Multiple sequence alignment - TraesCS5B01G490200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G490200 chr5B 100.000 2636 0 0 1 2636 659536140 659538775 0 4868
1 TraesCS5B01G490200 chr5B 94.509 1730 90 3 1 1726 529280456 529282184 0 2663
2 TraesCS5B01G490200 chr5B 99.011 910 9 0 1727 2636 659544669 659545578 0 1631
3 TraesCS5B01G490200 chr6B 96.994 1730 48 2 1 1726 147950687 147948958 0 2904
4 TraesCS5B01G490200 chr6B 93.811 1729 104 1 1 1726 567118187 567116459 0 2597
5 TraesCS5B01G490200 chr6B 98.901 910 10 0 1727 2636 466633404 466634313 0 1626
6 TraesCS5B01G490200 chr4B 96.530 1729 56 2 1 1726 622503280 622501553 0 2857
7 TraesCS5B01G490200 chr3D 95.142 1729 81 1 1 1726 558679303 558681031 0 2724
8 TraesCS5B01G490200 chr7B 95.200 1729 71 5 1 1726 36428066 36426347 0 2723
9 TraesCS5B01G490200 chr7B 99.121 910 8 0 1727 2636 150995814 150996723 0 1637
10 TraesCS5B01G490200 chr4D 95.147 1731 64 7 1 1726 473971221 473969506 0 2713
11 TraesCS5B01G490200 chr5D 94.858 1731 78 5 1 1726 387241779 387243503 0 2693
12 TraesCS5B01G490200 chr2B 94.162 1730 94 5 1 1726 664330484 664328758 0 2628
13 TraesCS5B01G490200 chr4A 99.121 910 7 1 1727 2636 450421858 450420950 0 1635
14 TraesCS5B01G490200 chr4A 99.011 910 9 0 1727 2636 450428768 450427859 0 1631
15 TraesCS5B01G490200 chr5A 99.011 910 9 0 1727 2636 124901271 124902180 0 1631
16 TraesCS5B01G490200 chr6A 99.009 908 9 0 1729 2636 176270351 176271258 0 1628
17 TraesCS5B01G490200 chr6A 98.901 910 10 0 1727 2636 176277131 176278040 0 1626
18 TraesCS5B01G490200 chr6A 98.901 910 10 0 1727 2636 563761058 563760149 0 1626


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G490200 chr5B 659536140 659538775 2635 False 4868 4868 100.000 1 2636 1 chr5B.!!$F2 2635
1 TraesCS5B01G490200 chr5B 529280456 529282184 1728 False 2663 2663 94.509 1 1726 1 chr5B.!!$F1 1725
2 TraesCS5B01G490200 chr5B 659544669 659545578 909 False 1631 1631 99.011 1727 2636 1 chr5B.!!$F3 909
3 TraesCS5B01G490200 chr6B 147948958 147950687 1729 True 2904 2904 96.994 1 1726 1 chr6B.!!$R1 1725
4 TraesCS5B01G490200 chr6B 567116459 567118187 1728 True 2597 2597 93.811 1 1726 1 chr6B.!!$R2 1725
5 TraesCS5B01G490200 chr6B 466633404 466634313 909 False 1626 1626 98.901 1727 2636 1 chr6B.!!$F1 909
6 TraesCS5B01G490200 chr4B 622501553 622503280 1727 True 2857 2857 96.530 1 1726 1 chr4B.!!$R1 1725
7 TraesCS5B01G490200 chr3D 558679303 558681031 1728 False 2724 2724 95.142 1 1726 1 chr3D.!!$F1 1725
8 TraesCS5B01G490200 chr7B 36426347 36428066 1719 True 2723 2723 95.200 1 1726 1 chr7B.!!$R1 1725
9 TraesCS5B01G490200 chr7B 150995814 150996723 909 False 1637 1637 99.121 1727 2636 1 chr7B.!!$F1 909
10 TraesCS5B01G490200 chr4D 473969506 473971221 1715 True 2713 2713 95.147 1 1726 1 chr4D.!!$R1 1725
11 TraesCS5B01G490200 chr5D 387241779 387243503 1724 False 2693 2693 94.858 1 1726 1 chr5D.!!$F1 1725
12 TraesCS5B01G490200 chr2B 664328758 664330484 1726 True 2628 2628 94.162 1 1726 1 chr2B.!!$R1 1725
13 TraesCS5B01G490200 chr4A 450420950 450421858 908 True 1635 1635 99.121 1727 2636 1 chr4A.!!$R1 909
14 TraesCS5B01G490200 chr4A 450427859 450428768 909 True 1631 1631 99.011 1727 2636 1 chr4A.!!$R2 909
15 TraesCS5B01G490200 chr5A 124901271 124902180 909 False 1631 1631 99.011 1727 2636 1 chr5A.!!$F1 909
16 TraesCS5B01G490200 chr6A 176270351 176271258 907 False 1628 1628 99.009 1729 2636 1 chr6A.!!$F1 907
17 TraesCS5B01G490200 chr6A 176277131 176278040 909 False 1626 1626 98.901 1727 2636 1 chr6A.!!$F2 909
18 TraesCS5B01G490200 chr6A 563760149 563761058 909 True 1626 1626 98.901 1727 2636 1 chr6A.!!$R1 909

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
596 601 1.26402 CAACTGTGGACAATGTGACGG 59.736 52.381 0.0 0.0 0.0 4.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2479 2498 2.443255 GGGATCTGGATACCCATGTTGT 59.557 50.0 0.39 0.0 42.59 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
296 298 4.467084 GATGACGGCGGCCAAGGA 62.467 66.667 20.71 0.0 0.00 3.36
374 376 1.374947 CCACGAGGTTGACATGGGT 59.625 57.895 0.00 0.0 0.00 4.51
403 405 2.496899 TCATCCTTTCCTTGACCAGC 57.503 50.000 0.00 0.0 0.00 4.85
527 532 2.730382 TGATCTAGCTGGTTACACCGA 58.270 47.619 0.00 0.0 42.58 4.69
596 601 1.264020 CAACTGTGGACAATGTGACGG 59.736 52.381 0.00 0.0 0.00 4.79
827 832 1.664306 GAGGTGGTCGTTCTTCCGT 59.336 57.895 0.00 0.0 0.00 4.69
908 914 7.723616 TCCGGATGGTTGAAATAATATGAATGT 59.276 33.333 0.00 0.0 36.30 2.71
1003 1010 6.186957 ACCACTCATATTTTTGTAGGCATGA 58.813 36.000 0.00 0.0 0.00 3.07
1106 1113 4.504461 CGAGGTGACGGAAAAAGATATGAG 59.496 45.833 0.00 0.0 0.00 2.90
1391 1402 4.081254 TCAAGATGTTCCAGAGGATGTCAG 60.081 45.833 0.00 0.0 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 20 1.182385 TCCATTTGGCGGTGGTTTCC 61.182 55.000 3.10 0.00 36.84 3.13
315 317 3.461773 CGCACGGTCCTCCCATCT 61.462 66.667 0.00 0.00 0.00 2.90
374 376 2.239654 AGGAAAGGATGAAATCGAGGCA 59.760 45.455 0.00 0.00 46.86 4.75
403 405 0.904649 TCATAGTCAGGCCACTGTGG 59.095 55.000 22.46 22.46 45.14 4.17
527 532 5.708230 TGACCGCTACCAAACTATTTCATTT 59.292 36.000 0.00 0.00 0.00 2.32
596 601 1.276989 TCCTAACATTGTGTCCCGGAC 59.723 52.381 10.96 10.96 0.00 4.79
632 637 1.635663 CGTGTTGGCATCGGTCCTTC 61.636 60.000 0.00 0.00 0.00 3.46
827 832 4.716794 GATCCTCCTCGTCCTAGTAAGAA 58.283 47.826 0.00 0.00 0.00 2.52
1003 1010 1.405526 CGTCATGGAACCGGATGAAGT 60.406 52.381 9.46 0.00 30.45 3.01
1106 1113 2.489329 CCACACCAACATGATGGAGTTC 59.511 50.000 27.18 0.00 40.77 3.01
1272 1279 6.935167 AGTTGAAGTTGGACAAAATTTGAGT 58.065 32.000 13.19 0.00 0.00 3.41
1391 1402 7.872113 AGACAATCTTGATATTGGTCCTTTC 57.128 36.000 0.00 0.00 40.48 2.62
1428 1439 4.133820 TCTGAAATGCTTCTTCAAACCGA 58.866 39.130 0.00 0.00 32.57 4.69
2479 2498 2.443255 GGGATCTGGATACCCATGTTGT 59.557 50.000 0.39 0.00 42.59 3.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.