Multiple sequence alignment - TraesCS5B01G514900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G514900 chr5B 100.000 1967 0 0 354 2320 679659250 679661216 0.000000e+00 3633
1 TraesCS5B01G514900 chr5B 100.000 253 0 0 1 253 679658897 679659149 3.490000e-128 468
2 TraesCS5B01G514900 chrUn 99.593 1967 7 1 354 2320 189392893 189394858 0.000000e+00 3587
3 TraesCS5B01G514900 chrUn 96.063 254 9 1 1 253 146984217 146984470 1.660000e-111 412
4 TraesCS5B01G514900 chr5A 99.492 1967 9 1 354 2320 300073333 300075298 0.000000e+00 3576
5 TraesCS5B01G514900 chr5A 98.932 1967 16 2 354 2320 16602565 16600604 0.000000e+00 3511
6 TraesCS5B01G514900 chr5A 96.838 253 7 1 1 253 482817193 482816942 2.760000e-114 422
7 TraesCS5B01G514900 chr2A 99.441 1967 10 1 354 2320 618279602 618277637 0.000000e+00 3570
8 TraesCS5B01G514900 chr7D 99.288 1967 13 1 354 2320 626698136 626696171 0.000000e+00 3554
9 TraesCS5B01G514900 chr7D 99.136 1967 15 2 354 2320 203555991 203554027 0.000000e+00 3537
10 TraesCS5B01G514900 chr7B 99.085 1968 15 3 354 2320 743086553 743088518 0.000000e+00 3531
11 TraesCS5B01G514900 chr7B 99.209 253 2 0 1 253 648263584 648263836 7.560000e-125 457
12 TraesCS5B01G514900 chr7B 99.209 253 2 0 1 253 740280843 740281095 7.560000e-125 457
13 TraesCS5B01G514900 chr6A 99.085 1967 15 2 354 2320 289128986 289130949 0.000000e+00 3530
14 TraesCS5B01G514900 chr3B 98.932 1967 17 4 354 2320 92199958 92201920 0.000000e+00 3513
15 TraesCS5B01G514900 chr3B 98.814 253 3 0 1 253 783015766 783015514 3.520000e-123 451
16 TraesCS5B01G514900 chr1A 98.814 253 3 0 1 253 534959495 534959243 3.520000e-123 451
17 TraesCS5B01G514900 chr1A 96.078 255 8 2 1 253 18116576 18116830 4.610000e-112 414
18 TraesCS5B01G514900 chr1A 96.063 254 9 1 1 253 18117244 18117497 1.660000e-111 412
19 TraesCS5B01G514900 chr3A 96.078 255 8 2 1 253 36156948 36156694 4.610000e-112 414


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G514900 chr5B 679658897 679661216 2319 False 2050.5 3633 100.0000 1 2320 2 chr5B.!!$F1 2319
1 TraesCS5B01G514900 chrUn 189392893 189394858 1965 False 3587.0 3587 99.5930 354 2320 1 chrUn.!!$F2 1966
2 TraesCS5B01G514900 chr5A 300073333 300075298 1965 False 3576.0 3576 99.4920 354 2320 1 chr5A.!!$F1 1966
3 TraesCS5B01G514900 chr5A 16600604 16602565 1961 True 3511.0 3511 98.9320 354 2320 1 chr5A.!!$R1 1966
4 TraesCS5B01G514900 chr2A 618277637 618279602 1965 True 3570.0 3570 99.4410 354 2320 1 chr2A.!!$R1 1966
5 TraesCS5B01G514900 chr7D 626696171 626698136 1965 True 3554.0 3554 99.2880 354 2320 1 chr7D.!!$R2 1966
6 TraesCS5B01G514900 chr7D 203554027 203555991 1964 True 3537.0 3537 99.1360 354 2320 1 chr7D.!!$R1 1966
7 TraesCS5B01G514900 chr7B 743086553 743088518 1965 False 3531.0 3531 99.0850 354 2320 1 chr7B.!!$F3 1966
8 TraesCS5B01G514900 chr6A 289128986 289130949 1963 False 3530.0 3530 99.0850 354 2320 1 chr6A.!!$F1 1966
9 TraesCS5B01G514900 chr3B 92199958 92201920 1962 False 3513.0 3513 98.9320 354 2320 1 chr3B.!!$F1 1966
10 TraesCS5B01G514900 chr1A 18116576 18117497 921 False 413.0 414 96.0705 1 253 2 chr1A.!!$F1 252

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
81 83 0.310854 CCCTTTGACTTTGCACGGAC 59.689 55.0 0.0 0.0 0.0 4.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2057 2729 2.103042 CGGCAAGAAGCTTCTCGGG 61.103 63.158 28.58 20.69 44.79 5.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 83 0.310854 CCCTTTGACTTTGCACGGAC 59.689 55.000 0.00 0.0 0.00 4.79
102 104 2.328099 GCTTTGACCAGCGGACCTG 61.328 63.158 1.50 0.0 41.41 4.00
182 852 1.565390 CCACAGCAAGATCCCCTCCA 61.565 60.000 0.00 0.0 0.00 3.86
189 859 2.641815 GCAAGATCCCCTCCATGTAGAT 59.358 50.000 0.00 0.0 0.00 1.98
190 860 3.840666 GCAAGATCCCCTCCATGTAGATA 59.159 47.826 0.00 0.0 0.00 1.98
198 868 0.589708 TCCATGTAGATACGACGCGG 59.410 55.000 12.47 0.0 0.00 6.46
801 1471 5.813513 AGGGAAGATGCAAGTCAATTTTT 57.186 34.783 0.00 0.0 0.00 1.94
979 1650 1.338200 GGAGTTCATTCAGCACCGAGT 60.338 52.381 0.00 0.0 0.00 4.18
2057 2729 3.618690 AATCAAGTCAGAGTAGGGTGC 57.381 47.619 0.00 0.0 0.00 5.01
2299 2971 1.009997 TTAGGGGTAAGAGGGGACGA 58.990 55.000 0.00 0.0 0.00 4.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 83 4.697756 TCCGCTGGTCAAAGCCCG 62.698 66.667 0.00 0.00 40.23 6.13
182 852 1.285023 GGCCGCGTCGTATCTACAT 59.715 57.895 4.92 0.00 0.00 2.29
198 868 2.269241 CTGGAGGGAGGAAACGGC 59.731 66.667 0.00 0.00 0.00 5.68
979 1650 0.730840 TTGAATCTACGCTCGCTCGA 59.269 50.000 3.28 0.00 0.00 4.04
1109 1781 5.075067 AGGAAGAAGAGGGGATTTCTGAAAA 59.925 40.000 6.95 0.00 34.09 2.29
2057 2729 2.103042 CGGCAAGAAGCTTCTCGGG 61.103 63.158 28.58 20.69 44.79 5.14


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.