATAT 58.313 37.500 22.45 0.00 38.05 1.63
1941 1981 6.828788 TGGTAAATTTGCCACGTAGGATATA 58.171 36.000 22.45 0.00 38.05 0.86
1942 1982 6.932400 TGGTAAATTTGCCACGTAGGATATAG 59.068 38.462 22.45 0.00 38.05 1.31
1943 1983 6.932960 GGTAAATTTGCCACGTAGGATATAGT 59.067 38.462 19.26 0.00 41.22 2.12
1944 1984 6.861065 AAATTTGCCACGTAGGATATAGTG 57.139 37.500 8.04 0.00 41.22 2.74
1945 1985 5.801531 ATTTGCCACGTAGGATATAGTGA 57.198 39.130 8.04 0.00 41.22 3.41
1946 1986 5.801531 TTTGCCACGTAGGATATAGTGAT 57.198 39.130 8.04 0.00 41.22 3.06
1947 1987 4.783764 TGCCACGTAGGATATAGTGATG 57.216 45.455 8.04 0.00 41.22 3.07
1948 1988 4.403734 TGCCACGTAGGATATAGTGATGA 58.596 43.478 8.04 0.00 41.22 2.92
1949 1989 5.016831 TGCCACGTAGGATATAGTGATGAT 58.983 41.667 8.04 0.00 41.22 2.45
1950 1990 5.105756 TGCCACGTAGGATATAGTGATGATG 60.106 44.000 8.04 0.00 41.22 3.07
1951 1991 5.105716 GCCACGTAGGATATAGTGATGATGT 60.106 44.000 8.04 0.00 41.22 3.06
1952 1992 6.325596 CCACGTAGGATATAGTGATGATGTG 58.674 44.000 0.00 0.00 41.22 3.21
1953 1993 6.325596 CACGTAGGATATAGTGATGATGTGG 58.674 44.000 0.00 0.00 35.17 4.17
1954 1994 5.105716 ACGTAGGATATAGTGATGATGTGGC 60.106 44.000 0.00 0.00 0.00 5.01
1955 1995 5.105756 CGTAGGATATAGTGATGATGTGGCA 60.106 44.000 0.00 0.00 0.00 4.92
1956 1996 6.406288 CGTAGGATATAGTGATGATGTGGCAT 60.406 42.308 0.00 0.00 0.00 4.40
1957 1997 5.742063 AGGATATAGTGATGATGTGGCATG 58.258 41.667 0.00 0.00 0.00 4.06
1958 1998 5.250082 AGGATATAGTGATGATGTGGCATGT 59.750 40.000 0.00 0.00 0.00 3.21
1959 1999 6.441604 AGGATATAGTGATGATGTGGCATGTA 59.558 38.462 0.00 0.00 0.00 2.29
1960 2000 7.038088 AGGATATAGTGATGATGTGGCATGTAA 60.038 37.037 0.00 0.00 0.00 2.41
1961 2001 7.772292 GGATATAGTGATGATGTGGCATGTAAT 59.228 37.037 0.00 0.00 0.00 1.89
1962 2002 9.822185 GATATAGTGATGATGTGGCATGTAATA 57.178 33.333 0.00 0.00 0.00 0.98
1964 2004 8.922931 ATAGTGATGATGTGGCATGTAATAAA 57.077 30.769 0.00 0.00 0.00 1.40
1965 2005 7.828508 AGTGATGATGTGGCATGTAATAAAT 57.171 32.000 0.00 0.00 0.00 1.40
1966 2006 7.654568 AGTGATGATGTGGCATGTAATAAATG 58.345 34.615 0.00 0.00 0.00 2.32
1967 2007 7.286087 AGTGATGATGTGGCATGTAATAAATGT 59.714 33.333 0.00 0.00 0.00 2.71
1968 2008 7.380333 GTGATGATGTGGCATGTAATAAATGTG 59.620 37.037 0.00 0.00 0.00 3.21
1969 2009 6.146601 TGATGTGGCATGTAATAAATGTGG 57.853 37.500 0.00 0.00 0.00 4.17
1970 2010 5.890419 TGATGTGGCATGTAATAAATGTGGA 59.110 36.000 0.00 0.00 0.00 4.02
1971 2011 5.833406 TGTGGCATGTAATAAATGTGGAG 57.167 39.130 0.00 0.00 0.00 3.86
1972 2012 5.504853 TGTGGCATGTAATAAATGTGGAGA 58.495 37.500 0.00 0.00 0.00 3.71
1973 2013 5.589855 TGTGGCATGTAATAAATGTGGAGAG 59.410 40.000 0.00 0.00 0.00 3.20
1974 2014 5.822519 GTGGCATGTAATAAATGTGGAGAGA 59.177 40.000 0.00 0.00 0.00 3.10
1975 2015 6.017605 GTGGCATGTAATAAATGTGGAGAGAG 60.018 42.308 0.00 0.00 0.00 3.20
1976 2016 6.126796 TGGCATGTAATAAATGTGGAGAGAGA 60.127 38.462 0.00 0.00 0.00 3.10
1977 2017 6.426328 GGCATGTAATAAATGTGGAGAGAGAG 59.574 42.308 0.00 0.00 0.00 3.20
1978 2018 6.073331 GCATGTAATAAATGTGGAGAGAGAGC 60.073 42.308 0.00 0.00 0.00 4.09
1979 2019 6.544928 TGTAATAAATGTGGAGAGAGAGCA 57.455 37.500 0.00 0.00 0.00 4.26
1980 2020 6.946340 TGTAATAAATGTGGAGAGAGAGCAA 58.054 36.000 0.00 0.00 0.00 3.91
1981 2021 7.394016 TGTAATAAATGTGGAGAGAGAGCAAA 58.606 34.615 0.00 0.00 0.00 3.68
1982 2022 6.998968 AATAAATGTGGAGAGAGAGCAAAG 57.001 37.500 0.00 0.00 0.00 2.77
1983 2023 4.363991 AAATGTGGAGAGAGAGCAAAGT 57.636 40.909 0.00 0.00 0.00 2.66
1984 2024 4.363991 AATGTGGAGAGAGAGCAAAGTT 57.636 40.909 0.00 0.00 0.00 2.66
1985 2025 3.117491 TGTGGAGAGAGAGCAAAGTTG 57.883 47.619 0.00 0.00 0.00 3.16
1986 2026 2.435805 TGTGGAGAGAGAGCAAAGTTGT 59.564 45.455 0.00 0.00 0.00 3.32
1987 2027 3.641436 TGTGGAGAGAGAGCAAAGTTGTA 59.359 43.478 0.00 0.00 0.00 2.41
1988 2028 4.284490 TGTGGAGAGAGAGCAAAGTTGTAT 59.716 41.667 0.00 0.00 0.00 2.29
1989 2029 4.629200 GTGGAGAGAGAGCAAAGTTGTATG 59.371 45.833 0.00 0.00 0.00 2.39
1990 2030 4.284490 TGGAGAGAGAGCAAAGTTGTATGT 59.716 41.667 0.00 0.00 0.00 2.29
1991 2031 5.480422 TGGAGAGAGAGCAAAGTTGTATGTA 59.520 40.000 0.00 0.00 0.00 2.29
1992 2032 6.039616 GGAGAGAGAGCAAAGTTGTATGTAG 58.960 44.000 0.00 0.00 0.00 2.74
1993 2033 6.127591 GGAGAGAGAGCAAAGTTGTATGTAGA 60.128 42.308 0.00 0.00 0.00 2.59
1994 2034 7.233389 AGAGAGAGCAAAGTTGTATGTAGAA 57.767 36.000 0.00 0.00 0.00 2.10
1995 2035 7.846066 AGAGAGAGCAAAGTTGTATGTAGAAT 58.154 34.615 0.00 0.00 0.00 2.40
1996 2036 8.972127 AGAGAGAGCAAAGTTGTATGTAGAATA 58.028 33.333 0.00 0.00 0.00 1.75
1997 2037 9.587772 GAGAGAGCAAAGTTGTATGTAGAATAA 57.412 33.333 0.00 0.00 0.00 1.40
1998 2038 9.372369 AGAGAGCAAAGTTGTATGTAGAATAAC 57.628 33.333 0.00 0.00 0.00 1.89
1999 2039 8.494016 AGAGCAAAGTTGTATGTAGAATAACC 57.506 34.615 0.00 0.00 0.00 2.85
2000 2040 8.100791 AGAGCAAAGTTGTATGTAGAATAACCA 58.899 33.333 0.00 0.00 0.00 3.67
2001 2041 8.630054 AGCAAAGTTGTATGTAGAATAACCAA 57.370 30.769 0.00 0.00 0.00 3.67
2002 2042 8.512138 AGCAAAGTTGTATGTAGAATAACCAAC 58.488 33.333 0.00 0.00 0.00 3.77
2003 2043 8.293867 GCAAAGTTGTATGTAGAATAACCAACA 58.706 33.333 0.00 0.00 0.00 3.33
2006 2046 8.331730 AGTTGTATGTAGAATAACCAACAACC 57.668 34.615 10.42 0.00 40.88 3.77
2007 2047 8.161425 AGTTGTATGTAGAATAACCAACAACCT 58.839 33.333 10.42 0.00 40.88 3.50
2008 2048 8.789762 GTTGTATGTAGAATAACCAACAACCTT 58.210 33.333 0.00 0.00 37.67 3.50
2009 2049 8.330466 TGTATGTAGAATAACCAACAACCTTG 57.670 34.615 0.00 0.00 0.00 3.61
2010 2050 6.834168 ATGTAGAATAACCAACAACCTTGG 57.166 37.500 0.00 0.00 44.91 3.61
2011 2051 4.521256 TGTAGAATAACCAACAACCTTGGC 59.479 41.667 0.00 0.00 43.23 4.52
2012 2052 3.571590 AGAATAACCAACAACCTTGGCA 58.428 40.909 0.00 0.00 43.23 4.92
2013 2053 3.320826 AGAATAACCAACAACCTTGGCAC 59.679 43.478 0.00 0.00 43.23 5.01
2014 2054 2.145397 TAACCAACAACCTTGGCACA 57.855 45.000 0.00 0.00 43.23 4.57
2025 2065 2.365656 CCTTGGCACAAGCTTCAAGGT 61.366 52.381 25.82 8.54 46.47 3.50
2026 2066 2.417978 TGGCACAAGCTTCAAGGTG 58.582 52.632 9.65 9.65 41.70 4.00
2027 2067 0.106769 TGGCACAAGCTTCAAGGTGA 60.107 50.000 16.46 0.00 41.70 4.02
2028 2068 1.032014 GGCACAAGCTTCAAGGTGAA 58.968 50.000 16.46 0.00 41.70 3.18
2029 2069 1.408702 GGCACAAGCTTCAAGGTGAAA 59.591 47.619 16.46 0.00 41.70 2.69
2030 2070 2.036346 GGCACAAGCTTCAAGGTGAAAT 59.964 45.455 16.46 0.00 41.70 2.17
2031 2071 3.255642 GGCACAAGCTTCAAGGTGAAATA 59.744 43.478 16.46 0.00 41.70 1.40
2032 2072 4.479619 GCACAAGCTTCAAGGTGAAATAG 58.520 43.478 16.46 0.00 35.73 1.73
2033 2073 4.216257 GCACAAGCTTCAAGGTGAAATAGA 59.784 41.667 16.46 0.00 35.73 1.98
2034 2074 5.618640 GCACAAGCTTCAAGGTGAAATAGAG 60.619 44.000 16.46 0.00 35.73 2.43
2035 2075 5.702670 CACAAGCTTCAAGGTGAAATAGAGA 59.297 40.000 8.57 0.00 35.73 3.10
2036 2076 5.936956 ACAAGCTTCAAGGTGAAATAGAGAG 59.063 40.000 0.00 0.00 35.73 3.20
2037 2077 4.512484 AGCTTCAAGGTGAAATAGAGAGC 58.488 43.478 0.00 0.00 35.73 4.09
2038 2078 4.019860 AGCTTCAAGGTGAAATAGAGAGCA 60.020 41.667 0.00 0.00 35.73 4.26
2039 2079 4.697352 GCTTCAAGGTGAAATAGAGAGCAA 59.303 41.667 0.00 0.00 35.73 3.91
2040 2080 5.356470 GCTTCAAGGTGAAATAGAGAGCAAT 59.644 40.000 0.00 0.00 35.73 3.56
2041 2081 6.458070 GCTTCAAGGTGAAATAGAGAGCAATC 60.458 42.308 0.00 0.00 35.73 2.67
2042 2082 6.053632 TCAAGGTGAAATAGAGAGCAATCA 57.946 37.500 0.00 0.00 0.00 2.57
2043 2083 5.877012 TCAAGGTGAAATAGAGAGCAATCAC 59.123 40.000 0.00 0.00 37.14 3.06
2044 2084 5.426689 AGGTGAAATAGAGAGCAATCACA 57.573 39.130 6.12 0.00 39.06 3.58
2045 2085 5.999044 AGGTGAAATAGAGAGCAATCACAT 58.001 37.500 6.12 0.00 39.06 3.21
2046 2086 6.421485 AGGTGAAATAGAGAGCAATCACATT 58.579 36.000 6.12 0.00 39.06 2.71
2047 2087 6.888632 AGGTGAAATAGAGAGCAATCACATTT 59.111 34.615 6.12 0.00 39.06 2.32
2048 2088 8.049117 AGGTGAAATAGAGAGCAATCACATTTA 58.951 33.333 6.12 0.00 39.06 1.40
2049 2089 8.125448 GGTGAAATAGAGAGCAATCACATTTAC 58.875 37.037 6.12 0.00 39.06 2.01
2050 2090 8.668353 GTGAAATAGAGAGCAATCACATTTACA 58.332 33.333 0.00 0.00 37.65 2.41
2051 2091 9.399797 TGAAATAGAGAGCAATCACATTTACAT 57.600 29.630 0.00 0.00 0.00 2.29
2054 2094 9.624373 AATAGAGAGCAATCACATTTACATTCT 57.376 29.630 0.00 0.00 0.00 2.40
2055 2095 7.551035 AGAGAGCAATCACATTTACATTCTC 57.449 36.000 0.00 0.00 0.00 2.87
2056 2096 7.108194 AGAGAGCAATCACATTTACATTCTCA 58.892 34.615 0.00 0.00 32.02 3.27
2057 2097 7.774157 AGAGAGCAATCACATTTACATTCTCAT 59.226 33.333 0.00 0.00 32.02 2.90
2058 2098 7.928103 AGAGCAATCACATTTACATTCTCATC 58.072 34.615 0.00 0.00 0.00 2.92
2059 2099 7.555195 AGAGCAATCACATTTACATTCTCATCA 59.445 33.333 0.00 0.00 0.00 3.07
2060 2100 8.234136 AGCAATCACATTTACATTCTCATCAT 57.766 30.769 0.00 0.00 0.00 2.45
2061 2101 8.350722 AGCAATCACATTTACATTCTCATCATC 58.649 33.333 0.00 0.00 0.00 2.92
2062 2102 8.350722 GCAATCACATTTACATTCTCATCATCT 58.649 33.333 0.00 0.00 0.00 2.90
2072 2112 9.881649 TTACATTCTCATCATCTATTGGATAGC 57.118 33.333 0.00 0.00 32.64 2.97
2073 2113 8.148437 ACATTCTCATCATCTATTGGATAGCT 57.852 34.615 0.00 0.00 32.64 3.32
2074 2114 8.604184 ACATTCTCATCATCTATTGGATAGCTT 58.396 33.333 0.00 0.00 32.64 3.74
2077 2117 9.539194 TTCTCATCATCTATTGGATAGCTTAGA 57.461 33.333 0.00 0.00 32.64 2.10
2078 2118 9.712250 TCTCATCATCTATTGGATAGCTTAGAT 57.288 33.333 0.00 0.00 32.89 1.98
2084 2124 9.593134 CATCTATTGGATAGCTTAGATACAACC 57.407 37.037 0.00 0.00 29.87 3.77
2085 2125 8.958060 TCTATTGGATAGCTTAGATACAACCT 57.042 34.615 0.00 0.00 29.87 3.50
2089 2129 9.950496 ATTGGATAGCTTAGATACAACCTATTG 57.050 33.333 0.00 0.00 41.98 1.90
2090 2130 7.907389 TGGATAGCTTAGATACAACCTATTGG 58.093 38.462 0.00 0.00 40.42 3.16
2091 2131 7.733047 TGGATAGCTTAGATACAACCTATTGGA 59.267 37.037 0.00 0.00 40.42 3.53
2092 2132 8.254508 GGATAGCTTAGATACAACCTATTGGAG 58.745 40.741 0.00 0.00 40.42 3.86
2093 2133 8.728596 ATAGCTTAGATACAACCTATTGGAGT 57.271 34.615 0.00 0.89 40.42 3.85
2094 2134 9.824216 ATAGCTTAGATACAACCTATTGGAGTA 57.176 33.333 0.00 3.19 40.42 2.59
2095 2135 8.184304 AGCTTAGATACAACCTATTGGAGTAG 57.816 38.462 0.00 0.00 40.42 2.57
2096 2136 7.785506 AGCTTAGATACAACCTATTGGAGTAGT 59.214 37.037 0.00 0.00 40.42 2.73
2097 2137 8.422566 GCTTAGATACAACCTATTGGAGTAGTT 58.577 37.037 0.00 0.00 40.42 2.24
2098 2138 9.751542 CTTAGATACAACCTATTGGAGTAGTTG 57.248 37.037 0.00 0.00 40.42 3.16
2099 2139 7.735326 AGATACAACCTATTGGAGTAGTTGT 57.265 36.000 11.13 11.13 40.42 3.32
2100 2140 8.834004 AGATACAACCTATTGGAGTAGTTGTA 57.166 34.615 14.29 14.29 40.42 2.41
2101 2141 9.435570 AGATACAACCTATTGGAGTAGTTGTAT 57.564 33.333 20.69 20.69 40.42 2.29
2102 2142 9.477484 GATACAACCTATTGGAGTAGTTGTATG 57.523 37.037 23.87 0.00 40.42 2.39
2103 2143 7.490657 ACAACCTATTGGAGTAGTTGTATGA 57.509 36.000 5.11 0.00 40.42 2.15
2104 2144 8.090788 ACAACCTATTGGAGTAGTTGTATGAT 57.909 34.615 5.11 0.00 40.42 2.45
2105 2145 9.209048 ACAACCTATTGGAGTAGTTGTATGATA 57.791 33.333 5.11 0.00 40.42 2.15
2106 2146 9.698309 CAACCTATTGGAGTAGTTGTATGATAG 57.302 37.037 0.00 0.00 37.04 2.08
2107 2147 7.897864 ACCTATTGGAGTAGTTGTATGATAGC 58.102 38.462 0.00 0.00 37.04 2.97
2108 2148 7.730784 ACCTATTGGAGTAGTTGTATGATAGCT 59.269 37.037 0.00 0.00 37.04 3.32
2109 2149 8.589338 CCTATTGGAGTAGTTGTATGATAGCTT 58.411 37.037 0.00 0.00 34.57 3.74
2110 2150 9.416794 CTATTGGAGTAGTTGTATGATAGCTTG 57.583 37.037 0.00 0.00 0.00 4.01
2111 2151 6.791867 TGGAGTAGTTGTATGATAGCTTGT 57.208 37.500 0.00 0.00 0.00 3.16
2112 2152 7.182817 TGGAGTAGTTGTATGATAGCTTGTT 57.817 36.000 0.00 0.00 0.00 2.83
2113 2153 7.041721 TGGAGTAGTTGTATGATAGCTTGTTG 58.958 38.462 0.00 0.00 0.00 3.33
2114 2154 6.480320 GGAGTAGTTGTATGATAGCTTGTTGG 59.520 42.308 0.00 0.00 0.00 3.77
2115 2155 5.817816 AGTAGTTGTATGATAGCTTGTTGGC 59.182 40.000 0.00 0.00 0.00 4.52
2116 2156 4.848357 AGTTGTATGATAGCTTGTTGGCT 58.152 39.130 0.00 0.00 45.29 4.75
2117 2157 4.637534 AGTTGTATGATAGCTTGTTGGCTG 59.362 41.667 0.00 0.00 43.01 4.85
2118 2158 4.486125 TGTATGATAGCTTGTTGGCTGA 57.514 40.909 0.00 0.00 43.01 4.26
2119 2159 5.039920 TGTATGATAGCTTGTTGGCTGAT 57.960 39.130 0.00 0.00 43.01 2.90
2120 2160 4.818005 TGTATGATAGCTTGTTGGCTGATG 59.182 41.667 0.00 0.00 43.01 3.07
2121 2161 3.632643 TGATAGCTTGTTGGCTGATGA 57.367 42.857 0.00 0.00 43.01 2.92
2122 2162 3.273434 TGATAGCTTGTTGGCTGATGAC 58.727 45.455 0.00 0.00 43.01 3.06
2123 2163 2.857186 TAGCTTGTTGGCTGATGACA 57.143 45.000 0.00 0.00 43.01 3.58
2124 2164 2.211250 AGCTTGTTGGCTGATGACAT 57.789 45.000 0.00 0.00 41.43 3.06
2125 2165 1.816835 AGCTTGTTGGCTGATGACATG 59.183 47.619 0.00 0.00 41.43 3.21
2126 2166 1.135199 GCTTGTTGGCTGATGACATGG 60.135 52.381 0.00 0.00 0.00 3.66
2127 2167 2.439409 CTTGTTGGCTGATGACATGGA 58.561 47.619 0.00 0.00 0.00 3.41
2128 2168 1.825090 TGTTGGCTGATGACATGGAC 58.175 50.000 0.00 0.00 0.00 4.02
2129 2169 1.073603 TGTTGGCTGATGACATGGACA 59.926 47.619 0.00 0.00 0.00 4.02
2130 2170 2.161855 GTTGGCTGATGACATGGACAA 58.838 47.619 0.00 0.00 0.00 3.18
2131 2171 2.756760 GTTGGCTGATGACATGGACAAT 59.243 45.455 8.84 0.00 0.00 2.71
2132 2172 3.090210 TGGCTGATGACATGGACAATT 57.910 42.857 0.00 0.00 0.00 2.32
2133 2173 3.433343 TGGCTGATGACATGGACAATTT 58.567 40.909 0.00 0.00 0.00 1.82
2134 2174 4.598022 TGGCTGATGACATGGACAATTTA 58.402 39.130 0.00 0.00 0.00 1.40
2135 2175 4.398988 TGGCTGATGACATGGACAATTTAC 59.601 41.667 0.00 0.00 0.00 2.01
2136 2176 4.202050 GGCTGATGACATGGACAATTTACC 60.202 45.833 0.00 0.00 0.00 2.85
2137 2177 4.398988 GCTGATGACATGGACAATTTACCA 59.601 41.667 0.00 3.30 40.57 3.25
2138 2178 5.105797 GCTGATGACATGGACAATTTACCAA 60.106 40.000 0.00 0.00 39.69 3.67
2139 2179 6.266168 TGATGACATGGACAATTTACCAAC 57.734 37.500 0.00 2.00 39.69 3.77
2140 2180 5.772169 TGATGACATGGACAATTTACCAACA 59.228 36.000 0.00 6.35 39.69 3.33
2141 2181 5.703978 TGACATGGACAATTTACCAACAG 57.296 39.130 0.00 2.12 39.69 3.16
2142 2182 4.522405 TGACATGGACAATTTACCAACAGG 59.478 41.667 0.00 0.00 39.69 4.00
2143 2183 4.735369 ACATGGACAATTTACCAACAGGA 58.265 39.130 0.00 0.00 39.69 3.86
2144 2184 4.522789 ACATGGACAATTTACCAACAGGAC 59.477 41.667 0.00 0.00 39.69 3.85
2145 2185 4.447138 TGGACAATTTACCAACAGGACT 57.553 40.909 0.00 0.00 32.93 3.85
2146 2186 5.570205 TGGACAATTTACCAACAGGACTA 57.430 39.130 0.00 0.00 32.93 2.59
2147 2187 5.942961 TGGACAATTTACCAACAGGACTAA 58.057 37.500 0.00 0.00 32.93 2.24
2148 2188 5.766174 TGGACAATTTACCAACAGGACTAAC 59.234 40.000 0.00 0.00 32.93 2.34
2149 2189 5.766174 GGACAATTTACCAACAGGACTAACA 59.234 40.000 0.00 0.00 0.00 2.41
2150 2190 6.433093 GGACAATTTACCAACAGGACTAACAT 59.567 38.462 0.00 0.00 0.00 2.71
2151 2191 7.608761 GGACAATTTACCAACAGGACTAACATA 59.391 37.037 0.00 0.00 0.00 2.29
2152 2192 8.331730 ACAATTTACCAACAGGACTAACATAC 57.668 34.615 0.00 0.00 0.00 2.39
2153 2193 7.940137 ACAATTTACCAACAGGACTAACATACA 59.060 33.333 0.00 0.00 0.00 2.29
2154 2194 8.788806 CAATTTACCAACAGGACTAACATACAA 58.211 33.333 0.00 0.00 0.00 2.41
2155 2195 9.528489 AATTTACCAACAGGACTAACATACAAT 57.472 29.630 0.00 0.00 0.00 2.71
2156 2196 8.556213 TTTACCAACAGGACTAACATACAATC 57.444 34.615 0.00 0.00 0.00 2.67
2157 2197 6.374417 ACCAACAGGACTAACATACAATCT 57.626 37.500 0.00 0.00 0.00 2.40
2158 2198 6.173339 ACCAACAGGACTAACATACAATCTG 58.827 40.000 0.00 0.00 0.00 2.90
2159 2199 6.173339 CCAACAGGACTAACATACAATCTGT 58.827 40.000 0.00 0.00 36.00 3.41
2160 2200 6.655003 CCAACAGGACTAACATACAATCTGTT 59.345 38.462 0.00 0.00 42.58 3.16
2161 2201 7.672983 AACAGGACTAACATACAATCTGTTG 57.327 36.000 0.00 0.00 41.01 3.33
2162 2202 6.173339 ACAGGACTAACATACAATCTGTTGG 58.827 40.000 0.00 0.00 39.95 3.77
2163 2203 6.013725 ACAGGACTAACATACAATCTGTTGGA 60.014 38.462 6.55 0.00 37.29 3.53
2164 2204 6.536582 CAGGACTAACATACAATCTGTTGGAG 59.463 42.308 6.55 0.00 37.29 3.86
2165 2205 6.440647 AGGACTAACATACAATCTGTTGGAGA 59.559 38.462 6.55 0.00 37.29 3.71
2166 2206 7.126421 AGGACTAACATACAATCTGTTGGAGAT 59.874 37.037 6.55 0.00 43.91 2.75
2167 2207 7.225538 GGACTAACATACAATCTGTTGGAGATG 59.774 40.741 6.55 0.00 40.89 2.90
2168 2208 5.824904 AACATACAATCTGTTGGAGATGC 57.175 39.130 0.00 0.00 40.89 3.91
2169 2209 4.202441 ACATACAATCTGTTGGAGATGCC 58.798 43.478 0.00 0.00 40.89 4.40
2170 2210 2.134789 ACAATCTGTTGGAGATGCCC 57.865 50.000 0.00 0.00 40.89 5.36
2193 2233 2.478547 TGCATGATACTGCATTTGCG 57.521 45.000 0.00 0.00 46.76 4.85
2197 2237 2.689553 TGATACTGCATTTGCGAGGA 57.310 45.000 0.00 0.00 45.83 3.71
2203 2243 0.881118 TGCATTTGCGAGGAAAGGTC 59.119 50.000 3.95 0.00 45.83 3.85
2208 2248 0.320374 TTGCGAGGAAAGGTCGTGAT 59.680 50.000 0.00 0.00 39.69 3.06
2210 2250 1.546923 TGCGAGGAAAGGTCGTGATAA 59.453 47.619 0.00 0.00 39.69 1.75
2211 2251 1.925185 GCGAGGAAAGGTCGTGATAAC 59.075 52.381 0.00 0.00 39.69 1.89
2212 2252 2.673043 GCGAGGAAAGGTCGTGATAACA 60.673 50.000 0.00 0.00 39.69 2.41
2214 2254 4.181578 CGAGGAAAGGTCGTGATAACATT 58.818 43.478 0.00 0.00 32.62 2.71
2215 2255 5.345702 CGAGGAAAGGTCGTGATAACATTA 58.654 41.667 0.00 0.00 32.62 1.90
2216 2256 5.231568 CGAGGAAAGGTCGTGATAACATTAC 59.768 44.000 0.00 0.00 32.62 1.89
2217 2257 6.045072 AGGAAAGGTCGTGATAACATTACA 57.955 37.500 0.00 0.00 0.00 2.41
2219 2259 6.761714 AGGAAAGGTCGTGATAACATTACATC 59.238 38.462 0.00 0.00 0.00 3.06
2220 2260 6.537301 GGAAAGGTCGTGATAACATTACATCA 59.463 38.462 0.00 0.00 0.00 3.07
2224 2267 7.103641 AGGTCGTGATAACATTACATCAAAGT 58.896 34.615 0.00 0.00 33.15 2.66
2229 2272 8.227119 CGTGATAACATTACATCAAAGTCAACA 58.773 33.333 0.00 0.00 33.15 3.33
2233 2276 5.762045 ACATTACATCAAAGTCAACACTGC 58.238 37.500 0.00 0.00 31.06 4.40
2235 2278 1.603802 ACATCAAAGTCAACACTGCCG 59.396 47.619 0.00 0.00 31.06 5.69
2267 2310 0.319297 GTTCAGAACGCCGTGGTAGT 60.319 55.000 0.00 0.00 0.00 2.73
2268 2311 0.038892 TTCAGAACGCCGTGGTAGTC 60.039 55.000 0.00 0.00 0.00 2.59
2269 2312 0.892358 TCAGAACGCCGTGGTAGTCT 60.892 55.000 0.00 0.00 0.00 3.24
2270 2313 0.456312 CAGAACGCCGTGGTAGTCTC 60.456 60.000 0.00 0.00 0.00 3.36
2271 2314 1.153881 GAACGCCGTGGTAGTCTCC 60.154 63.158 0.00 0.00 0.00 3.71
2286 2329 2.753452 AGTCTCCTCGCAAATCGTAGAA 59.247 45.455 0.00 0.00 43.58 2.10
2295 2338 4.926832 TCGCAAATCGTAGAATTCTGAACA 59.073 37.500 18.47 0.00 43.58 3.18
2319 2367 9.932207 ACAAAATCAGAATAAAAATGAGCATGA 57.068 25.926 0.00 0.00 0.00 3.07
2334 2382 7.944729 ATGAGCATGACCTTAATGTTTAGTT 57.055 32.000 0.00 0.00 0.00 2.24
2337 2385 6.913170 AGCATGACCTTAATGTTTAGTTGTG 58.087 36.000 0.00 0.00 0.00 3.33
2339 2387 7.023575 GCATGACCTTAATGTTTAGTTGTGAG 58.976 38.462 0.00 0.00 0.00 3.51
2345 2408 9.403583 ACCTTAATGTTTAGTTGTGAGAAAAGA 57.596 29.630 0.00 0.00 0.00 2.52
2399 2468 1.079612 CATGACAGTGCGCTGGAGA 60.080 57.895 29.60 14.03 46.62 3.71
2418 2487 2.029828 AGACCAAGTTGTGCTAGTCGAG 60.030 50.000 1.45 0.00 36.37 4.04
2427 2496 2.799371 CTAGTCGAGGACACGCCC 59.201 66.667 0.00 0.00 37.37 6.13
2438 2507 2.032528 CACGCCCAGGCTTTCAGA 59.967 61.111 7.17 0.00 39.32 3.27
2443 2512 1.134401 CGCCCAGGCTTTCAGAATCTA 60.134 52.381 7.17 0.00 39.32 1.98
2444 2513 2.570135 GCCCAGGCTTTCAGAATCTAG 58.430 52.381 0.08 0.00 38.26 2.43
2445 2514 2.747799 GCCCAGGCTTTCAGAATCTAGG 60.748 54.545 0.08 0.00 38.26 3.02
2446 2515 2.774234 CCCAGGCTTTCAGAATCTAGGA 59.226 50.000 0.00 0.00 0.00 2.94
2447 2516 3.393941 CCCAGGCTTTCAGAATCTAGGAT 59.606 47.826 0.00 0.00 0.00 3.24
2448 2517 4.141298 CCCAGGCTTTCAGAATCTAGGATT 60.141 45.833 0.00 0.00 0.00 3.01
2449 2518 5.444176 CCAGGCTTTCAGAATCTAGGATTT 58.556 41.667 0.00 0.00 0.00 2.17
2450 2519 5.890419 CCAGGCTTTCAGAATCTAGGATTTT 59.110 40.000 0.00 0.00 0.00 1.82
2451 2520 6.183360 CCAGGCTTTCAGAATCTAGGATTTTG 60.183 42.308 4.95 4.95 0.00 2.44
2452 2521 6.600822 CAGGCTTTCAGAATCTAGGATTTTGA 59.399 38.462 8.69 8.69 0.00 2.69
2453 2522 6.827762 AGGCTTTCAGAATCTAGGATTTTGAG 59.172 38.462 11.40 5.29 0.00 3.02
2454 2523 6.601217 GGCTTTCAGAATCTAGGATTTTGAGT 59.399 38.462 11.40 0.00 0.00 3.41
2455 2524 7.201688 GGCTTTCAGAATCTAGGATTTTGAGTC 60.202 40.741 11.40 2.91 0.00 3.36
2456 2525 7.465245 GCTTTCAGAATCTAGGATTTTGAGTCG 60.465 40.741 11.40 7.24 31.25 4.18
2457 2526 6.531503 TCAGAATCTAGGATTTTGAGTCGT 57.468 37.500 8.69 0.00 31.25 4.34
2458 2527 7.640597 TCAGAATCTAGGATTTTGAGTCGTA 57.359 36.000 8.69 0.00 31.25 3.43
2459 2528 8.239038 TCAGAATCTAGGATTTTGAGTCGTAT 57.761 34.615 8.69 0.00 31.25 3.06
2460 2529 8.353684 TCAGAATCTAGGATTTTGAGTCGTATC 58.646 37.037 8.69 0.00 31.25 2.24
2461 2530 8.138074 CAGAATCTAGGATTTTGAGTCGTATCA 58.862 37.037 5.27 0.00 31.25 2.15
2462 2531 8.356657 AGAATCTAGGATTTTGAGTCGTATCAG 58.643 37.037 0.00 0.00 31.25 2.90
2463 2532 7.825331 ATCTAGGATTTTGAGTCGTATCAGA 57.175 36.000 0.00 0.00 0.00 3.27
2464 2533 7.640597 TCTAGGATTTTGAGTCGTATCAGAA 57.359 36.000 0.00 0.00 0.00 3.02
2465 2534 7.481642 TCTAGGATTTTGAGTCGTATCAGAAC 58.518 38.462 0.00 0.00 0.00 3.01
2466 2535 6.287589 AGGATTTTGAGTCGTATCAGAACT 57.712 37.500 0.00 0.00 0.00 3.01
2467 2536 6.334202 AGGATTTTGAGTCGTATCAGAACTC 58.666 40.000 0.00 0.00 0.00 3.01
2468 2537 6.153680 AGGATTTTGAGTCGTATCAGAACTCT 59.846 38.462 3.69 0.00 0.00 3.24
2469 2538 6.474102 GGATTTTGAGTCGTATCAGAACTCTC 59.526 42.308 3.69 0.00 0.00 3.20
2470 2539 6.576662 TTTTGAGTCGTATCAGAACTCTCT 57.423 37.500 3.69 0.00 0.00 3.10
2471 2540 7.683437 TTTTGAGTCGTATCAGAACTCTCTA 57.317 36.000 3.69 0.00 0.00 2.43
2472 2541 7.867305 TTTGAGTCGTATCAGAACTCTCTAT 57.133 36.000 3.69 0.00 0.00 1.98
2473 2542 6.852858 TGAGTCGTATCAGAACTCTCTATG 57.147 41.667 3.69 0.00 0.00 2.23
2474 2543 6.583562 TGAGTCGTATCAGAACTCTCTATGA 58.416 40.000 3.69 0.00 0.00 2.15
2475 2544 7.220740 TGAGTCGTATCAGAACTCTCTATGAT 58.779 38.462 3.69 0.00 36.42 2.45
2476 2545 8.368668 TGAGTCGTATCAGAACTCTCTATGATA 58.631 37.037 3.69 0.00 34.38 2.15
2477 2546 9.210329 GAGTCGTATCAGAACTCTCTATGATAA 57.790 37.037 0.00 0.00 36.64 1.75
2478 2547 9.214957 AGTCGTATCAGAACTCTCTATGATAAG 57.785 37.037 0.00 0.00 36.64 1.73
2479 2548 9.210329 GTCGTATCAGAACTCTCTATGATAAGA 57.790 37.037 5.84 5.84 39.31 2.10
2480 2549 9.952030 TCGTATCAGAACTCTCTATGATAAGAT 57.048 33.333 5.84 0.00 37.85 2.40
2483 2552 7.139896 TCAGAACTCTCTATGATAAGATCGC 57.860 40.000 0.00 0.00 0.00 4.58
2484 2553 6.712547 TCAGAACTCTCTATGATAAGATCGCA 59.287 38.462 0.00 0.00 0.00 5.10
2485 2554 7.022979 CAGAACTCTCTATGATAAGATCGCAG 58.977 42.308 0.00 0.00 0.00 5.18
2486 2555 6.939730 AGAACTCTCTATGATAAGATCGCAGA 59.060 38.462 0.00 0.00 45.75 4.26
2487 2556 7.611467 AGAACTCTCTATGATAAGATCGCAGAT 59.389 37.037 0.00 0.00 45.12 2.90
2488 2557 7.320443 ACTCTCTATGATAAGATCGCAGATC 57.680 40.000 9.60 9.60 45.12 2.75
2489 2558 6.037062 ACTCTCTATGATAAGATCGCAGATCG 59.963 42.308 11.21 0.00 45.12 3.69
2490 2559 5.877564 TCTCTATGATAAGATCGCAGATCGT 59.122 40.000 11.21 10.84 45.12 3.73
2491 2560 5.873732 TCTATGATAAGATCGCAGATCGTG 58.126 41.667 13.83 0.00 45.12 4.35
2492 2561 3.990318 TGATAAGATCGCAGATCGTGT 57.010 42.857 13.83 9.23 45.12 4.49
2493 2562 4.307443 TGATAAGATCGCAGATCGTGTT 57.693 40.909 13.83 6.87 45.12 3.32
2494 2563 4.044426 TGATAAGATCGCAGATCGTGTTG 58.956 43.478 13.83 0.00 45.12 3.33
2495 2564 2.654749 AAGATCGCAGATCGTGTTGA 57.345 45.000 11.21 0.00 45.12 3.18
2496 2565 2.879002 AGATCGCAGATCGTGTTGAT 57.121 45.000 11.21 0.00 45.12 2.57
2497 2566 3.170791 AGATCGCAGATCGTGTTGATT 57.829 42.857 11.21 0.00 45.12 2.57
2498 2567 3.119291 AGATCGCAGATCGTGTTGATTC 58.881 45.455 11.21 0.00 45.12 2.52
2499 2568 2.654749 TCGCAGATCGTGTTGATTCT 57.345 45.000 0.00 0.00 37.47 2.40
2500 2569 3.775661 TCGCAGATCGTGTTGATTCTA 57.224 42.857 0.00 0.00 37.47 2.10
2501 2570 3.435566 TCGCAGATCGTGTTGATTCTAC 58.564 45.455 0.00 0.00 37.47 2.59
2502 2571 3.128764 TCGCAGATCGTGTTGATTCTACT 59.871 43.478 0.17 0.00 37.47 2.57
2503 2572 4.334481 TCGCAGATCGTGTTGATTCTACTA 59.666 41.667 0.17 0.00 37.47 1.82
2504 2573 5.034797 CGCAGATCGTGTTGATTCTACTAA 58.965 41.667 0.17 0.00 37.47 2.24
2505 2574 5.052304 CGCAGATCGTGTTGATTCTACTAAC 60.052 44.000 0.17 0.00 37.47 2.34
2506 2575 5.232414 GCAGATCGTGTTGATTCTACTAACC 59.768 44.000 0.17 0.00 37.47 2.85
2507 2576 6.330278 CAGATCGTGTTGATTCTACTAACCA 58.670 40.000 0.17 0.00 37.47 3.67
2508 2577 6.473778 CAGATCGTGTTGATTCTACTAACCAG 59.526 42.308 0.17 0.00 37.47 4.00
2509 2578 5.970317 TCGTGTTGATTCTACTAACCAGA 57.030 39.130 0.17 0.00 0.00 3.86
2510 2579 6.335471 TCGTGTTGATTCTACTAACCAGAA 57.665 37.500 0.17 0.00 36.50 3.02
2511 2580 6.931838 TCGTGTTGATTCTACTAACCAGAAT 58.068 36.000 0.00 0.00 43.71 2.40
2512 2581 7.383687 TCGTGTTGATTCTACTAACCAGAATT 58.616 34.615 0.00 0.00 41.66 2.17
2513 2582 7.330946 TCGTGTTGATTCTACTAACCAGAATTG 59.669 37.037 0.00 0.00 41.66 2.32
2514 2583 7.117812 CGTGTTGATTCTACTAACCAGAATTGT 59.882 37.037 0.00 0.00 41.66 2.71
2515 2584 9.431887 GTGTTGATTCTACTAACCAGAATTGTA 57.568 33.333 0.00 0.00 41.66 2.41
2516 2585 9.653287 TGTTGATTCTACTAACCAGAATTGTAG 57.347 33.333 0.00 0.00 41.66 2.74
2517 2586 9.871238 GTTGATTCTACTAACCAGAATTGTAGA 57.129 33.333 0.00 0.00 41.66 2.59
2522 2591 9.667107 TTCTACTAACCAGAATTGTAGAATTGG 57.333 33.333 2.01 2.30 41.99 3.16
2523 2592 8.822805 TCTACTAACCAGAATTGTAGAATTGGT 58.177 33.333 2.01 2.95 35.14 3.67
2524 2593 7.923414 ACTAACCAGAATTGTAGAATTGGTC 57.077 36.000 8.89 0.00 33.31 4.02
2525 2594 6.884836 ACTAACCAGAATTGTAGAATTGGTCC 59.115 38.462 8.89 0.00 33.31 4.46
2526 2595 4.261801 ACCAGAATTGTAGAATTGGTCCG 58.738 43.478 2.01 0.00 29.90 4.79
2527 2596 4.019681 ACCAGAATTGTAGAATTGGTCCGA 60.020 41.667 2.01 0.00 29.90 4.55
2528 2597 4.572389 CCAGAATTGTAGAATTGGTCCGAG 59.428 45.833 2.01 0.00 31.58 4.63
2529 2598 4.034510 CAGAATTGTAGAATTGGTCCGAGC 59.965 45.833 2.01 0.00 31.58 5.03
2530 2599 3.627395 ATTGTAGAATTGGTCCGAGCA 57.373 42.857 0.00 0.00 0.00 4.26
2531 2600 3.410631 TTGTAGAATTGGTCCGAGCAA 57.589 42.857 15.03 15.03 40.12 3.91
2532 2601 3.627395 TGTAGAATTGGTCCGAGCAAT 57.373 42.857 18.08 18.08 46.98 3.56
2540 2609 4.433186 TTGGTCCGAGCAATTTACATTG 57.567 40.909 8.95 0.00 42.60 2.82
2541 2610 3.417101 TGGTCCGAGCAATTTACATTGT 58.583 40.909 0.00 0.00 41.84 2.71
2542 2611 4.580868 TGGTCCGAGCAATTTACATTGTA 58.419 39.130 0.00 0.00 41.84 2.41
2543 2612 5.004448 TGGTCCGAGCAATTTACATTGTAA 58.996 37.500 5.14 5.14 41.84 2.41
2544 2613 5.473846 TGGTCCGAGCAATTTACATTGTAAA 59.526 36.000 20.94 20.94 41.84 2.01
2545 2614 6.027749 GGTCCGAGCAATTTACATTGTAAAG 58.972 40.000 22.49 13.58 41.84 1.85
2546 2615 6.349033 GGTCCGAGCAATTTACATTGTAAAGT 60.349 38.462 22.49 18.76 41.84 2.66
2547 2616 7.081976 GTCCGAGCAATTTACATTGTAAAGTT 58.918 34.615 22.49 15.25 41.84 2.66
2548 2617 7.593644 GTCCGAGCAATTTACATTGTAAAGTTT 59.406 33.333 22.49 13.00 41.84 2.66
2549 2618 7.806014 TCCGAGCAATTTACATTGTAAAGTTTC 59.194 33.333 22.49 18.11 41.84 2.78
2550 2619 7.593273 CCGAGCAATTTACATTGTAAAGTTTCA 59.407 33.333 22.49 3.99 41.84 2.69
2551 2620 8.629986 CGAGCAATTTACATTGTAAAGTTTCAG 58.370 33.333 22.49 12.11 41.84 3.02
2552 2621 9.463443 GAGCAATTTACATTGTAAAGTTTCAGT 57.537 29.630 22.49 5.98 41.84 3.41
2568 2637 9.601217 AAAGTTTCAGTATATGTATCTGACACC 57.399 33.333 11.22 2.36 42.17 4.16
2569 2638 7.426410 AGTTTCAGTATATGTATCTGACACCG 58.574 38.462 11.22 0.00 42.17 4.94
2570 2639 6.954487 TTCAGTATATGTATCTGACACCGT 57.046 37.500 0.00 0.00 42.17 4.83
2571 2640 8.347771 GTTTCAGTATATGTATCTGACACCGTA 58.652 37.037 0.00 0.00 42.17 4.02
2572 2641 8.631480 TTCAGTATATGTATCTGACACCGTAT 57.369 34.615 0.00 0.00 42.17 3.06
2573 2642 8.631480 TCAGTATATGTATCTGACACCGTATT 57.369 34.615 0.00 0.00 42.17 1.89
2574 2643 9.729281 TCAGTATATGTATCTGACACCGTATTA 57.271 33.333 0.00 0.00 42.17 0.98
2575 2644 9.770503 CAGTATATGTATCTGACACCGTATTAC 57.229 37.037 0.00 0.00 42.17 1.89
2576 2645 9.736414 AGTATATGTATCTGACACCGTATTACT 57.264 33.333 0.00 0.00 42.17 2.24
2577 2646 9.985318 GTATATGTATCTGACACCGTATTACTC 57.015 37.037 0.00 0.00 42.17 2.59
2578 2647 5.762825 TGTATCTGACACCGTATTACTCC 57.237 43.478 0.00 0.00 31.20 3.85
2579 2648 5.443283 TGTATCTGACACCGTATTACTCCT 58.557 41.667 0.00 0.00 31.20 3.69
2580 2649 6.594744 TGTATCTGACACCGTATTACTCCTA 58.405 40.000 0.00 0.00 31.20 2.94
2581 2650 6.709397 TGTATCTGACACCGTATTACTCCTAG 59.291 42.308 0.00 0.00 31.20 3.02
2582 2651 5.108187 TCTGACACCGTATTACTCCTAGT 57.892 43.478 0.00 0.00 0.00 2.57
2583 2652 5.503927 TCTGACACCGTATTACTCCTAGTT 58.496 41.667 0.00 0.00 0.00 2.24
2584 2653 5.587844 TCTGACACCGTATTACTCCTAGTTC 59.412 44.000 0.00 0.00 0.00 3.01
2585 2654 5.503927 TGACACCGTATTACTCCTAGTTCT 58.496 41.667 0.00 0.00 0.00 3.01
2586 2655 5.356190 TGACACCGTATTACTCCTAGTTCTG 59.644 44.000 0.00 0.00 0.00 3.02
2587 2656 5.503927 ACACCGTATTACTCCTAGTTCTGA 58.496 41.667 0.00 0.00 0.00 3.27
2588 2657 5.948162 ACACCGTATTACTCCTAGTTCTGAA 59.052 40.000 0.00 0.00 0.00 3.02
2589 2658 6.435277 ACACCGTATTACTCCTAGTTCTGAAA 59.565 38.462 0.00 0.00 0.00 2.69
2590 2659 6.973474 CACCGTATTACTCCTAGTTCTGAAAG 59.027 42.308 0.00 0.00 0.00 2.62
2591 2660 6.662663 ACCGTATTACTCCTAGTTCTGAAAGT 59.337 38.462 0.00 0.00 33.76 2.66
2592 2661 6.973474 CCGTATTACTCCTAGTTCTGAAAGTG 59.027 42.308 0.00 0.00 33.76 3.16
2593 2662 7.148120 CCGTATTACTCCTAGTTCTGAAAGTGA 60.148 40.741 0.00 0.00 33.76 3.41
2594 2663 8.242053 CGTATTACTCCTAGTTCTGAAAGTGAA 58.758 37.037 0.00 0.00 33.76 3.18
2595 2664 9.356433 GTATTACTCCTAGTTCTGAAAGTGAAC 57.644 37.037 0.00 0.00 42.77 3.18
2596 2665 5.216614 ACTCCTAGTTCTGAAAGTGAACC 57.783 43.478 0.00 0.00 43.28 3.62
2597 2666 4.238514 CTCCTAGTTCTGAAAGTGAACCG 58.761 47.826 0.00 0.00 43.28 4.44
2598 2667 3.006537 TCCTAGTTCTGAAAGTGAACCGG 59.993 47.826 0.00 0.00 43.28 5.28
2599 2668 3.006537 CCTAGTTCTGAAAGTGAACCGGA 59.993 47.826 9.46 0.00 43.28 5.14
2600 2669 3.113260 AGTTCTGAAAGTGAACCGGAG 57.887 47.619 9.46 0.00 43.28 4.63
2602 2671 0.034896 TCTGAAAGTGAACCGGAGGC 59.965 55.000 9.46 0.00 45.77 4.70
2603 2672 3.320300 TCTGAAAGTGAACCGGAGGCC 62.320 57.143 9.46 0.00 45.77 5.19
2612 2681 3.365265 CCGGAGGCCAAGTTGTGC 61.365 66.667 5.01 5.04 46.14 4.57
2613 2682 2.281761 CGGAGGCCAAGTTGTGCT 60.282 61.111 5.01 3.38 0.00 4.40
2614 2683 1.003839 CGGAGGCCAAGTTGTGCTA 60.004 57.895 5.01 0.00 0.00 3.49
2615 2684 1.021390 CGGAGGCCAAGTTGTGCTAG 61.021 60.000 5.01 0.00 0.00 3.42
2616 2685 0.036875 GGAGGCCAAGTTGTGCTAGT 59.963 55.000 5.01 2.69 0.00 2.57
2617 2686 1.443802 GAGGCCAAGTTGTGCTAGTC 58.556 55.000 5.01 7.01 0.00 2.59
2618 2687 0.320771 AGGCCAAGTTGTGCTAGTCG 60.321 55.000 5.01 0.00 0.00 4.18
2619 2688 0.320421 GGCCAAGTTGTGCTAGTCGA 60.320 55.000 13.69 0.00 0.00 4.20
2620 2689 0.790814 GCCAAGTTGTGCTAGTCGAC 59.209 55.000 7.70 7.70 0.00 4.20
2621 2690 1.429463 CCAAGTTGTGCTAGTCGACC 58.571 55.000 13.01 0.00 0.00 4.79
2622 2691 1.270094 CCAAGTTGTGCTAGTCGACCA 60.270 52.381 13.01 0.00 0.00 4.02
2623 2692 1.792949 CAAGTTGTGCTAGTCGACCAC 59.207 52.381 13.01 13.79 0.00 4.16
2624 2693 1.037493 AGTTGTGCTAGTCGACCACA 58.963 50.000 18.40 18.40 37.67 4.17
2625 2694 1.137513 GTTGTGCTAGTCGACCACAC 58.862 55.000 20.99 20.66 39.01 3.82
2626 2695 0.747852 TTGTGCTAGTCGACCACACA 59.252 50.000 23.96 23.96 39.01 3.72
2627 2696 0.031585 TGTGCTAGTCGACCACACAC 59.968 55.000 23.96 20.50 36.39 3.82
2628 2697 0.666577 GTGCTAGTCGACCACACACC 60.667 60.000 21.57 3.54 0.00 4.16
2629 2698 1.110518 TGCTAGTCGACCACACACCA 61.111 55.000 13.01 0.00 0.00 4.17
2630 2699 0.032952 GCTAGTCGACCACACACCAA 59.967 55.000 13.01 0.00 0.00 3.67
2631 2700 1.935300 GCTAGTCGACCACACACCAAG 60.935 57.143 13.01 0.00 0.00 3.61
2632 2701 0.677288 TAGTCGACCACACACCAAGG 59.323 55.000 13.01 0.00 0.00 3.61
2633 2702 1.145377 GTCGACCACACACCAAGGT 59.855 57.895 3.51 0.00 38.63 3.50
2634 2703 0.463116 GTCGACCACACACCAAGGTT 60.463 55.000 3.51 0.00 35.36 3.50
2635 2704 0.179067 TCGACCACACACCAAGGTTC 60.179 55.000 0.00 0.00 35.36 3.62
2636 2705 0.179056 CGACCACACACCAAGGTTCT 60.179 55.000 0.00 0.00 35.36 3.01
2637 2706 1.069513 CGACCACACACCAAGGTTCTA 59.930 52.381 0.00 0.00 35.36 2.10
2638 2707 2.484065 CGACCACACACCAAGGTTCTAA 60.484 50.000 0.00 0.00 35.36 2.10
2639 2708 3.139077 GACCACACACCAAGGTTCTAAG 58.861 50.000 0.00 0.00 35.36 2.18
2640 2709 2.508300 ACCACACACCAAGGTTCTAAGT 59.492 45.455 0.00 0.00 29.58 2.24
2641 2710 3.712733 ACCACACACCAAGGTTCTAAGTA 59.287 43.478 0.00 0.00 29.58 2.24
2642 2711 4.062991 CCACACACCAAGGTTCTAAGTAC 58.937 47.826 0.00 0.00 0.00 2.73
2643 2712 4.062991 CACACACCAAGGTTCTAAGTACC 58.937 47.826 0.00 0.00 35.85 3.34
2644 2713 3.712733 ACACACCAAGGTTCTAAGTACCA 59.287 43.478 0.77 0.00 38.16 3.25
2671 2740 7.451566 TGGATTATGAATCGGATCAGAACTCTA 59.548 37.037 0.00 0.00 38.82 2.43
2687 2756 8.672815 TCAGAACTCTATATGATAAGATCGCAG 58.327 37.037 0.00 0.00 0.00 5.18
2700 2769 2.423892 AGATCGCAGATCGTGTTGTAGT 59.576 45.455 11.21 0.00 45.12 2.73
2734 2806 2.425143 ACCGTGCATGAATCTCCAAT 57.575 45.000 7.72 0.00 0.00 3.16
2759 2834 9.692749 ATAAGTTTCAGTATATATGTGACACCG 57.307 33.333 2.45 0.00 0.00 4.94
2775 2850 1.743394 CACCGTTCCCTATTTTCAGGC 59.257 52.381 0.00 0.00 34.02 4.85
2778 2853 1.933853 CGTTCCCTATTTTCAGGCTCG 59.066 52.381 0.00 0.00 34.02 5.03
2781 2856 2.184533 TCCCTATTTTCAGGCTCGTCA 58.815 47.619 0.00 0.00 34.02 4.35
2782 2857 2.168521 TCCCTATTTTCAGGCTCGTCAG 59.831 50.000 0.00 0.00 34.02 3.51
2805 2880 0.614979 AAAGGAGGACGAGCCAGCTA 60.615 55.000 0.00 0.00 40.02 3.32
2898 2979 2.202932 GTGGCGATGGCGATGACT 60.203 61.111 0.00 0.00 41.24 3.41
3067 3148 1.209504 ACATCACGGGGTTCTACATGG 59.790 52.381 0.00 0.00 0.00 3.66
3165 3246 4.805231 TACGTGATGCGCACCCCG 62.805 66.667 14.90 9.43 44.85 5.73
3241 3322 3.835395 CCTCCAGTTCCTCAAGAAGTAGT 59.165 47.826 0.00 0.00 35.88 2.73
3242 3323 5.017490 CCTCCAGTTCCTCAAGAAGTAGTA 58.983 45.833 0.00 0.00 35.88 1.82
3243 3324 5.126384 CCTCCAGTTCCTCAAGAAGTAGTAG 59.874 48.000 0.00 0.00 35.88 2.57
3257 3341 2.029623 GTAGTAGCCATCTCCGTCCAA 58.970 52.381 0.00 0.00 0.00 3.53
3258 3342 1.794714 AGTAGCCATCTCCGTCCAAT 58.205 50.000 0.00 0.00 0.00 3.16
3260 3344 1.048601 TAGCCATCTCCGTCCAATCC 58.951 55.000 0.00 0.00 0.00 3.01
3263 3347 1.347707 GCCATCTCCGTCCAATCCATA 59.652 52.381 0.00 0.00 0.00 2.74
3278 3362 6.216868 TCCAATCCATACATCATCATCATCCT 59.783 38.462 0.00 0.00 0.00 3.24
3412 3500 2.223548 TGTTGATTTGTGTGCTCTGTGC 60.224 45.455 0.00 0.00 43.25 4.57
3466 3554 5.710984 CTTGAGATTCTTCATGCTGCTTTT 58.289 37.500 0.00 0.00 0.00 2.27
3470 3558 6.656270 TGAGATTCTTCATGCTGCTTTTTCTA 59.344 34.615 0.00 0.00 0.00 2.10
3531 3619 5.075448 CGCGTGTTTATATTCTGATGATGC 58.925 41.667 0.00 0.00 0.00 3.91
3532 3620 5.385617 GCGTGTTTATATTCTGATGATGCC 58.614 41.667 0.00 0.00 0.00 4.40
3533 3621 5.049474 GCGTGTTTATATTCTGATGATGCCA 60.049 40.000 0.00 0.00 0.00 4.92
3545 3659 5.070770 TGATGATGCCACATTTAAACACC 57.929 39.130 0.00 0.00 0.00 4.16
3635 3750 3.504906 ACCACATCACAGAGAAATTGCTG 59.495 43.478 0.00 0.00 38.10 4.41
3648 3763 1.382522 ATTGCTGCACCGAATACAGG 58.617 50.000 0.00 0.00 31.94 4.00
3652 3767 0.391661 CTGCACCGAATACAGGCTGT 60.392 55.000 25.34 25.34 0.00 4.40
3653 3768 0.673333 TGCACCGAATACAGGCTGTG 60.673 55.000 29.65 14.95 0.00 3.66
3658 3773 0.673333 CGAATACAGGCTGTGGCACA 60.673 55.000 29.65 20.76 40.87 4.57
3659 3774 1.755179 GAATACAGGCTGTGGCACAT 58.245 50.000 29.65 12.15 44.52 3.21
3660 3775 1.402968 GAATACAGGCTGTGGCACATG 59.597 52.381 29.65 18.73 44.52 3.21
3726 3847 7.095017 GGGATCGGTAAAATCTCAATCTCAATC 60.095 40.741 0.00 0.00 0.00 2.67
3727 3848 7.659390 GGATCGGTAAAATCTCAATCTCAATCT 59.341 37.037 0.00 0.00 0.00 2.40
3728 3849 8.600449 ATCGGTAAAATCTCAATCTCAATCTC 57.400 34.615 0.00 0.00 0.00 2.75
3729 3850 7.555965 TCGGTAAAATCTCAATCTCAATCTCA 58.444 34.615 0.00 0.00 0.00 3.27
3730 3851 8.040727 TCGGTAAAATCTCAATCTCAATCTCAA 58.959 33.333 0.00 0.00 0.00 3.02
3731 3852 8.668353 CGGTAAAATCTCAATCTCAATCTCAAA 58.332 33.333 0.00 0.00 0.00 2.69
3736 3857 9.682465 AAATCTCAATCTCAATCTCAAATCTCA 57.318 29.630 0.00 0.00 0.00 3.27
3737 3858 9.682465 AATCTCAATCTCAATCTCAAATCTCAA 57.318 29.630 0.00 0.00 0.00 3.02
3738 3859 9.854668 ATCTCAATCTCAATCTCAAATCTCAAT 57.145 29.630 0.00 0.00 0.00 2.57
3769 3890 6.911308 AGGTGGGCTAAATTTACATGATACT 58.089 36.000 0.00 0.00 0.00 2.12
3804 3925 1.079336 GTACAGGCCGAGGGTGAAC 60.079 63.158 0.00 0.00 0.00 3.18
3829 3951 4.657039 TGTATTAGAAGGGGGTGGTCATAC 59.343 45.833 0.00 0.00 0.00 2.39
3832 3954 1.203440 AGAAGGGGGTGGTCATACTGT 60.203 52.381 0.00 0.00 0.00 3.55
3842 3964 4.332819 GGTGGTCATACTGTTGTCAATAGC 59.667 45.833 9.09 0.00 0.00 2.97
3851 3973 2.948315 TGTTGTCAATAGCACAGCACAA 59.052 40.909 0.00 0.00 30.85 3.33
3855 3977 2.095567 GTCAATAGCACAGCACAACAGG 60.096 50.000 0.00 0.00 0.00 4.00
3857 3979 2.553602 CAATAGCACAGCACAACAGGAA 59.446 45.455 0.00 0.00 0.00 3.36
3866 3988 3.876914 CAGCACAACAGGAAACTAAGACA 59.123 43.478 0.00 0.00 40.21 3.41
3873 3995 3.244596 ACAGGAAACTAAGACAAGCTCCC 60.245 47.826 0.00 0.00 40.21 4.30
3875 3997 4.223032 CAGGAAACTAAGACAAGCTCCCTA 59.777 45.833 0.00 0.00 40.21 3.53
3884 4006 1.118838 CAAGCTCCCTAGACTCCAGG 58.881 60.000 0.00 0.00 0.00 4.45
3894 4016 2.848678 AGACTCCAGGGCACTACATA 57.151 50.000 0.00 0.00 0.00 2.29
3914 4036 2.358247 GGTCCGCAACGATGGTGT 60.358 61.111 0.00 0.00 0.00 4.16
3917 4039 0.108992 GTCCGCAACGATGGTGTCTA 60.109 55.000 0.00 0.00 0.00 2.59
3940 4062 8.037166 TCTATCATATATCATTCAGGTGTGTGC 58.963 37.037 0.00 0.00 0.00 4.57
3983 4105 1.256812 GCAAAGTACCTGGGCATGTT 58.743 50.000 0.00 0.00 0.00 2.71
3990 4112 2.034066 CTGGGCATGTTGACGGGT 59.966 61.111 0.00 0.00 0.00 5.28
3991 4113 2.033448 TGGGCATGTTGACGGGTC 59.967 61.111 0.00 0.00 0.00 4.46
4086 4208 3.279116 GTGCTGTTGCTGCCACGA 61.279 61.111 0.00 0.00 40.48 4.35
4095 4217 2.177531 CTGCCACGACAATGCAGC 59.822 61.111 0.00 0.00 45.09 5.25
4101 4223 1.301953 ACGACAATGCAGCAGCTGA 60.302 52.632 27.39 11.60 42.74 4.26
4168 4290 2.138320 CCTGCGCCAGTATTATCTGTG 58.862 52.381 4.18 0.00 34.02 3.66
4224 4346 0.965439 TTGAATCCGCACAAAAGGGG 59.035 50.000 0.00 0.00 42.56 4.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 2.105128 CGTGTCGGAGATGGAGCC 59.895 66.667 0.00 0.00 40.67 4.70
1 2 0.802607 GAACGTGTCGGAGATGGAGC 60.803 60.000 0.00 0.00 40.67 4.70
2 3 0.811915 AGAACGTGTCGGAGATGGAG 59.188 55.000 0.00 0.00 40.67 3.86
3 4 0.809385 GAGAACGTGTCGGAGATGGA 59.191 55.000 0.00 0.00 40.67 3.41
4 5 0.179134 GGAGAACGTGTCGGAGATGG 60.179 60.000 0.00 0.00 40.67 3.51
5 6 0.523546 CGGAGAACGTGTCGGAGATG 60.524 60.000 0.00 0.00 36.87 2.90
6 7 0.675837 TCGGAGAACGTGTCGGAGAT 60.676 55.000 0.00 0.00 44.69 2.75
7 8 1.301953 TCGGAGAACGTGTCGGAGA 60.302 57.895 0.00 0.00 44.69 3.71
8 9 1.154263 GTCGGAGAACGTGTCGGAG 60.154 63.158 8.24 0.00 44.69 4.63
9 10 2.949106 GTCGGAGAACGTGTCGGA 59.051 61.111 0.00 0.00 44.69 4.55
10 11 2.501222 CGTCGGAGAACGTGTCGG 60.501 66.667 0.00 0.00 44.69 4.79
11 12 2.501222 CCGTCGGAGAACGTGTCG 60.501 66.667 4.91 0.00 44.69 4.35
12 13 1.000736 GAACCGTCGGAGAACGTGTC 61.001 60.000 20.51 0.00 44.69 3.67
13 14 1.008079 GAACCGTCGGAGAACGTGT 60.008 57.895 20.51 0.00 44.69 4.49
14 15 1.731969 GGAACCGTCGGAGAACGTG 60.732 63.158 20.51 0.00 44.69 4.49
15 16 1.530013 ATGGAACCGTCGGAGAACGT 61.530 55.000 20.51 3.66 44.69 3.99
16 17 1.076533 CATGGAACCGTCGGAGAACG 61.077 60.000 20.51 0.00 39.69 3.95
17 18 1.359459 GCATGGAACCGTCGGAGAAC 61.359 60.000 20.51 5.69 39.69 3.01
18 19 1.079405 GCATGGAACCGTCGGAGAA 60.079 57.895 20.51 0.37 39.69 2.87
19 20 2.577059 GCATGGAACCGTCGGAGA 59.423 61.111 20.51 0.00 0.00 3.71
20 21 2.885644 CGCATGGAACCGTCGGAG 60.886 66.667 20.51 1.45 0.00 4.63
21 22 3.636313 GACGCATGGAACCGTCGGA 62.636 63.158 20.51 0.00 43.37 4.55
22 23 3.186047 GACGCATGGAACCGTCGG 61.186 66.667 10.48 10.48 43.37 4.79
28 29 3.849953 GTCGCCGACGCATGGAAC 61.850 66.667 0.00 0.00 39.84 3.62
37 38 2.506438 CTTCCTTCCGTCGCCGAC 60.506 66.667 7.29 7.29 35.63 4.79
38 39 3.755628 CCTTCCTTCCGTCGCCGA 61.756 66.667 0.00 0.00 35.63 5.54
41 42 4.430765 TCGCCTTCCTTCCGTCGC 62.431 66.667 0.00 0.00 0.00 5.19
42 43 2.202623 CTCGCCTTCCTTCCGTCG 60.203 66.667 0.00 0.00 0.00 5.12
43 44 1.139947 CTCTCGCCTTCCTTCCGTC 59.860 63.158 0.00 0.00 0.00 4.79
44 45 1.606889 ACTCTCGCCTTCCTTCCGT 60.607 57.895 0.00 0.00 0.00 4.69
45 46 1.153745 CACTCTCGCCTTCCTTCCG 60.154 63.158 0.00 0.00 0.00 4.30
46 47 0.608640 TTCACTCTCGCCTTCCTTCC 59.391 55.000 0.00 0.00 0.00 3.46
47 48 2.028930 TCTTTCACTCTCGCCTTCCTTC 60.029 50.000 0.00 0.00 0.00 3.46
48 49 1.971357 TCTTTCACTCTCGCCTTCCTT 59.029 47.619 0.00 0.00 0.00 3.36
49 50 1.633774 TCTTTCACTCTCGCCTTCCT 58.366 50.000 0.00 0.00 0.00 3.36
50 51 2.457366 TTCTTTCACTCTCGCCTTCC 57.543 50.000 0.00 0.00 0.00 3.46
51 52 4.058817 TCTTTTCTTTCACTCTCGCCTTC 58.941 43.478 0.00 0.00 0.00 3.46
52 53 4.061596 CTCTTTTCTTTCACTCTCGCCTT 58.938 43.478 0.00 0.00 0.00 4.35
53 54 3.658709 CTCTTTTCTTTCACTCTCGCCT 58.341 45.455 0.00 0.00 0.00 5.52
54 55 2.158645 GCTCTTTTCTTTCACTCTCGCC 59.841 50.000 0.00 0.00 0.00 5.54
55 56 2.159907 CGCTCTTTTCTTTCACTCTCGC 60.160 50.000 0.00 0.00 0.00 5.03
56 57 2.410053 CCGCTCTTTTCTTTCACTCTCG 59.590 50.000 0.00 0.00 0.00 4.04
57 58 2.739379 CCCGCTCTTTTCTTTCACTCTC 59.261 50.000 0.00 0.00 0.00 3.20
58 59 2.368875 TCCCGCTCTTTTCTTTCACTCT 59.631 45.455 0.00 0.00 0.00 3.24
59 60 2.767505 TCCCGCTCTTTTCTTTCACTC 58.232 47.619 0.00 0.00 0.00 3.51
60 61 2.930826 TCCCGCTCTTTTCTTTCACT 57.069 45.000 0.00 0.00 0.00 3.41
61 62 4.505313 AATTCCCGCTCTTTTCTTTCAC 57.495 40.909 0.00 0.00 0.00 3.18
62 63 4.700213 CCTAATTCCCGCTCTTTTCTTTCA 59.300 41.667 0.00 0.00 0.00 2.69
63 64 4.438880 GCCTAATTCCCGCTCTTTTCTTTC 60.439 45.833 0.00 0.00 0.00 2.62
64 65 3.444034 GCCTAATTCCCGCTCTTTTCTTT 59.556 43.478 0.00 0.00 0.00 2.52
65 66 3.017442 GCCTAATTCCCGCTCTTTTCTT 58.983 45.455 0.00 0.00 0.00 2.52
66 67 2.026262 TGCCTAATTCCCGCTCTTTTCT 60.026 45.455 0.00 0.00 0.00 2.52
67 68 2.356069 CTGCCTAATTCCCGCTCTTTTC 59.644 50.000 0.00 0.00 0.00 2.29
68 69 2.026262 TCTGCCTAATTCCCGCTCTTTT 60.026 45.455 0.00 0.00 0.00 2.27
69 70 1.559682 TCTGCCTAATTCCCGCTCTTT 59.440 47.619 0.00 0.00 0.00 2.52
70 71 1.139853 CTCTGCCTAATTCCCGCTCTT 59.860 52.381 0.00 0.00 0.00 2.85
71 72 0.755686 CTCTGCCTAATTCCCGCTCT 59.244 55.000 0.00 0.00 0.00 4.09
72 73 0.753262 TCTCTGCCTAATTCCCGCTC 59.247 55.000 0.00 0.00 0.00 5.03
73 74 0.755686 CTCTCTGCCTAATTCCCGCT 59.244 55.000 0.00 0.00 0.00 5.52
74 75 0.882484 GCTCTCTGCCTAATTCCCGC 60.882 60.000 0.00 0.00 35.15 6.13
75 76 0.465705 TGCTCTCTGCCTAATTCCCG 59.534 55.000 0.00 0.00 42.00 5.14
76 77 1.488393 AGTGCTCTCTGCCTAATTCCC 59.512 52.381 0.00 0.00 42.00 3.97
77 78 2.559440 CAGTGCTCTCTGCCTAATTCC 58.441 52.381 0.00 0.00 42.00 3.01
78 79 2.559440 CCAGTGCTCTCTGCCTAATTC 58.441 52.381 0.00 0.00 42.00 2.17
79 80 1.211457 CCCAGTGCTCTCTGCCTAATT 59.789 52.381 0.00 0.00 42.00 1.40
80 81 0.835941 CCCAGTGCTCTCTGCCTAAT 59.164 55.000 0.00 0.00 42.00 1.73
81 82 1.267574 CCCCAGTGCTCTCTGCCTAA 61.268 60.000 0.00 0.00 42.00 2.69
82 83 1.687146 CCCCAGTGCTCTCTGCCTA 60.687 63.158 0.00 0.00 42.00 3.93
83 84 3.007920 CCCCAGTGCTCTCTGCCT 61.008 66.667 0.00 0.00 42.00 4.75
84 85 4.106925 CCCCCAGTGCTCTCTGCC 62.107 72.222 0.00 0.00 42.00 4.85
85 86 2.373707 ATCCCCCAGTGCTCTCTGC 61.374 63.158 0.00 0.00 43.25 4.26
86 87 1.525923 CATCCCCCAGTGCTCTCTG 59.474 63.158 0.00 0.00 35.45 3.35
87 88 1.692042 CCATCCCCCAGTGCTCTCT 60.692 63.158 0.00 0.00 0.00 3.10
88 89 1.274703 TTCCATCCCCCAGTGCTCTC 61.275 60.000 0.00 0.00 0.00 3.20
89 90 1.229951 TTCCATCCCCCAGTGCTCT 60.230 57.895 0.00 0.00 0.00 4.09
90 91 1.225704 CTTCCATCCCCCAGTGCTC 59.774 63.158 0.00 0.00 0.00 4.26
91 92 0.846427 TTCTTCCATCCCCCAGTGCT 60.846 55.000 0.00 0.00 0.00 4.40
92 93 0.394899 CTTCTTCCATCCCCCAGTGC 60.395 60.000 0.00 0.00 0.00 4.40
93 94 1.211457 CTCTTCTTCCATCCCCCAGTG 59.789 57.143 0.00 0.00 0.00 3.66
94 95 1.081174 TCTCTTCTTCCATCCCCCAGT 59.919 52.381 0.00 0.00 0.00 4.00
95 96 1.767681 CTCTCTTCTTCCATCCCCCAG 59.232 57.143 0.00 0.00 0.00 4.45
96 97 1.081174 ACTCTCTTCTTCCATCCCCCA 59.919 52.381 0.00 0.00 0.00 4.96
97 98 1.488393 CACTCTCTTCTTCCATCCCCC 59.512 57.143 0.00 0.00 0.00 5.40
98 99 1.488393 CCACTCTCTTCTTCCATCCCC 59.512 57.143 0.00 0.00 0.00 4.81
99 100 1.488393 CCCACTCTCTTCTTCCATCCC 59.512 57.143 0.00 0.00 0.00 3.85
100 101 1.488393 CCCCACTCTCTTCTTCCATCC 59.512 57.143 0.00 0.00 0.00 3.51
101 102 1.488393 CCCCCACTCTCTTCTTCCATC 59.512 57.143 0.00 0.00 0.00 3.51
102 103 1.081174 TCCCCCACTCTCTTCTTCCAT 59.919 52.381 0.00 0.00 0.00 3.41
103 104 0.491823 TCCCCCACTCTCTTCTTCCA 59.508 55.000 0.00 0.00 0.00 3.53
104 105 1.886422 ATCCCCCACTCTCTTCTTCC 58.114 55.000 0.00 0.00 0.00 3.46
105 106 4.013050 CAAAATCCCCCACTCTCTTCTTC 58.987 47.826 0.00 0.00 0.00 2.87
106 107 3.245407 CCAAAATCCCCCACTCTCTTCTT 60.245 47.826 0.00 0.00 0.00 2.52
107 108 2.310052 CCAAAATCCCCCACTCTCTTCT 59.690 50.000 0.00 0.00 0.00 2.85
108 109 2.728007 CCAAAATCCCCCACTCTCTTC 58.272 52.381 0.00 0.00 0.00 2.87
109 110 1.272704 GCCAAAATCCCCCACTCTCTT 60.273 52.381 0.00 0.00 0.00 2.85
110 111 0.332972 GCCAAAATCCCCCACTCTCT 59.667 55.000 0.00 0.00 0.00 3.10
111 112 0.039618 TGCCAAAATCCCCCACTCTC 59.960 55.000 0.00 0.00 0.00 3.20
112 113 0.251787 GTGCCAAAATCCCCCACTCT 60.252 55.000 0.00 0.00 0.00 3.24
113 114 1.595093 CGTGCCAAAATCCCCCACTC 61.595 60.000 0.00 0.00 0.00 3.51
114 115 1.606313 CGTGCCAAAATCCCCCACT 60.606 57.895 0.00 0.00 0.00 4.00
115 116 1.182385 TTCGTGCCAAAATCCCCCAC 61.182 55.000 0.00 0.00 0.00 4.61
116 117 0.470080 TTTCGTGCCAAAATCCCCCA 60.470 50.000 0.00 0.00 0.00 4.96
117 118 0.682292 TTTTCGTGCCAAAATCCCCC 59.318 50.000 0.00 0.00 0.00 5.40
118 119 2.760634 ATTTTCGTGCCAAAATCCCC 57.239 45.000 0.00 0.00 31.53 4.81
119 120 4.173256 CACTATTTTCGTGCCAAAATCCC 58.827 43.478 2.35 0.00 37.23 3.85
120 121 4.621034 CACACTATTTTCGTGCCAAAATCC 59.379 41.667 2.35 0.00 37.23 3.01
121 122 4.621034 CCACACTATTTTCGTGCCAAAATC 59.379 41.667 2.35 0.00 37.23 2.17
122 123 4.555262 CCACACTATTTTCGTGCCAAAAT 58.445 39.130 4.20 4.20 39.01 1.82
123 124 3.243569 CCCACACTATTTTCGTGCCAAAA 60.244 43.478 0.00 0.00 35.84 2.44
124 125 2.294791 CCCACACTATTTTCGTGCCAAA 59.705 45.455 0.00 0.00 35.84 3.28
125 126 1.883275 CCCACACTATTTTCGTGCCAA 59.117 47.619 0.00 0.00 35.84 4.52
126 127 1.072489 TCCCACACTATTTTCGTGCCA 59.928 47.619 0.00 0.00 35.84 4.92
127 128 1.816074 TCCCACACTATTTTCGTGCC 58.184 50.000 0.00 0.00 35.84 5.01
128 129 3.689649 AGAATCCCACACTATTTTCGTGC 59.310 43.478 0.00 0.00 35.84 5.34
129 130 5.872617 TGTAGAATCCCACACTATTTTCGTG 59.127 40.000 0.00 0.00 38.32 4.35
130 131 6.045072 TGTAGAATCCCACACTATTTTCGT 57.955 37.500 0.00 0.00 0.00 3.85
131 132 6.978343 TTGTAGAATCCCACACTATTTTCG 57.022 37.500 0.00 0.00 0.00 3.46
132 133 9.010029 TCTTTTGTAGAATCCCACACTATTTTC 57.990 33.333 0.00 0.00 0.00 2.29
133 134 8.934023 TCTTTTGTAGAATCCCACACTATTTT 57.066 30.769 0.00 0.00 0.00 1.82
134 135 8.164070 ACTCTTTTGTAGAATCCCACACTATTT 58.836 33.333 0.00 0.00 30.91 1.40
135 136 7.607991 CACTCTTTTGTAGAATCCCACACTATT 59.392 37.037 0.00 0.00 30.91 1.73
136 137 7.106239 CACTCTTTTGTAGAATCCCACACTAT 58.894 38.462 0.00 0.00 30.91 2.12
137 138 6.464222 CACTCTTTTGTAGAATCCCACACTA 58.536 40.000 0.00 0.00 30.91 2.74
138 139 5.308825 CACTCTTTTGTAGAATCCCACACT 58.691 41.667 0.00 0.00 30.91 3.55
139 140 4.455877 CCACTCTTTTGTAGAATCCCACAC 59.544 45.833 0.00 0.00 30.91 3.82
140 141 4.506625 CCCACTCTTTTGTAGAATCCCACA 60.507 45.833 0.00 0.00 30.91 4.17
141 142 4.010349 CCCACTCTTTTGTAGAATCCCAC 58.990 47.826 0.00 0.00 30.91 4.61
142 143 3.561313 GCCCACTCTTTTGTAGAATCCCA 60.561 47.826 0.00 0.00 30.91 4.37
143 144 3.017442 GCCCACTCTTTTGTAGAATCCC 58.983 50.000 0.00 0.00 30.91 3.85
144 145 3.942115 GAGCCCACTCTTTTGTAGAATCC 59.058 47.826 0.00 0.00 40.03 3.01
163 164 1.000171 CACCCAAAAGAAAGGCAGAGC 60.000 52.381 0.00 0.00 0.00 4.09
164 165 1.615392 CCACCCAAAAGAAAGGCAGAG 59.385 52.381 0.00 0.00 0.00 3.35
165 166 1.216678 TCCACCCAAAAGAAAGGCAGA 59.783 47.619 0.00 0.00 0.00 4.26
166 167 1.341209 GTCCACCCAAAAGAAAGGCAG 59.659 52.381 0.00 0.00 0.00 4.85
167 168 1.408969 GTCCACCCAAAAGAAAGGCA 58.591 50.000 0.00 0.00 0.00 4.75
168 169 0.679505 GGTCCACCCAAAAGAAAGGC 59.320 55.000 0.00 0.00 0.00 4.35
169 170 0.958822 CGGTCCACCCAAAAGAAAGG 59.041 55.000 0.00 0.00 0.00 3.11
170 171 0.958822 CCGGTCCACCCAAAAGAAAG 59.041 55.000 0.00 0.00 0.00 2.62
171 172 0.468400 CCCGGTCCACCCAAAAGAAA 60.468 55.000 0.00 0.00 0.00 2.52
172 173 1.151908 CCCGGTCCACCCAAAAGAA 59.848 57.895 0.00 0.00 0.00 2.52
173 174 2.836187 CCCCGGTCCACCCAAAAGA 61.836 63.158 0.00 0.00 0.00 2.52
174 175 2.282887 CCCCGGTCCACCCAAAAG 60.283 66.667 0.00 0.00 0.00 2.27
175 176 2.777400 TCCCCGGTCCACCCAAAA 60.777 61.111 0.00 0.00 0.00 2.44
176 177 3.253838 CTCCCCGGTCCACCCAAA 61.254 66.667 0.00 0.00 0.00 3.28
184 185 4.779733 TCTCTGCCCTCCCCGGTC 62.780 72.222 0.00 0.00 0.00 4.79
185 186 4.787280 CTCTCTGCCCTCCCCGGT 62.787 72.222 0.00 0.00 0.00 5.28
188 189 2.381941 ATTGCTCTCTGCCCTCCCC 61.382 63.158 0.00 0.00 42.00 4.81
189 190 1.153005 CATTGCTCTCTGCCCTCCC 60.153 63.158 0.00 0.00 42.00 4.30
190 191 0.034670 AACATTGCTCTCTGCCCTCC 60.035 55.000 0.00 0.00 42.00 4.30
191 192 1.742268 GAAACATTGCTCTCTGCCCTC 59.258 52.381 0.00 0.00 42.00 4.30
192 193 1.074405 TGAAACATTGCTCTCTGCCCT 59.926 47.619 0.00 0.00 42.00 5.19
193 194 1.200948 GTGAAACATTGCTCTCTGCCC 59.799 52.381 0.00 0.00 37.64 5.36
194 195 1.135859 CGTGAAACATTGCTCTCTGCC 60.136 52.381 0.00 0.00 37.58 4.85
195 196 1.532868 ACGTGAAACATTGCTCTCTGC 59.467 47.619 0.00 0.00 38.63 4.26
196 197 2.545526 ACACGTGAAACATTGCTCTCTG 59.454 45.455 25.01 0.00 35.74 3.35
197 198 2.802816 GACACGTGAAACATTGCTCTCT 59.197 45.455 25.01 0.00 35.74 3.10
198 199 2.096218 GGACACGTGAAACATTGCTCTC 60.096 50.000 25.01 4.08 35.74 3.20
199 200 1.873591 GGACACGTGAAACATTGCTCT 59.126 47.619 25.01 0.00 35.74 4.09
200 201 1.398451 CGGACACGTGAAACATTGCTC 60.398 52.381 25.01 5.46 35.74 4.26
201 202 0.586319 CGGACACGTGAAACATTGCT 59.414 50.000 25.01 0.00 35.74 3.91
202 203 0.385473 CCGGACACGTGAAACATTGC 60.385 55.000 25.01 2.39 38.78 3.56
203 204 1.070175 GTCCGGACACGTGAAACATTG 60.070 52.381 29.75 4.25 38.78 2.82
204 205 1.202604 AGTCCGGACACGTGAAACATT 60.203 47.619 35.00 8.09 38.78 2.71
205 206 0.391597 AGTCCGGACACGTGAAACAT 59.608 50.000 35.00 8.65 38.78 2.71
206 207 0.249155 GAGTCCGGACACGTGAAACA 60.249 55.000 35.00 0.00 38.78 2.83
207 208 0.031721 AGAGTCCGGACACGTGAAAC 59.968 55.000 35.00 15.03 38.78 2.78
208 209 0.313043 GAGAGTCCGGACACGTGAAA 59.687 55.000 35.00 0.00 38.78 2.69
209 210 1.848932 CGAGAGTCCGGACACGTGAA 61.849 60.000 35.00 0.00 38.78 3.18
210 211 2.322830 CGAGAGTCCGGACACGTGA 61.323 63.158 35.00 0.00 38.78 4.35
211 212 2.176055 CGAGAGTCCGGACACGTG 59.824 66.667 35.00 21.88 38.78 4.49
212 213 3.735029 GCGAGAGTCCGGACACGT 61.735 66.667 35.00 19.39 38.78 4.49
213 214 2.742710 TTTGCGAGAGTCCGGACACG 62.743 60.000 35.00 32.04 40.55 4.49
214 215 1.006571 TTTGCGAGAGTCCGGACAC 60.007 57.895 35.00 28.95 0.00 3.67
215 216 1.289066 CTTTGCGAGAGTCCGGACA 59.711 57.895 35.00 11.91 0.00 4.02
216 217 2.095252 GCTTTGCGAGAGTCCGGAC 61.095 63.158 27.67 27.67 0.00 4.79
217 218 2.261671 GCTTTGCGAGAGTCCGGA 59.738 61.111 0.00 0.00 0.00 5.14
218 219 2.815647 GGCTTTGCGAGAGTCCGG 60.816 66.667 0.00 0.00 0.00 5.14
219 220 2.815647 GGGCTTTGCGAGAGTCCG 60.816 66.667 0.00 0.00 0.00 4.79
220 221 1.448717 GAGGGCTTTGCGAGAGTCC 60.449 63.158 0.00 0.00 39.22 3.85
221 222 1.448717 GGAGGGCTTTGCGAGAGTC 60.449 63.158 0.00 0.00 0.00 3.36
222 223 2.217038 TGGAGGGCTTTGCGAGAGT 61.217 57.895 0.00 0.00 0.00 3.24
223 224 1.743252 GTGGAGGGCTTTGCGAGAG 60.743 63.158 0.00 0.00 0.00 3.20
224 225 2.347490 GTGGAGGGCTTTGCGAGA 59.653 61.111 0.00 0.00 0.00 4.04
225 226 3.121030 CGTGGAGGGCTTTGCGAG 61.121 66.667 0.00 0.00 0.00 5.03
226 227 2.951475 AAACGTGGAGGGCTTTGCGA 62.951 55.000 0.00 0.00 0.00 5.10
227 228 2.070654 AAAACGTGGAGGGCTTTGCG 62.071 55.000 0.00 0.00 0.00 4.85
228 229 0.104120 AAAAACGTGGAGGGCTTTGC 59.896 50.000 0.00 0.00 0.00 3.68
229 230 1.681264 AGAAAAACGTGGAGGGCTTTG 59.319 47.619 0.00 0.00 0.00 2.77
230 231 1.954382 GAGAAAAACGTGGAGGGCTTT 59.046 47.619 0.00 0.00 0.00 3.51
231 232 1.605753 GAGAAAAACGTGGAGGGCTT 58.394 50.000 0.00 0.00 0.00 4.35
232 233 0.602905 CGAGAAAAACGTGGAGGGCT 60.603 55.000 0.00 0.00 0.00 5.19
233 234 1.866925 CGAGAAAAACGTGGAGGGC 59.133 57.895 0.00 0.00 0.00 5.19
234 235 1.866925 GCGAGAAAAACGTGGAGGG 59.133 57.895 0.00 0.00 0.00 4.30
235 236 1.219522 ACGCGAGAAAAACGTGGAGG 61.220 55.000 15.93 0.00 43.94 4.30
236 237 0.580104 AACGCGAGAAAAACGTGGAG 59.420 50.000 15.93 0.00 43.94 3.86
237 238 1.008329 AAACGCGAGAAAAACGTGGA 58.992 45.000 15.93 0.00 43.94 4.02
238 239 1.109296 CAAACGCGAGAAAAACGTGG 58.891 50.000 15.93 0.00 43.94 4.94
239 240 0.492737 GCAAACGCGAGAAAAACGTG 59.507 50.000 15.93 0.00 44.93 4.49
240 241 2.849521 GCAAACGCGAGAAAAACGT 58.150 47.368 15.93 0.00 42.81 3.99
251 252 0.452585 TAAAATAGCCCCGCAAACGC 59.547 50.000 0.00 0.00 38.22 4.84
252 253 1.064952 CCTAAAATAGCCCCGCAAACG 59.935 52.381 0.00 0.00 39.67 3.60
253 254 2.371306 TCCTAAAATAGCCCCGCAAAC 58.629 47.619 0.00 0.00 0.00 2.93
254 255 2.810870 TCCTAAAATAGCCCCGCAAA 57.189 45.000 0.00 0.00 0.00 3.68
255 256 2.810870 TTCCTAAAATAGCCCCGCAA 57.189 45.000 0.00 0.00 0.00 4.85
256 257 2.488347 GGATTCCTAAAATAGCCCCGCA 60.488 50.000 0.00 0.00 0.00 5.69
257 258 2.160205 GGATTCCTAAAATAGCCCCGC 58.840 52.381 0.00 0.00 0.00 6.13
258 259 3.502123 TGGATTCCTAAAATAGCCCCG 57.498 47.619 3.95 0.00 0.00 5.73
259 260 7.010771 AGTTATTGGATTCCTAAAATAGCCCC 58.989 38.462 3.95 0.00 0.00 5.80
260 261 7.176865 GGAGTTATTGGATTCCTAAAATAGCCC 59.823 40.741 3.95 3.21 0.00 5.19
261 262 7.176865 GGGAGTTATTGGATTCCTAAAATAGCC 59.823 40.741 3.95 3.76 0.00 3.93
262 263 7.094762 CGGGAGTTATTGGATTCCTAAAATAGC 60.095 40.741 3.95 2.72 0.00 2.97
263 264 8.154856 TCGGGAGTTATTGGATTCCTAAAATAG 58.845 37.037 3.95 0.00 0.00 1.73
264 265 8.036585 TCGGGAGTTATTGGATTCCTAAAATA 57.963 34.615 3.95 0.00 0.00 1.40
265 266 6.906848 TCGGGAGTTATTGGATTCCTAAAAT 58.093 36.000 3.95 0.00 0.00 1.82
266 267 6.316280 TCGGGAGTTATTGGATTCCTAAAA 57.684 37.500 3.95 0.00 0.00 1.52
267 268 5.961398 TCGGGAGTTATTGGATTCCTAAA 57.039 39.130 3.95 0.00 0.00 1.85
268 269 5.677567 GTTCGGGAGTTATTGGATTCCTAA 58.322 41.667 3.95 0.00 0.00 2.69
269 270 4.202182 CGTTCGGGAGTTATTGGATTCCTA 60.202 45.833 3.95 0.00 0.00 2.94
270 271 3.431766 CGTTCGGGAGTTATTGGATTCCT 60.432 47.826 3.95 0.00 0.00 3.36
271 272 2.870411 CGTTCGGGAGTTATTGGATTCC 59.130 50.000 0.00 0.00 0.00 3.01
272 273 3.308866 CACGTTCGGGAGTTATTGGATTC 59.691 47.826 0.00 0.00 0.00 2.52
273 274 3.267483 CACGTTCGGGAGTTATTGGATT 58.733 45.455 0.00 0.00 0.00 3.01
274 275 2.901249 CACGTTCGGGAGTTATTGGAT 58.099 47.619 0.00 0.00 0.00 3.41
275 276 1.673626 GCACGTTCGGGAGTTATTGGA 60.674 52.381 0.00 0.00 0.00 3.53
276 277 0.725117 GCACGTTCGGGAGTTATTGG 59.275 55.000 0.00 0.00 0.00 3.16
277 278 0.368907 CGCACGTTCGGGAGTTATTG 59.631 55.000 0.00 0.00 0.00 1.90
278 279 0.738412 CCGCACGTTCGGGAGTTATT 60.738 55.000 19.38 0.00 45.38 1.40
279 280 1.153706 CCGCACGTTCGGGAGTTAT 60.154 57.895 19.38 0.00 45.38 1.89
280 281 2.259204 CCGCACGTTCGGGAGTTA 59.741 61.111 19.38 0.00 45.38 2.24
287 288 1.419922 CTCAAATCCCGCACGTTCG 59.580 57.895 0.00 0.00 0.00 3.95
288 289 1.134694 GCTCAAATCCCGCACGTTC 59.865 57.895 0.00 0.00 0.00 3.95
289 290 0.960364 ATGCTCAAATCCCGCACGTT 60.960 50.000 0.00 0.00 36.37 3.99
290 291 0.960364 AATGCTCAAATCCCGCACGT 60.960 50.000 0.00 0.00 36.37 4.49
291 292 0.171007 AAATGCTCAAATCCCGCACG 59.829 50.000 0.00 0.00 36.37 5.34
292 293 1.795162 CGAAATGCTCAAATCCCGCAC 60.795 52.381 0.00 0.00 36.37 5.34
293 294 0.451383 CGAAATGCTCAAATCCCGCA 59.549 50.000 0.00 0.00 38.14 5.69
294 295 0.451783 ACGAAATGCTCAAATCCCGC 59.548 50.000 0.00 0.00 0.00 6.13
295 296 1.064060 GGACGAAATGCTCAAATCCCG 59.936 52.381 0.00 0.00 0.00 5.14
296 297 1.405463 GGGACGAAATGCTCAAATCCC 59.595 52.381 0.00 0.00 34.70 3.85
297 298 2.851805 GGGACGAAATGCTCAAATCC 57.148 50.000 0.00 0.00 0.00 3.01
312 313 1.069500 CCATGTCAAAACGTTCGGGAC 60.069 52.381 15.81 15.81 0.00 4.46
313 314 1.231221 CCATGTCAAAACGTTCGGGA 58.769 50.000 0.00 0.00 0.00 5.14
314 315 0.386731 GCCATGTCAAAACGTTCGGG 60.387 55.000 0.00 0.00 0.00 5.14
315 316 0.309302 TGCCATGTCAAAACGTTCGG 59.691 50.000 0.00 0.00 0.00 4.30
316 317 1.778591 GTTGCCATGTCAAAACGTTCG 59.221 47.619 0.00 0.00 0.00 3.95
317 318 3.078594 AGTTGCCATGTCAAAACGTTC 57.921 42.857 0.00 0.00 0.00 3.95
318 319 3.518634 AAGTTGCCATGTCAAAACGTT 57.481 38.095 0.00 0.00 0.00 3.99
319 320 3.518634 AAAGTTGCCATGTCAAAACGT 57.481 38.095 0.00 0.00 0.00 3.99
320 321 4.606961 ACTAAAGTTGCCATGTCAAAACG 58.393 39.130 0.00 0.00 0.00 3.60
321 322 5.173131 CGAACTAAAGTTGCCATGTCAAAAC 59.827 40.000 0.00 0.00 38.56 2.43
322 323 5.163602 ACGAACTAAAGTTGCCATGTCAAAA 60.164 36.000 0.00 0.00 38.56 2.44
323 324 4.336993 ACGAACTAAAGTTGCCATGTCAAA 59.663 37.500 0.00 0.00 38.56 2.69
324 325 3.880490 ACGAACTAAAGTTGCCATGTCAA 59.120 39.130 0.00 0.00 38.56 3.18
325 326 3.472652 ACGAACTAAAGTTGCCATGTCA 58.527 40.909 0.00 0.00 38.56 3.58
326 327 4.092968 CCTACGAACTAAAGTTGCCATGTC 59.907 45.833 0.00 0.00 38.56 3.06
327 328 4.000988 CCTACGAACTAAAGTTGCCATGT 58.999 43.478 0.00 0.00 38.56 3.21
328 329 4.250464 TCCTACGAACTAAAGTTGCCATG 58.750 43.478 0.00 0.00 38.56 3.66
329 330 4.222145 TCTCCTACGAACTAAAGTTGCCAT 59.778 41.667 0.00 0.00 38.56 4.40
330 331 3.575256 TCTCCTACGAACTAAAGTTGCCA 59.425 43.478 0.00 0.00 38.56 4.92
331 332 4.184079 TCTCCTACGAACTAAAGTTGCC 57.816 45.455 0.00 0.00 38.56 4.52
332 333 4.567159 CCATCTCCTACGAACTAAAGTTGC 59.433 45.833 0.00 0.00 38.56 4.17
333 334 4.567159 GCCATCTCCTACGAACTAAAGTTG 59.433 45.833 0.00 0.00 38.56 3.16
334 335 4.222145 TGCCATCTCCTACGAACTAAAGTT 59.778 41.667 0.00 0.00 41.64 2.66
335 336 3.767673 TGCCATCTCCTACGAACTAAAGT 59.232 43.478 0.00 0.00 0.00 2.66
336 337 4.386867 TGCCATCTCCTACGAACTAAAG 57.613 45.455 0.00 0.00 0.00 1.85
337 338 4.222145 AGTTGCCATCTCCTACGAACTAAA 59.778 41.667 0.00 0.00 0.00 1.85
338 339 3.767673 AGTTGCCATCTCCTACGAACTAA 59.232 43.478 0.00 0.00 0.00 2.24
339 340 3.362706 AGTTGCCATCTCCTACGAACTA 58.637 45.455 0.00 0.00 0.00 2.24
340 341 2.180276 AGTTGCCATCTCCTACGAACT 58.820 47.619 0.00 0.00 0.00 3.01
341 342 2.674796 AGTTGCCATCTCCTACGAAC 57.325 50.000 0.00 0.00 0.00 3.95
342 343 3.695830 AAAGTTGCCATCTCCTACGAA 57.304 42.857 0.00 0.00 0.00 3.85
343 344 3.767673 ACTAAAGTTGCCATCTCCTACGA 59.232 43.478 0.00 0.00 0.00 3.43
344 345 4.124851 ACTAAAGTTGCCATCTCCTACG 57.875 45.455 0.00 0.00 0.00 3.51
357 358 5.201243 GCCATCCCCTTATCAACTAAAGTT 58.799 41.667 0.00 0.00 39.12 2.66
358 359 4.229582 TGCCATCCCCTTATCAACTAAAGT 59.770 41.667 0.00 0.00 0.00 2.66
359 360 4.792068 TGCCATCCCCTTATCAACTAAAG 58.208 43.478 0.00 0.00 0.00 1.85
360 361 4.871871 TGCCATCCCCTTATCAACTAAA 57.128 40.909 0.00 0.00 0.00 1.85
361 362 4.229582 AGTTGCCATCCCCTTATCAACTAA 59.770 41.667 3.91 0.00 41.31 2.24
362 363 3.785887 AGTTGCCATCCCCTTATCAACTA 59.214 43.478 3.91 0.00 41.31 2.24
363 364 2.582636 AGTTGCCATCCCCTTATCAACT 59.417 45.455 0.00 0.00 39.19 3.16
364 365 3.018423 AGTTGCCATCCCCTTATCAAC 57.982 47.619 0.00 0.00 35.39 3.18
365 366 3.756082 AAGTTGCCATCCCCTTATCAA 57.244 42.857 0.00 0.00 0.00 2.57
366 367 3.245586 ACAAAGTTGCCATCCCCTTATCA 60.246 43.478 0.00 0.00 0.00 2.15
367 368 3.365472 ACAAAGTTGCCATCCCCTTATC 58.635 45.455 0.00 0.00 0.00 1.75
368 369 3.365472 GACAAAGTTGCCATCCCCTTAT 58.635 45.455 0.00 0.00 0.00 1.73
369 370 2.556559 GGACAAAGTTGCCATCCCCTTA 60.557 50.000 0.00 0.00 0.00 2.69
370 371 1.632589 GACAAAGTTGCCATCCCCTT 58.367 50.000 0.00 0.00 0.00 3.95
371 372 0.251787 GGACAAAGTTGCCATCCCCT 60.252 55.000 0.00 0.00 0.00 4.79
372 373 0.251787 AGGACAAAGTTGCCATCCCC 60.252 55.000 7.09 0.00 0.00 4.81
373 374 1.632589 AAGGACAAAGTTGCCATCCC 58.367 50.000 7.09 0.00 0.00 3.85
374 375 3.751479 AAAAGGACAAAGTTGCCATCC 57.249 42.857 7.09 0.71 0.00 3.51
375 376 3.735746 CGAAAAAGGACAAAGTTGCCATC 59.264 43.478 7.09 0.00 0.00 3.51
376 377 3.132111 ACGAAAAAGGACAAAGTTGCCAT 59.868 39.130 0.00 0.00 0.00 4.40
377 378 2.494073 ACGAAAAAGGACAAAGTTGCCA 59.506 40.909 0.00 0.00 0.00 4.92
378 379 3.159353 ACGAAAAAGGACAAAGTTGCC 57.841 42.857 0.00 0.00 0.00 4.52
379 380 5.524511 AAAACGAAAAAGGACAAAGTTGC 57.475 34.783 0.00 0.00 0.00 4.17
401 402 9.487790 GGGAAACATGACAATTTTCTGATAAAA 57.512 29.630 0.00 0.00 31.21 1.52
402 403 8.869109 AGGGAAACATGACAATTTTCTGATAAA 58.131 29.630 0.00 0.00 31.21 1.40
403 404 8.421249 AGGGAAACATGACAATTTTCTGATAA 57.579 30.769 0.00 0.00 31.21 1.75
404 405 9.527157 TTAGGGAAACATGACAATTTTCTGATA 57.473 29.630 0.00 0.00 31.21 2.15
405 406 6.923199 AGGGAAACATGACAATTTTCTGAT 57.077 33.333 0.00 0.00 31.21 2.90
406 407 7.831691 TTAGGGAAACATGACAATTTTCTGA 57.168 32.000 0.00 0.00 31.21 3.27
407 408 8.526147 AGATTAGGGAAACATGACAATTTTCTG 58.474 33.333 0.00 0.00 31.21 3.02
408 409 8.655935 AGATTAGGGAAACATGACAATTTTCT 57.344 30.769 0.00 0.00 31.21 2.52
409 410 8.522830 TGAGATTAGGGAAACATGACAATTTTC 58.477 33.333 0.00 0.00 0.00 2.29
410 411 8.306761 GTGAGATTAGGGAAACATGACAATTTT 58.693 33.333 0.00 0.00 0.00 1.82
411 412 7.362056 CGTGAGATTAGGGAAACATGACAATTT 60.362 37.037 0.00 0.00 0.00 1.82
412 413 6.094048 CGTGAGATTAGGGAAACATGACAATT 59.906 38.462 0.00 0.00 0.00 2.32
413 414 5.586243 CGTGAGATTAGGGAAACATGACAAT 59.414 40.000 0.00 0.00 0.00 2.71
414 415 4.935205 CGTGAGATTAGGGAAACATGACAA 59.065 41.667 0.00 0.00 0.00 3.18
415 416 4.503910 CGTGAGATTAGGGAAACATGACA 58.496 43.478 0.00 0.00 0.00 3.58
416 417 3.309954 GCGTGAGATTAGGGAAACATGAC 59.690 47.826 0.00 0.00 0.00 3.06
417 418 3.055458 TGCGTGAGATTAGGGAAACATGA 60.055 43.478 0.00 0.00 0.00 3.07
418 419 3.270027 TGCGTGAGATTAGGGAAACATG 58.730 45.455 0.00 0.00 0.00 3.21
419 420 3.627395 TGCGTGAGATTAGGGAAACAT 57.373 42.857 0.00 0.00 0.00 2.71
420 421 3.410631 TTGCGTGAGATTAGGGAAACA 57.589 42.857 0.00 0.00 0.00 2.83
421 422 4.759516 TTTTGCGTGAGATTAGGGAAAC 57.240 40.909 0.00 0.00 0.00 2.78
422 423 7.175990 ACTTTATTTTGCGTGAGATTAGGGAAA 59.824 33.333 0.00 0.00 0.00 3.13
423 424 6.657541 ACTTTATTTTGCGTGAGATTAGGGAA 59.342 34.615 0.00 0.00 0.00 3.97
424 425 6.177610 ACTTTATTTTGCGTGAGATTAGGGA 58.822 36.000 0.00 0.00 0.00 4.20
425 426 6.436843 ACTTTATTTTGCGTGAGATTAGGG 57.563 37.500 0.00 0.00 0.00 3.53
426 427 7.305474 ACAACTTTATTTTGCGTGAGATTAGG 58.695 34.615 0.00 0.00 0.00 2.69
427 428 7.214449 CGACAACTTTATTTTGCGTGAGATTAG 59.786 37.037 0.00 0.00 0.00 1.73
428 429 7.012943 CGACAACTTTATTTTGCGTGAGATTA 58.987 34.615 0.00 0.00 0.00 1.75
429 430 5.851177 CGACAACTTTATTTTGCGTGAGATT 59.149 36.000 0.00 0.00 0.00 2.40
430 431 5.049680 ACGACAACTTTATTTTGCGTGAGAT 60.050 36.000 0.00 0.00 36.25 2.75
431 432 4.271533 ACGACAACTTTATTTTGCGTGAGA 59.728 37.500 0.00 0.00 36.25 3.27
432 433 4.523813 ACGACAACTTTATTTTGCGTGAG 58.476 39.130 0.00 0.00 36.25 3.51
433 434 4.271533 AGACGACAACTTTATTTTGCGTGA 59.728 37.500 0.00 0.00 37.07 4.35
434 435 4.523813 AGACGACAACTTTATTTTGCGTG 58.476 39.130 0.00 0.00 37.07 5.34
435 436 4.806342 AGACGACAACTTTATTTTGCGT 57.194 36.364 0.00 0.00 38.50 5.24
436 437 7.597643 TTTTAGACGACAACTTTATTTTGCG 57.402 32.000 0.00 0.00 32.99 4.85
437 438 7.490868 GCTTTTAGACGACAACTTTATTTTGC 58.509 34.615 0.00 0.00 0.00 3.68
438 439 7.375017 ACGCTTTTAGACGACAACTTTATTTTG 59.625 33.333 0.00 0.00 0.00 2.44
439 440 7.412063 ACGCTTTTAGACGACAACTTTATTTT 58.588 30.769 0.00 0.00 0.00 1.82
440 441 6.951643 ACGCTTTTAGACGACAACTTTATTT 58.048 32.000 0.00 0.00 0.00 1.40
441 442 6.535274 ACGCTTTTAGACGACAACTTTATT 57.465 33.333 0.00 0.00 0.00 1.40
442 443 6.535274 AACGCTTTTAGACGACAACTTTAT 57.465 33.333 0.00 0.00 0.00 1.40
443 444 5.331756 CGAACGCTTTTAGACGACAACTTTA 60.332 40.000 0.00 0.00 0.00 1.85
444 445 4.549489 CGAACGCTTTTAGACGACAACTTT 60.549 41.667 0.00 0.00 0.00 2.66
445 446 3.060740 CGAACGCTTTTAGACGACAACTT 60.061 43.478 0.00 0.00 0.00 2.66
446 447 2.470257 CGAACGCTTTTAGACGACAACT 59.530 45.455 0.00 0.00 0.00 3.16
447 448 2.409371 CCGAACGCTTTTAGACGACAAC 60.409 50.000 0.00 0.00 0.00 3.32
448 449 1.788308 CCGAACGCTTTTAGACGACAA 59.212 47.619 0.00 0.00 0.00 3.18
449 450 1.411394 CCGAACGCTTTTAGACGACA 58.589 50.000 0.00 0.00 0.00 4.35
450 451 0.712222 CCCGAACGCTTTTAGACGAC 59.288 55.000 0.00 0.00 0.00 4.34
451 452 0.314935 ACCCGAACGCTTTTAGACGA 59.685 50.000 0.00 0.00 0.00 4.20
452 453 1.136446 CAACCCGAACGCTTTTAGACG 60.136 52.381 0.00 0.00 0.00 4.18
453 454 1.399343 GCAACCCGAACGCTTTTAGAC 60.399 52.381 0.00 0.00 0.00 2.59
454 455 0.869730 GCAACCCGAACGCTTTTAGA 59.130 50.000 0.00 0.00 0.00 2.10
455 456 0.109919 GGCAACCCGAACGCTTTTAG 60.110 55.000 0.00 0.00 0.00 1.85
456 457 0.818445 TGGCAACCCGAACGCTTTTA 60.818 50.000 0.00 0.00 0.00 1.52
457 458 1.460273 ATGGCAACCCGAACGCTTTT 61.460 50.000 0.00 0.00 0.00 2.27
458 459 1.901464 ATGGCAACCCGAACGCTTT 60.901 52.632 0.00 0.00 0.00 3.51
459 460 2.282180 ATGGCAACCCGAACGCTT 60.282 55.556 0.00 0.00 0.00 4.68
460 461 3.055719 CATGGCAACCCGAACGCT 61.056 61.111 0.00 0.00 0.00 5.07
461 462 4.776647 GCATGGCAACCCGAACGC 62.777 66.667 0.00 0.00 0.00 4.84
462 463 1.302383 TAAGCATGGCAACCCGAACG 61.302 55.000 0.00 0.00 0.00 3.95
463 464 0.885196 TTAAGCATGGCAACCCGAAC 59.115 50.000 0.00 0.00 0.00 3.95
464 465 1.621992 TTTAAGCATGGCAACCCGAA 58.378 45.000 0.00 0.00 0.00 4.30
465 466 1.748493 GATTTAAGCATGGCAACCCGA 59.252 47.619 0.00 0.00 0.00 5.14
466 467 1.202405 GGATTTAAGCATGGCAACCCG 60.202 52.381 0.00 0.00 0.00 5.28
467 468 2.110578 AGGATTTAAGCATGGCAACCC 58.889 47.619 0.00 0.00 0.00 4.11
468 469 2.760092 TCAGGATTTAAGCATGGCAACC 59.240 45.455 0.00 0.00 0.00 3.77
469 470 4.176271 GTTCAGGATTTAAGCATGGCAAC 58.824 43.478 0.00 0.00 0.00 4.17
470 471 3.119531 CGTTCAGGATTTAAGCATGGCAA 60.120 43.478 0.00 0.00 0.00 4.52
471 472 2.423185 CGTTCAGGATTTAAGCATGGCA 59.577 45.455 0.00 0.00 0.00 4.92
472 473 2.423538 ACGTTCAGGATTTAAGCATGGC 59.576 45.455 0.00 0.00 0.00 4.40
473 474 4.662145 GAACGTTCAGGATTTAAGCATGG 58.338 43.478 23.12 0.00 0.00 3.66
474 475 4.334443 CGAACGTTCAGGATTTAAGCATG 58.666 43.478 26.71 2.64 0.00 4.06
475 476 3.374058 CCGAACGTTCAGGATTTAAGCAT 59.626 43.478 26.71 0.00 0.00 3.79
476 477 2.739913 CCGAACGTTCAGGATTTAAGCA 59.260 45.455 26.71 0.00 0.00 3.91
477 478 2.095372 CCCGAACGTTCAGGATTTAAGC 59.905 50.000 28.81 3.54 0.00 3.09
478 479 3.592059 TCCCGAACGTTCAGGATTTAAG 58.408 45.455 25.93 14.02 29.02 1.85
479 480 3.007182 ACTCCCGAACGTTCAGGATTTAA 59.993 43.478 28.81 10.54 33.52 1.52
480 481 2.564062 ACTCCCGAACGTTCAGGATTTA 59.436 45.455 28.81 10.88 33.52 1.40
481 482 1.346722 ACTCCCGAACGTTCAGGATTT 59.653 47.619 28.81 18.14 33.52 2.17
482 483 0.974383 ACTCCCGAACGTTCAGGATT 59.026 50.000 28.81 22.19 33.52 3.01
483 484 0.974383 AACTCCCGAACGTTCAGGAT 59.026 50.000 28.81 15.67 33.52 3.24
484 485 1.619654 TAACTCCCGAACGTTCAGGA 58.380 50.000 27.33 27.33 32.98 3.86
485 486 2.094390 TGATAACTCCCGAACGTTCAGG 60.094 50.000 26.71 24.49 0.00 3.86
486 487 3.226346 TGATAACTCCCGAACGTTCAG 57.774 47.619 26.71 18.68 0.00 3.02
487 488 3.880047 ATGATAACTCCCGAACGTTCA 57.120 42.857 26.71 7.82 0.00 3.18
488 489 4.505556 GGTAATGATAACTCCCGAACGTTC 59.494 45.833 18.47 18.47 0.00 3.95
489 490 4.436332 GGTAATGATAACTCCCGAACGTT 58.564 43.478 0.00 0.00 0.00 3.99
490 491 3.489738 CGGTAATGATAACTCCCGAACGT 60.490 47.826 0.00 0.00 37.66 3.99
491 492 3.047796 CGGTAATGATAACTCCCGAACG 58.952 50.000 0.00 0.00 37.66 3.95
492 493 2.798847 GCGGTAATGATAACTCCCGAAC 59.201 50.000 0.00 0.00 37.66 3.95
493 494 2.696707 AGCGGTAATGATAACTCCCGAA 59.303 45.455 0.00 0.00 37.66 4.30
494 495 2.313317 AGCGGTAATGATAACTCCCGA 58.687 47.619 0.00 0.00 37.66 5.14
495 496 2.814280 AGCGGTAATGATAACTCCCG 57.186 50.000 0.00 0.00 38.45 5.14
496 497 9.477484 CATAATATAGCGGTAATGATAACTCCC 57.523 37.037 0.00 0.00 0.00 4.30
497 498 9.477484 CCATAATATAGCGGTAATGATAACTCC 57.523 37.037 0.00 0.00 0.00 3.85
499 500 9.817809 CACCATAATATAGCGGTAATGATAACT 57.182 33.333 0.00 0.00 0.00 2.24
500 501 8.548721 GCACCATAATATAGCGGTAATGATAAC 58.451 37.037 0.00 0.00 0.00 1.89
501 502 7.713507 GGCACCATAATATAGCGGTAATGATAA 59.286 37.037 0.00 0.00 0.00 1.75
502 503 7.070696 AGGCACCATAATATAGCGGTAATGATA 59.929 37.037 0.00 0.00 0.00 2.15
503 504 6.055588 GGCACCATAATATAGCGGTAATGAT 58.944 40.000 0.00 0.00 0.00 2.45
504 505 5.188948 AGGCACCATAATATAGCGGTAATGA 59.811 40.000 0.00 0.00 0.00 2.57
505 506 5.428253 AGGCACCATAATATAGCGGTAATG 58.572 41.667 0.00 0.00 0.00 1.90
506 507 5.693769 AGGCACCATAATATAGCGGTAAT 57.306 39.130 0.00 0.00 0.00 1.89
507 508 5.492855 AAGGCACCATAATATAGCGGTAA 57.507 39.130 0.00 0.00 0.00 2.85
508 509 6.801718 ATAAGGCACCATAATATAGCGGTA 57.198 37.500 0.00 0.00 0.00 4.02
509 510 5.693769 ATAAGGCACCATAATATAGCGGT 57.306 39.130 0.00 0.00 0.00 5.68
510 511 7.012044 GGTTTATAAGGCACCATAATATAGCGG 59.988 40.741 0.71 0.00 0.00 5.52
511 512 7.551262 TGGTTTATAAGGCACCATAATATAGCG 59.449 37.037 3.78 0.00 35.57 4.26
512 513 8.801882 TGGTTTATAAGGCACCATAATATAGC 57.198 34.615 3.78 0.00 35.57 2.97
517 518 9.520515 CTTATCTGGTTTATAAGGCACCATAAT 57.479 33.333 7.76 7.59 39.89 1.28
518 519 8.719596 TCTTATCTGGTTTATAAGGCACCATAA 58.280 33.333 7.76 4.97 39.89 1.90
519 520 8.270137 TCTTATCTGGTTTATAAGGCACCATA 57.730 34.615 7.76 2.53 39.89 2.74
520 521 7.149202 TCTTATCTGGTTTATAAGGCACCAT 57.851 36.000 7.76 0.00 39.89 3.55
521 522 6.409234 CCTCTTATCTGGTTTATAAGGCACCA 60.409 42.308 7.20 7.20 37.47 4.17
522 523 5.998363 CCTCTTATCTGGTTTATAAGGCACC 59.002 44.000 0.00 0.00 37.47 5.01
523 524 5.998363 CCCTCTTATCTGGTTTATAAGGCAC 59.002 44.000 0.00 0.00 37.47 5.01
524 525 5.073144 CCCCTCTTATCTGGTTTATAAGGCA 59.927 44.000 0.00 0.00 37.47 4.75
525 526 5.561679 CCCCTCTTATCTGGTTTATAAGGC 58.438 45.833 0.00 0.00 37.47 4.35
526 527 5.515008 GGCCCCTCTTATCTGGTTTATAAGG 60.515 48.000 0.00 0.00 37.47 2.69
527 528 5.073144 TGGCCCCTCTTATCTGGTTTATAAG 59.927 44.000 0.00 0.00 37.98 1.73
528 529 4.979039 TGGCCCCTCTTATCTGGTTTATAA 59.021 41.667 0.00 0.00 0.00 0.98
529 530 4.572978 TGGCCCCTCTTATCTGGTTTATA 58.427 43.478 0.00 0.00 0.00 0.98
530 531 3.403322 TGGCCCCTCTTATCTGGTTTAT 58.597 45.455 0.00 0.00 0.00 1.40
531 532 2.853430 TGGCCCCTCTTATCTGGTTTA 58.147 47.619 0.00 0.00 0.00 2.01
532 533 1.681229 TGGCCCCTCTTATCTGGTTT 58.319 50.000 0.00 0.00 0.00 3.27
533 534 1.912862 ATGGCCCCTCTTATCTGGTT 58.087 50.000 0.00 0.00 0.00 3.67
534 535 1.912862 AATGGCCCCTCTTATCTGGT 58.087 50.000 0.00 0.00 0.00 4.00
535 536 3.319031 AAAATGGCCCCTCTTATCTGG 57.681 47.619 0.00 0.00 0.00 3.86
536 537 5.835280 ACAATAAAATGGCCCCTCTTATCTG 59.165 40.000 0.00 3.33 0.00 2.90
537 538 6.030727 ACAATAAAATGGCCCCTCTTATCT 57.969 37.500 0.00 0.00 0.00 1.98
538 539 7.175119 GTCTACAATAAAATGGCCCCTCTTATC 59.825 40.741 0.00 0.00 0.00 1.75
539 540 7.004691 GTCTACAATAAAATGGCCCCTCTTAT 58.995 38.462 0.00 0.00 0.00 1.73
540 541 6.362248 GTCTACAATAAAATGGCCCCTCTTA 58.638 40.000 0.00 0.00 0.00 2.10
541 542 5.201243 GTCTACAATAAAATGGCCCCTCTT 58.799 41.667 0.00 0.00 0.00 2.85
542 543 4.686122 CGTCTACAATAAAATGGCCCCTCT 60.686 45.833 0.00 0.00 0.00 3.69
543 544 3.564225 CGTCTACAATAAAATGGCCCCTC 59.436 47.826 0.00 0.00 0.00 4.30
544 545 3.201266 TCGTCTACAATAAAATGGCCCCT 59.799 43.478 0.00 0.00 0.00 4.79
545 546 3.547746 TCGTCTACAATAAAATGGCCCC 58.452 45.455 0.00 0.00 0.00 5.80
546 547 5.063880 AGATCGTCTACAATAAAATGGCCC 58.936 41.667 0.00 0.00 0.00 5.80
547 548 5.992217 AGAGATCGTCTACAATAAAATGGCC 59.008 40.000 0.00 0.00 31.71 5.36
548 549 6.926272 AGAGAGATCGTCTACAATAAAATGGC 59.074 38.462 0.00 0.00 34.71 4.40
549 550 8.879342 AAGAGAGATCGTCTACAATAAAATGG 57.121 34.615 1.49 0.00 34.71 3.16
578 579 8.402472 CGTTATATTTGGAGAAAATGTAGGCAA 58.598 33.333 0.00 0.00 38.93 4.52
579 580 7.554835 ACGTTATATTTGGAGAAAATGTAGGCA 59.445 33.333 0.00 0.00 38.93 4.75
580 581 7.927048 ACGTTATATTTGGAGAAAATGTAGGC 58.073 34.615 0.00 0.00 38.93 3.93
581 582 8.273557 CGACGTTATATTTGGAGAAAATGTAGG 58.726 37.037 0.00 0.00 38.93 3.18
582 583 7.792508 GCGACGTTATATTTGGAGAAAATGTAG 59.207 37.037 0.00 0.00 38.93 2.74
583 584 7.278203 TGCGACGTTATATTTGGAGAAAATGTA 59.722 33.333 0.00 0.00 38.93 2.29
584 585 6.092944 TGCGACGTTATATTTGGAGAAAATGT 59.907 34.615 0.00 0.00 38.93 2.71
585 586 6.482835 TGCGACGTTATATTTGGAGAAAATG 58.517 36.000 0.00 0.00 38.93 2.32
586 587 6.671614 TGCGACGTTATATTTGGAGAAAAT 57.328 33.333 0.00 0.00 41.47 1.82
587 588 6.671614 ATGCGACGTTATATTTGGAGAAAA 57.328 33.333 0.00 0.00 0.00 2.29
588 589 7.956420 ATATGCGACGTTATATTTGGAGAAA 57.044 32.000 0.00 0.00 0.00 2.52
589 590 7.956420 AATATGCGACGTTATATTTGGAGAA 57.044 32.000 11.30 0.00 0.00 2.87
590 591 9.478768 TTTAATATGCGACGTTATATTTGGAGA 57.521 29.630 18.08 4.62 33.06 3.71
598 599 9.142515 CCACCTATTTTAATATGCGACGTTATA 57.857 33.333 0.00 0.00 0.00 0.98
599 600 7.874016 TCCACCTATTTTAATATGCGACGTTAT 59.126 33.333 0.00 0.00 0.00 1.89
600 601 7.208777 TCCACCTATTTTAATATGCGACGTTA 58.791 34.615 0.00 0.00 0.00 3.18
601 602 6.050432 TCCACCTATTTTAATATGCGACGTT 58.950 36.000 0.00 0.00 0.00 3.99
602 603 5.603596 TCCACCTATTTTAATATGCGACGT 58.396 37.500 0.00 0.00 0.00 4.34
603 604 6.347402 CCTTCCACCTATTTTAATATGCGACG 60.347 42.308 0.00 0.00 0.00 5.12
604 605 6.567891 GCCTTCCACCTATTTTAATATGCGAC 60.568 42.308 0.00 0.00 0.00 5.19
605 606 5.472137 GCCTTCCACCTATTTTAATATGCGA 59.528 40.000 0.00 0.00 0.00 5.10
606 607 5.240623 TGCCTTCCACCTATTTTAATATGCG 59.759 40.000 0.00 0.00 0.00 4.73
607 608 6.648879 TGCCTTCCACCTATTTTAATATGC 57.351 37.500 0.00 0.00 0.00 3.14
608 609 8.237811 AGTTGCCTTCCACCTATTTTAATATG 57.762 34.615 0.00 0.00 0.00 1.78
609 610 9.574516 CTAGTTGCCTTCCACCTATTTTAATAT 57.425 33.333 0.00 0.00 0.00 1.28
610 611 7.996644 CCTAGTTGCCTTCCACCTATTTTAATA 59.003 37.037 0.00 0.00 0.00 0.98
611 612 6.833933 CCTAGTTGCCTTCCACCTATTTTAAT 59.166 38.462 0.00 0.00 0.00 1.40
612 613 6.012333 TCCTAGTTGCCTTCCACCTATTTTAA 60.012 38.462 0.00 0.00 0.00 1.52
613 614 5.489637 TCCTAGTTGCCTTCCACCTATTTTA 59.510 40.000 0.00 0.00 0.00 1.52
614 615 4.291249 TCCTAGTTGCCTTCCACCTATTTT 59.709 41.667 0.00 0.00 0.00 1.82
615 616 3.850173 TCCTAGTTGCCTTCCACCTATTT 59.150 43.478 0.00 0.00 0.00 1.40
616 617 3.200165 GTCCTAGTTGCCTTCCACCTATT 59.800 47.826 0.00 0.00 0.00 1.73
617 618 2.772515 GTCCTAGTTGCCTTCCACCTAT 59.227 50.000 0.00 0.00 0.00 2.57
618 619 2.185387 GTCCTAGTTGCCTTCCACCTA 58.815 52.381 0.00 0.00 0.00 3.08
619 620 0.984995 GTCCTAGTTGCCTTCCACCT 59.015 55.000 0.00 0.00 0.00 4.00
620 621 0.391263 CGTCCTAGTTGCCTTCCACC 60.391 60.000 0.00 0.00 0.00 4.61
621 622 0.606604 TCGTCCTAGTTGCCTTCCAC 59.393 55.000 0.00 0.00 0.00 4.02
622 623 1.344065 TTCGTCCTAGTTGCCTTCCA 58.656 50.000 0.00 0.00 0.00 3.53
623 624 2.467566 TTTCGTCCTAGTTGCCTTCC 57.532 50.000 0.00 0.00 0.00 3.46
624 625 3.335579 ACATTTCGTCCTAGTTGCCTTC 58.664 45.455 0.00 0.00 0.00 3.46
625 626 3.244422 TGACATTTCGTCCTAGTTGCCTT 60.244 43.478 0.00 0.00 44.71 4.35
626 627 2.301870 TGACATTTCGTCCTAGTTGCCT 59.698 45.455 0.00 0.00 44.71 4.75
627 628 2.695359 TGACATTTCGTCCTAGTTGCC 58.305 47.619 0.00 0.00 44.71 4.52
628 629 3.120304 GGTTGACATTTCGTCCTAGTTGC 60.120 47.826 0.00 0.00 44.71 4.17
629 630 4.062293 TGGTTGACATTTCGTCCTAGTTG 58.938 43.478 0.00 0.00 44.71 3.16
630 631 4.202326 ACTGGTTGACATTTCGTCCTAGTT 60.202 41.667 0.00 0.00 44.71 2.24
631 632 3.323979 ACTGGTTGACATTTCGTCCTAGT 59.676 43.478 0.00 0.00 44.71 2.57
632 633 3.926616 ACTGGTTGACATTTCGTCCTAG 58.073 45.455 0.00 0.00 44.71 3.02
637 638 3.326747 GCTCTACTGGTTGACATTTCGT 58.673 45.455 0.00 0.00 0.00 3.85
646 647 0.666274 TTCGTGCGCTCTACTGGTTG 60.666 55.000 9.73 0.00 0.00 3.77
666 667 3.127203 TCCGTAATGCCATTACCGTTTTG 59.873 43.478 19.23 6.49 41.55 2.44
695 696 6.013293 GCCTTGTATAAGATAATGGAGGGAGT 60.013 42.308 0.00 0.00 35.92 3.85
696 697 6.410540 GCCTTGTATAAGATAATGGAGGGAG 58.589 44.000 0.00 0.00 35.92 4.30
697 698 5.250774 GGCCTTGTATAAGATAATGGAGGGA 59.749 44.000 0.00 0.00 35.92 4.20
698 699 5.014123 TGGCCTTGTATAAGATAATGGAGGG 59.986 44.000 3.32 0.00 35.92 4.30
699 700 5.940470 GTGGCCTTGTATAAGATAATGGAGG 59.060 44.000 3.32 0.00 35.92 4.30
700 701 6.533730 TGTGGCCTTGTATAAGATAATGGAG 58.466 40.000 3.32 0.00 35.92 3.86
701 702 6.508030 TGTGGCCTTGTATAAGATAATGGA 57.492 37.500 3.32 0.00 35.92 3.41
702 703 7.285401 AGTTTGTGGCCTTGTATAAGATAATGG 59.715 37.037 3.32 0.00 35.92 3.16
703 704 8.225603 AGTTTGTGGCCTTGTATAAGATAATG 57.774 34.615 3.32 0.00 35.92 1.90
704 705 8.052748 TGAGTTTGTGGCCTTGTATAAGATAAT 58.947 33.333 3.32 0.00 35.92 1.28
705 706 7.398829 TGAGTTTGTGGCCTTGTATAAGATAA 58.601 34.615 3.32 0.00 35.92 1.75
706 707 6.953101 TGAGTTTGTGGCCTTGTATAAGATA 58.047 36.000 3.32 0.00 35.92 1.98
707 708 5.815581 TGAGTTTGTGGCCTTGTATAAGAT 58.184 37.500 3.32 0.00 35.92 2.40
708 709 5.235850 TGAGTTTGTGGCCTTGTATAAGA 57.764 39.130 3.32 0.00 35.92 2.10
709 710 5.957842 TTGAGTTTGTGGCCTTGTATAAG 57.042 39.130 3.32 0.00 0.00 1.73
710 711 6.909550 ATTTGAGTTTGTGGCCTTGTATAA 57.090 33.333 3.32 0.00 0.00 0.98
711 712 6.909550 AATTTGAGTTTGTGGCCTTGTATA 57.090 33.333 3.32 0.00 0.00 1.47
712 713 5.806654 AATTTGAGTTTGTGGCCTTGTAT 57.193 34.783 3.32 0.00 0.00 2.29
713 714 5.594725 TGTAATTTGAGTTTGTGGCCTTGTA 59.405 36.000 3.32 0.00 0.00 2.41
714 715 4.404073 TGTAATTTGAGTTTGTGGCCTTGT 59.596 37.500 3.32 0.00 0.00 3.16
715 716 4.942852 TGTAATTTGAGTTTGTGGCCTTG 58.057 39.130 3.32 0.00 0.00 3.61
716 717 4.039124 CCTGTAATTTGAGTTTGTGGCCTT 59.961 41.667 3.32 0.00 0.00 4.35
717 718 3.573967 CCTGTAATTTGAGTTTGTGGCCT 59.426 43.478 3.32 0.00 0.00 5.19
718 719 3.320826 ACCTGTAATTTGAGTTTGTGGCC 59.679 43.478 0.00 0.00 0.00 5.36
719 720 4.584327 ACCTGTAATTTGAGTTTGTGGC 57.416 40.909 0.00 0.00 0.00 5.01
720 721 7.687941 AGATACCTGTAATTTGAGTTTGTGG 57.312 36.000 0.00 0.00 0.00 4.17
721 722 8.883731 CCTAGATACCTGTAATTTGAGTTTGTG 58.116 37.037 0.00 0.00 0.00 3.33
722 723 8.603304 ACCTAGATACCTGTAATTTGAGTTTGT 58.397 33.333 0.00 0.00 0.00 2.83
749 750 8.646900 TGGCTTGGAAACTAGTCATTAAATTTT 58.353 29.630 0.00 0.00 42.80 1.82
750 751 8.189119 TGGCTTGGAAACTAGTCATTAAATTT 57.811 30.769 0.00 0.00 42.80 1.82
751 752 7.775053 TGGCTTGGAAACTAGTCATTAAATT 57.225 32.000 0.00 0.00 42.80 1.82
752 753 7.451566 AGTTGGCTTGGAAACTAGTCATTAAAT 59.548 33.333 0.00 0.00 46.74 1.40
753 754 6.775629 AGTTGGCTTGGAAACTAGTCATTAAA 59.224 34.615 0.00 0.00 46.74 1.52
754 755 6.303839 AGTTGGCTTGGAAACTAGTCATTAA 58.696 36.000 0.00 0.00 46.74 1.40
755 756 5.876357 AGTTGGCTTGGAAACTAGTCATTA 58.124 37.500 0.00 0.00 46.74 1.90
756 757 4.729868 AGTTGGCTTGGAAACTAGTCATT 58.270 39.130 0.00 0.00 46.74 2.57
757 758 4.373156 AGTTGGCTTGGAAACTAGTCAT 57.627 40.909 0.00 0.00 46.74 3.06
758 759 3.857157 AGTTGGCTTGGAAACTAGTCA 57.143 42.857 0.00 0.00 45.91 3.41
759 760 5.299531 AGAAAAGTTGGCTTGGAAACTAGTC 59.700 40.000 0.00 0.00 38.34 2.59
760 761 5.201243 AGAAAAGTTGGCTTGGAAACTAGT 58.799 37.500 0.00 0.00 35.60 2.57
761 762 5.774498 AGAAAAGTTGGCTTGGAAACTAG 57.226 39.130 0.00 0.00 35.60 2.57
762 763 5.891551 AGAAGAAAAGTTGGCTTGGAAACTA 59.108 36.000 0.00 0.00 35.60 2.24
763 764 4.711846 AGAAGAAAAGTTGGCTTGGAAACT 59.288 37.500 0.00 0.00 38.25 2.66
764 765 5.011090 AGAAGAAAAGTTGGCTTGGAAAC 57.989 39.130 0.00 0.00 34.71 2.78
765 766 5.046663 ACAAGAAGAAAAGTTGGCTTGGAAA 60.047 36.000 0.00 0.00 37.60 3.13
766 767 4.466015 ACAAGAAGAAAAGTTGGCTTGGAA 59.534 37.500 0.00 0.00 37.60 3.53
767 768 4.023291 ACAAGAAGAAAAGTTGGCTTGGA 58.977 39.130 0.00 0.00 37.60 3.53
768 769 4.391405 ACAAGAAGAAAAGTTGGCTTGG 57.609 40.909 0.00 0.00 37.60 3.61
769 770 7.380602 CAGATAACAAGAAGAAAAGTTGGCTTG 59.619 37.037 0.00 0.00 38.81 4.01
770 771 7.428826 CAGATAACAAGAAGAAAAGTTGGCTT 58.571 34.615 0.00 0.00 36.30 4.35
771 772 6.015940 CCAGATAACAAGAAGAAAAGTTGGCT 60.016 38.462 0.00 0.00 0.00 4.75
772 773 6.152379 CCAGATAACAAGAAGAAAAGTTGGC 58.848 40.000 0.00 0.00 0.00 4.52
773 774 6.490040 TCCCAGATAACAAGAAGAAAAGTTGG 59.510 38.462 0.00 0.00 0.00 3.77
774 775 7.510549 TCCCAGATAACAAGAAGAAAAGTTG 57.489 36.000 0.00 0.00 0.00 3.16
775 776 7.944554 TGATCCCAGATAACAAGAAGAAAAGTT 59.055 33.333 0.00 0.00 0.00 2.66
776 777 7.461749 TGATCCCAGATAACAAGAAGAAAAGT 58.538 34.615 0.00 0.00 0.00 2.66
777 778 7.928307 TGATCCCAGATAACAAGAAGAAAAG 57.072 36.000 0.00 0.00 0.00 2.27
778 779 8.884124 AATGATCCCAGATAACAAGAAGAAAA 57.116 30.769 0.00 0.00 0.00 2.29
779 780 9.973661 TTAATGATCCCAGATAACAAGAAGAAA 57.026 29.630 0.00 0.00 0.00 2.52
783 784 9.489084 CGTATTAATGATCCCAGATAACAAGAA 57.511 33.333 0.00 0.00 0.00 2.52
784 785 7.602644 GCGTATTAATGATCCCAGATAACAAGA 59.397 37.037 0.00 0.00 0.00 3.02
785 786 7.604164 AGCGTATTAATGATCCCAGATAACAAG 59.396 37.037 0.00 0.00 0.00 3.16
786 787 7.450074 AGCGTATTAATGATCCCAGATAACAA 58.550 34.615 0.00 0.00 0.00 2.83
787 788 7.004555 AGCGTATTAATGATCCCAGATAACA 57.995 36.000 0.00 0.00 0.00 2.41
788 789 6.253727 CGAGCGTATTAATGATCCCAGATAAC 59.746 42.308 0.00 0.00 0.00 1.89
789 790 6.330278 CGAGCGTATTAATGATCCCAGATAA 58.670 40.000 0.00 0.00 0.00 1.75
790 791 5.678871 GCGAGCGTATTAATGATCCCAGATA 60.679 44.000 0.00 0.00 0.00 1.98
791 792 4.748892 CGAGCGTATTAATGATCCCAGAT 58.251 43.478 0.00 0.00 0.00 2.90
792 793 3.614150 GCGAGCGTATTAATGATCCCAGA 60.614 47.826 0.00 0.00 0.00 3.86
793 794 2.668457 GCGAGCGTATTAATGATCCCAG 59.332 50.000 0.00 0.00 0.00 4.45
794 795 2.036604 TGCGAGCGTATTAATGATCCCA 59.963 45.455 0.00 0.00 0.00 4.37
795 796 2.683968 TGCGAGCGTATTAATGATCCC 58.316 47.619 0.00 0.00 0.00 3.85
796 797 3.484229 GCATGCGAGCGTATTAATGATCC 60.484 47.826 0.00 0.00 0.00 3.36
797 798 3.123453 TGCATGCGAGCGTATTAATGATC 59.877 43.478 14.09 0.00 37.31 2.92
798 799 3.066380 TGCATGCGAGCGTATTAATGAT 58.934 40.909 14.09 0.00 37.31 2.45
799 800 2.478831 TGCATGCGAGCGTATTAATGA 58.521 42.857 14.09 0.00 37.31 2.57
800 801 2.947754 TGCATGCGAGCGTATTAATG 57.052 45.000 14.09 0.00 37.31 1.90
801 802 2.413239 GCATGCATGCGAGCGTATTAAT 60.413 45.455 33.99 0.00 44.67 1.40
802 803 1.069973 GCATGCATGCGAGCGTATTAA 60.070 47.619 33.99 0.00 44.67 1.40
803 804 0.512518 GCATGCATGCGAGCGTATTA 59.487 50.000 33.99 0.00 44.67 0.98
804 805 1.280746 GCATGCATGCGAGCGTATT 59.719 52.632 33.99 0.00 44.67 1.89
805 806 2.941333 GCATGCATGCGAGCGTAT 59.059 55.556 33.99 0.00 44.67 3.06
814 815 4.118093 TCATTTCTTCCTTGCATGCATG 57.882 40.909 23.37 23.21 0.00 4.06
815 816 4.811969 TTCATTTCTTCCTTGCATGCAT 57.188 36.364 23.37 0.00 0.00 3.96
816 817 4.603989 TTTCATTTCTTCCTTGCATGCA 57.396 36.364 18.46 18.46 0.00 3.96
817 818 4.390909 CCTTTTCATTTCTTCCTTGCATGC 59.609 41.667 11.82 11.82 0.00 4.06
818 819 5.786311 TCCTTTTCATTTCTTCCTTGCATG 58.214 37.500 0.00 0.00 0.00 4.06
819 820 6.042437 ACTTCCTTTTCATTTCTTCCTTGCAT 59.958 34.615 0.00 0.00 0.00 3.96
820 821 5.363580 ACTTCCTTTTCATTTCTTCCTTGCA 59.636 36.000 0.00 0.00 0.00 4.08
821 822 5.847304 ACTTCCTTTTCATTTCTTCCTTGC 58.153 37.500 0.00 0.00 0.00 4.01
822 823 7.087007 GCTACTTCCTTTTCATTTCTTCCTTG 58.913 38.462 0.00 0.00 0.00 3.61
823 824 6.777580 TGCTACTTCCTTTTCATTTCTTCCTT 59.222 34.615 0.00 0.00 0.00 3.36
824 825 6.207614 GTGCTACTTCCTTTTCATTTCTTCCT 59.792 38.462 0.00 0.00 0.00 3.36
825 826 6.016276 TGTGCTACTTCCTTTTCATTTCTTCC 60.016 38.462 0.00 0.00 0.00 3.46
826 827 6.970484 TGTGCTACTTCCTTTTCATTTCTTC 58.030 36.000 0.00 0.00 0.00 2.87
827 828 6.547510 ACTGTGCTACTTCCTTTTCATTTCTT 59.452 34.615 0.00 0.00 0.00 2.52
828 829 6.016777 CACTGTGCTACTTCCTTTTCATTTCT 60.017 38.462 0.00 0.00 0.00 2.52
829 830 6.145535 CACTGTGCTACTTCCTTTTCATTTC 58.854 40.000 0.00 0.00 0.00 2.17
830 831 5.594317 ACACTGTGCTACTTCCTTTTCATTT 59.406 36.000 7.90 0.00 0.00 2.32
831 832 5.133221 ACACTGTGCTACTTCCTTTTCATT 58.867 37.500 7.90 0.00 0.00 2.57
832 833 4.718961 ACACTGTGCTACTTCCTTTTCAT 58.281 39.130 7.90 0.00 0.00 2.57
833 834 4.127171 GACACTGTGCTACTTCCTTTTCA 58.873 43.478 7.90 0.00 0.00 2.69
834 835 4.127171 TGACACTGTGCTACTTCCTTTTC 58.873 43.478 7.90 0.00 0.00 2.29
835 836 4.150897 TGACACTGTGCTACTTCCTTTT 57.849 40.909 7.90 0.00 0.00 2.27
836 837 3.838244 TGACACTGTGCTACTTCCTTT 57.162 42.857 7.90 0.00 0.00 3.11
837 838 4.357918 AATGACACTGTGCTACTTCCTT 57.642 40.909 7.90 0.00 0.00 3.36
838 839 5.187772 TCATAATGACACTGTGCTACTTCCT 59.812 40.000 7.90 0.00 0.00 3.36
839 840 5.292101 GTCATAATGACACTGTGCTACTTCC 59.708 44.000 7.90 0.00 46.22 3.46
840 841 6.337853 GTCATAATGACACTGTGCTACTTC 57.662 41.667 7.90 0.00 46.22 3.01
848 849 8.064218 ACATGCATGTAGTCATAATGACACTGT 61.064 37.037 30.50 0.00 42.13 3.55
849 850 6.259387 ACATGCATGTAGTCATAATGACACTG 59.741 38.462 30.50 0.00 42.13 3.66
850 851 6.351711 ACATGCATGTAGTCATAATGACACT 58.648 36.000 30.50 0.00 42.13 3.55
851 852 6.609237 ACATGCATGTAGTCATAATGACAC 57.391 37.500 30.50 0.00 42.13 3.67
852 853 7.986889 ACTTACATGCATGTAGTCATAATGACA 59.013 33.333 32.09 16.51 44.34 3.58
853 854 8.370493 ACTTACATGCATGTAGTCATAATGAC 57.630 34.615 32.09 0.00 43.44 3.06
860 861 9.660180 TGTTTAATACTTACATGCATGTAGTCA 57.340 29.630 32.09 22.82 43.44 3.41
866 867 9.904647 GCAATTTGTTTAATACTTACATGCATG 57.095 29.630 25.09 25.09 0.00 4.06
867 868 9.874205 AGCAATTTGTTTAATACTTACATGCAT 57.126 25.926 0.00 0.00 0.00 3.96
876 877 9.865321 TCTCGTACTAGCAATTTGTTTAATACT 57.135 29.630 0.00 0.00 0.00 2.12
880 881 9.654417 GTTTTCTCGTACTAGCAATTTGTTTAA 57.346 29.630 0.00 0.00 0.00 1.52
881 882 8.828644 TGTTTTCTCGTACTAGCAATTTGTTTA 58.171 29.630 0.00 0.00 0.00 2.01
882 883 7.699566 TGTTTTCTCGTACTAGCAATTTGTTT 58.300 30.769 0.00 0.00 0.00 2.83
883 884 7.254227 TGTTTTCTCGTACTAGCAATTTGTT 57.746 32.000 0.00 0.00 0.00 2.83
884 885 6.854496 TGTTTTCTCGTACTAGCAATTTGT 57.146 33.333 0.00 0.00 0.00 2.83
885 886 7.518161 TGATGTTTTCTCGTACTAGCAATTTG 58.482 34.615 0.00 0.00 0.00 2.32
886 887 7.667043 TGATGTTTTCTCGTACTAGCAATTT 57.333 32.000 0.00 0.00 0.00 1.82
887 888 7.849804 ATGATGTTTTCTCGTACTAGCAATT 57.150 32.000 0.00 0.00 0.00 2.32
888 889 7.849804 AATGATGTTTTCTCGTACTAGCAAT 57.150 32.000 0.00 0.00 0.00 3.56
889 890 8.766000 TTAATGATGTTTTCTCGTACTAGCAA 57.234 30.769 0.00 0.00 0.00 3.91
890 891 8.766000 TTTAATGATGTTTTCTCGTACTAGCA 57.234 30.769 0.00 0.00 0.00 3.49
895 896 9.937577 GCAAAATTTAATGATGTTTTCTCGTAC 57.062 29.630 0.00 0.00 0.00 3.67
896 897 9.134734 GGCAAAATTTAATGATGTTTTCTCGTA 57.865 29.630 0.00 0.00 0.00 3.43
897 898 7.872483 AGGCAAAATTTAATGATGTTTTCTCGT 59.128 29.630 0.00 0.00 0.00 4.18
898 899 8.243289 AGGCAAAATTTAATGATGTTTTCTCG 57.757 30.769 0.00 0.00 0.00 4.04
899 900 8.375465 CGAGGCAAAATTTAATGATGTTTTCTC 58.625 33.333 0.00 0.00 0.00 2.87
900 901 7.331687 CCGAGGCAAAATTTAATGATGTTTTCT 59.668 33.333 0.00 0.00 0.00 2.52
901 902 7.117667 ACCGAGGCAAAATTTAATGATGTTTTC 59.882 33.333 0.00 0.00 0.00 2.29
902 903 6.934083 ACCGAGGCAAAATTTAATGATGTTTT 59.066 30.769 0.00 0.00 0.00 2.43
903 904 6.463360 ACCGAGGCAAAATTTAATGATGTTT 58.537 32.000 0.00 0.00 0.00 2.83
904 905 6.036577 ACCGAGGCAAAATTTAATGATGTT 57.963 33.333 0.00 0.00 0.00 2.71
905 906 5.659440 ACCGAGGCAAAATTTAATGATGT 57.341 34.783 0.00 0.00 0.00 3.06
906 907 7.220683 CACTAACCGAGGCAAAATTTAATGATG 59.779 37.037 0.00 0.00 0.00 3.07
907 908 7.093945 ACACTAACCGAGGCAAAATTTAATGAT 60.094 33.333 0.00 0.00 0.00 2.45
908 909 6.207810 ACACTAACCGAGGCAAAATTTAATGA 59.792 34.615 0.00 0.00 0.00 2.57
909 910 6.386654 ACACTAACCGAGGCAAAATTTAATG 58.613 36.000 0.00 0.00 0.00 1.90
910 911 6.584185 ACACTAACCGAGGCAAAATTTAAT 57.416 33.333 0.00 0.00 0.00 1.40
911 912 6.394025 AACACTAACCGAGGCAAAATTTAA 57.606 33.333 0.00 0.00 0.00 1.52
912 913 6.711645 ACTAACACTAACCGAGGCAAAATTTA 59.288 34.615 0.00 0.00 0.00 1.40
913 914 4.929819 AACACTAACCGAGGCAAAATTT 57.070 36.364 0.00 0.00 0.00 1.82
914 915 5.048991 CACTAACACTAACCGAGGCAAAATT 60.049 40.000 0.00 0.00 0.00 1.82
915 916 4.454504 CACTAACACTAACCGAGGCAAAAT 59.545 41.667 0.00 0.00 0.00 1.82
916 917 3.810941 CACTAACACTAACCGAGGCAAAA 59.189 43.478 0.00 0.00 0.00 2.44
917 918 3.395639 CACTAACACTAACCGAGGCAAA 58.604 45.455 0.00 0.00 0.00 3.68
918 919 2.289195 CCACTAACACTAACCGAGGCAA 60.289 50.000 0.00 0.00 0.00 4.52
919 920 1.274167 CCACTAACACTAACCGAGGCA 59.726 52.381 0.00 0.00 0.00 4.75
920 921 2.005560 GCCACTAACACTAACCGAGGC 61.006 57.143 0.00 0.00 0.00 4.70
921 922 1.405121 GGCCACTAACACTAACCGAGG 60.405 57.143 0.00 0.00 0.00 4.63
922 923 1.549170 AGGCCACTAACACTAACCGAG 59.451 52.381 5.01 0.00 0.00 4.63
923 924 1.636148 AGGCCACTAACACTAACCGA 58.364 50.000 5.01 0.00 0.00 4.69
924 925 2.073816 CAAGGCCACTAACACTAACCG 58.926 52.381 5.01 0.00 0.00 4.44
925 926 3.136009 ACAAGGCCACTAACACTAACC 57.864 47.619 5.01 0.00 0.00 2.85
926 927 9.257651 CTTATATACAAGGCCACTAACACTAAC 57.742 37.037 5.01 0.00 0.00 2.34
927 928 7.929785 GCTTATATACAAGGCCACTAACACTAA 59.070 37.037 5.01 0.00 0.00 2.24
928 929 7.070198 TGCTTATATACAAGGCCACTAACACTA 59.930 37.037 5.01 0.00 0.00 2.74
929 930 6.126883 TGCTTATATACAAGGCCACTAACACT 60.127 38.462 5.01 0.00 0.00 3.55
930 931 6.053005 TGCTTATATACAAGGCCACTAACAC 58.947 40.000 5.01 0.00 0.00 3.32
931 932 6.241882 TGCTTATATACAAGGCCACTAACA 57.758 37.500 5.01 0.00 0.00 2.41
932 933 7.562454 TTTGCTTATATACAAGGCCACTAAC 57.438 36.000 5.01 0.00 0.00 2.34
933 934 8.629158 CATTTTGCTTATATACAAGGCCACTAA 58.371 33.333 5.01 0.00 0.00 2.24
934 935 7.777910 ACATTTTGCTTATATACAAGGCCACTA 59.222 33.333 5.01 0.00 0.00 2.74
935 936 6.607198 ACATTTTGCTTATATACAAGGCCACT 59.393 34.615 5.01 0.00 0.00 4.00
936 937 6.805713 ACATTTTGCTTATATACAAGGCCAC 58.194 36.000 5.01 0.00 0.00 5.01
937 938 8.704849 ATACATTTTGCTTATATACAAGGCCA 57.295 30.769 5.01 0.00 0.00 5.36
938 939 9.981114 AAATACATTTTGCTTATATACAAGGCC 57.019 29.630 0.00 0.00 0.00 5.19
950 951 8.676401 GGCCATTATGAAAAATACATTTTGCTT 58.324 29.630 0.00 3.79 41.27 3.91
951 952 8.048514 AGGCCATTATGAAAAATACATTTTGCT 58.951 29.630 5.01 0.00 41.27 3.91
952 953 8.212317 AGGCCATTATGAAAAATACATTTTGC 57.788 30.769 5.01 0.03 41.27 3.68
953 954 9.991388 CAAGGCCATTATGAAAAATACATTTTG 57.009 29.630 5.01 0.00 41.27 2.44
954 955 9.737844 ACAAGGCCATTATGAAAAATACATTTT 57.262 25.926 5.01 0.00 43.85 1.82
957 958 9.985730 CATACAAGGCCATTATGAAAAATACAT 57.014 29.630 5.01 0.00 0.00 2.29
958 959 9.194972 TCATACAAGGCCATTATGAAAAATACA 57.805 29.630 15.14 0.00 30.88 2.29
959 960 9.683069 CTCATACAAGGCCATTATGAAAAATAC 57.317 33.333 17.13 0.00 33.00 1.89
960 961 8.859090 CCTCATACAAGGCCATTATGAAAAATA 58.141 33.333 17.13 1.03 33.00 1.40
961 962 7.202029 CCCTCATACAAGGCCATTATGAAAAAT 60.202 37.037 17.13 0.91 33.00 1.82
962 963 6.098124 CCCTCATACAAGGCCATTATGAAAAA 59.902 38.462 17.13 1.82 33.00 1.94
963 964 5.598005 CCCTCATACAAGGCCATTATGAAAA 59.402 40.000 17.13 2.09 33.00 2.29
964 965 5.103728 TCCCTCATACAAGGCCATTATGAAA 60.104 40.000 17.13 7.50 33.00 2.69
965 966 4.415179 TCCCTCATACAAGGCCATTATGAA 59.585 41.667 17.13 5.30 33.00 2.57
966 967 3.980022 TCCCTCATACAAGGCCATTATGA 59.020 43.478 5.01 12.63 34.88 2.15
967 968 4.371624 TCCCTCATACAAGGCCATTATG 57.628 45.455 5.01 8.70 34.88 1.90
968 969 5.327732 CATTCCCTCATACAAGGCCATTAT 58.672 41.667 5.01 0.00 34.88 1.28
969 970 4.447616 CCATTCCCTCATACAAGGCCATTA 60.448 45.833 5.01 0.00 34.88 1.90
970 971 3.569491 CATTCCCTCATACAAGGCCATT 58.431 45.455 5.01 0.00 34.88 3.16
971 972 2.158415 CCATTCCCTCATACAAGGCCAT 60.158 50.000 5.01 0.00 34.88 4.40
972 973 1.215173 CCATTCCCTCATACAAGGCCA 59.785 52.381 5.01 0.00 34.88 5.36
973 974 1.494721 TCCATTCCCTCATACAAGGCC 59.505 52.381 0.00 0.00 34.88 5.19
974 975 2.487986 CCTCCATTCCCTCATACAAGGC 60.488 54.545 0.00 0.00 34.88 4.35
975 976 2.107204 CCCTCCATTCCCTCATACAAGG 59.893 54.545 0.00 0.00 36.08 3.61
976 977 3.048600 TCCCTCCATTCCCTCATACAAG 58.951 50.000 0.00 0.00 0.00 3.16
977 978 3.048600 CTCCCTCCATTCCCTCATACAA 58.951 50.000 0.00 0.00 0.00 2.41
978 979 2.022035 ACTCCCTCCATTCCCTCATACA 60.022 50.000 0.00 0.00 0.00 2.29
979 980 2.695585 ACTCCCTCCATTCCCTCATAC 58.304 52.381 0.00 0.00 0.00 2.39
980 981 4.109600 TCATACTCCCTCCATTCCCTCATA 59.890 45.833 0.00 0.00 0.00 2.15
981 982 3.116199 TCATACTCCCTCCATTCCCTCAT 60.116 47.826 0.00 0.00 0.00 2.90
982 983 2.250008 TCATACTCCCTCCATTCCCTCA 59.750 50.000 0.00 0.00 0.00 3.86
983 984 2.977808 TCATACTCCCTCCATTCCCTC 58.022 52.381 0.00 0.00 0.00 4.30
984 985 3.116199 TGATCATACTCCCTCCATTCCCT 60.116 47.826 0.00 0.00 0.00 4.20
985 986 3.251484 TGATCATACTCCCTCCATTCCC 58.749 50.000 0.00 0.00 0.00 3.97
986 987 4.382470 CGATGATCATACTCCCTCCATTCC 60.382 50.000 8.54 0.00 0.00 3.01
987 988 4.221703 ACGATGATCATACTCCCTCCATTC 59.778 45.833 8.54 0.00 0.00 2.67
988 989 4.020751 CACGATGATCATACTCCCTCCATT 60.021 45.833 8.54 0.00 0.00 3.16
989 990 3.513119 CACGATGATCATACTCCCTCCAT 59.487 47.826 8.54 0.00 0.00 3.41
990 991 2.893489 CACGATGATCATACTCCCTCCA 59.107 50.000 8.54 0.00 0.00 3.86
991 992 2.353208 GCACGATGATCATACTCCCTCC 60.353 54.545 8.54 0.00 0.00 4.30
992 993 2.560542 AGCACGATGATCATACTCCCTC 59.439 50.000 8.54 0.00 0.00 4.30
993 994 2.603021 AGCACGATGATCATACTCCCT 58.397 47.619 8.54 0.00 0.00 4.20
994 995 3.062763 CAAGCACGATGATCATACTCCC 58.937 50.000 8.54 0.00 0.00 4.30
995 996 2.478134 GCAAGCACGATGATCATACTCC 59.522 50.000 8.54 0.00 0.00 3.85
996 997 2.478134 GGCAAGCACGATGATCATACTC 59.522 50.000 8.54 0.00 0.00 2.59
997 998 2.158914 TGGCAAGCACGATGATCATACT 60.159 45.455 8.54 1.24 0.00 2.12
998 999 2.212652 TGGCAAGCACGATGATCATAC 58.787 47.619 8.54 1.77 0.00 2.39
1018 1019 4.392138 GTGCAAATAGGCGAAAACTAGTCT 59.608 41.667 0.00 0.00 36.28 3.24
1019 1020 4.436986 GGTGCAAATAGGCGAAAACTAGTC 60.437 45.833 0.00 0.00 36.28 2.59
1082 1087 3.056213 CCACCCTGGCATCTTTTGT 57.944 52.632 0.00 0.00 0.00 2.83
1104 1109 3.242543 GCGATCTGTGCGAATGATTTTCT 60.243 43.478 0.00 0.00 0.00 2.52
1110 1115 0.807275 CTGGCGATCTGTGCGAATGA 60.807 55.000 0.00 0.00 0.00 2.57
1116 1121 0.528684 GTACCTCTGGCGATCTGTGC 60.529 60.000 0.00 0.00 0.00 4.57
1120 1125 0.178987 ATCGGTACCTCTGGCGATCT 60.179 55.000 10.90 0.00 0.00 2.75
1136 1141 1.378882 CCAACCACAGCCATCCATCG 61.379 60.000 0.00 0.00 0.00 3.84
1222 1231 1.406887 GCTGGCGTAGAAGGATGGAAA 60.407 52.381 0.00 0.00 0.00 3.13
1235 1247 3.914551 AAGAGAGGGAGGCTGGCGT 62.915 63.158 0.00 0.00 0.00 5.68
1392 1404 3.096092 ACACAAGAGGGAGCTAGAAGAG 58.904 50.000 0.00 0.00 0.00 2.85
1401 1413 3.769844 ACCACTACATACACAAGAGGGAG 59.230 47.826 0.00 0.00 0.00 4.30
1407 1419 3.673338 CACGTGACCACTACATACACAAG 59.327 47.826 10.90 0.00 0.00 3.16
1441 1453 2.575993 CCAGTCCCAGAGCAGACG 59.424 66.667 0.00 0.00 38.08 4.18
1473 1485 4.321217 GTGTATCTGTTCTCTGAACGAACG 59.679 45.833 6.05 0.00 42.73 3.95
1582 1594 2.295885 GAAGAAGGTGGGCAGATCATG 58.704 52.381 0.00 0.00 0.00 3.07
1610 1638 0.911769 TCCAAGTACATCCTGCCCTG 59.088 55.000 0.00 0.00 0.00 4.45
1658 1686 7.465353 TTTCTTTGGCATGTCATCAGAAATA 57.535 32.000 22.33 9.35 29.12 1.40
1663 1691 5.716094 TCAATTTCTTTGGCATGTCATCAG 58.284 37.500 0.00 0.14 35.92 2.90
1669 1697 4.339872 TGCTTCAATTTCTTTGGCATGT 57.660 36.364 0.00 0.00 35.92 3.21
1673 1701 3.059665 CGGTTTGCTTCAATTTCTTTGGC 60.060 43.478 0.00 0.00 35.92 4.52
1702 1730 2.262211 GAATTTGGAGAACCGCAATGC 58.738 47.619 0.00 0.00 39.42 3.56
1720 1748 1.133790 GCCTAAACTAGAGACGGCGAA 59.866 52.381 16.62 0.00 0.00 4.70
1760 1792 1.070289 GAAGGTTTCGTCACCAGAGGT 59.930 52.381 8.25 0.00 39.62 3.85
1765 1797 3.071479 GCATAAGAAGGTTTCGTCACCA 58.929 45.455 8.25 0.00 39.62 4.17
1771 1803 4.878397 AGAGAATGGCATAAGAAGGTTTCG 59.122 41.667 0.00 0.00 34.02 3.46
1776 1808 8.632906 AAATCATAGAGAATGGCATAAGAAGG 57.367 34.615 0.00 0.00 36.15 3.46
1821 1854 5.293814 CAGAGATCTACAAACATCAAGGCTG 59.706 44.000 0.00 0.00 0.00 4.85
1828 1861 7.604164 TGGTTTTCTCAGAGATCTACAAACATC 59.396 37.037 19.51 9.09 0.00 3.06
1839 1872 5.221322 GCAAAACCTTGGTTTTCTCAGAGAT 60.221 40.000 23.01 1.85 34.68 2.75
1851 1891 2.632512 CACCCATAAGCAAAACCTTGGT 59.367 45.455 0.00 0.00 45.10 3.67
1852 1892 2.612721 GCACCCATAAGCAAAACCTTGG 60.613 50.000 0.00 0.00 32.76 3.61
1870 1910 3.408634 TGCCCTAACTTGAACTAAGCAC 58.591 45.455 0.00 0.00 40.16 4.40
1872 1912 4.518249 AGATGCCCTAACTTGAACTAAGC 58.482 43.478 0.00 0.00 40.16 3.09
1876 1916 2.912956 TGGAGATGCCCTAACTTGAACT 59.087 45.455 0.00 0.00 34.97 3.01
1881 1921 2.619074 GCTGTTGGAGATGCCCTAACTT 60.619 50.000 0.00 0.00 34.97 2.66
1884 1924 0.255890 GGCTGTTGGAGATGCCCTAA 59.744 55.000 0.00 0.00 39.49 2.69
1885 1925 1.915228 GGCTGTTGGAGATGCCCTA 59.085 57.895 0.00 0.00 39.49 3.53
1886 1926 2.679716 GGCTGTTGGAGATGCCCT 59.320 61.111 0.00 0.00 39.49 5.19
1887 1927 2.252072 TACGGCTGTTGGAGATGCCC 62.252 60.000 1.99 0.00 42.15 5.36
1888 1928 0.392461 TTACGGCTGTTGGAGATGCC 60.392 55.000 1.99 0.00 41.76 4.40
1889 1929 1.009829 CTTACGGCTGTTGGAGATGC 58.990 55.000 1.99 0.00 0.00 3.91
1890 1930 2.672961 TCTTACGGCTGTTGGAGATG 57.327 50.000 1.99 0.00 0.00 2.90
1891 1931 3.322254 CCTATCTTACGGCTGTTGGAGAT 59.678 47.826 1.99 12.95 0.00 2.75
1892 1932 2.693591 CCTATCTTACGGCTGTTGGAGA 59.306 50.000 1.99 6.02 0.00 3.71
1893 1933 2.431057 ACCTATCTTACGGCTGTTGGAG 59.569 50.000 1.99 0.00 0.00 3.86
1894 1934 2.167693 CACCTATCTTACGGCTGTTGGA 59.832 50.000 1.99 2.86 0.00 3.53
1895 1935 2.093658 ACACCTATCTTACGGCTGTTGG 60.094 50.000 1.99 0.00 0.00 3.77
1896 1936 3.247006 ACACCTATCTTACGGCTGTTG 57.753 47.619 1.99 0.00 0.00 3.33
1897 1937 3.596214 CAACACCTATCTTACGGCTGTT 58.404 45.455 1.99 0.00 0.00 3.16
1898 1938 2.093658 CCAACACCTATCTTACGGCTGT 60.094 50.000 2.42 2.42 0.00 4.40
1899 1939 2.093658 ACCAACACCTATCTTACGGCTG 60.094 50.000 0.00 0.00 0.00 4.85
1900 1940 2.185387 ACCAACACCTATCTTACGGCT 58.815 47.619 0.00 0.00 0.00 5.52
1901 1941 2.685850 ACCAACACCTATCTTACGGC 57.314 50.000 0.00 0.00 0.00 5.68
1902 1942 7.469260 CAAATTTACCAACACCTATCTTACGG 58.531 38.462 0.00 0.00 0.00 4.02
1903 1943 6.964934 GCAAATTTACCAACACCTATCTTACG 59.035 38.462 0.00 0.00 0.00 3.18
1904 1944 7.094118 TGGCAAATTTACCAACACCTATCTTAC 60.094 37.037 7.73 0.00 31.46 2.34
1905 1945 6.948886 TGGCAAATTTACCAACACCTATCTTA 59.051 34.615 7.73 0.00 31.46 2.10
1906 1946 5.777732 TGGCAAATTTACCAACACCTATCTT 59.222 36.000 7.73 0.00 31.46 2.40
1907 1947 5.185056 GTGGCAAATTTACCAACACCTATCT 59.815 40.000 11.84 0.00 37.79 1.98
1908 1948 5.407502 GTGGCAAATTTACCAACACCTATC 58.592 41.667 11.84 0.00 37.79 2.08
1909 1949 4.082463 CGTGGCAAATTTACCAACACCTAT 60.082 41.667 11.84 0.00 37.79 2.57
1910 1950 3.253677 CGTGGCAAATTTACCAACACCTA 59.746 43.478 11.84 0.00 37.79 3.08
1911 1951 2.035321 CGTGGCAAATTTACCAACACCT 59.965 45.455 11.84 0.00 37.79 4.00
1912 1952 2.223852 ACGTGGCAAATTTACCAACACC 60.224 45.455 11.84 0.00 37.79 4.16
1913 1953 3.086818 ACGTGGCAAATTTACCAACAC 57.913 42.857 11.84 5.91 37.79 3.32
1914 1954 3.253677 CCTACGTGGCAAATTTACCAACA 59.746 43.478 11.84 0.00 37.79 3.33
1915 1955 3.502979 TCCTACGTGGCAAATTTACCAAC 59.497 43.478 11.84 5.95 37.79 3.77
1916 1956 3.752665 TCCTACGTGGCAAATTTACCAA 58.247 40.909 11.84 0.00 37.79 3.67
1917 1957 3.420300 TCCTACGTGGCAAATTTACCA 57.580 42.857 6.00 6.00 35.26 3.25
1918 1958 6.932960 ACTATATCCTACGTGGCAAATTTACC 59.067 38.462 0.00 0.00 35.26 2.85
1919 1959 7.654520 TCACTATATCCTACGTGGCAAATTTAC 59.345 37.037 0.00 0.00 35.26 2.01
1920 1960 7.728148 TCACTATATCCTACGTGGCAAATTTA 58.272 34.615 0.00 0.00 35.26 1.40
1921 1961 6.588204 TCACTATATCCTACGTGGCAAATTT 58.412 36.000 0.00 0.00 35.26 1.82
1922 1962 6.169557 TCACTATATCCTACGTGGCAAATT 57.830 37.500 0.00 0.00 35.26 1.82
1923 1963 5.801531 TCACTATATCCTACGTGGCAAAT 57.198 39.130 0.00 0.00 35.26 2.32
1924 1964 5.303333 TCATCACTATATCCTACGTGGCAAA 59.697 40.000 0.00 0.00 35.26 3.68
1925 1965 4.830600 TCATCACTATATCCTACGTGGCAA 59.169 41.667 0.00 0.00 35.26 4.52
1926 1966 4.403734 TCATCACTATATCCTACGTGGCA 58.596 43.478 0.00 0.00 35.26 4.92
1927 1967 5.105716 ACATCATCACTATATCCTACGTGGC 60.106 44.000 0.00 0.00 35.26 5.01
1928 1968 6.325596 CACATCATCACTATATCCTACGTGG 58.674 44.000 0.00 0.00 37.10 4.94
1929 1969 6.325596 CCACATCATCACTATATCCTACGTG 58.674 44.000 0.00 0.00 0.00 4.49
1930 1970 5.105716 GCCACATCATCACTATATCCTACGT 60.106 44.000 0.00 0.00 0.00 3.57
1931 1971 5.105756 TGCCACATCATCACTATATCCTACG 60.106 44.000 0.00 0.00 0.00 3.51
1932 1972 6.286240 TGCCACATCATCACTATATCCTAC 57.714 41.667 0.00 0.00 0.00 3.18
1933 1973 6.441604 ACATGCCACATCATCACTATATCCTA 59.558 38.462 0.00 0.00 0.00 2.94
1934 1974 5.250082 ACATGCCACATCATCACTATATCCT 59.750 40.000 0.00 0.00 0.00 3.24
1935 1975 5.494724 ACATGCCACATCATCACTATATCC 58.505 41.667 0.00 0.00 0.00 2.59
1936 1976 8.728337 ATTACATGCCACATCATCACTATATC 57.272 34.615 0.00 0.00 0.00 1.63
1939 1979 8.922931 TTTATTACATGCCACATCATCACTAT 57.077 30.769 0.00 0.00 0.00 2.12
1940 1980 8.785946 CATTTATTACATGCCACATCATCACTA 58.214 33.333 0.00 0.00 0.00 2.74
1941 1981 7.286087 ACATTTATTACATGCCACATCATCACT 59.714 33.333 0.00 0.00 0.00 3.41
1942 1982 7.380333 CACATTTATTACATGCCACATCATCAC 59.620 37.037 0.00 0.00 0.00 3.06
1943 1983 7.427214 CACATTTATTACATGCCACATCATCA 58.573 34.615 0.00 0.00 0.00 3.07
1944 1984 6.864685 CCACATTTATTACATGCCACATCATC 59.135 38.462 0.00 0.00 0.00 2.92
1945 1985 6.550481 TCCACATTTATTACATGCCACATCAT 59.450 34.615 0.00 0.00 0.00 2.45
1946 1986 5.890419 TCCACATTTATTACATGCCACATCA 59.110 36.000 0.00 0.00 0.00 3.07
1947 1987 6.262944 TCTCCACATTTATTACATGCCACATC 59.737 38.462 0.00 0.00 0.00 3.06
1948 1988 6.128486 TCTCCACATTTATTACATGCCACAT 58.872 36.000 0.00 0.00 0.00 3.21
1949 1989 5.504853 TCTCCACATTTATTACATGCCACA 58.495 37.500 0.00 0.00 0.00 4.17
1950 1990 5.822519 TCTCTCCACATTTATTACATGCCAC 59.177 40.000 0.00 0.00 0.00 5.01
1951 1991 6.000246 TCTCTCCACATTTATTACATGCCA 58.000 37.500 0.00 0.00 0.00 4.92
1952 1992 6.291377 TCTCTCTCCACATTTATTACATGCC 58.709 40.000 0.00 0.00 0.00 4.40
1953 1993 6.073331 GCTCTCTCTCCACATTTATTACATGC 60.073 42.308 0.00 0.00 0.00 4.06
1954 1994 6.988580 TGCTCTCTCTCCACATTTATTACATG 59.011 38.462 0.00 0.00 0.00 3.21
1955 1995 7.129457 TGCTCTCTCTCCACATTTATTACAT 57.871 36.000 0.00 0.00 0.00 2.29
1956 1996 6.544928 TGCTCTCTCTCCACATTTATTACA 57.455 37.500 0.00 0.00 0.00 2.41
1957 1997 7.550906 ACTTTGCTCTCTCTCCACATTTATTAC 59.449 37.037 0.00 0.00 0.00 1.89
1958 1998 7.624549 ACTTTGCTCTCTCTCCACATTTATTA 58.375 34.615 0.00 0.00 0.00 0.98
1959 1999 6.479884 ACTTTGCTCTCTCTCCACATTTATT 58.520 36.000 0.00 0.00 0.00 1.40
1960 2000 6.059787 ACTTTGCTCTCTCTCCACATTTAT 57.940 37.500 0.00 0.00 0.00 1.40
1961 2001 5.489792 ACTTTGCTCTCTCTCCACATTTA 57.510 39.130 0.00 0.00 0.00 1.40
1962 2002 4.363991 ACTTTGCTCTCTCTCCACATTT 57.636 40.909 0.00 0.00 0.00 2.32
1963 2003 4.070716 CAACTTTGCTCTCTCTCCACATT 58.929 43.478 0.00 0.00 0.00 2.71
1964 2004 3.072184 ACAACTTTGCTCTCTCTCCACAT 59.928 43.478 0.00 0.00 0.00 3.21
1965 2005 2.435805 ACAACTTTGCTCTCTCTCCACA 59.564 45.455 0.00 0.00 0.00 4.17
1966 2006 3.118905 ACAACTTTGCTCTCTCTCCAC 57.881 47.619 0.00 0.00 0.00 4.02
1967 2007 4.284490 ACATACAACTTTGCTCTCTCTCCA 59.716 41.667 0.00 0.00 0.00 3.86
1968 2008 4.826556 ACATACAACTTTGCTCTCTCTCC 58.173 43.478 0.00 0.00 0.00 3.71
1969 2009 6.857956 TCTACATACAACTTTGCTCTCTCTC 58.142 40.000 0.00 0.00 0.00 3.20
1970 2010 6.842437 TCTACATACAACTTTGCTCTCTCT 57.158 37.500 0.00 0.00 0.00 3.10
1971 2011 9.587772 TTATTCTACATACAACTTTGCTCTCTC 57.412 33.333 0.00 0.00 0.00 3.20
1972 2012 9.372369 GTTATTCTACATACAACTTTGCTCTCT 57.628 33.333 0.00 0.00 0.00 3.10
1973 2013 8.604890 GGTTATTCTACATACAACTTTGCTCTC 58.395 37.037 0.00 0.00 0.00 3.20
1974 2014 8.100791 TGGTTATTCTACATACAACTTTGCTCT 58.899 33.333 0.00 0.00 0.00 4.09
1975 2015 8.263940 TGGTTATTCTACATACAACTTTGCTC 57.736 34.615 0.00 0.00 0.00 4.26
1976 2016 8.512138 GTTGGTTATTCTACATACAACTTTGCT 58.488 33.333 0.00 0.00 35.24 3.91
1977 2017 8.293867 TGTTGGTTATTCTACATACAACTTTGC 58.706 33.333 0.00 0.00 37.99 3.68
1980 2020 8.789762 GGTTGTTGGTTATTCTACATACAACTT 58.210 33.333 0.00 0.00 40.21 2.66
1981 2021 8.161425 AGGTTGTTGGTTATTCTACATACAACT 58.839 33.333 0.00 0.00 40.21 3.16
1982 2022 8.331730 AGGTTGTTGGTTATTCTACATACAAC 57.668 34.615 0.00 0.00 39.95 3.32
1983 2023 8.788806 CAAGGTTGTTGGTTATTCTACATACAA 58.211 33.333 0.00 0.00 0.00 2.41
1984 2024 7.392113 CCAAGGTTGTTGGTTATTCTACATACA 59.608 37.037 0.00 0.00 34.92 2.29
1985 2025 7.627726 GCCAAGGTTGTTGGTTATTCTACATAC 60.628 40.741 5.70 0.00 41.53 2.39
1986 2026 6.376018 GCCAAGGTTGTTGGTTATTCTACATA 59.624 38.462 5.70 0.00 41.53 2.29
1987 2027 5.185056 GCCAAGGTTGTTGGTTATTCTACAT 59.815 40.000 5.70 0.00 41.53 2.29
1988 2028 4.521256 GCCAAGGTTGTTGGTTATTCTACA 59.479 41.667 5.70 0.00 41.53 2.74
1989 2029 4.521256 TGCCAAGGTTGTTGGTTATTCTAC 59.479 41.667 5.70 0.00 41.53 2.59
1990 2030 4.521256 GTGCCAAGGTTGTTGGTTATTCTA 59.479 41.667 5.70 0.00 41.53 2.10
1991 2031 3.320826 GTGCCAAGGTTGTTGGTTATTCT 59.679 43.478 5.70 0.00 41.53 2.40
1992 2032 3.068873 TGTGCCAAGGTTGTTGGTTATTC 59.931 43.478 5.70 0.00 41.53 1.75
1993 2033 3.034635 TGTGCCAAGGTTGTTGGTTATT 58.965 40.909 5.70 0.00 41.53 1.40
1994 2034 2.672098 TGTGCCAAGGTTGTTGGTTAT 58.328 42.857 5.70 0.00 41.53 1.89
1995 2035 2.145397 TGTGCCAAGGTTGTTGGTTA 57.855 45.000 5.70 0.00 41.53 2.85
1996 2036 1.206849 CTTGTGCCAAGGTTGTTGGTT 59.793 47.619 5.70 0.00 41.53 3.67
1997 2037 0.823460 CTTGTGCCAAGGTTGTTGGT 59.177 50.000 5.70 0.00 41.53 3.67
1998 2038 0.530431 GCTTGTGCCAAGGTTGTTGG 60.530 55.000 14.32 0.00 42.37 3.77
1999 2039 0.461135 AGCTTGTGCCAAGGTTGTTG 59.539 50.000 12.13 0.00 40.80 3.33
2000 2040 1.136891 GAAGCTTGTGCCAAGGTTGTT 59.863 47.619 26.39 11.34 38.01 2.83
2001 2041 0.746659 GAAGCTTGTGCCAAGGTTGT 59.253 50.000 26.39 11.88 38.01 3.32
2002 2042 0.746063 TGAAGCTTGTGCCAAGGTTG 59.254 50.000 26.39 3.37 38.01 3.77
2003 2043 1.410153 CTTGAAGCTTGTGCCAAGGTT 59.590 47.619 23.46 23.46 40.27 3.50
2004 2044 1.035139 CTTGAAGCTTGTGCCAAGGT 58.965 50.000 2.10 12.13 40.80 3.50
2005 2045 0.316204 CCTTGAAGCTTGTGCCAAGG 59.684 55.000 22.98 22.98 45.27 3.61
2006 2046 1.035139 ACCTTGAAGCTTGTGCCAAG 58.965 50.000 2.10 11.11 40.80 3.61
2007 2047 0.746063 CACCTTGAAGCTTGTGCCAA 59.254 50.000 2.10 0.23 40.80 4.52
2008 2048 0.106769 TCACCTTGAAGCTTGTGCCA 60.107 50.000 2.10 0.00 40.80 4.92
2009 2049 1.032014 TTCACCTTGAAGCTTGTGCC 58.968 50.000 2.10 0.00 40.80 5.01
2010 2050 2.869233 TTTCACCTTGAAGCTTGTGC 57.131 45.000 2.10 0.00 37.70 4.57
2011 2051 5.702670 TCTCTATTTCACCTTGAAGCTTGTG 59.297 40.000 2.10 5.94 37.70 3.33
2012 2052 5.869579 TCTCTATTTCACCTTGAAGCTTGT 58.130 37.500 2.10 0.00 37.70 3.16
2013 2053 5.163774 GCTCTCTATTTCACCTTGAAGCTTG 60.164 44.000 2.10 0.00 37.70 4.01
2014 2054 4.940654 GCTCTCTATTTCACCTTGAAGCTT 59.059 41.667 0.00 0.00 37.70 3.74
2015 2055 4.019860 TGCTCTCTATTTCACCTTGAAGCT 60.020 41.667 0.00 0.00 37.70 3.74
2016 2056 4.256920 TGCTCTCTATTTCACCTTGAAGC 58.743 43.478 0.00 0.00 37.70 3.86
2017 2057 6.596888 TGATTGCTCTCTATTTCACCTTGAAG 59.403 38.462 0.00 0.00 37.70 3.02
2018 2058 6.372659 GTGATTGCTCTCTATTTCACCTTGAA 59.627 38.462 0.00 0.00 34.03 2.69
2019 2059 5.877012 GTGATTGCTCTCTATTTCACCTTGA 59.123 40.000 0.00 0.00 0.00 3.02
2020 2060 5.645067 TGTGATTGCTCTCTATTTCACCTTG 59.355 40.000 0.00 0.00 34.11 3.61
2021 2061 5.809001 TGTGATTGCTCTCTATTTCACCTT 58.191 37.500 0.00 0.00 34.11 3.50
2022 2062 5.426689 TGTGATTGCTCTCTATTTCACCT 57.573 39.130 0.00 0.00 34.11 4.00
2023 2063 6.690194 AATGTGATTGCTCTCTATTTCACC 57.310 37.500 0.00 0.00 34.11 4.02
2024 2064 8.668353 TGTAAATGTGATTGCTCTCTATTTCAC 58.332 33.333 0.00 0.00 35.27 3.18
2025 2065 8.791327 TGTAAATGTGATTGCTCTCTATTTCA 57.209 30.769 0.00 0.00 0.00 2.69
2028 2068 9.624373 AGAATGTAAATGTGATTGCTCTCTATT 57.376 29.630 0.00 0.00 0.00 1.73
2029 2069 9.270640 GAGAATGTAAATGTGATTGCTCTCTAT 57.729 33.333 0.00 0.00 0.00 1.98
2030 2070 8.260114 TGAGAATGTAAATGTGATTGCTCTCTA 58.740 33.333 0.00 0.00 0.00 2.43
2031 2071 7.108194 TGAGAATGTAAATGTGATTGCTCTCT 58.892 34.615 0.00 0.00 0.00 3.10
2032 2072 7.312657 TGAGAATGTAAATGTGATTGCTCTC 57.687 36.000 0.00 0.00 0.00 3.20
2033 2073 7.555195 TGATGAGAATGTAAATGTGATTGCTCT 59.445 33.333 0.00 0.00 0.00 4.09
2034 2074 7.700505 TGATGAGAATGTAAATGTGATTGCTC 58.299 34.615 0.00 0.00 0.00 4.26
2035 2075 7.634671 TGATGAGAATGTAAATGTGATTGCT 57.365 32.000 0.00 0.00 0.00 3.91
2036 2076 8.350722 AGATGATGAGAATGTAAATGTGATTGC 58.649 33.333 0.00 0.00 0.00 3.56
2046 2086 9.881649 GCTATCCAATAGATGATGAGAATGTAA 57.118 33.333 0.00 0.00 36.33 2.41
2047 2087 9.264653 AGCTATCCAATAGATGATGAGAATGTA 57.735 33.333 0.00 0.00 36.33 2.29
2048 2088 8.148437 AGCTATCCAATAGATGATGAGAATGT 57.852 34.615 0.00 0.00 36.33 2.71
2051 2091 9.539194 TCTAAGCTATCCAATAGATGATGAGAA 57.461 33.333 0.00 0.00 36.33 2.87
2052 2092 9.712250 ATCTAAGCTATCCAATAGATGATGAGA 57.288 33.333 3.14 0.00 34.64 3.27
2058 2098 9.593134 GGTTGTATCTAAGCTATCCAATAGATG 57.407 37.037 11.86 0.00 36.18 2.90
2059 2099 9.554053 AGGTTGTATCTAAGCTATCCAATAGAT 57.446 33.333 8.13 8.13 36.69 1.98
2060 2100 8.958060 AGGTTGTATCTAAGCTATCCAATAGA 57.042 34.615 0.00 0.00 36.69 1.98
2063 2103 9.950496 CAATAGGTTGTATCTAAGCTATCCAAT 57.050 33.333 9.74 0.00 45.52 3.16
2064 2104 8.375506 CCAATAGGTTGTATCTAAGCTATCCAA 58.624 37.037 9.74 0.00 45.52 3.53
2065 2105 7.733047 TCCAATAGGTTGTATCTAAGCTATCCA 59.267 37.037 9.74 0.00 45.52 3.41
2066 2106 8.135382 TCCAATAGGTTGTATCTAAGCTATCC 57.865 38.462 9.74 0.00 45.52 2.59
2067 2107 8.808092 ACTCCAATAGGTTGTATCTAAGCTATC 58.192 37.037 9.74 0.00 45.52 2.08
2069 2109 9.298250 CTACTCCAATAGGTTGTATCTAAGCTA 57.702 37.037 0.00 0.00 42.67 3.32
2070 2110 7.785506 ACTACTCCAATAGGTTGTATCTAAGCT 59.214 37.037 0.00 0.00 40.99 3.74
2071 2111 7.953752 ACTACTCCAATAGGTTGTATCTAAGC 58.046 38.462 0.00 0.00 35.89 3.09
2072 2112 9.751542 CAACTACTCCAATAGGTTGTATCTAAG 57.248 37.037 0.00 0.00 35.89 2.18
2073 2113 9.263446 ACAACTACTCCAATAGGTTGTATCTAA 57.737 33.333 7.80 0.00 35.89 2.10
2074 2114 8.834004 ACAACTACTCCAATAGGTTGTATCTA 57.166 34.615 7.80 0.00 35.89 1.98
2075 2115 7.735326 ACAACTACTCCAATAGGTTGTATCT 57.265 36.000 7.80 0.00 35.89 1.98
2076 2116 9.477484 CATACAACTACTCCAATAGGTTGTATC 57.523 37.037 19.89 0.00 37.33 2.24
2077 2117 9.209048 TCATACAACTACTCCAATAGGTTGTAT 57.791 33.333 18.10 18.10 38.37 2.29
2078 2118 8.598202 TCATACAACTACTCCAATAGGTTGTA 57.402 34.615 15.80 15.80 35.53 2.41
2079 2119 7.490657 TCATACAACTACTCCAATAGGTTGT 57.509 36.000 12.99 12.99 34.14 3.32
2080 2120 9.698309 CTATCATACAACTACTCCAATAGGTTG 57.302 37.037 0.00 0.00 35.89 3.77
2081 2121 8.368668 GCTATCATACAACTACTCCAATAGGTT 58.631 37.037 0.00 0.00 35.89 3.50
2082 2122 7.730784 AGCTATCATACAACTACTCCAATAGGT 59.269 37.037 0.00 0.00 35.89 3.08
2083 2123 8.128322 AGCTATCATACAACTACTCCAATAGG 57.872 38.462 0.00 0.00 0.00 2.57
2084 2124 9.416794 CAAGCTATCATACAACTACTCCAATAG 57.583 37.037 0.00 0.00 0.00 1.73
2085 2125 8.924303 ACAAGCTATCATACAACTACTCCAATA 58.076 33.333 0.00 0.00 0.00 1.90
2086 2126 7.796054 ACAAGCTATCATACAACTACTCCAAT 58.204 34.615 0.00 0.00 0.00 3.16
2087 2127 7.182817 ACAAGCTATCATACAACTACTCCAA 57.817 36.000 0.00 0.00 0.00 3.53
2088 2128 6.791867 ACAAGCTATCATACAACTACTCCA 57.208 37.500 0.00 0.00 0.00 3.86
2089 2129 6.480320 CCAACAAGCTATCATACAACTACTCC 59.520 42.308 0.00 0.00 0.00 3.85
2090 2130 6.018669 GCCAACAAGCTATCATACAACTACTC 60.019 42.308 0.00 0.00 0.00 2.59
2091 2131 5.817816 GCCAACAAGCTATCATACAACTACT 59.182 40.000 0.00 0.00 0.00 2.57
2092 2132 5.817816 AGCCAACAAGCTATCATACAACTAC 59.182 40.000 0.00 0.00 42.70 2.73
2093 2133 5.817296 CAGCCAACAAGCTATCATACAACTA 59.183 40.000 0.00 0.00 42.61 2.24
2094 2134 4.637534 CAGCCAACAAGCTATCATACAACT 59.362 41.667 0.00 0.00 42.61 3.16
2095 2135 4.635765 TCAGCCAACAAGCTATCATACAAC 59.364 41.667 0.00 0.00 42.61 3.32
2096 2136 4.842574 TCAGCCAACAAGCTATCATACAA 58.157 39.130 0.00 0.00 42.61 2.41
2097 2137 4.486125 TCAGCCAACAAGCTATCATACA 57.514 40.909 0.00 0.00 42.61 2.29
2098 2138 5.049818 GTCATCAGCCAACAAGCTATCATAC 60.050 44.000 0.00 0.00 42.61 2.39
2099 2139 5.059161 GTCATCAGCCAACAAGCTATCATA 58.941 41.667 0.00 0.00 42.61 2.15
2100 2140 3.881688 GTCATCAGCCAACAAGCTATCAT 59.118 43.478 0.00 0.00 42.61 2.45
2101 2141 3.273434 GTCATCAGCCAACAAGCTATCA 58.727 45.455 0.00 0.00 42.61 2.15
2102 2142 3.273434 TGTCATCAGCCAACAAGCTATC 58.727 45.455 0.00 0.00 42.61 2.08
2103 2143 3.354948 TGTCATCAGCCAACAAGCTAT 57.645 42.857 0.00 0.00 42.61 2.97
2104 2144 2.857186 TGTCATCAGCCAACAAGCTA 57.143 45.000 0.00 0.00 42.61 3.32
2105 2145 1.816835 CATGTCATCAGCCAACAAGCT 59.183 47.619 0.00 0.00 46.45 3.74
2106 2146 1.135199 CCATGTCATCAGCCAACAAGC 60.135 52.381 0.00 0.00 0.00 4.01
2107 2147 2.163010 GTCCATGTCATCAGCCAACAAG 59.837 50.000 0.00 0.00 0.00 3.16
2108 2148 2.161855 GTCCATGTCATCAGCCAACAA 58.838 47.619 0.00 0.00 0.00 2.83
2109 2149 1.073603 TGTCCATGTCATCAGCCAACA 59.926 47.619 0.00 0.00 0.00 3.33
2110 2150 1.825090 TGTCCATGTCATCAGCCAAC 58.175 50.000 0.00 0.00 0.00 3.77
2111 2151 2.583024 TTGTCCATGTCATCAGCCAA 57.417 45.000 0.00 0.00 0.00 4.52
2112 2152 2.812836 ATTGTCCATGTCATCAGCCA 57.187 45.000 0.00 0.00 0.00 4.75
2113 2153 4.202050 GGTAAATTGTCCATGTCATCAGCC 60.202 45.833 0.00 0.00 0.00 4.85
2114 2154 4.398988 TGGTAAATTGTCCATGTCATCAGC 59.601 41.667 0.00 0.00 0.00 4.26
2115 2155 6.072008 TGTTGGTAAATTGTCCATGTCATCAG 60.072 38.462 3.24 0.00 33.50 2.90
2116 2156 5.772169 TGTTGGTAAATTGTCCATGTCATCA 59.228 36.000 3.24 0.00 33.50 3.07
2117 2157 6.266168 TGTTGGTAAATTGTCCATGTCATC 57.734 37.500 3.24 0.00 33.50 2.92
2118 2158 5.185635 CCTGTTGGTAAATTGTCCATGTCAT 59.814 40.000 3.24 0.00 33.50 3.06
2119 2159 4.522405 CCTGTTGGTAAATTGTCCATGTCA 59.478 41.667 3.24 3.71 33.50 3.58
2120 2160 4.764823 TCCTGTTGGTAAATTGTCCATGTC 59.235 41.667 3.24 0.00 33.50 3.06
2121 2161 4.522789 GTCCTGTTGGTAAATTGTCCATGT 59.477 41.667 3.24 0.00 33.50 3.21
2122 2162 4.766891 AGTCCTGTTGGTAAATTGTCCATG 59.233 41.667 3.24 0.00 33.50 3.66
2123 2163 4.998051 AGTCCTGTTGGTAAATTGTCCAT 58.002 39.130 3.24 0.00 33.50 3.41
2124 2164 4.447138 AGTCCTGTTGGTAAATTGTCCA 57.553 40.909 0.00 0.00 34.23 4.02
2125 2165 5.766174 TGTTAGTCCTGTTGGTAAATTGTCC 59.234 40.000 0.00 0.00 34.23 4.02
2126 2166 6.870971 TGTTAGTCCTGTTGGTAAATTGTC 57.129 37.500 0.00 0.00 34.23 3.18
2127 2167 7.940137 TGTATGTTAGTCCTGTTGGTAAATTGT 59.060 33.333 0.00 0.00 34.23 2.71
2128 2168 8.330466 TGTATGTTAGTCCTGTTGGTAAATTG 57.670 34.615 0.00 0.00 34.23 2.32
2129 2169 8.927675 TTGTATGTTAGTCCTGTTGGTAAATT 57.072 30.769 0.00 0.00 34.23 1.82
2130 2170 9.174166 GATTGTATGTTAGTCCTGTTGGTAAAT 57.826 33.333 0.00 0.00 34.23 1.40
2131 2171 8.380099 AGATTGTATGTTAGTCCTGTTGGTAAA 58.620 33.333 0.00 0.00 34.23 2.01
2132 2172 7.822334 CAGATTGTATGTTAGTCCTGTTGGTAA 59.178 37.037 0.00 0.00 34.23 2.85
2133 2173 7.038587 ACAGATTGTATGTTAGTCCTGTTGGTA 60.039 37.037 0.00 0.00 30.42 3.25
2134 2174 6.173339 CAGATTGTATGTTAGTCCTGTTGGT 58.827 40.000 0.00 0.00 34.23 3.67
2135 2175 6.173339 ACAGATTGTATGTTAGTCCTGTTGG 58.827 40.000 0.00 0.00 30.42 3.77
2136 2176 7.672983 AACAGATTGTATGTTAGTCCTGTTG 57.327 36.000 0.00 0.00 40.67 3.33
2137 2177 6.655003 CCAACAGATTGTATGTTAGTCCTGTT 59.345 38.462 0.00 0.00 42.25 3.16
2138 2178 6.013725 TCCAACAGATTGTATGTTAGTCCTGT 60.014 38.462 0.00 0.00 38.80 4.00
2139 2179 6.406370 TCCAACAGATTGTATGTTAGTCCTG 58.594 40.000 0.00 0.00 38.80 3.86
2140 2180 6.440647 TCTCCAACAGATTGTATGTTAGTCCT 59.559 38.462 0.00 0.00 38.80 3.85
2141 2181 6.640518 TCTCCAACAGATTGTATGTTAGTCC 58.359 40.000 0.00 0.00 38.80 3.85
2142