Multiple sequence alignment - TraesCS5B01G508300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G508300 chr5B 100.000 2546 0 0 1 2546 673306661 673304116 0 4702
1 TraesCS5B01G508300 chr5B 96.808 1723 34 10 840 2546 158570945 158569228 0 2857
2 TraesCS5B01G508300 chr6A 97.042 1724 34 6 840 2546 617222602 617220879 0 2885
3 TraesCS5B01G508300 chr6A 96.696 1725 38 7 840 2546 533982055 533980332 0 2852
4 TraesCS5B01G508300 chr6A 96.582 1726 37 9 840 2546 616131563 616133285 0 2841
5 TraesCS5B01G508300 chr6A 98.810 840 10 0 1 840 569700967 569701806 0 1496
6 TraesCS5B01G508300 chr1B 96.984 1724 34 7 840 2546 42162071 42160349 0 2880
7 TraesCS5B01G508300 chr1B 96.868 1724 36 7 840 2546 7851343 7853065 0 2868
8 TraesCS5B01G508300 chr1B 96.576 1723 43 5 840 2546 684834605 684832883 0 2841
9 TraesCS5B01G508300 chr1B 98.692 841 11 0 1 841 60347044 60346204 0 1493
10 TraesCS5B01G508300 chr1B 98.690 840 11 0 1 840 633846665 633845826 0 1491
11 TraesCS5B01G508300 chr3A 96.754 1725 35 10 840 2546 54952185 54953906 0 2856
12 TraesCS5B01G508300 chr3A 98.700 846 8 2 1 844 737590061 737590905 0 1498
13 TraesCS5B01G508300 chr6B 96.580 1725 40 7 840 2546 585915854 585917577 0 2841
14 TraesCS5B01G508300 chr2A 96.522 1725 41 7 840 2546 751250307 751248584 0 2835
15 TraesCS5B01G508300 chr2A 96.685 1448 33 5 840 2272 613866725 613868172 0 2394
16 TraesCS5B01G508300 chr2A 98.692 841 10 1 1 841 159202517 159203356 0 1491
17 TraesCS5B01G508300 chr2B 96.408 1726 41 7 840 2546 757363040 757364763 0 2824
18 TraesCS5B01G508300 chr2B 98.694 842 9 1 1 840 575372288 575371447 0 1493
19 TraesCS5B01G508300 chr2B 98.237 851 14 1 1 850 785970313 785969463 0 1487
20 TraesCS5B01G508300 chr7B 96.769 1702 36 7 840 2522 552931876 552930175 0 2820
21 TraesCS5B01G508300 chr7B 98.694 842 9 1 1 840 690308598 690307757 0 1493
22 TraesCS5B01G508300 chr1A 96.763 1699 38 5 840 2522 22791796 22793493 0 2817
23 TraesCS5B01G508300 chr4A 96.682 1688 41 5 840 2522 726682045 726680368 0 2793
24 TraesCS5B01G508300 chr4A 98.690 840 11 0 1 840 441956667 441957506 0 1491


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G508300 chr5B 673304116 673306661 2545 True 4702 4702 100.000 1 2546 1 chr5B.!!$R2 2545
1 TraesCS5B01G508300 chr5B 158569228 158570945 1717 True 2857 2857 96.808 840 2546 1 chr5B.!!$R1 1706
2 TraesCS5B01G508300 chr6A 617220879 617222602 1723 True 2885 2885 97.042 840 2546 1 chr6A.!!$R2 1706
3 TraesCS5B01G508300 chr6A 533980332 533982055 1723 True 2852 2852 96.696 840 2546 1 chr6A.!!$R1 1706
4 TraesCS5B01G508300 chr6A 616131563 616133285 1722 False 2841 2841 96.582 840 2546 1 chr6A.!!$F2 1706
5 TraesCS5B01G508300 chr6A 569700967 569701806 839 False 1496 1496 98.810 1 840 1 chr6A.!!$F1 839
6 TraesCS5B01G508300 chr1B 42160349 42162071 1722 True 2880 2880 96.984 840 2546 1 chr1B.!!$R1 1706
7 TraesCS5B01G508300 chr1B 7851343 7853065 1722 False 2868 2868 96.868 840 2546 1 chr1B.!!$F1 1706
8 TraesCS5B01G508300 chr1B 684832883 684834605 1722 True 2841 2841 96.576 840 2546 1 chr1B.!!$R4 1706
9 TraesCS5B01G508300 chr1B 60346204 60347044 840 True 1493 1493 98.692 1 841 1 chr1B.!!$R2 840
10 TraesCS5B01G508300 chr1B 633845826 633846665 839 True 1491 1491 98.690 1 840 1 chr1B.!!$R3 839
11 TraesCS5B01G508300 chr3A 54952185 54953906 1721 False 2856 2856 96.754 840 2546 1 chr3A.!!$F1 1706
12 TraesCS5B01G508300 chr3A 737590061 737590905 844 False 1498 1498 98.700 1 844 1 chr3A.!!$F2 843
13 TraesCS5B01G508300 chr6B 585915854 585917577 1723 False 2841 2841 96.580 840 2546 1 chr6B.!!$F1 1706
14 TraesCS5B01G508300 chr2A 751248584 751250307 1723 True 2835 2835 96.522 840 2546 1 chr2A.!!$R1 1706
15 TraesCS5B01G508300 chr2A 613866725 613868172 1447 False 2394 2394 96.685 840 2272 1 chr2A.!!$F2 1432
16 TraesCS5B01G508300 chr2A 159202517 159203356 839 False 1491 1491 98.692 1 841 1 chr2A.!!$F1 840
17 TraesCS5B01G508300 chr2B 757363040 757364763 1723 False 2824 2824 96.408 840 2546 1 chr2B.!!$F1 1706
18 TraesCS5B01G508300 chr2B 575371447 575372288 841 True 1493 1493 98.694 1 840 1 chr2B.!!$R1 839
19 TraesCS5B01G508300 chr2B 785969463 785970313 850 True 1487 1487 98.237 1 850 1 chr2B.!!$R2 849
20 TraesCS5B01G508300 chr7B 552930175 552931876 1701 True 2820 2820 96.769 840 2522 1 chr7B.!!$R1 1682
21 TraesCS5B01G508300 chr7B 690307757 690308598 841 True 1493 1493 98.694 1 840 1 chr7B.!!$R2 839
22 TraesCS5B01G508300 chr1A 22791796 22793493 1697 False 2817 2817 96.763 840 2522 1 chr1A.!!$F1 1682
23 TraesCS5B01G508300 chr4A 726680368 726682045 1677 True 2793 2793 96.682 840 2522 1 chr4A.!!$R1 1682
24 TraesCS5B01G508300 chr4A 441956667 441957506 839 False 1491 1491 98.690 1 840 1 chr4A.!!$F1 839

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
272 273 1.754234 GGGCTGGCAATCCGAATGT 60.754 57.895 2.88 0.0 34.14 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1745 1761 0.398381 TGGCCCAAGAGCAACCTTTT 60.398 50.0 0.0 0.0 0.0 2.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
268 269 3.329542 GACTGGGCTGGCAATCCGA 62.330 63.158 2.88 0.0 34.14 4.55
272 273 1.754234 GGGCTGGCAATCCGAATGT 60.754 57.895 2.88 0.0 34.14 2.71
560 561 5.122519 TGAAGTTGACTATCACTTTGTGCA 58.877 37.500 0.00 0.0 32.98 4.57
1073 1080 1.634702 GACATGCCTGTCTTCGTCTC 58.365 55.000 14.17 0.0 46.84 3.36
1114 1121 3.189287 CGTTGATCAAAGGGTTTCTCAGG 59.811 47.826 10.35 0.0 0.00 3.86
1245 1252 0.884259 TGGTGTTCATGCAGGTGACG 60.884 55.000 0.00 0.0 0.00 4.35
1337 1344 4.183686 GCGCATGCTGCCACGAAT 62.184 61.111 17.13 0.0 41.12 3.34
1380 1387 1.765314 CCGGAAGAAGAGATGGATGGT 59.235 52.381 0.00 0.0 0.00 3.55
1492 1502 7.094463 CCATTTGCAAATACTTTTGGGCATTTA 60.094 33.333 23.69 0.0 42.09 1.40
1493 1503 6.793492 TTGCAAATACTTTTGGGCATTTAC 57.207 33.333 0.00 0.0 42.09 2.01
1522 1532 2.919666 AATCGCACTGGTTGTAATGC 57.080 45.000 0.00 0.0 34.66 3.56
1745 1761 2.362077 GCTCTGCCTTTCTGTCCAAAAA 59.638 45.455 0.00 0.0 0.00 1.94
1809 1825 2.092429 CAGGCTAGACTAATGGGCCAAA 60.092 50.000 11.89 0.0 44.60 3.28
2352 2388 8.553459 TCCTTTGTTTTGCACTTAAATTTTGA 57.447 26.923 0.00 0.0 0.00 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
162 163 6.172966 GTGAAACGAATATAGCGCAAAATG 57.827 37.500 11.47 0.0 0.00 2.32
268 269 1.153369 CCGTGGATCGCCTGACATT 60.153 57.895 0.00 0.0 38.35 2.71
560 561 2.297315 TGCTTCTGAGAGACACGTTCAT 59.703 45.455 0.00 0.0 0.00 2.57
939 946 1.679311 CACTGCTAGCTTCCCACCA 59.321 57.895 17.23 0.0 0.00 4.17
1100 1107 0.537371 CGGTGCCTGAGAAACCCTTT 60.537 55.000 0.00 0.0 0.00 3.11
1114 1121 1.084370 CGATTCTGGTTCCTCGGTGC 61.084 60.000 0.00 0.0 0.00 5.01
1245 1252 2.218603 TCGACCCAAAGAAAGAAGCAC 58.781 47.619 0.00 0.0 0.00 4.40
1380 1387 1.224069 GCTCTCTGTTGCGTGCTTCA 61.224 55.000 0.00 0.0 0.00 3.02
1492 1502 2.158957 CCAGTGCGATTACCATACCTGT 60.159 50.000 0.00 0.0 0.00 4.00
1493 1503 2.158957 ACCAGTGCGATTACCATACCTG 60.159 50.000 0.00 0.0 0.00 4.00
1522 1532 6.211587 TCATGCCTTTCCATACATTTTCAG 57.788 37.500 0.00 0.0 0.00 3.02
1745 1761 0.398381 TGGCCCAAGAGCAACCTTTT 60.398 50.000 0.00 0.0 0.00 2.27
1809 1825 2.708037 ATGGGCCTAATTGGATGCAT 57.292 45.000 4.53 0.0 38.35 3.96
2009 2029 4.837860 AGGCACATTTTCCATGACCTTTTA 59.162 37.500 0.00 0.0 0.00 1.52
2014 2034 2.165030 CTGAGGCACATTTTCCATGACC 59.835 50.000 0.00 0.0 0.00 4.02
2125 2146 3.922171 TTTGTGCATTTTCCACCCTTT 57.078 38.095 0.00 0.0 32.30 3.11
2177 2207 1.033574 CGGCCCTAAACACCACAAAA 58.966 50.000 0.00 0.0 0.00 2.44
2296 2331 0.310543 ACGCGTGTGCAAACATTCAT 59.689 45.000 12.93 0.0 42.97 2.57
2352 2388 4.037222 ACATTTTCAACCTTCCAACCCTT 58.963 39.130 0.00 0.0 0.00 3.95


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.