Multiple sequence alignment - TraesCS5B01G489000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G489000 chr5B 100.000 6211 0 0 1 6211 658920627 658914417 0.000000e+00 11470.0
1 TraesCS5B01G489000 chr5B 86.275 255 33 2 412 664 618270107 618269853 6.130000e-70 276.0
2 TraesCS5B01G489000 chr5B 86.869 99 8 3 3532 3626 658916999 658916902 8.520000e-19 106.0
3 TraesCS5B01G489000 chr5B 86.869 99 8 3 3629 3726 658917096 658917002 8.520000e-19 106.0
4 TraesCS5B01G489000 chr5B 93.023 43 3 0 2455 2497 47119545 47119587 5.200000e-06 63.9
5 TraesCS5B01G489000 chr5D 85.605 2744 188 81 692 3353 524441786 524439168 0.000000e+00 2687.0
6 TraesCS5B01G489000 chr5D 91.939 1836 95 17 3516 5334 524439165 524437366 0.000000e+00 2521.0
7 TraesCS5B01G489000 chr5D 94.828 174 7 2 3348 3521 53583072 53583243 2.850000e-68 270.0
8 TraesCS5B01G489000 chr5D 96.250 160 6 0 3355 3514 345684356 345684197 4.770000e-66 263.0
9 TraesCS5B01G489000 chr5D 87.692 195 19 2 50 239 524444107 524443913 8.100000e-54 222.0
10 TraesCS5B01G489000 chr5A 83.942 2491 221 85 886 3319 650643898 650641530 0.000000e+00 2218.0
11 TraesCS5B01G489000 chr5A 88.813 1752 131 35 3518 5230 650641481 650639756 0.000000e+00 2089.0
12 TraesCS5B01G489000 chr5A 92.424 66 5 0 240 305 650646026 650645961 1.840000e-15 95.3
13 TraesCS5B01G489000 chr2B 87.259 259 31 2 404 660 627873461 627873719 1.690000e-75 294.0
14 TraesCS5B01G489000 chrUn 87.352 253 32 0 408 660 112557178 112557430 2.190000e-74 291.0
15 TraesCS5B01G489000 chrUn 85.606 264 33 4 404 665 31793155 31792895 7.930000e-69 272.0
16 TraesCS5B01G489000 chrUn 94.611 167 8 1 3348 3514 127140018 127140183 2.220000e-64 257.0
17 TraesCS5B01G489000 chrUn 89.394 66 7 0 2444 2509 433064932 433064867 3.990000e-12 84.2
18 TraesCS5B01G489000 chr6D 87.550 249 30 1 412 660 424807318 424807071 2.830000e-73 287.0
19 TraesCS5B01G489000 chr3B 86.381 257 34 1 404 660 262079698 262079443 4.740000e-71 279.0
20 TraesCS5B01G489000 chr3B 73.884 739 114 43 1054 1749 412905804 412906506 8.100000e-54 222.0
21 TraesCS5B01G489000 chr7D 85.824 261 35 2 401 660 523191374 523191633 6.130000e-70 276.0
22 TraesCS5B01G489000 chr7B 85.824 261 35 2 402 660 199792902 199792642 6.130000e-70 276.0
23 TraesCS5B01G489000 chr7B 85.714 259 37 0 401 659 691043400 691043658 2.210000e-69 274.0
24 TraesCS5B01G489000 chr4A 96.875 160 5 0 3355 3514 517406631 517406472 1.030000e-67 268.0
25 TraesCS5B01G489000 chr4A 89.394 66 7 0 2444 2509 643576014 643576079 3.990000e-12 84.2
26 TraesCS5B01G489000 chr2D 96.875 160 5 0 3355 3514 362930968 362930809 1.030000e-67 268.0
27 TraesCS5B01G489000 chr2D 92.179 179 13 1 3345 3523 87407533 87407356 1.030000e-62 252.0
28 TraesCS5B01G489000 chr2D 92.208 77 6 0 2433 2509 179346215 179346139 6.580000e-20 110.0
29 TraesCS5B01G489000 chr3D 95.732 164 6 1 3355 3517 537154703 537154866 4.770000e-66 263.0
30 TraesCS5B01G489000 chr2A 94.186 172 10 0 3347 3518 734269868 734270039 4.770000e-66 263.0
31 TraesCS5B01G489000 chr1D 95.210 167 6 2 3350 3514 338937206 338937372 4.770000e-66 263.0
32 TraesCS5B01G489000 chr1A 92.208 77 6 0 2433 2509 525191295 525191371 6.580000e-20 110.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G489000 chr5B 658914417 658920627 6210 True 3894.000000 11470 91.246 1 6211 3 chr5B.!!$R2 6210
1 TraesCS5B01G489000 chr5D 524437366 524444107 6741 True 1810.000000 2687 88.412 50 5334 3 chr5D.!!$R2 5284
2 TraesCS5B01G489000 chr5A 650639756 650646026 6270 True 1467.433333 2218 88.393 240 5230 3 chr5A.!!$R1 4990
3 TraesCS5B01G489000 chr3B 412905804 412906506 702 False 222.000000 222 73.884 1054 1749 1 chr3B.!!$F1 695


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
485 486 0.027194 CGATGCGCATTCAGTGGAAG 59.973 55.0 26.12 4.12 36.25 3.46 F
487 488 0.035152 ATGCGCATTCAGTGGAAGGA 60.035 50.0 19.28 0.00 36.97 3.36 F
793 4351 0.108424 CCTGAGCACTGACTGGCTAC 60.108 60.0 0.00 0.00 41.22 3.58 F
1477 5126 0.110238 CGTGGCTGTTTGGATTCGTG 60.110 55.0 0.00 0.00 0.00 4.35 F
1498 5147 0.165944 GCGTATTTGTCGTGCTTGCT 59.834 50.0 0.00 0.00 0.00 3.91 F
2265 5982 0.179073 GCAGCGTGTCTATGGACCAT 60.179 55.0 12.67 12.67 41.47 3.55 F
3370 7108 0.115745 ACCACTCCCTCCGTTCCTAA 59.884 55.0 0.00 0.00 0.00 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1770 5474 0.032952 TTTCCAGACGGACCAGTTCG 59.967 55.0 0.0 0.0 42.67 3.95 R
1859 5563 0.172803 ACGCATCACCTACGAGTTCC 59.827 55.0 0.0 0.0 0.00 3.62 R
2711 6437 0.035630 ACTGCCTCTGCCAAGATGAC 60.036 55.0 0.0 0.0 36.33 3.06 R
3142 6868 0.035458 CTCCCACCTGACGAAAAGCT 59.965 55.0 0.0 0.0 0.00 3.74 R
3153 6879 0.706433 AACCATCAATGCTCCCACCT 59.294 50.0 0.0 0.0 0.00 4.00 R
3502 7240 0.981183 TGCAATACACTCCCTCCGTT 59.019 50.0 0.0 0.0 0.00 4.44 R
5290 9072 0.249280 ACATCGACACAACACTCGCA 60.249 50.0 0.0 0.0 0.00 5.10 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 0.991920 TTTCACTGTCATCCCCTCCC 59.008 55.000 0.00 0.00 0.00 4.30
21 22 0.119155 TTCACTGTCATCCCCTCCCT 59.881 55.000 0.00 0.00 0.00 4.20
22 23 0.119155 TCACTGTCATCCCCTCCCTT 59.881 55.000 0.00 0.00 0.00 3.95
23 24 0.543749 CACTGTCATCCCCTCCCTTC 59.456 60.000 0.00 0.00 0.00 3.46
24 25 0.119155 ACTGTCATCCCCTCCCTTCA 59.881 55.000 0.00 0.00 0.00 3.02
25 26 1.274650 ACTGTCATCCCCTCCCTTCAT 60.275 52.381 0.00 0.00 0.00 2.57
26 27 1.142465 CTGTCATCCCCTCCCTTCATG 59.858 57.143 0.00 0.00 0.00 3.07
27 28 1.216990 GTCATCCCCTCCCTTCATGT 58.783 55.000 0.00 0.00 0.00 3.21
28 29 1.133976 GTCATCCCCTCCCTTCATGTG 60.134 57.143 0.00 0.00 0.00 3.21
29 30 0.184451 CATCCCCTCCCTTCATGTGG 59.816 60.000 0.00 0.00 0.00 4.17
30 31 0.046242 ATCCCCTCCCTTCATGTGGA 59.954 55.000 8.66 5.41 0.00 4.02
31 32 0.914417 TCCCCTCCCTTCATGTGGAC 60.914 60.000 8.66 0.00 0.00 4.02
32 33 1.207488 CCCCTCCCTTCATGTGGACA 61.207 60.000 8.66 0.00 0.00 4.02
33 34 0.035056 CCCTCCCTTCATGTGGACAC 60.035 60.000 8.66 0.00 0.00 3.67
34 35 0.692476 CCTCCCTTCATGTGGACACA 59.308 55.000 7.68 7.68 46.44 3.72
35 36 1.611673 CCTCCCTTCATGTGGACACAC 60.612 57.143 7.37 0.00 45.05 3.82
46 47 3.402628 GTGGACACACACTAATGGAGT 57.597 47.619 0.00 0.00 46.90 3.85
47 48 4.530710 GTGGACACACACTAATGGAGTA 57.469 45.455 0.00 0.00 46.90 2.59
48 49 4.890088 GTGGACACACACTAATGGAGTAA 58.110 43.478 0.00 0.00 46.90 2.24
49 50 5.488341 GTGGACACACACTAATGGAGTAAT 58.512 41.667 0.00 0.00 46.90 1.89
50 51 6.636705 GTGGACACACACTAATGGAGTAATA 58.363 40.000 0.00 0.00 46.90 0.98
51 52 7.101054 GTGGACACACACTAATGGAGTAATAA 58.899 38.462 0.00 0.00 46.90 1.40
52 53 7.769044 GTGGACACACACTAATGGAGTAATAAT 59.231 37.037 0.00 0.00 46.90 1.28
53 54 8.325787 TGGACACACACTAATGGAGTAATAATT 58.674 33.333 0.00 0.00 35.64 1.40
54 55 9.826574 GGACACACACTAATGGAGTAATAATTA 57.173 33.333 0.00 0.00 35.64 1.40
111 112 3.348151 TTGCCGGCCAACTATTGAA 57.652 47.368 26.77 4.72 0.00 2.69
112 113 0.885196 TTGCCGGCCAACTATTGAAC 59.115 50.000 26.77 0.00 0.00 3.18
113 114 1.302383 TGCCGGCCAACTATTGAACG 61.302 55.000 26.77 0.00 0.00 3.95
114 115 1.427819 CCGGCCAACTATTGAACGC 59.572 57.895 2.24 0.00 0.00 4.84
115 116 1.024579 CCGGCCAACTATTGAACGCT 61.025 55.000 2.24 0.00 0.00 5.07
116 117 0.373716 CGGCCAACTATTGAACGCTC 59.626 55.000 2.24 0.00 0.00 5.03
117 118 0.733150 GGCCAACTATTGAACGCTCC 59.267 55.000 0.00 0.00 0.00 4.70
118 119 0.733150 GCCAACTATTGAACGCTCCC 59.267 55.000 0.00 0.00 0.00 4.30
119 120 1.379527 CCAACTATTGAACGCTCCCC 58.620 55.000 0.00 0.00 0.00 4.81
120 121 1.339631 CCAACTATTGAACGCTCCCCA 60.340 52.381 0.00 0.00 0.00 4.96
121 122 2.432444 CAACTATTGAACGCTCCCCAA 58.568 47.619 0.00 0.00 0.00 4.12
122 123 2.109425 ACTATTGAACGCTCCCCAAC 57.891 50.000 0.00 0.00 0.00 3.77
123 124 1.628846 ACTATTGAACGCTCCCCAACT 59.371 47.619 0.00 0.00 0.00 3.16
124 125 2.835764 ACTATTGAACGCTCCCCAACTA 59.164 45.455 0.00 0.00 0.00 2.24
125 126 2.871096 ATTGAACGCTCCCCAACTAA 57.129 45.000 0.00 0.00 0.00 2.24
126 127 2.871096 TTGAACGCTCCCCAACTAAT 57.129 45.000 0.00 0.00 0.00 1.73
127 128 2.396590 TGAACGCTCCCCAACTAATC 57.603 50.000 0.00 0.00 0.00 1.75
128 129 1.626321 TGAACGCTCCCCAACTAATCA 59.374 47.619 0.00 0.00 0.00 2.57
129 130 2.039216 TGAACGCTCCCCAACTAATCAA 59.961 45.455 0.00 0.00 0.00 2.57
130 131 2.403252 ACGCTCCCCAACTAATCAAG 57.597 50.000 0.00 0.00 0.00 3.02
131 132 1.017387 CGCTCCCCAACTAATCAAGC 58.983 55.000 0.00 0.00 0.00 4.01
132 133 1.678728 CGCTCCCCAACTAATCAAGCA 60.679 52.381 0.00 0.00 0.00 3.91
133 134 1.745653 GCTCCCCAACTAATCAAGCAC 59.254 52.381 0.00 0.00 0.00 4.40
134 135 2.619074 GCTCCCCAACTAATCAAGCACT 60.619 50.000 0.00 0.00 0.00 4.40
135 136 3.274288 CTCCCCAACTAATCAAGCACTC 58.726 50.000 0.00 0.00 0.00 3.51
136 137 2.026262 TCCCCAACTAATCAAGCACTCC 60.026 50.000 0.00 0.00 0.00 3.85
137 138 2.025887 CCCCAACTAATCAAGCACTCCT 60.026 50.000 0.00 0.00 0.00 3.69
138 139 3.274288 CCCAACTAATCAAGCACTCCTC 58.726 50.000 0.00 0.00 0.00 3.71
139 140 3.274288 CCAACTAATCAAGCACTCCTCC 58.726 50.000 0.00 0.00 0.00 4.30
140 141 3.054802 CCAACTAATCAAGCACTCCTCCT 60.055 47.826 0.00 0.00 0.00 3.69
141 142 3.902881 ACTAATCAAGCACTCCTCCTG 57.097 47.619 0.00 0.00 0.00 3.86
142 143 2.093235 ACTAATCAAGCACTCCTCCTGC 60.093 50.000 0.00 0.00 34.63 4.85
144 145 1.871418 ATCAAGCACTCCTCCTGCTA 58.129 50.000 0.00 0.00 44.45 3.49
145 146 0.898320 TCAAGCACTCCTCCTGCTAC 59.102 55.000 0.00 0.00 44.45 3.58
146 147 0.107945 CAAGCACTCCTCCTGCTACC 60.108 60.000 0.00 0.00 44.45 3.18
147 148 0.252467 AAGCACTCCTCCTGCTACCT 60.252 55.000 0.00 0.00 44.45 3.08
148 149 0.686112 AGCACTCCTCCTGCTACCTC 60.686 60.000 0.00 0.00 43.37 3.85
149 150 2.010582 GCACTCCTCCTGCTACCTCG 62.011 65.000 0.00 0.00 0.00 4.63
150 151 1.076632 ACTCCTCCTGCTACCTCGG 60.077 63.158 0.00 0.00 0.00 4.63
151 152 2.442272 TCCTCCTGCTACCTCGGC 60.442 66.667 0.00 0.00 0.00 5.54
152 153 2.759973 CCTCCTGCTACCTCGGCA 60.760 66.667 0.00 0.00 38.10 5.69
153 154 2.136878 CCTCCTGCTACCTCGGCAT 61.137 63.158 0.00 0.00 39.07 4.40
154 155 1.365633 CTCCTGCTACCTCGGCATC 59.634 63.158 0.00 0.00 39.07 3.91
155 156 2.028190 CCTGCTACCTCGGCATCG 59.972 66.667 0.00 0.00 39.07 3.84
156 157 2.490148 CCTGCTACCTCGGCATCGA 61.490 63.158 0.00 0.00 43.86 3.59
157 158 1.299468 CTGCTACCTCGGCATCGAC 60.299 63.158 0.00 0.00 40.88 4.20
158 159 1.729470 CTGCTACCTCGGCATCGACT 61.729 60.000 0.00 0.00 40.88 4.18
159 160 1.299468 GCTACCTCGGCATCGACTG 60.299 63.158 0.00 0.00 40.88 3.51
160 161 1.725557 GCTACCTCGGCATCGACTGA 61.726 60.000 0.00 0.00 40.88 3.41
161 162 0.955178 CTACCTCGGCATCGACTGAT 59.045 55.000 0.00 0.00 40.88 2.90
162 163 1.338337 CTACCTCGGCATCGACTGATT 59.662 52.381 0.00 0.00 40.88 2.57
163 164 0.179100 ACCTCGGCATCGACTGATTG 60.179 55.000 0.00 0.00 40.88 2.67
164 165 1.493950 CCTCGGCATCGACTGATTGC 61.494 60.000 0.00 0.00 40.88 3.56
165 166 0.529337 CTCGGCATCGACTGATTGCT 60.529 55.000 7.79 0.00 40.88 3.91
166 167 0.528466 TCGGCATCGACTGATTGCTC 60.528 55.000 7.79 0.00 40.88 4.26
167 168 0.807275 CGGCATCGACTGATTGCTCA 60.807 55.000 7.79 0.00 39.00 4.26
168 169 1.372582 GGCATCGACTGATTGCTCAA 58.627 50.000 7.79 0.00 32.61 3.02
169 170 1.945394 GGCATCGACTGATTGCTCAAT 59.055 47.619 7.79 0.00 32.61 2.57
170 171 2.357009 GGCATCGACTGATTGCTCAATT 59.643 45.455 7.79 0.00 32.61 2.32
171 172 3.360533 GCATCGACTGATTGCTCAATTG 58.639 45.455 0.00 0.00 30.49 2.32
172 173 3.791122 GCATCGACTGATTGCTCAATTGG 60.791 47.826 5.42 0.00 30.49 3.16
173 174 1.739466 TCGACTGATTGCTCAATTGGC 59.261 47.619 5.42 8.66 0.00 4.52
174 175 1.530441 CGACTGATTGCTCAATTGGCG 60.530 52.381 5.42 9.20 32.85 5.69
175 176 1.739466 GACTGATTGCTCAATTGGCGA 59.261 47.619 5.42 8.32 0.00 5.54
176 177 1.741706 ACTGATTGCTCAATTGGCGAG 59.258 47.619 5.42 0.00 0.00 5.03
177 178 2.011947 CTGATTGCTCAATTGGCGAGA 58.988 47.619 5.42 0.00 31.84 4.04
178 179 2.617308 CTGATTGCTCAATTGGCGAGAT 59.383 45.455 5.42 4.26 31.84 2.75
179 180 2.356695 TGATTGCTCAATTGGCGAGATG 59.643 45.455 5.42 0.00 31.84 2.90
180 181 1.097232 TTGCTCAATTGGCGAGATGG 58.903 50.000 5.42 0.00 31.84 3.51
181 182 0.252761 TGCTCAATTGGCGAGATGGA 59.747 50.000 5.42 0.00 31.84 3.41
182 183 0.659957 GCTCAATTGGCGAGATGGAC 59.340 55.000 5.42 0.00 31.84 4.02
183 184 0.933097 CTCAATTGGCGAGATGGACG 59.067 55.000 5.42 0.00 31.84 4.79
184 185 0.461870 TCAATTGGCGAGATGGACGG 60.462 55.000 5.42 0.00 0.00 4.79
185 186 0.461870 CAATTGGCGAGATGGACGGA 60.462 55.000 0.00 0.00 0.00 4.69
186 187 0.462047 AATTGGCGAGATGGACGGAC 60.462 55.000 0.00 0.00 0.00 4.79
187 188 2.311688 ATTGGCGAGATGGACGGACC 62.312 60.000 0.00 0.00 39.54 4.46
197 198 2.421751 TGGACGGACCACAAAAGAAA 57.578 45.000 0.00 0.00 44.64 2.52
198 199 2.294074 TGGACGGACCACAAAAGAAAG 58.706 47.619 0.00 0.00 44.64 2.62
199 200 2.092861 TGGACGGACCACAAAAGAAAGA 60.093 45.455 0.00 0.00 44.64 2.52
200 201 3.146847 GGACGGACCACAAAAGAAAGAT 58.853 45.455 0.00 0.00 38.79 2.40
201 202 3.568430 GGACGGACCACAAAAGAAAGATT 59.432 43.478 0.00 0.00 38.79 2.40
202 203 4.537015 GACGGACCACAAAAGAAAGATTG 58.463 43.478 0.00 0.00 0.00 2.67
203 204 3.317993 ACGGACCACAAAAGAAAGATTGG 59.682 43.478 0.00 0.00 0.00 3.16
204 205 3.653344 GGACCACAAAAGAAAGATTGGC 58.347 45.455 0.00 0.00 0.00 4.52
205 206 3.554960 GGACCACAAAAGAAAGATTGGCC 60.555 47.826 0.00 0.00 0.00 5.36
206 207 2.035832 ACCACAAAAGAAAGATTGGCCG 59.964 45.455 0.00 0.00 0.00 6.13
207 208 2.035832 CCACAAAAGAAAGATTGGCCGT 59.964 45.455 0.00 0.00 0.00 5.68
208 209 3.052036 CACAAAAGAAAGATTGGCCGTG 58.948 45.455 0.00 0.00 0.00 4.94
209 210 2.061028 CAAAAGAAAGATTGGCCGTGC 58.939 47.619 0.00 0.00 0.00 5.34
221 222 3.261441 GCCGTGCCAAATGATGATG 57.739 52.632 0.00 0.00 0.00 3.07
222 223 0.740149 GCCGTGCCAAATGATGATGA 59.260 50.000 0.00 0.00 0.00 2.92
223 224 1.134753 GCCGTGCCAAATGATGATGAA 59.865 47.619 0.00 0.00 0.00 2.57
224 225 2.223876 GCCGTGCCAAATGATGATGAAT 60.224 45.455 0.00 0.00 0.00 2.57
225 226 3.738899 GCCGTGCCAAATGATGATGAATT 60.739 43.478 0.00 0.00 0.00 2.17
226 227 4.435425 CCGTGCCAAATGATGATGAATTT 58.565 39.130 0.00 0.00 0.00 1.82
227 228 4.269123 CCGTGCCAAATGATGATGAATTTG 59.731 41.667 0.00 0.00 41.41 2.32
228 229 4.865925 CGTGCCAAATGATGATGAATTTGT 59.134 37.500 7.20 0.00 40.57 2.83
229 230 5.349270 CGTGCCAAATGATGATGAATTTGTT 59.651 36.000 7.20 0.00 40.57 2.83
230 231 6.539324 GTGCCAAATGATGATGAATTTGTTG 58.461 36.000 7.20 0.00 40.57 3.33
231 232 5.122554 TGCCAAATGATGATGAATTTGTTGC 59.877 36.000 7.20 5.37 40.57 4.17
232 233 5.122554 GCCAAATGATGATGAATTTGTTGCA 59.877 36.000 7.20 0.00 40.57 4.08
233 234 6.539324 CCAAATGATGATGAATTTGTTGCAC 58.461 36.000 7.20 0.00 40.57 4.57
234 235 6.370442 CCAAATGATGATGAATTTGTTGCACT 59.630 34.615 7.20 0.00 40.57 4.40
235 236 6.961359 AATGATGATGAATTTGTTGCACTG 57.039 33.333 0.00 0.00 0.00 3.66
236 237 4.811908 TGATGATGAATTTGTTGCACTGG 58.188 39.130 0.00 0.00 0.00 4.00
237 238 4.281435 TGATGATGAATTTGTTGCACTGGT 59.719 37.500 0.00 0.00 0.00 4.00
238 239 4.241590 TGATGAATTTGTTGCACTGGTC 57.758 40.909 0.00 0.00 0.00 4.02
248 249 1.246649 TGCACTGGTCGCAATTCAAT 58.753 45.000 0.00 0.00 36.17 2.57
252 253 4.037690 GCACTGGTCGCAATTCAATATTC 58.962 43.478 0.00 0.00 0.00 1.75
256 257 3.376859 TGGTCGCAATTCAATATTCGCTT 59.623 39.130 0.00 0.00 0.00 4.68
293 294 3.751479 TGTGATCATTCCGTATCAGGG 57.249 47.619 0.00 0.00 32.93 4.45
301 302 1.646912 TCCGTATCAGGGTTGTTCCA 58.353 50.000 0.00 0.00 38.11 3.53
305 306 3.000727 CGTATCAGGGTTGTTCCAGTTC 58.999 50.000 0.00 0.00 38.11 3.01
307 308 1.217916 TCAGGGTTGTTCCAGTTCCA 58.782 50.000 0.00 0.00 38.11 3.53
309 310 1.133792 CAGGGTTGTTCCAGTTCCACT 60.134 52.381 0.00 0.00 38.11 4.00
318 319 3.100545 CAGTTCCACTGGTTGTGCT 57.899 52.632 0.00 0.00 42.35 4.40
319 320 2.254546 CAGTTCCACTGGTTGTGCTA 57.745 50.000 0.00 0.00 42.35 3.49
320 321 2.783135 CAGTTCCACTGGTTGTGCTAT 58.217 47.619 0.00 0.00 42.35 2.97
324 325 1.696884 TCCACTGGTTGTGCTATGACA 59.303 47.619 0.00 0.00 44.92 3.58
325 326 2.305635 TCCACTGGTTGTGCTATGACAT 59.694 45.455 0.00 0.00 44.92 3.06
326 327 3.517500 TCCACTGGTTGTGCTATGACATA 59.482 43.478 0.00 0.00 44.92 2.29
327 328 4.164030 TCCACTGGTTGTGCTATGACATAT 59.836 41.667 0.00 0.00 44.92 1.78
329 330 6.054941 CCACTGGTTGTGCTATGACATATAA 58.945 40.000 0.00 0.00 44.92 0.98
330 331 6.203530 CCACTGGTTGTGCTATGACATATAAG 59.796 42.308 0.00 0.00 44.92 1.73
331 332 6.203530 CACTGGTTGTGCTATGACATATAAGG 59.796 42.308 0.00 0.00 40.06 2.69
332 333 6.126768 ACTGGTTGTGCTATGACATATAAGGT 60.127 38.462 0.00 0.00 0.00 3.50
334 335 6.055588 GGTTGTGCTATGACATATAAGGTGT 58.944 40.000 0.00 0.00 0.00 4.16
335 336 6.017934 GGTTGTGCTATGACATATAAGGTGTG 60.018 42.308 0.00 0.00 0.00 3.82
336 337 6.478512 TGTGCTATGACATATAAGGTGTGA 57.521 37.500 0.00 0.00 0.00 3.58
338 339 7.154656 TGTGCTATGACATATAAGGTGTGATC 58.845 38.462 0.00 0.00 0.00 2.92
340 341 5.289675 GCTATGACATATAAGGTGTGATCGC 59.710 44.000 0.00 0.00 28.51 4.58
341 342 4.937201 TGACATATAAGGTGTGATCGCT 57.063 40.909 7.94 0.00 0.00 4.93
342 343 4.871513 TGACATATAAGGTGTGATCGCTC 58.128 43.478 7.94 3.63 0.00 5.03
344 345 3.898123 ACATATAAGGTGTGATCGCTCCT 59.102 43.478 21.41 21.41 34.20 3.69
346 347 2.672961 TAAGGTGTGATCGCTCCTTG 57.327 50.000 36.02 0.00 41.00 3.61
348 349 0.247736 AGGTGTGATCGCTCCTTGTC 59.752 55.000 21.41 0.00 0.00 3.18
349 350 0.037326 GGTGTGATCGCTCCTTGTCA 60.037 55.000 18.04 0.00 0.00 3.58
350 351 1.071605 GTGTGATCGCTCCTTGTCAC 58.928 55.000 7.94 0.00 40.93 3.67
351 352 0.969149 TGTGATCGCTCCTTGTCACT 59.031 50.000 7.94 0.00 41.08 3.41
353 354 2.164422 TGTGATCGCTCCTTGTCACTAG 59.836 50.000 7.94 0.00 41.08 2.57
354 355 2.164624 GTGATCGCTCCTTGTCACTAGT 59.835 50.000 0.00 0.00 38.29 2.57
355 356 2.164422 TGATCGCTCCTTGTCACTAGTG 59.836 50.000 17.17 17.17 0.00 2.74
356 357 0.888619 TCGCTCCTTGTCACTAGTGG 59.111 55.000 22.48 6.44 0.00 4.00
357 358 0.737715 CGCTCCTTGTCACTAGTGGC 60.738 60.000 20.72 20.72 35.37 5.01
358 359 0.737715 GCTCCTTGTCACTAGTGGCG 60.738 60.000 21.86 9.03 38.19 5.69
359 360 0.888619 CTCCTTGTCACTAGTGGCGA 59.111 55.000 21.86 19.20 38.19 5.54
362 363 0.244994 CTTGTCACTAGTGGCGAGCT 59.755 55.000 27.54 0.00 39.54 4.09
363 364 0.679505 TTGTCACTAGTGGCGAGCTT 59.320 50.000 21.86 0.00 38.19 3.74
364 365 1.541379 TGTCACTAGTGGCGAGCTTA 58.459 50.000 21.86 0.70 38.19 3.09
366 367 0.815734 TCACTAGTGGCGAGCTTACC 59.184 55.000 22.48 0.00 0.00 2.85
374 375 0.101759 GGCGAGCTTACCACATACGA 59.898 55.000 1.24 0.00 0.00 3.43
375 376 1.269621 GGCGAGCTTACCACATACGAT 60.270 52.381 1.24 0.00 0.00 3.73
376 377 2.470821 GCGAGCTTACCACATACGATT 58.529 47.619 0.00 0.00 0.00 3.34
378 379 4.046462 GCGAGCTTACCACATACGATTAA 58.954 43.478 0.00 0.00 0.00 1.40
379 380 4.505191 GCGAGCTTACCACATACGATTAAA 59.495 41.667 0.00 0.00 0.00 1.52
380 381 5.332355 GCGAGCTTACCACATACGATTAAAG 60.332 44.000 0.00 0.00 0.00 1.85
381 382 5.332355 CGAGCTTACCACATACGATTAAAGC 60.332 44.000 0.00 0.00 38.64 3.51
382 383 5.424757 AGCTTACCACATACGATTAAAGCA 58.575 37.500 6.51 0.00 40.33 3.91
383 384 6.055588 AGCTTACCACATACGATTAAAGCAT 58.944 36.000 6.51 0.00 40.33 3.79
384 385 6.202954 AGCTTACCACATACGATTAAAGCATC 59.797 38.462 6.51 0.00 40.33 3.91
393 394 4.183539 CGATTAAAGCATCGGTTCAGTC 57.816 45.455 0.00 0.00 42.03 3.51
394 395 3.001330 CGATTAAAGCATCGGTTCAGTCC 59.999 47.826 0.00 0.00 42.03 3.85
395 396 3.695830 TTAAAGCATCGGTTCAGTCCT 57.304 42.857 0.00 0.00 0.00 3.85
396 397 4.811969 TTAAAGCATCGGTTCAGTCCTA 57.188 40.909 0.00 0.00 0.00 2.94
400 401 1.134670 GCATCGGTTCAGTCCTAGCTT 60.135 52.381 0.00 0.00 0.00 3.74
403 404 3.361281 TCGGTTCAGTCCTAGCTTCTA 57.639 47.619 0.00 0.00 0.00 2.10
405 406 2.223618 CGGTTCAGTCCTAGCTTCTAGC 60.224 54.545 0.00 0.00 42.84 3.42
416 417 2.481289 GCTTCTAGCTCACAAGGGTT 57.519 50.000 0.00 0.00 38.45 4.11
419 420 3.807209 GCTTCTAGCTCACAAGGGTTCAA 60.807 47.826 0.00 0.00 38.45 2.69
420 421 3.685139 TCTAGCTCACAAGGGTTCAAG 57.315 47.619 0.00 0.00 0.00 3.02
423 424 1.771255 AGCTCACAAGGGTTCAAGTCT 59.229 47.619 0.00 0.00 0.00 3.24
424 425 2.173569 AGCTCACAAGGGTTCAAGTCTT 59.826 45.455 0.00 0.00 0.00 3.01
425 426 2.291741 GCTCACAAGGGTTCAAGTCTTG 59.708 50.000 6.21 6.21 42.37 3.02
427 428 2.092429 TCACAAGGGTTCAAGTCTTGCT 60.092 45.455 7.78 0.00 40.90 3.91
428 429 2.033801 CACAAGGGTTCAAGTCTTGCTG 59.966 50.000 7.78 1.49 40.90 4.41
429 430 1.000938 CAAGGGTTCAAGTCTTGCTGC 60.001 52.381 7.78 0.00 32.75 5.25
431 432 0.877743 GGGTTCAAGTCTTGCTGCTC 59.122 55.000 7.78 0.00 0.00 4.26
433 434 1.803555 GGTTCAAGTCTTGCTGCTCTC 59.196 52.381 7.78 0.00 0.00 3.20
434 435 2.487934 GTTCAAGTCTTGCTGCTCTCA 58.512 47.619 7.78 0.00 0.00 3.27
437 438 3.748083 TCAAGTCTTGCTGCTCTCATTT 58.252 40.909 7.78 0.00 0.00 2.32
438 439 4.898320 TCAAGTCTTGCTGCTCTCATTTA 58.102 39.130 7.78 0.00 0.00 1.40
439 440 5.494724 TCAAGTCTTGCTGCTCTCATTTAT 58.505 37.500 7.78 0.00 0.00 1.40
441 442 6.093219 TCAAGTCTTGCTGCTCTCATTTATTC 59.907 38.462 7.78 0.00 0.00 1.75
443 444 4.880696 GTCTTGCTGCTCTCATTTATTCCT 59.119 41.667 0.00 0.00 0.00 3.36
444 445 6.051717 GTCTTGCTGCTCTCATTTATTCCTA 58.948 40.000 0.00 0.00 0.00 2.94
445 446 6.202570 GTCTTGCTGCTCTCATTTATTCCTAG 59.797 42.308 0.00 0.00 0.00 3.02
446 447 5.876651 TGCTGCTCTCATTTATTCCTAGA 57.123 39.130 0.00 0.00 0.00 2.43
450 451 8.432013 TGCTGCTCTCATTTATTCCTAGATTTA 58.568 33.333 0.00 0.00 0.00 1.40
466 467 8.695456 TCCTAGATTTATTTCAGGATTTTTGGC 58.305 33.333 0.00 0.00 30.43 4.52
467 468 7.649306 CCTAGATTTATTTCAGGATTTTTGGCG 59.351 37.037 0.00 0.00 0.00 5.69
468 469 7.169158 AGATTTATTTCAGGATTTTTGGCGA 57.831 32.000 0.00 0.00 0.00 5.54
469 470 7.785033 AGATTTATTTCAGGATTTTTGGCGAT 58.215 30.769 0.00 0.00 0.00 4.58
470 471 7.707893 AGATTTATTTCAGGATTTTTGGCGATG 59.292 33.333 0.00 0.00 0.00 3.84
471 472 2.652941 TTCAGGATTTTTGGCGATGC 57.347 45.000 0.00 0.00 0.00 3.91
472 473 0.451383 TCAGGATTTTTGGCGATGCG 59.549 50.000 0.00 0.00 0.00 4.73
483 484 3.798380 CGATGCGCATTCAGTGGA 58.202 55.556 26.12 0.00 0.00 4.02
484 485 2.089017 CGATGCGCATTCAGTGGAA 58.911 52.632 26.12 0.00 37.45 3.53
485 486 0.027194 CGATGCGCATTCAGTGGAAG 59.973 55.000 26.12 4.12 36.25 3.46
486 487 0.379669 GATGCGCATTCAGTGGAAGG 59.620 55.000 26.12 0.00 37.84 3.46
487 488 0.035152 ATGCGCATTCAGTGGAAGGA 60.035 50.000 19.28 0.00 36.97 3.36
489 490 1.209261 TGCGCATTCAGTGGAAGGATA 59.791 47.619 5.66 0.00 36.97 2.59
490 491 1.599542 GCGCATTCAGTGGAAGGATAC 59.400 52.381 0.30 0.00 36.97 2.24
491 492 2.905075 CGCATTCAGTGGAAGGATACA 58.095 47.619 0.00 0.00 36.97 2.29
492 493 3.470709 CGCATTCAGTGGAAGGATACAT 58.529 45.455 0.00 0.00 36.97 2.29
493 494 3.879295 CGCATTCAGTGGAAGGATACATT 59.121 43.478 0.00 0.00 36.97 2.71
495 496 4.276926 GCATTCAGTGGAAGGATACATTCC 59.723 45.833 8.02 8.02 45.45 3.01
507 508 5.139435 GGATACATTCCTGTCGATGATGA 57.861 43.478 0.00 0.00 41.78 2.92
508 509 5.541845 GGATACATTCCTGTCGATGATGAA 58.458 41.667 0.00 0.00 41.78 2.57
510 511 4.478206 ACATTCCTGTCGATGATGAAGT 57.522 40.909 0.00 0.00 0.00 3.01
514 2681 1.134580 CCTGTCGATGATGAAGTGCCT 60.135 52.381 0.00 0.00 0.00 4.75
518 2685 2.021457 TCGATGATGAAGTGCCTACGA 58.979 47.619 0.00 0.00 0.00 3.43
521 2688 3.550842 CGATGATGAAGTGCCTACGATGA 60.551 47.826 0.00 0.00 0.00 2.92
557 2724 8.579850 TTTAAAATGATATGCTGGTTCAGTCT 57.420 30.769 0.00 0.00 33.43 3.24
558 2725 8.579850 TTAAAATGATATGCTGGTTCAGTCTT 57.420 30.769 0.00 0.00 33.43 3.01
559 2726 7.472334 AAAATGATATGCTGGTTCAGTCTTT 57.528 32.000 0.00 0.00 33.43 2.52
560 2727 6.690194 AATGATATGCTGGTTCAGTCTTTC 57.310 37.500 0.00 0.00 33.43 2.62
561 2728 4.183865 TGATATGCTGGTTCAGTCTTTCG 58.816 43.478 0.00 0.00 33.43 3.46
563 2730 0.756294 TGCTGGTTCAGTCTTTCGGA 59.244 50.000 0.00 0.00 33.43 4.55
564 2731 1.270305 TGCTGGTTCAGTCTTTCGGAG 60.270 52.381 0.00 0.00 33.43 4.63
566 2733 1.344763 CTGGTTCAGTCTTTCGGAGGT 59.655 52.381 0.00 0.00 0.00 3.85
567 2734 1.070134 TGGTTCAGTCTTTCGGAGGTG 59.930 52.381 0.00 0.00 0.00 4.00
568 2735 1.149148 GTTCAGTCTTTCGGAGGTGC 58.851 55.000 0.00 0.00 0.00 5.01
569 2736 1.048601 TTCAGTCTTTCGGAGGTGCT 58.951 50.000 0.00 0.00 0.00 4.40
571 2738 0.318441 CAGTCTTTCGGAGGTGCTCA 59.682 55.000 0.00 0.00 31.08 4.26
572 2739 1.066573 CAGTCTTTCGGAGGTGCTCAT 60.067 52.381 0.00 0.00 31.08 2.90
574 2741 2.428890 AGTCTTTCGGAGGTGCTCATAG 59.571 50.000 0.00 0.00 31.08 2.23
575 2742 2.427453 GTCTTTCGGAGGTGCTCATAGA 59.573 50.000 0.00 0.00 31.08 1.98
576 2743 2.690497 TCTTTCGGAGGTGCTCATAGAG 59.310 50.000 0.00 0.00 31.08 2.43
578 2745 0.259065 TCGGAGGTGCTCATAGAGGT 59.741 55.000 0.00 0.00 31.08 3.85
579 2746 1.493446 TCGGAGGTGCTCATAGAGGTA 59.507 52.381 0.00 0.00 31.08 3.08
581 2748 2.487445 CGGAGGTGCTCATAGAGGTAGA 60.487 54.545 0.00 0.00 31.08 2.59
582 2749 3.153919 GGAGGTGCTCATAGAGGTAGAG 58.846 54.545 0.00 0.00 31.08 2.43
583 2750 3.435890 GGAGGTGCTCATAGAGGTAGAGT 60.436 52.174 0.00 0.00 31.08 3.24
584 2751 3.561143 AGGTGCTCATAGAGGTAGAGTG 58.439 50.000 0.00 0.00 0.00 3.51
586 2753 3.067461 GGTGCTCATAGAGGTAGAGTGTG 59.933 52.174 0.00 0.00 0.00 3.82
587 2754 2.690497 TGCTCATAGAGGTAGAGTGTGC 59.310 50.000 0.00 0.00 0.00 4.57
588 2755 2.287308 GCTCATAGAGGTAGAGTGTGCG 60.287 54.545 0.00 0.00 0.00 5.34
589 2756 3.206964 CTCATAGAGGTAGAGTGTGCGA 58.793 50.000 0.00 0.00 0.00 5.10
590 2757 3.206964 TCATAGAGGTAGAGTGTGCGAG 58.793 50.000 0.00 0.00 0.00 5.03
591 2758 2.783609 TAGAGGTAGAGTGTGCGAGT 57.216 50.000 0.00 0.00 0.00 4.18
592 2759 1.169577 AGAGGTAGAGTGTGCGAGTG 58.830 55.000 0.00 0.00 0.00 3.51
593 2760 0.882474 GAGGTAGAGTGTGCGAGTGT 59.118 55.000 0.00 0.00 0.00 3.55
594 2761 0.598562 AGGTAGAGTGTGCGAGTGTG 59.401 55.000 0.00 0.00 0.00 3.82
595 2762 1.009389 GGTAGAGTGTGCGAGTGTGC 61.009 60.000 0.00 0.00 0.00 4.57
597 2764 1.792118 TAGAGTGTGCGAGTGTGCGT 61.792 55.000 0.00 0.00 37.81 5.24
598 2765 2.202878 AGTGTGCGAGTGTGCGTT 60.203 55.556 0.00 0.00 37.81 4.84
599 2766 1.762222 GAGTGTGCGAGTGTGCGTTT 61.762 55.000 0.00 0.00 37.81 3.60
600 2767 0.528901 AGTGTGCGAGTGTGCGTTTA 60.529 50.000 0.00 0.00 37.81 2.01
601 2768 0.511221 GTGTGCGAGTGTGCGTTTAT 59.489 50.000 0.00 0.00 37.81 1.40
602 2769 1.722464 GTGTGCGAGTGTGCGTTTATA 59.278 47.619 0.00 0.00 37.81 0.98
603 2770 1.989864 TGTGCGAGTGTGCGTTTATAG 59.010 47.619 0.00 0.00 37.81 1.31
605 2772 1.989864 TGCGAGTGTGCGTTTATAGTG 59.010 47.619 0.00 0.00 37.81 2.74
606 2773 1.323534 GCGAGTGTGCGTTTATAGTGG 59.676 52.381 0.00 0.00 0.00 4.00
607 2774 2.602878 CGAGTGTGCGTTTATAGTGGT 58.397 47.619 0.00 0.00 0.00 4.16
609 2776 3.323243 GAGTGTGCGTTTATAGTGGTGT 58.677 45.455 0.00 0.00 0.00 4.16
611 2778 2.803956 GTGTGCGTTTATAGTGGTGTGT 59.196 45.455 0.00 0.00 0.00 3.72
613 2780 2.803956 GTGCGTTTATAGTGGTGTGTGT 59.196 45.455 0.00 0.00 0.00 3.72
614 2781 3.989167 GTGCGTTTATAGTGGTGTGTGTA 59.011 43.478 0.00 0.00 0.00 2.90
615 2782 4.628333 GTGCGTTTATAGTGGTGTGTGTAT 59.372 41.667 0.00 0.00 0.00 2.29
617 2784 4.493545 GCGTTTATAGTGGTGTGTGTATGC 60.494 45.833 0.00 0.00 0.00 3.14
618 2785 4.259650 CGTTTATAGTGGTGTGTGTATGCG 60.260 45.833 0.00 0.00 0.00 4.73
619 2786 1.651987 ATAGTGGTGTGTGTATGCGC 58.348 50.000 0.00 0.00 0.00 6.09
620 2787 0.606096 TAGTGGTGTGTGTATGCGCT 59.394 50.000 9.73 0.00 0.00 5.92
621 2788 0.250295 AGTGGTGTGTGTATGCGCTT 60.250 50.000 9.73 4.59 0.00 4.68
622 2789 0.110238 GTGGTGTGTGTATGCGCTTG 60.110 55.000 9.73 0.00 0.00 4.01
627 4130 3.807622 GGTGTGTGTATGCGCTTGTATAT 59.192 43.478 9.73 0.00 0.00 0.86
647 4150 2.468532 GCGTTTGCGTCTGTACCG 59.531 61.111 0.00 0.00 40.81 4.02
649 4152 1.485514 CGTTTGCGTCTGTACCGTG 59.514 57.895 0.00 0.00 0.00 4.94
650 4153 1.210545 CGTTTGCGTCTGTACCGTGT 61.211 55.000 0.00 0.00 0.00 4.49
653 4156 2.505628 TTGCGTCTGTACCGTGTTAA 57.494 45.000 0.00 0.00 0.00 2.01
654 4157 2.505628 TGCGTCTGTACCGTGTTAAA 57.494 45.000 0.00 0.00 0.00 1.52
655 4158 2.819115 TGCGTCTGTACCGTGTTAAAA 58.181 42.857 0.00 0.00 0.00 1.52
656 4159 3.193263 TGCGTCTGTACCGTGTTAAAAA 58.807 40.909 0.00 0.00 0.00 1.94
674 4177 0.783579 AAAAATGATGCACGCAACGC 59.216 45.000 0.00 0.00 0.00 4.84
675 4178 1.008361 AAAATGATGCACGCAACGCC 61.008 50.000 0.00 0.00 0.00 5.68
676 4179 3.665825 AATGATGCACGCAACGCCG 62.666 57.895 0.00 0.00 0.00 6.46
682 4185 4.424430 CACGCAACGCCGCACTAC 62.424 66.667 0.00 0.00 0.00 2.73
690 4193 1.733758 CGCCGCACTACGTTGGTAA 60.734 57.895 0.00 0.00 41.42 2.85
697 4202 3.674138 CGCACTACGTTGGTAATACACCT 60.674 47.826 0.00 0.00 42.00 4.00
729 4239 6.201044 CACGCTAATGGAGGAGTAAGTAATTG 59.799 42.308 0.00 0.00 0.00 2.32
743 4253 3.454375 AGTAATTGATTAGCCACGTCGG 58.546 45.455 0.00 0.00 38.11 4.79
760 4287 4.730487 GCCATGTGAGCCAGTCTT 57.270 55.556 0.00 0.00 0.00 3.01
763 4290 1.065854 GCCATGTGAGCCAGTCTTACT 60.066 52.381 0.00 0.00 32.94 2.24
764 4291 2.898705 CCATGTGAGCCAGTCTTACTC 58.101 52.381 0.00 0.00 32.94 2.59
765 4292 2.234661 CCATGTGAGCCAGTCTTACTCA 59.765 50.000 0.00 0.00 38.09 3.41
774 4332 3.929610 GCCAGTCTTACTCACATTCTGAC 59.070 47.826 0.00 0.00 0.00 3.51
777 4335 5.167121 CAGTCTTACTCACATTCTGACCTG 58.833 45.833 0.00 0.00 0.00 4.00
778 4336 5.047731 CAGTCTTACTCACATTCTGACCTGA 60.048 44.000 0.00 0.00 0.00 3.86
780 4338 2.758736 ACTCACATTCTGACCTGAGC 57.241 50.000 5.68 0.00 34.62 4.26
785 4343 1.973515 ACATTCTGACCTGAGCACTGA 59.026 47.619 0.00 0.00 0.00 3.41
791 4349 1.825281 GACCTGAGCACTGACTGGCT 61.825 60.000 0.00 0.00 44.48 4.75
793 4351 0.108424 CCTGAGCACTGACTGGCTAC 60.108 60.000 0.00 0.00 41.22 3.58
804 4362 3.633094 CTGGCTACAGCGCGTCAGT 62.633 63.158 8.43 6.72 43.26 3.41
844 4405 3.305964 CAGCAGACAAAATCTTGCACTG 58.694 45.455 0.00 3.23 40.32 3.66
849 4410 3.047796 GACAAAATCTTGCACTGCTGTG 58.952 45.455 18.54 18.54 46.37 3.66
850 4411 2.223876 ACAAAATCTTGCACTGCTGTGG 60.224 45.455 23.15 8.69 43.97 4.17
864 4425 2.941720 TGCTGTGGCAAAAATGTTTTCC 59.058 40.909 0.00 0.00 46.36 3.13
865 4426 2.290367 GCTGTGGCAAAAATGTTTTCCC 59.710 45.455 0.00 0.00 38.54 3.97
866 4427 2.543430 CTGTGGCAAAAATGTTTTCCCG 59.457 45.455 0.00 0.00 29.66 5.14
867 4428 1.262950 GTGGCAAAAATGTTTTCCCGC 59.737 47.619 0.00 0.00 29.66 6.13
868 4429 1.134401 TGGCAAAAATGTTTTCCCGCA 60.134 42.857 0.00 0.00 29.66 5.69
869 4430 1.943340 GGCAAAAATGTTTTCCCGCAA 59.057 42.857 8.50 0.00 0.00 4.85
870 4431 2.032117 GGCAAAAATGTTTTCCCGCAAG 60.032 45.455 8.50 0.00 0.00 4.01
882 4443 2.945984 CGCAAGGCTTCTCGCAAA 59.054 55.556 0.00 0.00 41.67 3.68
883 4444 1.282570 CGCAAGGCTTCTCGCAAAA 59.717 52.632 0.00 0.00 41.67 2.44
884 4445 0.727122 CGCAAGGCTTCTCGCAAAAG 60.727 55.000 0.00 0.00 41.67 2.27
885 4446 0.593128 GCAAGGCTTCTCGCAAAAGA 59.407 50.000 0.00 0.00 41.67 2.52
886 4447 1.001378 GCAAGGCTTCTCGCAAAAGAA 60.001 47.619 0.00 0.00 41.67 2.52
887 4448 2.543653 GCAAGGCTTCTCGCAAAAGAAA 60.544 45.455 0.00 0.00 41.67 2.52
888 4449 3.705604 CAAGGCTTCTCGCAAAAGAAAA 58.294 40.909 0.00 0.00 41.67 2.29
889 4450 3.355626 AGGCTTCTCGCAAAAGAAAAC 57.644 42.857 0.00 0.00 41.67 2.43
903 4464 6.405216 CAAAAGAAAACGCAAGAGACAAATG 58.595 36.000 0.00 0.00 43.62 2.32
997 4565 3.260888 TGGAAATCCACGGGGGCA 61.261 61.111 2.42 0.00 42.01 5.36
998 4566 2.440247 GGAAATCCACGGGGGCAG 60.440 66.667 2.42 0.00 36.21 4.85
1279 4926 2.111878 GACAGGATGATGGGCGGG 59.888 66.667 0.00 0.00 39.69 6.13
1280 4927 4.195334 ACAGGATGATGGGCGGGC 62.195 66.667 0.00 0.00 39.69 6.13
1440 5087 1.094785 GGTTAGCGTCCGGTGTAGTA 58.905 55.000 0.00 0.00 0.00 1.82
1441 5088 1.202188 GGTTAGCGTCCGGTGTAGTAC 60.202 57.143 0.00 0.00 0.00 2.73
1442 5089 1.468520 GTTAGCGTCCGGTGTAGTACA 59.531 52.381 0.00 0.00 0.00 2.90
1443 5090 1.372582 TAGCGTCCGGTGTAGTACAG 58.627 55.000 2.39 0.00 0.00 2.74
1444 5091 0.607489 AGCGTCCGGTGTAGTACAGT 60.607 55.000 2.39 0.00 0.00 3.55
1445 5092 1.086696 GCGTCCGGTGTAGTACAGTA 58.913 55.000 2.39 0.00 0.00 2.74
1446 5093 1.202076 GCGTCCGGTGTAGTACAGTAC 60.202 57.143 2.39 2.05 0.00 2.73
1464 5113 0.324943 ACTACTTGATTGGCGTGGCT 59.675 50.000 0.00 0.00 0.00 4.75
1465 5114 0.729116 CTACTTGATTGGCGTGGCTG 59.271 55.000 0.00 0.00 0.00 4.85
1477 5126 0.110238 CGTGGCTGTTTGGATTCGTG 60.110 55.000 0.00 0.00 0.00 4.35
1479 5128 0.893270 TGGCTGTTTGGATTCGTGGG 60.893 55.000 0.00 0.00 0.00 4.61
1489 5138 1.329599 GGATTCGTGGGCGTATTTGTC 59.670 52.381 0.00 0.00 39.49 3.18
1494 5143 1.004320 TGGGCGTATTTGTCGTGCT 60.004 52.632 0.00 0.00 0.00 4.40
1495 5144 0.604243 TGGGCGTATTTGTCGTGCTT 60.604 50.000 0.00 0.00 0.00 3.91
1496 5145 0.179200 GGGCGTATTTGTCGTGCTTG 60.179 55.000 0.00 0.00 0.00 4.01
1497 5146 0.793104 GGCGTATTTGTCGTGCTTGC 60.793 55.000 0.00 0.00 0.00 4.01
1498 5147 0.165944 GCGTATTTGTCGTGCTTGCT 59.834 50.000 0.00 0.00 0.00 3.91
1499 5148 1.869503 CGTATTTGTCGTGCTTGCTG 58.130 50.000 0.00 0.00 0.00 4.41
1500 5149 1.459209 CGTATTTGTCGTGCTTGCTGA 59.541 47.619 0.00 0.00 0.00 4.26
1501 5150 2.096466 CGTATTTGTCGTGCTTGCTGAA 60.096 45.455 0.00 0.00 0.00 3.02
1540 5194 5.519722 CCTAATTCGTCTTGCTGTTTTTGT 58.480 37.500 0.00 0.00 0.00 2.83
1551 5205 2.160285 GCTGTTTTTGTTCGATTTCGCG 60.160 45.455 0.00 0.00 39.60 5.87
1632 5288 9.476202 AAGCTTGTTAAGTTGTTATGGAAATTC 57.524 29.630 0.00 0.00 0.00 2.17
1668 5344 6.483307 TGCATCGCTTAATTAGTTGCTTCTAT 59.517 34.615 7.41 0.00 31.73 1.98
1672 5348 6.198403 TCGCTTAATTAGTTGCTTCTATGACG 59.802 38.462 5.92 0.00 0.00 4.35
1674 5350 7.559845 GCTTAATTAGTTGCTTCTATGACGAG 58.440 38.462 0.00 0.00 0.00 4.18
1685 5361 4.439253 TCTATGACGAGATCAGGGAGAA 57.561 45.455 0.00 0.00 41.91 2.87
1686 5362 4.793201 TCTATGACGAGATCAGGGAGAAA 58.207 43.478 0.00 0.00 41.91 2.52
1687 5363 5.389520 TCTATGACGAGATCAGGGAGAAAT 58.610 41.667 0.00 0.00 41.91 2.17
1704 5380 7.499232 AGGGAGAAATAACGATGGAAATTGTAG 59.501 37.037 0.00 0.00 0.00 2.74
1721 5409 8.409358 AAATTGTAGTCAGAAAAATACAGGCT 57.591 30.769 0.00 0.00 30.39 4.58
1756 5460 3.254892 GTTTGTCCGAGGAAGAGATCAC 58.745 50.000 0.00 0.00 0.00 3.06
1767 5471 4.761739 AGGAAGAGATCACGCAAAATTTCA 59.238 37.500 0.00 0.00 0.00 2.69
1770 5474 5.288543 AGAGATCACGCAAAATTTCAGAC 57.711 39.130 0.00 0.00 0.00 3.51
1824 5528 6.000840 ACATCATTAGATCGCAGAGAGACTA 58.999 40.000 0.00 0.00 43.63 2.59
1826 5530 5.616270 TCATTAGATCGCAGAGAGACTACT 58.384 41.667 0.00 0.00 43.63 2.57
1833 5537 8.712285 AGATCGCAGAGAGACTACTATAATAC 57.288 38.462 0.00 0.00 43.63 1.89
1836 5540 8.984891 TCGCAGAGAGACTACTATAATACTAC 57.015 38.462 0.00 0.00 0.00 2.73
1837 5541 8.805175 TCGCAGAGAGACTACTATAATACTACT 58.195 37.037 0.00 0.00 0.00 2.57
1838 5542 9.079833 CGCAGAGAGACTACTATAATACTACTC 57.920 40.741 0.00 0.00 0.00 2.59
1839 5543 9.079833 GCAGAGAGACTACTATAATACTACTCG 57.920 40.741 0.00 0.00 0.00 4.18
1861 5565 7.565190 TCGTAGAGTAGATAGAATTAGGGGA 57.435 40.000 0.00 0.00 0.00 4.81
1862 5566 7.982252 TCGTAGAGTAGATAGAATTAGGGGAA 58.018 38.462 0.00 0.00 0.00 3.97
1863 5567 7.882271 TCGTAGAGTAGATAGAATTAGGGGAAC 59.118 40.741 0.00 0.00 0.00 3.62
1864 5568 7.884354 CGTAGAGTAGATAGAATTAGGGGAACT 59.116 40.741 0.00 0.00 0.00 3.01
1871 5575 3.991683 AGAATTAGGGGAACTCGTAGGT 58.008 45.455 0.00 0.00 0.00 3.08
1876 5580 0.179081 GGGGAACTCGTAGGTGATGC 60.179 60.000 0.00 0.00 0.00 3.91
1880 5584 2.034305 GGAACTCGTAGGTGATGCGTAT 59.966 50.000 0.00 0.00 38.29 3.06
1898 5602 3.482472 CGTATGAGTCAACGTCAGTATGC 59.518 47.826 15.34 0.00 34.76 3.14
1899 5603 2.363788 TGAGTCAACGTCAGTATGCC 57.636 50.000 0.00 0.00 34.76 4.40
1908 5612 1.463674 GTCAGTATGCCCCAAACCTG 58.536 55.000 0.00 0.00 34.76 4.00
1909 5613 0.323360 TCAGTATGCCCCAAACCTGC 60.323 55.000 0.00 0.00 34.76 4.85
1926 5631 0.531657 TGCATCGCAATTCCCCTTTG 59.468 50.000 0.00 0.00 34.76 2.77
1960 5665 2.279136 CGATTTAGACGCGTCTTCTTGG 59.721 50.000 42.90 26.10 40.93 3.61
1967 5672 0.519175 CGCGTCTTCTTGGCAATTCG 60.519 55.000 0.00 3.10 0.00 3.34
1975 5680 2.268988 CTTGGCAATTCGGATGCGCA 62.269 55.000 14.96 14.96 44.75 6.09
1991 5696 4.560136 TGCGCAAACAATCTAAACAAGA 57.440 36.364 8.16 0.00 39.02 3.02
1992 5697 4.536065 TGCGCAAACAATCTAAACAAGAG 58.464 39.130 8.16 0.00 37.74 2.85
2013 5718 3.198853 AGAGCAAGTAGAAGGATCCAACC 59.801 47.826 15.82 2.02 0.00 3.77
2028 5733 0.450184 CAACCTAATTTGGCCGTCCG 59.550 55.000 5.79 0.00 34.14 4.79
2031 5736 1.170442 CCTAATTTGGCCGTCCGTTT 58.830 50.000 0.00 0.00 34.14 3.60
2033 5738 1.807742 CTAATTTGGCCGTCCGTTTCA 59.192 47.619 0.00 0.00 34.14 2.69
2060 5765 8.833231 TGCCTCTGTAACTCTATTATATTTGC 57.167 34.615 0.00 0.00 0.00 3.68
2072 5777 9.155975 CTCTATTATATTTGCTGACATGGGTAC 57.844 37.037 0.00 0.00 0.00 3.34
2099 5804 6.294899 CCACCATTTGAGATTGATGTGACTTT 60.295 38.462 0.00 0.00 0.00 2.66
2132 5837 5.381174 TGATCTTTGAATGGTTCTTGCTG 57.619 39.130 0.00 0.00 0.00 4.41
2143 5848 2.608752 GGTTCTTGCTGTGCATCAAAGG 60.609 50.000 0.00 0.00 38.76 3.11
2197 5914 1.609072 GCTTTGGAGTTGACCTGTTCC 59.391 52.381 0.00 0.00 0.00 3.62
2208 5925 2.687935 TGACCTGTTCCTGTTTTGCTTC 59.312 45.455 0.00 0.00 0.00 3.86
2209 5926 2.687935 GACCTGTTCCTGTTTTGCTTCA 59.312 45.455 0.00 0.00 0.00 3.02
2210 5927 3.299503 ACCTGTTCCTGTTTTGCTTCAT 58.700 40.909 0.00 0.00 0.00 2.57
2211 5928 3.068590 ACCTGTTCCTGTTTTGCTTCATG 59.931 43.478 0.00 0.00 0.00 3.07
2212 5929 3.068590 CCTGTTCCTGTTTTGCTTCATGT 59.931 43.478 0.00 0.00 0.00 3.21
2213 5930 4.293415 CTGTTCCTGTTTTGCTTCATGTC 58.707 43.478 0.00 0.00 0.00 3.06
2214 5931 3.953612 TGTTCCTGTTTTGCTTCATGTCT 59.046 39.130 0.00 0.00 0.00 3.41
2215 5932 4.402155 TGTTCCTGTTTTGCTTCATGTCTT 59.598 37.500 0.00 0.00 0.00 3.01
2216 5933 4.572985 TCCTGTTTTGCTTCATGTCTTG 57.427 40.909 0.00 0.00 0.00 3.02
2217 5934 3.953612 TCCTGTTTTGCTTCATGTCTTGT 59.046 39.130 0.00 0.00 0.00 3.16
2218 5935 5.129634 TCCTGTTTTGCTTCATGTCTTGTA 58.870 37.500 0.00 0.00 0.00 2.41
2219 5936 5.008613 TCCTGTTTTGCTTCATGTCTTGTAC 59.991 40.000 0.00 0.00 0.00 2.90
2220 5937 4.843147 TGTTTTGCTTCATGTCTTGTACG 58.157 39.130 0.00 0.00 0.00 3.67
2263 5980 0.807667 CAGCAGCGTGTCTATGGACC 60.808 60.000 6.77 0.00 41.47 4.46
2264 5981 1.218047 GCAGCGTGTCTATGGACCA 59.782 57.895 6.77 0.00 41.47 4.02
2265 5982 0.179073 GCAGCGTGTCTATGGACCAT 60.179 55.000 12.67 12.67 41.47 3.55
2274 5991 5.866092 CGTGTCTATGGACCATTATCATCAG 59.134 44.000 13.40 1.86 41.47 2.90
2276 5993 7.095910 GTGTCTATGGACCATTATCATCAGAG 58.904 42.308 13.40 0.30 41.47 3.35
2278 5995 4.923516 ATGGACCATTATCATCAGAGGG 57.076 45.455 0.00 0.00 0.00 4.30
2295 6012 1.625818 AGGGTTCCAGAAGTAGCAGTG 59.374 52.381 0.00 0.00 0.00 3.66
2340 6057 3.625764 TGTAAGTTGTTCACTTGCTCACC 59.374 43.478 4.74 0.00 45.98 4.02
2351 6068 4.081697 TCACTTGCTCACCATTCTTCGATA 60.082 41.667 0.00 0.00 0.00 2.92
2360 6077 7.800380 GCTCACCATTCTTCGATAAACAATATG 59.200 37.037 0.00 0.00 0.00 1.78
2450 6167 3.005050 TGCTTGTTGCTTCTCATTTCTGG 59.995 43.478 0.00 0.00 43.37 3.86
2493 6210 7.800380 CAGCTTCATTCGGATTTATGTGAATAC 59.200 37.037 0.00 0.00 30.33 1.89
2525 6242 6.657875 AGAGGTCCTTGAGAAATGAAATAGG 58.342 40.000 0.00 0.00 0.00 2.57
2541 6267 5.428457 TGAAATAGGAAGCCACCATTCTCTA 59.572 40.000 0.00 0.00 0.00 2.43
2547 6273 4.102367 GGAAGCCACCATTCTCTATCTTCT 59.898 45.833 0.00 0.00 31.93 2.85
2548 6274 4.686191 AGCCACCATTCTCTATCTTCTG 57.314 45.455 0.00 0.00 0.00 3.02
2555 6281 7.046652 CACCATTCTCTATCTTCTGTGATGTT 58.953 38.462 0.00 0.00 0.00 2.71
2584 6310 1.133790 GGAATCATGGTGCAGCAACTC 59.866 52.381 24.18 15.49 0.00 3.01
2641 6367 1.544314 GGCCAACAGAGAAGCAAGTCT 60.544 52.381 0.00 0.00 0.00 3.24
2646 6372 2.324541 ACAGAGAAGCAAGTCTCCAGT 58.675 47.619 8.09 5.58 44.43 4.00
2666 6392 5.357032 CCAGTAACAACAACTTTCTTCCTGT 59.643 40.000 0.00 0.00 0.00 4.00
2695 6421 2.838202 ACTGTCTCGGATTATGGGTTGT 59.162 45.455 0.00 0.00 0.00 3.32
2711 6437 3.139077 GGTTGTCCTATCGGCCTAAATG 58.861 50.000 0.00 0.00 0.00 2.32
2749 6475 4.614535 GCAGTAACAAGGCAAATCAGACTG 60.615 45.833 0.00 0.00 35.88 3.51
2750 6476 4.074970 AGTAACAAGGCAAATCAGACTGG 58.925 43.478 1.81 0.00 0.00 4.00
2839 6565 3.007290 TGATTCTATGAAGATGGGCCGAG 59.993 47.826 0.00 0.00 0.00 4.63
2865 6591 0.595095 CAAAGTGCTCCCTTGCAGAC 59.405 55.000 0.00 0.00 44.20 3.51
2883 6609 3.021355 GACACAATGTCGATGTTACGC 57.979 47.619 0.00 0.00 37.67 4.42
2964 6690 3.758554 GGCATAAGAACACACAATCTGGT 59.241 43.478 0.00 0.00 0.00 4.00
3142 6868 4.183865 CAGTGAATCTGACAAGGCGATAA 58.816 43.478 0.00 0.00 46.27 1.75
3150 6876 2.415168 TGACAAGGCGATAAGCTTTTCG 59.585 45.455 28.09 28.09 42.95 3.46
3153 6879 2.415168 CAAGGCGATAAGCTTTTCGTCA 59.585 45.455 34.30 6.74 42.95 4.35
3159 6885 2.178912 TAAGCTTTTCGTCAGGTGGG 57.821 50.000 3.20 0.00 0.00 4.61
3238 6964 4.164988 ACTCCAATTTATCCTCTCTGGGTG 59.835 45.833 0.00 0.00 36.20 4.61
3355 7093 8.620416 TGCATGTGTATTTTCTTATGATACCAC 58.380 33.333 0.00 0.00 0.00 4.16
3356 7094 8.840321 GCATGTGTATTTTCTTATGATACCACT 58.160 33.333 0.00 0.00 0.00 4.00
3358 7096 8.958119 TGTGTATTTTCTTATGATACCACTCC 57.042 34.615 0.00 0.00 0.00 3.85
3359 7097 7.990886 TGTGTATTTTCTTATGATACCACTCCC 59.009 37.037 0.00 0.00 0.00 4.30
3360 7098 8.211629 GTGTATTTTCTTATGATACCACTCCCT 58.788 37.037 0.00 0.00 0.00 4.20
3361 7099 8.429641 TGTATTTTCTTATGATACCACTCCCTC 58.570 37.037 0.00 0.00 0.00 4.30
3362 7100 5.888982 TTTCTTATGATACCACTCCCTCC 57.111 43.478 0.00 0.00 0.00 4.30
3363 7101 3.497332 TCTTATGATACCACTCCCTCCG 58.503 50.000 0.00 0.00 0.00 4.63
3364 7102 3.117246 TCTTATGATACCACTCCCTCCGT 60.117 47.826 0.00 0.00 0.00 4.69
3365 7103 2.176247 ATGATACCACTCCCTCCGTT 57.824 50.000 0.00 0.00 0.00 4.44
3366 7104 1.481871 TGATACCACTCCCTCCGTTC 58.518 55.000 0.00 0.00 0.00 3.95
3367 7105 0.751452 GATACCACTCCCTCCGTTCC 59.249 60.000 0.00 0.00 0.00 3.62
3368 7106 0.338814 ATACCACTCCCTCCGTTCCT 59.661 55.000 0.00 0.00 0.00 3.36
3369 7107 1.002069 TACCACTCCCTCCGTTCCTA 58.998 55.000 0.00 0.00 0.00 2.94
3370 7108 0.115745 ACCACTCCCTCCGTTCCTAA 59.884 55.000 0.00 0.00 0.00 2.69
3371 7109 1.272807 CCACTCCCTCCGTTCCTAAA 58.727 55.000 0.00 0.00 0.00 1.85
3372 7110 1.838077 CCACTCCCTCCGTTCCTAAAT 59.162 52.381 0.00 0.00 0.00 1.40
3373 7111 3.036091 CCACTCCCTCCGTTCCTAAATA 58.964 50.000 0.00 0.00 0.00 1.40
3374 7112 3.646637 CCACTCCCTCCGTTCCTAAATAT 59.353 47.826 0.00 0.00 0.00 1.28
3375 7113 4.836736 CCACTCCCTCCGTTCCTAAATATA 59.163 45.833 0.00 0.00 0.00 0.86
3376 7114 5.306160 CCACTCCCTCCGTTCCTAAATATAA 59.694 44.000 0.00 0.00 0.00 0.98
3377 7115 6.456501 CACTCCCTCCGTTCCTAAATATAAG 58.543 44.000 0.00 0.00 0.00 1.73
3378 7116 6.041751 CACTCCCTCCGTTCCTAAATATAAGT 59.958 42.308 0.00 0.00 0.00 2.24
3379 7117 6.267242 ACTCCCTCCGTTCCTAAATATAAGTC 59.733 42.308 0.00 0.00 0.00 3.01
3380 7118 6.379579 TCCCTCCGTTCCTAAATATAAGTCT 58.620 40.000 0.00 0.00 0.00 3.24
3381 7119 6.842807 TCCCTCCGTTCCTAAATATAAGTCTT 59.157 38.462 0.00 0.00 0.00 3.01
3382 7120 7.346436 TCCCTCCGTTCCTAAATATAAGTCTTT 59.654 37.037 0.00 0.00 0.00 2.52
3383 7121 7.991460 CCCTCCGTTCCTAAATATAAGTCTTTT 59.009 37.037 0.00 0.00 0.00 2.27
3384 7122 9.392259 CCTCCGTTCCTAAATATAAGTCTTTTT 57.608 33.333 0.00 0.00 0.00 1.94
3399 7137 9.944376 ATAAGTCTTTTTAGAGATTGCACTACA 57.056 29.630 0.00 0.00 0.00 2.74
3400 7138 8.677148 AAGTCTTTTTAGAGATTGCACTACAA 57.323 30.769 0.00 0.00 44.01 2.41
3401 7139 8.677148 AGTCTTTTTAGAGATTGCACTACAAA 57.323 30.769 0.00 0.00 42.86 2.83
3402 7140 8.560374 AGTCTTTTTAGAGATTGCACTACAAAC 58.440 33.333 0.00 0.00 42.86 2.93
3403 7141 8.560374 GTCTTTTTAGAGATTGCACTACAAACT 58.440 33.333 0.00 0.00 43.46 2.66
3404 7142 9.772973 TCTTTTTAGAGATTGCACTACAAACTA 57.227 29.630 0.00 0.00 41.09 2.24
3405 7143 9.813080 CTTTTTAGAGATTGCACTACAAACTAC 57.187 33.333 0.00 0.00 41.09 2.73
3406 7144 8.896320 TTTTAGAGATTGCACTACAAACTACA 57.104 30.769 0.00 0.00 41.09 2.74
3407 7145 9.502091 TTTTAGAGATTGCACTACAAACTACAT 57.498 29.630 0.00 0.00 41.09 2.29
3409 7147 9.582431 TTAGAGATTGCACTACAAACTACATAC 57.418 33.333 0.00 0.00 41.09 2.39
3410 7148 6.752351 AGAGATTGCACTACAAACTACATACG 59.248 38.462 0.00 0.00 41.09 3.06
3411 7149 5.810587 AGATTGCACTACAAACTACATACGG 59.189 40.000 0.00 0.00 42.86 4.02
3412 7150 4.787260 TGCACTACAAACTACATACGGA 57.213 40.909 0.00 0.00 0.00 4.69
3413 7151 5.333299 TGCACTACAAACTACATACGGAT 57.667 39.130 0.00 0.00 0.00 4.18
3414 7152 5.106442 TGCACTACAAACTACATACGGATG 58.894 41.667 5.94 5.94 39.16 3.51
3415 7153 6.794981 TTGCACTACAAACTACATACGGATGT 60.795 38.462 19.12 19.12 41.55 3.06
3416 7154 6.127675 TGCACTACAAACTACATACGGATGTA 60.128 38.462 19.32 19.32 44.77 2.29
3417 7155 6.921857 GCACTACAAACTACATACGGATGTAT 59.078 38.462 20.64 8.38 45.42 2.29
3418 7156 8.077991 GCACTACAAACTACATACGGATGTATA 58.922 37.037 20.64 9.08 45.42 1.47
3475 7213 8.786826 TTTTCTTTGTATGTAGTCCATAGTGG 57.213 34.615 0.00 0.00 36.71 4.00
3476 7214 7.727578 TTCTTTGTATGTAGTCCATAGTGGA 57.272 36.000 0.00 0.00 45.98 4.02
3490 7228 6.357367 TCCATAGTGGAATCTCTAAAAAGGC 58.643 40.000 0.00 0.00 45.00 4.35
3491 7229 6.158695 TCCATAGTGGAATCTCTAAAAAGGCT 59.841 38.462 0.00 0.00 45.00 4.58
3492 7230 6.830838 CCATAGTGGAATCTCTAAAAAGGCTT 59.169 38.462 0.00 0.00 40.96 4.35
3493 7231 7.993183 CCATAGTGGAATCTCTAAAAAGGCTTA 59.007 37.037 0.00 0.00 40.96 3.09
3494 7232 9.566432 CATAGTGGAATCTCTAAAAAGGCTTAT 57.434 33.333 0.00 0.00 0.00 1.73
3506 7244 9.333724 TCTAAAAAGGCTTATATTTAGGAACGG 57.666 33.333 21.19 4.97 36.48 4.44
3507 7245 9.333724 CTAAAAAGGCTTATATTTAGGAACGGA 57.666 33.333 16.77 0.00 33.69 4.69
3508 7246 7.803279 AAAAGGCTTATATTTAGGAACGGAG 57.197 36.000 0.00 0.00 0.00 4.63
3509 7247 5.485209 AGGCTTATATTTAGGAACGGAGG 57.515 43.478 0.00 0.00 0.00 4.30
3510 7248 4.286291 AGGCTTATATTTAGGAACGGAGGG 59.714 45.833 0.00 0.00 0.00 4.30
3511 7249 4.285260 GGCTTATATTTAGGAACGGAGGGA 59.715 45.833 0.00 0.00 0.00 4.20
3512 7250 5.480205 GCTTATATTTAGGAACGGAGGGAG 58.520 45.833 0.00 0.00 0.00 4.30
3513 7251 5.011840 GCTTATATTTAGGAACGGAGGGAGT 59.988 44.000 0.00 0.00 0.00 3.85
3514 7252 4.957684 ATATTTAGGAACGGAGGGAGTG 57.042 45.455 0.00 0.00 0.00 3.51
3523 7261 1.139058 ACGGAGGGAGTGTATTGCATC 59.861 52.381 0.00 0.00 0.00 3.91
3548 7286 6.537301 CGGAGCTTTGGTTATGTCTGTAAATA 59.463 38.462 0.00 0.00 0.00 1.40
3570 7309 3.173953 AGAATCAGAAACATGGGGCAA 57.826 42.857 0.00 0.00 0.00 4.52
3583 7322 0.752658 GGGGCAAGTTTCTGTTTGCT 59.247 50.000 8.82 0.00 46.69 3.91
3668 7414 0.036010 ATCAGAAACGTGGAGCAGGG 60.036 55.000 0.00 0.00 0.00 4.45
3684 7430 2.799562 GCAGGGTTTCTGTTTGCAACTC 60.800 50.000 0.00 0.00 45.08 3.01
3738 7484 6.959671 GCTTACTGCTAGGCTATCAATTAG 57.040 41.667 0.00 0.00 38.95 1.73
3741 7487 8.432006 GCTTACTGCTAGGCTATCAATTAGCAA 61.432 40.741 11.47 0.00 45.42 3.91
3830 7576 4.755411 TGAGCTCCTCTTTTGTTATACCG 58.245 43.478 12.15 0.00 0.00 4.02
3948 7694 5.097742 TCCAGCTGAAGATTTTTCCGATA 57.902 39.130 17.39 0.00 0.00 2.92
3996 7742 5.226194 AGATCCTCATGGTAAGCAATCTC 57.774 43.478 0.00 0.00 34.23 2.75
4027 7773 9.965824 TTCTAATGTTTCAATCAACCTTCTTTC 57.034 29.630 0.00 0.00 0.00 2.62
4046 7793 9.817365 CTTCTTTCTGTATCTAATTGTGTGTTG 57.183 33.333 0.00 0.00 0.00 3.33
4082 7829 2.438075 CAGCCAAGGCCTGAGCTC 60.438 66.667 23.53 6.82 43.17 4.09
4484 8231 1.074951 GCACCCTTGGGCAACTACT 59.925 57.895 5.46 0.00 0.00 2.57
4622 8369 5.183904 AGTGTTAAATCAGAAATGGCCAGAC 59.816 40.000 13.05 4.94 0.00 3.51
4728 8475 0.523519 GTCCAGCTAGTTGCAAAGCC 59.476 55.000 17.48 0.00 45.94 4.35
4838 8585 5.003804 GTCAGGTTGATCATTGGTTGTACT 58.996 41.667 0.00 0.00 0.00 2.73
4856 8603 8.403236 GGTTGTACTGAGTATTTGTTTCTTTGT 58.597 33.333 0.00 0.00 0.00 2.83
4964 8712 7.564044 GCATATTATTTGAGAAGATGCTTGC 57.436 36.000 7.43 0.00 44.36 4.01
4979 8727 3.587498 TGCTTGCTGTAGGATATAGGGT 58.413 45.455 0.00 0.00 29.56 4.34
4980 8728 4.747583 TGCTTGCTGTAGGATATAGGGTA 58.252 43.478 0.00 0.00 29.56 3.69
5057 8805 8.482128 AGTTGAAATTCATTCTTGGTACCAAAA 58.518 29.630 26.90 21.94 38.92 2.44
5064 8812 1.165270 CTTGGTACCAAAAGGGAGCG 58.835 55.000 26.90 10.02 41.15 5.03
5118 8867 8.641499 TTGGATTTTGTCAGTTGTTACAATTC 57.359 30.769 0.00 0.00 35.64 2.17
5231 9013 6.710597 AGTAGAGCGTATATGTTTCCTTCA 57.289 37.500 0.00 0.00 0.00 3.02
5293 9075 7.647907 TTAGGACTAAGTTTCTAGTTTTGCG 57.352 36.000 0.00 0.00 32.14 4.85
5295 9077 5.927115 AGGACTAAGTTTCTAGTTTTGCGAG 59.073 40.000 0.00 0.00 32.14 5.03
5300 9082 5.156804 AGTTTCTAGTTTTGCGAGTGTTG 57.843 39.130 0.00 0.00 0.00 3.33
5317 9099 3.421888 GTGTTGTGTCGATGTTGCATTTC 59.578 43.478 0.00 0.00 0.00 2.17
5318 9100 3.065925 TGTTGTGTCGATGTTGCATTTCA 59.934 39.130 0.00 0.00 0.00 2.69
5319 9101 4.229096 GTTGTGTCGATGTTGCATTTCAT 58.771 39.130 0.00 0.00 0.00 2.57
5334 9116 9.309516 GTTGCATTTCATTGAATATTGACTGAT 57.690 29.630 0.00 0.00 0.00 2.90
5335 9117 8.865590 TGCATTTCATTGAATATTGACTGATG 57.134 30.769 0.00 0.00 0.00 3.07
5336 9118 8.471609 TGCATTTCATTGAATATTGACTGATGT 58.528 29.630 0.00 0.00 0.00 3.06
5337 9119 9.955208 GCATTTCATTGAATATTGACTGATGTA 57.045 29.630 0.00 0.00 0.00 2.29
5341 9123 9.671279 TTCATTGAATATTGACTGATGTACTGT 57.329 29.630 0.00 0.00 0.00 3.55
5342 9124 9.101655 TCATTGAATATTGACTGATGTACTGTG 57.898 33.333 0.00 0.00 0.00 3.66
5343 9125 6.908870 TGAATATTGACTGATGTACTGTGC 57.091 37.500 0.00 0.00 0.00 4.57
5344 9126 6.405538 TGAATATTGACTGATGTACTGTGCA 58.594 36.000 0.00 0.00 0.00 4.57
5345 9127 7.049754 TGAATATTGACTGATGTACTGTGCAT 58.950 34.615 11.24 11.24 0.00 3.96
5346 9128 7.553760 TGAATATTGACTGATGTACTGTGCATT 59.446 33.333 12.62 0.00 0.00 3.56
5347 9129 5.808042 ATTGACTGATGTACTGTGCATTC 57.192 39.130 12.62 7.34 0.00 2.67
5348 9130 4.270245 TGACTGATGTACTGTGCATTCA 57.730 40.909 12.62 9.69 0.00 2.57
5349 9131 3.996363 TGACTGATGTACTGTGCATTCAC 59.004 43.478 12.62 1.46 43.40 3.18
5350 9132 4.248859 GACTGATGTACTGTGCATTCACT 58.751 43.478 12.62 2.65 43.49 3.41
5351 9133 3.999001 ACTGATGTACTGTGCATTCACTG 59.001 43.478 12.62 7.01 43.49 3.66
5352 9134 4.248058 CTGATGTACTGTGCATTCACTGA 58.752 43.478 12.62 0.00 42.56 3.41
5353 9135 4.640364 TGATGTACTGTGCATTCACTGAA 58.360 39.130 12.62 0.00 42.56 3.02
5354 9136 5.247862 TGATGTACTGTGCATTCACTGAAT 58.752 37.500 12.62 0.00 42.56 2.57
5355 9137 6.405538 TGATGTACTGTGCATTCACTGAATA 58.594 36.000 12.62 0.00 42.56 1.75
5356 9138 7.049754 TGATGTACTGTGCATTCACTGAATAT 58.950 34.615 12.62 0.94 42.56 1.28
5357 9139 7.553760 TGATGTACTGTGCATTCACTGAATATT 59.446 33.333 12.62 0.00 42.56 1.28
5358 9140 8.962884 ATGTACTGTGCATTCACTGAATATTA 57.037 30.769 9.21 0.00 42.56 0.98
5359 9141 8.785329 TGTACTGTGCATTCACTGAATATTAA 57.215 30.769 9.21 0.00 42.56 1.40
5360 9142 9.225436 TGTACTGTGCATTCACTGAATATTAAA 57.775 29.630 9.21 0.00 42.56 1.52
5385 9167 8.429237 AAAATGGGAGGTTTTACATGATAACA 57.571 30.769 0.00 0.00 0.00 2.41
5386 9168 8.608185 AAATGGGAGGTTTTACATGATAACAT 57.392 30.769 0.00 0.00 37.19 2.71
5387 9169 9.707957 AAATGGGAGGTTTTACATGATAACATA 57.292 29.630 0.00 0.00 35.09 2.29
5388 9170 8.691661 ATGGGAGGTTTTACATGATAACATAC 57.308 34.615 0.00 0.00 35.09 2.39
5389 9171 7.634718 TGGGAGGTTTTACATGATAACATACA 58.365 34.615 0.00 0.00 35.09 2.29
5390 9172 7.554835 TGGGAGGTTTTACATGATAACATACAC 59.445 37.037 0.00 0.00 35.09 2.90
5391 9173 7.012989 GGGAGGTTTTACATGATAACATACACC 59.987 40.741 0.00 0.00 35.09 4.16
5392 9174 7.012989 GGAGGTTTTACATGATAACATACACCC 59.987 40.741 0.00 0.00 35.09 4.61
5393 9175 6.540914 AGGTTTTACATGATAACATACACCCG 59.459 38.462 0.00 0.00 35.09 5.28
5394 9176 5.994887 TTTACATGATAACATACACCCGC 57.005 39.130 0.00 0.00 35.09 6.13
5395 9177 3.552132 ACATGATAACATACACCCGCA 57.448 42.857 0.00 0.00 35.09 5.69
5396 9178 3.879998 ACATGATAACATACACCCGCAA 58.120 40.909 0.00 0.00 35.09 4.85
5397 9179 4.265893 ACATGATAACATACACCCGCAAA 58.734 39.130 0.00 0.00 35.09 3.68
5398 9180 4.095782 ACATGATAACATACACCCGCAAAC 59.904 41.667 0.00 0.00 35.09 2.93
5399 9181 3.011119 TGATAACATACACCCGCAAACC 58.989 45.455 0.00 0.00 0.00 3.27
5400 9182 2.563261 TAACATACACCCGCAAACCA 57.437 45.000 0.00 0.00 0.00 3.67
5401 9183 1.243902 AACATACACCCGCAAACCAG 58.756 50.000 0.00 0.00 0.00 4.00
5402 9184 0.608035 ACATACACCCGCAAACCAGG 60.608 55.000 0.00 0.00 0.00 4.45
5403 9185 0.322098 CATACACCCGCAAACCAGGA 60.322 55.000 0.00 0.00 0.00 3.86
5404 9186 0.402504 ATACACCCGCAAACCAGGAA 59.597 50.000 0.00 0.00 0.00 3.36
5405 9187 0.183014 TACACCCGCAAACCAGGAAA 59.817 50.000 0.00 0.00 0.00 3.13
5406 9188 1.106944 ACACCCGCAAACCAGGAAAG 61.107 55.000 0.00 0.00 0.00 2.62
5407 9189 0.821711 CACCCGCAAACCAGGAAAGA 60.822 55.000 0.00 0.00 0.00 2.52
5408 9190 0.537371 ACCCGCAAACCAGGAAAGAG 60.537 55.000 0.00 0.00 0.00 2.85
5409 9191 1.244019 CCCGCAAACCAGGAAAGAGG 61.244 60.000 0.00 0.00 0.00 3.69
5410 9192 0.250727 CCGCAAACCAGGAAAGAGGA 60.251 55.000 0.00 0.00 0.00 3.71
5411 9193 1.604604 CGCAAACCAGGAAAGAGGAA 58.395 50.000 0.00 0.00 0.00 3.36
5412 9194 2.162681 CGCAAACCAGGAAAGAGGAAT 58.837 47.619 0.00 0.00 0.00 3.01
5413 9195 3.343617 CGCAAACCAGGAAAGAGGAATA 58.656 45.455 0.00 0.00 0.00 1.75
5414 9196 3.375299 CGCAAACCAGGAAAGAGGAATAG 59.625 47.826 0.00 0.00 0.00 1.73
5415 9197 4.589908 GCAAACCAGGAAAGAGGAATAGA 58.410 43.478 0.00 0.00 0.00 1.98
5416 9198 5.010282 GCAAACCAGGAAAGAGGAATAGAA 58.990 41.667 0.00 0.00 0.00 2.10
5417 9199 5.124617 GCAAACCAGGAAAGAGGAATAGAAG 59.875 44.000 0.00 0.00 0.00 2.85
5418 9200 4.495690 ACCAGGAAAGAGGAATAGAAGC 57.504 45.455 0.00 0.00 0.00 3.86
5419 9201 3.846588 ACCAGGAAAGAGGAATAGAAGCA 59.153 43.478 0.00 0.00 0.00 3.91
5420 9202 4.289672 ACCAGGAAAGAGGAATAGAAGCAA 59.710 41.667 0.00 0.00 0.00 3.91
5421 9203 5.222130 ACCAGGAAAGAGGAATAGAAGCAAA 60.222 40.000 0.00 0.00 0.00 3.68
5422 9204 5.711976 CCAGGAAAGAGGAATAGAAGCAAAA 59.288 40.000 0.00 0.00 0.00 2.44
5423 9205 6.127786 CCAGGAAAGAGGAATAGAAGCAAAAG 60.128 42.308 0.00 0.00 0.00 2.27
5424 9206 6.656693 CAGGAAAGAGGAATAGAAGCAAAAGA 59.343 38.462 0.00 0.00 0.00 2.52
5425 9207 6.657117 AGGAAAGAGGAATAGAAGCAAAAGAC 59.343 38.462 0.00 0.00 0.00 3.01
5426 9208 6.431234 GGAAAGAGGAATAGAAGCAAAAGACA 59.569 38.462 0.00 0.00 0.00 3.41
5427 9209 7.040409 GGAAAGAGGAATAGAAGCAAAAGACAA 60.040 37.037 0.00 0.00 0.00 3.18
5428 9210 7.823745 AAGAGGAATAGAAGCAAAAGACAAA 57.176 32.000 0.00 0.00 0.00 2.83
5429 9211 7.446001 AGAGGAATAGAAGCAAAAGACAAAG 57.554 36.000 0.00 0.00 0.00 2.77
5430 9212 7.001073 AGAGGAATAGAAGCAAAAGACAAAGT 58.999 34.615 0.00 0.00 0.00 2.66
5431 9213 7.174080 AGAGGAATAGAAGCAAAAGACAAAGTC 59.826 37.037 0.00 0.00 0.00 3.01
5432 9214 6.772716 AGGAATAGAAGCAAAAGACAAAGTCA 59.227 34.615 0.00 0.00 34.60 3.41
5433 9215 6.858478 GGAATAGAAGCAAAAGACAAAGTCAC 59.142 38.462 0.00 0.00 34.60 3.67
5434 9216 6.942532 ATAGAAGCAAAAGACAAAGTCACA 57.057 33.333 0.00 0.00 34.60 3.58
5435 9217 5.643379 AGAAGCAAAAGACAAAGTCACAA 57.357 34.783 0.00 0.00 34.60 3.33
5436 9218 6.024552 AGAAGCAAAAGACAAAGTCACAAA 57.975 33.333 0.00 0.00 34.60 2.83
5437 9219 5.863935 AGAAGCAAAAGACAAAGTCACAAAC 59.136 36.000 0.00 0.00 34.60 2.93
5438 9220 5.132897 AGCAAAAGACAAAGTCACAAACA 57.867 34.783 0.00 0.00 34.60 2.83
5439 9221 4.923281 AGCAAAAGACAAAGTCACAAACAC 59.077 37.500 0.00 0.00 34.60 3.32
5440 9222 4.683781 GCAAAAGACAAAGTCACAAACACA 59.316 37.500 0.00 0.00 34.60 3.72
5441 9223 5.176590 GCAAAAGACAAAGTCACAAACACAA 59.823 36.000 0.00 0.00 34.60 3.33
5442 9224 6.580476 CAAAAGACAAAGTCACAAACACAAC 58.420 36.000 0.00 0.00 34.60 3.32
5443 9225 5.705609 AAGACAAAGTCACAAACACAACT 57.294 34.783 0.00 0.00 34.60 3.16
5444 9226 5.296813 AGACAAAGTCACAAACACAACTC 57.703 39.130 0.00 0.00 34.60 3.01
5445 9227 4.759693 AGACAAAGTCACAAACACAACTCA 59.240 37.500 0.00 0.00 34.60 3.41
5446 9228 4.794169 ACAAAGTCACAAACACAACTCAC 58.206 39.130 0.00 0.00 0.00 3.51
5447 9229 4.518970 ACAAAGTCACAAACACAACTCACT 59.481 37.500 0.00 0.00 0.00 3.41
5448 9230 5.703592 ACAAAGTCACAAACACAACTCACTA 59.296 36.000 0.00 0.00 0.00 2.74
5449 9231 5.796350 AAGTCACAAACACAACTCACTAC 57.204 39.130 0.00 0.00 0.00 2.73
5450 9232 4.827692 AGTCACAAACACAACTCACTACA 58.172 39.130 0.00 0.00 0.00 2.74
5451 9233 5.242434 AGTCACAAACACAACTCACTACAA 58.758 37.500 0.00 0.00 0.00 2.41
5452 9234 5.703592 AGTCACAAACACAACTCACTACAAA 59.296 36.000 0.00 0.00 0.00 2.83
5453 9235 6.374333 AGTCACAAACACAACTCACTACAAAT 59.626 34.615 0.00 0.00 0.00 2.32
5454 9236 7.551262 AGTCACAAACACAACTCACTACAAATA 59.449 33.333 0.00 0.00 0.00 1.40
5455 9237 7.850982 GTCACAAACACAACTCACTACAAATAG 59.149 37.037 0.00 0.00 34.25 1.73
5456 9238 7.766738 TCACAAACACAACTCACTACAAATAGA 59.233 33.333 0.00 0.00 32.23 1.98
5457 9239 7.850982 CACAAACACAACTCACTACAAATAGAC 59.149 37.037 0.00 0.00 32.23 2.59
5458 9240 6.764877 AACACAACTCACTACAAATAGACG 57.235 37.500 0.00 0.00 32.23 4.18
5459 9241 6.080648 ACACAACTCACTACAAATAGACGA 57.919 37.500 0.00 0.00 32.23 4.20
5460 9242 5.919141 ACACAACTCACTACAAATAGACGAC 59.081 40.000 0.00 0.00 32.23 4.34
5461 9243 5.345202 CACAACTCACTACAAATAGACGACC 59.655 44.000 0.00 0.00 32.23 4.79
5462 9244 5.010314 ACAACTCACTACAAATAGACGACCA 59.990 40.000 0.00 0.00 32.23 4.02
5463 9245 5.717078 ACTCACTACAAATAGACGACCAA 57.283 39.130 0.00 0.00 32.23 3.67
5464 9246 6.092955 ACTCACTACAAATAGACGACCAAA 57.907 37.500 0.00 0.00 32.23 3.28
5465 9247 6.518493 ACTCACTACAAATAGACGACCAAAA 58.482 36.000 0.00 0.00 32.23 2.44
5466 9248 6.987992 ACTCACTACAAATAGACGACCAAAAA 59.012 34.615 0.00 0.00 32.23 1.94
5489 9271 7.905604 AAAGAGAATATGACGATTGAACACA 57.094 32.000 0.00 0.00 0.00 3.72
5490 9272 7.905604 AAGAGAATATGACGATTGAACACAA 57.094 32.000 0.00 0.00 0.00 3.33
5491 9273 7.905604 AGAGAATATGACGATTGAACACAAA 57.094 32.000 0.00 0.00 0.00 2.83
5492 9274 8.322906 AGAGAATATGACGATTGAACACAAAA 57.677 30.769 0.00 0.00 0.00 2.44
5493 9275 8.230486 AGAGAATATGACGATTGAACACAAAAC 58.770 33.333 0.00 0.00 0.00 2.43
5494 9276 7.015289 AGAATATGACGATTGAACACAAAACG 58.985 34.615 0.00 0.00 35.46 3.60
5495 9277 4.804608 ATGACGATTGAACACAAAACGA 57.195 36.364 14.93 0.00 34.46 3.85
5496 9278 4.601621 TGACGATTGAACACAAAACGAA 57.398 36.364 14.93 5.30 34.46 3.85
5497 9279 4.583426 TGACGATTGAACACAAAACGAAG 58.417 39.130 14.93 0.00 34.46 3.79
5498 9280 4.330347 TGACGATTGAACACAAAACGAAGA 59.670 37.500 14.93 2.33 34.46 2.87
5499 9281 4.584394 ACGATTGAACACAAAACGAAGAC 58.416 39.130 14.93 0.00 34.46 3.01
5500 9282 4.093703 ACGATTGAACACAAAACGAAGACA 59.906 37.500 14.93 0.00 34.46 3.41
5501 9283 5.204833 CGATTGAACACAAAACGAAGACAT 58.795 37.500 0.00 0.00 33.30 3.06
5502 9284 5.113975 CGATTGAACACAAAACGAAGACATG 59.886 40.000 0.00 0.00 33.30 3.21
5503 9285 5.553290 TTGAACACAAAACGAAGACATGA 57.447 34.783 0.00 0.00 0.00 3.07
5504 9286 5.553290 TGAACACAAAACGAAGACATGAA 57.447 34.783 0.00 0.00 0.00 2.57
5505 9287 5.944013 TGAACACAAAACGAAGACATGAAA 58.056 33.333 0.00 0.00 0.00 2.69
5506 9288 6.382608 TGAACACAAAACGAAGACATGAAAA 58.617 32.000 0.00 0.00 0.00 2.29
5507 9289 6.526325 TGAACACAAAACGAAGACATGAAAAG 59.474 34.615 0.00 0.00 0.00 2.27
5508 9290 6.189677 ACACAAAACGAAGACATGAAAAGA 57.810 33.333 0.00 0.00 0.00 2.52
5509 9291 6.258160 ACACAAAACGAAGACATGAAAAGAG 58.742 36.000 0.00 0.00 0.00 2.85
5510 9292 6.128007 ACACAAAACGAAGACATGAAAAGAGT 60.128 34.615 0.00 0.00 0.00 3.24
5511 9293 6.412072 CACAAAACGAAGACATGAAAAGAGTC 59.588 38.462 0.00 0.00 0.00 3.36
5512 9294 6.093495 ACAAAACGAAGACATGAAAAGAGTCA 59.907 34.615 0.00 0.00 34.80 3.41
5513 9295 6.677781 AAACGAAGACATGAAAAGAGTCAA 57.322 33.333 0.00 0.00 34.80 3.18
5514 9296 6.867662 AACGAAGACATGAAAAGAGTCAAT 57.132 33.333 0.00 0.00 34.80 2.57
5515 9297 6.867662 ACGAAGACATGAAAAGAGTCAATT 57.132 33.333 0.00 0.00 34.80 2.32
5516 9298 7.962964 ACGAAGACATGAAAAGAGTCAATTA 57.037 32.000 0.00 0.00 34.80 1.40
5517 9299 8.378172 ACGAAGACATGAAAAGAGTCAATTAA 57.622 30.769 0.00 0.00 34.80 1.40
5518 9300 8.283291 ACGAAGACATGAAAAGAGTCAATTAAC 58.717 33.333 0.00 0.00 34.80 2.01
5519 9301 8.499162 CGAAGACATGAAAAGAGTCAATTAACT 58.501 33.333 0.00 0.00 34.80 2.24
5520 9302 9.818796 GAAGACATGAAAAGAGTCAATTAACTC 57.181 33.333 0.00 0.00 44.96 3.01
5521 9303 8.908786 AGACATGAAAAGAGTCAATTAACTCA 57.091 30.769 11.40 0.00 46.65 3.41
5522 9304 8.778358 AGACATGAAAAGAGTCAATTAACTCAC 58.222 33.333 11.40 0.94 46.65 3.51
5523 9305 7.576236 ACATGAAAAGAGTCAATTAACTCACG 58.424 34.615 11.40 0.00 46.65 4.35
5524 9306 5.985781 TGAAAAGAGTCAATTAACTCACGC 58.014 37.500 11.40 0.00 46.65 5.34
5525 9307 4.647291 AAAGAGTCAATTAACTCACGCG 57.353 40.909 11.40 3.53 46.65 6.01
5526 9308 3.570926 AGAGTCAATTAACTCACGCGA 57.429 42.857 15.93 0.00 46.65 5.87
5527 9309 3.243336 AGAGTCAATTAACTCACGCGAC 58.757 45.455 15.93 0.00 46.65 5.19
5528 9310 2.334838 AGTCAATTAACTCACGCGACC 58.665 47.619 15.93 0.00 0.00 4.79
5529 9311 1.058695 GTCAATTAACTCACGCGACCG 59.941 52.381 15.93 1.88 41.14 4.79
5539 9321 2.127906 CGCGACCGTGGAAAAACG 60.128 61.111 0.00 0.00 43.20 3.60
5540 9322 2.873604 CGCGACCGTGGAAAAACGT 61.874 57.895 0.00 0.00 42.01 3.99
5541 9323 1.547292 CGCGACCGTGGAAAAACGTA 61.547 55.000 0.00 0.00 42.01 3.57
5542 9324 0.792031 GCGACCGTGGAAAAACGTAT 59.208 50.000 0.00 0.00 42.01 3.06
5543 9325 1.991965 GCGACCGTGGAAAAACGTATA 59.008 47.619 0.00 0.00 42.01 1.47
5544 9326 2.604462 GCGACCGTGGAAAAACGTATAT 59.396 45.455 0.00 0.00 42.01 0.86
5545 9327 3.302028 GCGACCGTGGAAAAACGTATATC 60.302 47.826 0.00 0.00 42.01 1.63
5546 9328 3.858812 CGACCGTGGAAAAACGTATATCA 59.141 43.478 0.00 0.00 42.01 2.15
5547 9329 4.505191 CGACCGTGGAAAAACGTATATCAT 59.495 41.667 0.00 0.00 42.01 2.45
5548 9330 5.686841 CGACCGTGGAAAAACGTATATCATA 59.313 40.000 0.00 0.00 42.01 2.15
5549 9331 6.198778 CGACCGTGGAAAAACGTATATCATAA 59.801 38.462 0.00 0.00 42.01 1.90
5550 9332 7.254050 CGACCGTGGAAAAACGTATATCATAAA 60.254 37.037 0.00 0.00 42.01 1.40
5551 9333 8.266392 ACCGTGGAAAAACGTATATCATAAAA 57.734 30.769 0.00 0.00 42.01 1.52
5552 9334 8.895737 ACCGTGGAAAAACGTATATCATAAAAT 58.104 29.630 0.00 0.00 42.01 1.82
5553 9335 9.165014 CCGTGGAAAAACGTATATCATAAAATG 57.835 33.333 0.00 0.00 42.01 2.32
5554 9336 9.923786 CGTGGAAAAACGTATATCATAAAATGA 57.076 29.630 0.00 0.00 40.06 2.57
5561 9343 9.646336 AAACGTATATCATAAAATGAAACGAGC 57.354 29.630 20.15 0.00 43.50 5.03
5562 9344 8.360325 ACGTATATCATAAAATGAAACGAGCA 57.640 30.769 20.15 0.00 43.50 4.26
5563 9345 8.822855 ACGTATATCATAAAATGAAACGAGCAA 58.177 29.630 20.15 0.00 43.50 3.91
5564 9346 9.306280 CGTATATCATAAAATGAAACGAGCAAG 57.694 33.333 13.21 0.00 43.50 4.01
5567 9349 6.801539 TCATAAAATGAAACGAGCAAGACT 57.198 33.333 0.00 0.00 36.11 3.24
5568 9350 7.899178 TCATAAAATGAAACGAGCAAGACTA 57.101 32.000 0.00 0.00 36.11 2.59
5569 9351 7.963981 TCATAAAATGAAACGAGCAAGACTAG 58.036 34.615 0.00 0.00 36.11 2.57
5570 9352 4.670227 AAATGAAACGAGCAAGACTAGC 57.330 40.909 0.00 0.00 0.00 3.42
5571 9353 1.698165 TGAAACGAGCAAGACTAGCG 58.302 50.000 0.00 0.00 37.01 4.26
5572 9354 1.000607 TGAAACGAGCAAGACTAGCGT 60.001 47.619 0.00 0.00 37.01 5.07
5573 9355 1.649662 GAAACGAGCAAGACTAGCGTC 59.350 52.381 0.00 0.00 40.54 5.19
5574 9356 0.109226 AACGAGCAAGACTAGCGTCC 60.109 55.000 0.00 0.00 41.16 4.79
5575 9357 1.583967 CGAGCAAGACTAGCGTCCG 60.584 63.158 0.00 0.00 41.16 4.79
5576 9358 1.507174 GAGCAAGACTAGCGTCCGT 59.493 57.895 0.00 0.00 41.16 4.69
5577 9359 0.523757 GAGCAAGACTAGCGTCCGTC 60.524 60.000 0.00 0.00 41.16 4.79
5578 9360 1.516603 GCAAGACTAGCGTCCGTCC 60.517 63.158 0.00 0.00 41.16 4.79
5579 9361 1.880894 CAAGACTAGCGTCCGTCCA 59.119 57.895 0.00 0.00 41.16 4.02
5580 9362 0.456221 CAAGACTAGCGTCCGTCCAT 59.544 55.000 0.00 0.00 41.16 3.41
5581 9363 1.135083 CAAGACTAGCGTCCGTCCATT 60.135 52.381 0.00 0.00 41.16 3.16
5582 9364 0.456221 AGACTAGCGTCCGTCCATTG 59.544 55.000 0.00 0.00 41.16 2.82
5583 9365 1.146358 GACTAGCGTCCGTCCATTGC 61.146 60.000 0.00 0.00 33.98 3.56
5584 9366 1.153647 CTAGCGTCCGTCCATTGCA 60.154 57.895 0.00 0.00 0.00 4.08
5585 9367 0.530650 CTAGCGTCCGTCCATTGCAT 60.531 55.000 0.00 0.00 0.00 3.96
5586 9368 0.747852 TAGCGTCCGTCCATTGCATA 59.252 50.000 0.00 0.00 0.00 3.14
5587 9369 0.530650 AGCGTCCGTCCATTGCATAG 60.531 55.000 0.00 0.00 0.00 2.23
5588 9370 1.934463 CGTCCGTCCATTGCATAGC 59.066 57.895 0.00 0.00 0.00 2.97
5589 9371 0.809636 CGTCCGTCCATTGCATAGCA 60.810 55.000 0.00 0.00 36.47 3.49
5590 9372 1.597742 GTCCGTCCATTGCATAGCAT 58.402 50.000 0.00 0.00 38.76 3.79
5591 9373 1.532868 GTCCGTCCATTGCATAGCATC 59.467 52.381 0.00 0.00 38.76 3.91
5592 9374 0.514255 CCGTCCATTGCATAGCATCG 59.486 55.000 0.00 0.00 38.76 3.84
5593 9375 1.501169 CGTCCATTGCATAGCATCGA 58.499 50.000 0.00 0.00 38.76 3.59
5594 9376 1.458445 CGTCCATTGCATAGCATCGAG 59.542 52.381 0.00 0.00 38.76 4.04
5595 9377 2.759191 GTCCATTGCATAGCATCGAGA 58.241 47.619 0.00 0.00 38.76 4.04
5596 9378 3.332919 GTCCATTGCATAGCATCGAGAT 58.667 45.455 0.00 0.00 38.76 2.75
5597 9379 3.370366 GTCCATTGCATAGCATCGAGATC 59.630 47.826 0.00 0.00 38.76 2.75
5598 9380 2.347755 CCATTGCATAGCATCGAGATCG 59.652 50.000 0.00 0.00 38.76 3.69
5612 9394 5.270812 TCGAGATCGATGACTATTCTTCG 57.729 43.478 0.54 10.87 46.01 3.79
5613 9395 3.843541 CGAGATCGATGACTATTCTTCGC 59.156 47.826 0.54 2.14 44.89 4.70
5614 9396 4.611581 CGAGATCGATGACTATTCTTCGCA 60.612 45.833 0.54 4.19 44.89 5.10
5615 9397 4.793071 AGATCGATGACTATTCTTCGCAG 58.207 43.478 0.54 0.00 44.89 5.18
5616 9398 4.277174 AGATCGATGACTATTCTTCGCAGT 59.723 41.667 0.54 3.24 44.89 4.40
5617 9399 3.695816 TCGATGACTATTCTTCGCAGTG 58.304 45.455 11.93 0.00 44.89 3.66
5618 9400 2.791560 CGATGACTATTCTTCGCAGTGG 59.208 50.000 5.62 0.00 41.04 4.00
5619 9401 2.010145 TGACTATTCTTCGCAGTGGC 57.990 50.000 0.00 0.00 0.00 5.01
5620 9402 1.275010 TGACTATTCTTCGCAGTGGCA 59.725 47.619 0.00 0.00 41.24 4.92
5621 9403 2.289382 TGACTATTCTTCGCAGTGGCAA 60.289 45.455 0.00 0.00 41.24 4.52
5622 9404 2.349886 GACTATTCTTCGCAGTGGCAAG 59.650 50.000 0.00 0.00 41.24 4.01
5623 9405 2.289694 ACTATTCTTCGCAGTGGCAAGT 60.290 45.455 0.00 0.00 41.24 3.16
5624 9406 2.472695 ATTCTTCGCAGTGGCAAGTA 57.527 45.000 0.00 0.00 41.24 2.24
5625 9407 2.472695 TTCTTCGCAGTGGCAAGTAT 57.527 45.000 0.00 0.00 41.24 2.12
5626 9408 1.725641 TCTTCGCAGTGGCAAGTATG 58.274 50.000 0.00 0.00 41.24 2.39
5627 9409 1.001974 TCTTCGCAGTGGCAAGTATGT 59.998 47.619 0.00 0.00 41.24 2.29
5628 9410 1.129251 CTTCGCAGTGGCAAGTATGTG 59.871 52.381 0.00 0.00 41.24 3.21
5629 9411 0.034756 TCGCAGTGGCAAGTATGTGT 59.965 50.000 0.00 0.00 41.24 3.72
5630 9412 0.874390 CGCAGTGGCAAGTATGTGTT 59.126 50.000 0.00 0.00 41.24 3.32
5631 9413 1.400113 CGCAGTGGCAAGTATGTGTTG 60.400 52.381 0.00 0.00 41.24 3.33
5639 9421 4.954238 GCAAGTATGTGTTGCTGAAAAC 57.046 40.909 0.58 0.00 45.67 2.43
5640 9422 3.735746 GCAAGTATGTGTTGCTGAAAACC 59.264 43.478 0.58 0.00 45.67 3.27
5641 9423 4.736168 GCAAGTATGTGTTGCTGAAAACCA 60.736 41.667 0.58 0.00 45.67 3.67
5642 9424 5.531634 CAAGTATGTGTTGCTGAAAACCAT 58.468 37.500 0.00 0.00 0.00 3.55
5643 9425 5.125100 AGTATGTGTTGCTGAAAACCATG 57.875 39.130 0.00 0.00 0.00 3.66
5644 9426 4.584325 AGTATGTGTTGCTGAAAACCATGT 59.416 37.500 0.00 0.00 0.00 3.21
5645 9427 3.883830 TGTGTTGCTGAAAACCATGTT 57.116 38.095 0.00 0.00 0.00 2.71
5646 9428 3.519579 TGTGTTGCTGAAAACCATGTTG 58.480 40.909 0.00 0.00 0.00 3.33
5647 9429 3.056250 TGTGTTGCTGAAAACCATGTTGT 60.056 39.130 0.00 0.00 0.00 3.32
5648 9430 3.932089 GTGTTGCTGAAAACCATGTTGTT 59.068 39.130 0.00 0.00 0.00 2.83
5649 9431 4.032786 GTGTTGCTGAAAACCATGTTGTTC 59.967 41.667 0.00 0.00 0.00 3.18
5650 9432 3.451141 TGCTGAAAACCATGTTGTTCC 57.549 42.857 0.00 0.00 0.00 3.62
5651 9433 3.030291 TGCTGAAAACCATGTTGTTCCT 58.970 40.909 0.00 0.00 0.00 3.36
5652 9434 3.068024 TGCTGAAAACCATGTTGTTCCTC 59.932 43.478 0.00 0.00 0.00 3.71
5653 9435 3.319122 GCTGAAAACCATGTTGTTCCTCT 59.681 43.478 0.00 0.00 0.00 3.69
5654 9436 4.557496 GCTGAAAACCATGTTGTTCCTCTC 60.557 45.833 0.00 0.00 0.00 3.20
5655 9437 3.888930 TGAAAACCATGTTGTTCCTCTCC 59.111 43.478 0.00 0.00 0.00 3.71
5656 9438 2.586648 AACCATGTTGTTCCTCTCCC 57.413 50.000 0.00 0.00 0.00 4.30
5657 9439 1.747444 ACCATGTTGTTCCTCTCCCT 58.253 50.000 0.00 0.00 0.00 4.20
5658 9440 1.630878 ACCATGTTGTTCCTCTCCCTC 59.369 52.381 0.00 0.00 0.00 4.30
5659 9441 1.065126 CCATGTTGTTCCTCTCCCTCC 60.065 57.143 0.00 0.00 0.00 4.30
5660 9442 1.630369 CATGTTGTTCCTCTCCCTCCA 59.370 52.381 0.00 0.00 0.00 3.86
5661 9443 1.814429 TGTTGTTCCTCTCCCTCCAA 58.186 50.000 0.00 0.00 0.00 3.53
5662 9444 2.131854 TGTTGTTCCTCTCCCTCCAAA 58.868 47.619 0.00 0.00 0.00 3.28
5663 9445 2.716424 TGTTGTTCCTCTCCCTCCAAAT 59.284 45.455 0.00 0.00 0.00 2.32
5664 9446 3.084786 GTTGTTCCTCTCCCTCCAAATG 58.915 50.000 0.00 0.00 0.00 2.32
5665 9447 1.004745 TGTTCCTCTCCCTCCAAATGC 59.995 52.381 0.00 0.00 0.00 3.56
5666 9448 0.625849 TTCCTCTCCCTCCAAATGCC 59.374 55.000 0.00 0.00 0.00 4.40
5667 9449 1.228510 CCTCTCCCTCCAAATGCCC 59.771 63.158 0.00 0.00 0.00 5.36
5668 9450 1.228510 CTCTCCCTCCAAATGCCCC 59.771 63.158 0.00 0.00 0.00 5.80
5669 9451 1.543642 TCTCCCTCCAAATGCCCCA 60.544 57.895 0.00 0.00 0.00 4.96
5670 9452 0.925720 TCTCCCTCCAAATGCCCCAT 60.926 55.000 0.00 0.00 0.00 4.00
5671 9453 0.852842 CTCCCTCCAAATGCCCCATA 59.147 55.000 0.00 0.00 0.00 2.74
5672 9454 1.430464 CTCCCTCCAAATGCCCCATAT 59.570 52.381 0.00 0.00 0.00 1.78
5673 9455 1.147608 TCCCTCCAAATGCCCCATATG 59.852 52.381 0.00 0.00 0.00 1.78
5674 9456 1.147608 CCCTCCAAATGCCCCATATGA 59.852 52.381 3.65 0.00 0.00 2.15
5675 9457 2.225445 CCCTCCAAATGCCCCATATGAT 60.225 50.000 3.65 0.00 0.00 2.45
5676 9458 3.513517 CCTCCAAATGCCCCATATGATT 58.486 45.455 3.65 0.00 0.00 2.57
5677 9459 4.510748 CCCTCCAAATGCCCCATATGATTA 60.511 45.833 3.65 0.00 0.00 1.75
5678 9460 4.708421 CCTCCAAATGCCCCATATGATTAG 59.292 45.833 3.65 0.00 0.00 1.73
5679 9461 4.676109 TCCAAATGCCCCATATGATTAGG 58.324 43.478 3.65 0.58 0.00 2.69
5680 9462 4.356492 TCCAAATGCCCCATATGATTAGGA 59.644 41.667 3.65 0.00 0.00 2.94
5681 9463 4.708421 CCAAATGCCCCATATGATTAGGAG 59.292 45.833 3.65 0.00 0.00 3.69
5682 9464 3.659183 ATGCCCCATATGATTAGGAGC 57.341 47.619 3.65 3.72 0.00 4.70
5683 9465 2.347500 TGCCCCATATGATTAGGAGCA 58.653 47.619 3.65 6.12 0.00 4.26
5684 9466 2.040278 TGCCCCATATGATTAGGAGCAC 59.960 50.000 3.65 0.00 0.00 4.40
5685 9467 2.619074 GCCCCATATGATTAGGAGCACC 60.619 54.545 3.65 0.00 0.00 5.01
5686 9468 2.644299 CCCCATATGATTAGGAGCACCA 59.356 50.000 3.65 0.00 38.94 4.17
5687 9469 3.074390 CCCCATATGATTAGGAGCACCAA 59.926 47.826 3.65 0.00 38.94 3.67
5688 9470 4.264083 CCCCATATGATTAGGAGCACCAAT 60.264 45.833 3.65 0.33 38.94 3.16
5689 9471 4.703575 CCCATATGATTAGGAGCACCAATG 59.296 45.833 3.65 0.00 38.94 2.82
5690 9472 5.515359 CCCATATGATTAGGAGCACCAATGA 60.515 44.000 3.65 0.00 38.94 2.57
5691 9473 6.185511 CCATATGATTAGGAGCACCAATGAT 58.814 40.000 3.65 3.25 38.94 2.45
5692 9474 6.662234 CCATATGATTAGGAGCACCAATGATT 59.338 38.462 3.65 0.00 38.94 2.57
5693 9475 7.177921 CCATATGATTAGGAGCACCAATGATTT 59.822 37.037 3.65 0.00 38.94 2.17
5694 9476 8.582437 CATATGATTAGGAGCACCAATGATTTT 58.418 33.333 2.07 0.00 38.94 1.82
5695 9477 9.812347 ATATGATTAGGAGCACCAATGATTTTA 57.188 29.630 2.07 0.00 38.94 1.52
5696 9478 7.572523 TGATTAGGAGCACCAATGATTTTAG 57.427 36.000 2.07 0.00 38.94 1.85
5697 9479 7.345691 TGATTAGGAGCACCAATGATTTTAGA 58.654 34.615 2.07 0.00 38.94 2.10
5698 9480 7.500227 TGATTAGGAGCACCAATGATTTTAGAG 59.500 37.037 2.07 0.00 38.94 2.43
5699 9481 3.950395 AGGAGCACCAATGATTTTAGAGC 59.050 43.478 2.07 0.00 38.94 4.09
5700 9482 3.067320 GGAGCACCAATGATTTTAGAGCC 59.933 47.826 0.00 0.00 35.97 4.70
5701 9483 3.950395 GAGCACCAATGATTTTAGAGCCT 59.050 43.478 0.00 0.00 0.00 4.58
5702 9484 4.347607 AGCACCAATGATTTTAGAGCCTT 58.652 39.130 0.00 0.00 0.00 4.35
5703 9485 4.400567 AGCACCAATGATTTTAGAGCCTTC 59.599 41.667 0.00 0.00 0.00 3.46
5704 9486 4.440663 GCACCAATGATTTTAGAGCCTTCC 60.441 45.833 0.00 0.00 0.00 3.46
5705 9487 4.952335 CACCAATGATTTTAGAGCCTTCCT 59.048 41.667 0.00 0.00 0.00 3.36
5706 9488 5.067023 CACCAATGATTTTAGAGCCTTCCTC 59.933 44.000 0.00 0.00 41.07 3.71
5715 9497 0.884514 GAGCCTTCCTCTTTTGTGCC 59.115 55.000 0.00 0.00 37.60 5.01
5716 9498 0.185901 AGCCTTCCTCTTTTGTGCCA 59.814 50.000 0.00 0.00 0.00 4.92
5717 9499 0.315251 GCCTTCCTCTTTTGTGCCAC 59.685 55.000 0.00 0.00 0.00 5.01
5718 9500 0.593128 CCTTCCTCTTTTGTGCCACG 59.407 55.000 0.00 0.00 0.00 4.94
5719 9501 1.593196 CTTCCTCTTTTGTGCCACGA 58.407 50.000 0.00 0.00 0.00 4.35
5720 9502 1.532868 CTTCCTCTTTTGTGCCACGAG 59.467 52.381 0.00 0.00 0.00 4.18
5721 9503 0.468226 TCCTCTTTTGTGCCACGAGT 59.532 50.000 0.00 0.00 0.00 4.18
5722 9504 1.134220 TCCTCTTTTGTGCCACGAGTT 60.134 47.619 0.00 0.00 0.00 3.01
5723 9505 1.264288 CCTCTTTTGTGCCACGAGTTC 59.736 52.381 0.00 0.00 0.00 3.01
5724 9506 2.213499 CTCTTTTGTGCCACGAGTTCT 58.787 47.619 0.00 0.00 0.00 3.01
5725 9507 2.210116 TCTTTTGTGCCACGAGTTCTC 58.790 47.619 0.00 0.00 0.00 2.87
5726 9508 0.934496 TTTTGTGCCACGAGTTCTCG 59.066 50.000 18.66 18.66 39.31 4.04
5727 9509 0.103390 TTTGTGCCACGAGTTCTCGA 59.897 50.000 25.45 3.54 36.85 4.04
5728 9510 0.596600 TTGTGCCACGAGTTCTCGAC 60.597 55.000 25.45 14.72 36.85 4.20
5729 9511 1.733399 GTGCCACGAGTTCTCGACC 60.733 63.158 25.45 14.11 36.85 4.79
5730 9512 1.901948 TGCCACGAGTTCTCGACCT 60.902 57.895 25.45 3.88 36.85 3.85
5731 9513 1.444553 GCCACGAGTTCTCGACCTG 60.445 63.158 25.45 14.56 36.85 4.00
5732 9514 1.213013 CCACGAGTTCTCGACCTGG 59.787 63.158 25.45 18.78 36.85 4.45
5733 9515 1.444553 CACGAGTTCTCGACCTGGC 60.445 63.158 25.45 0.00 36.85 4.85
5734 9516 2.182030 CGAGTTCTCGACCTGGCC 59.818 66.667 15.87 0.00 34.64 5.36
5735 9517 2.344203 CGAGTTCTCGACCTGGCCT 61.344 63.158 15.87 0.00 34.64 5.19
5736 9518 1.513622 GAGTTCTCGACCTGGCCTC 59.486 63.158 3.32 0.00 0.00 4.70
5737 9519 1.950973 GAGTTCTCGACCTGGCCTCC 61.951 65.000 3.32 0.00 0.00 4.30
5738 9520 1.985116 GTTCTCGACCTGGCCTCCT 60.985 63.158 3.32 0.00 0.00 3.69
5739 9521 0.683504 GTTCTCGACCTGGCCTCCTA 60.684 60.000 3.32 0.00 0.00 2.94
5740 9522 0.683504 TTCTCGACCTGGCCTCCTAC 60.684 60.000 3.32 0.00 0.00 3.18
5741 9523 2.043248 TCGACCTGGCCTCCTACC 60.043 66.667 3.32 0.00 0.00 3.18
5742 9524 2.363795 CGACCTGGCCTCCTACCA 60.364 66.667 3.32 0.00 35.40 3.25
5743 9525 2.722201 CGACCTGGCCTCCTACCAC 61.722 68.421 3.32 0.00 32.49 4.16
5744 9526 2.285442 ACCTGGCCTCCTACCACC 60.285 66.667 3.32 0.00 32.49 4.61
5745 9527 2.285368 CCTGGCCTCCTACCACCA 60.285 66.667 3.32 0.00 32.49 4.17
5746 9528 2.670148 CCTGGCCTCCTACCACCAC 61.670 68.421 3.32 0.00 32.49 4.16
5747 9529 1.613630 CTGGCCTCCTACCACCACT 60.614 63.158 3.32 0.00 32.49 4.00
5748 9530 1.612442 TGGCCTCCTACCACCACTC 60.612 63.158 3.32 0.00 30.29 3.51
5749 9531 1.612442 GGCCTCCTACCACCACTCA 60.612 63.158 0.00 0.00 0.00 3.41
5750 9532 0.983378 GGCCTCCTACCACCACTCAT 60.983 60.000 0.00 0.00 0.00 2.90
5751 9533 0.466124 GCCTCCTACCACCACTCATC 59.534 60.000 0.00 0.00 0.00 2.92
5752 9534 1.967274 GCCTCCTACCACCACTCATCT 60.967 57.143 0.00 0.00 0.00 2.90
5753 9535 2.690026 GCCTCCTACCACCACTCATCTA 60.690 54.545 0.00 0.00 0.00 1.98
5754 9536 3.850752 CCTCCTACCACCACTCATCTAT 58.149 50.000 0.00 0.00 0.00 1.98
5755 9537 4.227197 CCTCCTACCACCACTCATCTATT 58.773 47.826 0.00 0.00 0.00 1.73
5756 9538 4.039730 CCTCCTACCACCACTCATCTATTG 59.960 50.000 0.00 0.00 0.00 1.90
5757 9539 3.967326 TCCTACCACCACTCATCTATTGG 59.033 47.826 0.00 0.00 34.10 3.16
5758 9540 3.967326 CCTACCACCACTCATCTATTGGA 59.033 47.826 0.00 0.00 32.28 3.53
5759 9541 4.408921 CCTACCACCACTCATCTATTGGAA 59.591 45.833 0.00 0.00 32.28 3.53
5760 9542 4.494091 ACCACCACTCATCTATTGGAAG 57.506 45.455 0.00 0.00 32.28 3.46
5761 9543 4.104086 ACCACCACTCATCTATTGGAAGA 58.896 43.478 0.00 0.00 32.28 2.87
5762 9544 4.536090 ACCACCACTCATCTATTGGAAGAA 59.464 41.667 0.00 0.00 32.28 2.52
5763 9545 5.014123 ACCACCACTCATCTATTGGAAGAAA 59.986 40.000 0.00 0.00 32.28 2.52
5764 9546 5.587844 CCACCACTCATCTATTGGAAGAAAG 59.412 44.000 0.00 0.00 32.28 2.62
5765 9547 5.065731 CACCACTCATCTATTGGAAGAAAGC 59.934 44.000 0.00 0.00 32.28 3.51
5766 9548 4.578105 CCACTCATCTATTGGAAGAAAGCC 59.422 45.833 0.00 0.00 29.21 4.35
5767 9549 4.578105 CACTCATCTATTGGAAGAAAGCCC 59.422 45.833 0.00 0.00 0.00 5.19
5768 9550 3.808728 TCATCTATTGGAAGAAAGCCCG 58.191 45.455 0.00 0.00 0.00 6.13
5769 9551 3.454447 TCATCTATTGGAAGAAAGCCCGA 59.546 43.478 0.00 0.00 0.00 5.14
5770 9552 3.543680 TCTATTGGAAGAAAGCCCGAG 57.456 47.619 0.00 0.00 0.00 4.63
5771 9553 2.170607 TCTATTGGAAGAAAGCCCGAGG 59.829 50.000 0.00 0.00 0.00 4.63
5782 9564 2.587194 CCCGAGGCAGCGATCTTG 60.587 66.667 1.22 0.00 0.00 3.02
5783 9565 3.267860 CCGAGGCAGCGATCTTGC 61.268 66.667 9.80 9.80 0.00 4.01
5785 9567 2.236382 CGAGGCAGCGATCTTGCTC 61.236 63.158 15.77 11.24 45.23 4.26
5786 9568 1.153489 GAGGCAGCGATCTTGCTCA 60.153 57.895 15.77 0.00 45.23 4.26
5787 9569 1.152989 GAGGCAGCGATCTTGCTCAG 61.153 60.000 15.77 0.00 45.23 3.35
5788 9570 1.153489 GGCAGCGATCTTGCTCAGA 60.153 57.895 15.77 0.00 45.23 3.27
5789 9571 0.532417 GGCAGCGATCTTGCTCAGAT 60.532 55.000 15.77 0.00 45.23 2.90
5790 9572 1.297664 GCAGCGATCTTGCTCAGATT 58.702 50.000 10.74 0.00 45.23 2.40
5791 9573 1.669779 GCAGCGATCTTGCTCAGATTT 59.330 47.619 10.74 0.00 45.23 2.17
5792 9574 2.539142 GCAGCGATCTTGCTCAGATTTG 60.539 50.000 10.74 2.84 45.23 2.32
5793 9575 1.669779 AGCGATCTTGCTCAGATTTGC 59.330 47.619 12.62 12.62 42.95 3.68
5794 9576 1.268437 GCGATCTTGCTCAGATTTGCC 60.268 52.381 10.76 0.00 42.92 4.52
5795 9577 1.332997 CGATCTTGCTCAGATTTGCCC 59.667 52.381 1.08 0.00 42.92 5.36
5796 9578 2.372264 GATCTTGCTCAGATTTGCCCA 58.628 47.619 1.08 0.00 42.92 5.36
5797 9579 2.519771 TCTTGCTCAGATTTGCCCAT 57.480 45.000 0.00 0.00 0.00 4.00
5798 9580 2.811410 TCTTGCTCAGATTTGCCCATT 58.189 42.857 0.00 0.00 0.00 3.16
5799 9581 2.494471 TCTTGCTCAGATTTGCCCATTG 59.506 45.455 0.00 0.00 0.00 2.82
5800 9582 0.533491 TGCTCAGATTTGCCCATTGC 59.467 50.000 0.00 0.00 41.77 3.56
5809 9591 4.679412 GCCCATTGCAACACCAAG 57.321 55.556 0.00 0.00 40.77 3.61
5810 9592 1.668793 GCCCATTGCAACACCAAGC 60.669 57.895 0.00 0.00 40.77 4.01
5811 9593 2.051941 CCCATTGCAACACCAAGCT 58.948 52.632 0.00 0.00 0.00 3.74
5812 9594 0.320073 CCCATTGCAACACCAAGCTG 60.320 55.000 0.00 0.00 0.00 4.24
5813 9595 0.947180 CCATTGCAACACCAAGCTGC 60.947 55.000 0.00 0.00 36.60 5.25
5814 9596 0.249531 CATTGCAACACCAAGCTGCA 60.250 50.000 0.00 0.00 44.04 4.41
5815 9597 3.613527 TGCAACACCAAGCTGCAA 58.386 50.000 1.02 0.00 42.84 4.08
5816 9598 1.895966 TGCAACACCAAGCTGCAAA 59.104 47.368 1.02 0.00 42.84 3.68
5817 9599 0.464870 TGCAACACCAAGCTGCAAAT 59.535 45.000 1.02 0.00 42.84 2.32
5818 9600 0.863144 GCAACACCAAGCTGCAAATG 59.137 50.000 1.02 0.00 36.09 2.32
5819 9601 1.538634 GCAACACCAAGCTGCAAATGA 60.539 47.619 1.02 0.00 36.09 2.57
5820 9602 2.868839 GCAACACCAAGCTGCAAATGAT 60.869 45.455 1.02 0.00 36.09 2.45
5821 9603 2.991190 CAACACCAAGCTGCAAATGATC 59.009 45.455 1.02 0.00 0.00 2.92
5822 9604 2.241160 ACACCAAGCTGCAAATGATCA 58.759 42.857 1.02 0.00 0.00 2.92
5823 9605 2.629137 ACACCAAGCTGCAAATGATCAA 59.371 40.909 0.00 0.00 0.00 2.57
5824 9606 3.069872 ACACCAAGCTGCAAATGATCAAA 59.930 39.130 0.00 0.00 0.00 2.69
5825 9607 4.059511 CACCAAGCTGCAAATGATCAAAA 58.940 39.130 0.00 0.00 0.00 2.44
5826 9608 4.693566 CACCAAGCTGCAAATGATCAAAAT 59.306 37.500 0.00 0.00 0.00 1.82
5827 9609 4.693566 ACCAAGCTGCAAATGATCAAAATG 59.306 37.500 0.00 0.13 0.00 2.32
5828 9610 4.932799 CCAAGCTGCAAATGATCAAAATGA 59.067 37.500 0.00 0.00 0.00 2.57
5829 9611 5.163893 CCAAGCTGCAAATGATCAAAATGAC 60.164 40.000 0.00 0.00 0.00 3.06
5830 9612 5.142061 AGCTGCAAATGATCAAAATGACA 57.858 34.783 0.00 1.93 0.00 3.58
5831 9613 4.927425 AGCTGCAAATGATCAAAATGACAC 59.073 37.500 0.00 0.00 0.00 3.67
5832 9614 4.927425 GCTGCAAATGATCAAAATGACACT 59.073 37.500 0.00 0.00 0.00 3.55
5833 9615 5.163992 GCTGCAAATGATCAAAATGACACTG 60.164 40.000 0.00 0.00 0.00 3.66
5834 9616 4.687018 TGCAAATGATCAAAATGACACTGC 59.313 37.500 0.00 0.00 0.00 4.40
5835 9617 4.687018 GCAAATGATCAAAATGACACTGCA 59.313 37.500 0.00 0.00 30.03 4.41
5836 9618 5.177881 GCAAATGATCAAAATGACACTGCAA 59.822 36.000 0.00 0.00 30.03 4.08
5837 9619 6.586751 CAAATGATCAAAATGACACTGCAAC 58.413 36.000 0.00 0.00 0.00 4.17
5838 9620 4.241590 TGATCAAAATGACACTGCAACC 57.758 40.909 0.00 0.00 0.00 3.77
5839 9621 3.005684 TGATCAAAATGACACTGCAACCC 59.994 43.478 0.00 0.00 0.00 4.11
5840 9622 1.336440 TCAAAATGACACTGCAACCCG 59.664 47.619 0.00 0.00 0.00 5.28
5841 9623 1.066908 CAAAATGACACTGCAACCCGT 59.933 47.619 0.00 0.00 0.00 5.28
5842 9624 2.264005 AAATGACACTGCAACCCGTA 57.736 45.000 0.00 0.00 0.00 4.02
5843 9625 2.264005 AATGACACTGCAACCCGTAA 57.736 45.000 0.00 0.00 0.00 3.18
5844 9626 2.264005 ATGACACTGCAACCCGTAAA 57.736 45.000 0.00 0.00 0.00 2.01
5845 9627 1.588674 TGACACTGCAACCCGTAAAG 58.411 50.000 0.00 0.00 0.00 1.85
5846 9628 1.139256 TGACACTGCAACCCGTAAAGA 59.861 47.619 0.00 0.00 0.00 2.52
5847 9629 1.798813 GACACTGCAACCCGTAAAGAG 59.201 52.381 0.00 0.00 0.00 2.85
5848 9630 1.156736 CACTGCAACCCGTAAAGAGG 58.843 55.000 0.00 0.00 0.00 3.69
5849 9631 0.763035 ACTGCAACCCGTAAAGAGGT 59.237 50.000 0.00 0.00 38.27 3.85
5850 9632 1.156736 CTGCAACCCGTAAAGAGGTG 58.843 55.000 0.00 0.00 36.19 4.00
5851 9633 0.470766 TGCAACCCGTAAAGAGGTGT 59.529 50.000 0.00 0.00 36.19 4.16
5852 9634 0.872388 GCAACCCGTAAAGAGGTGTG 59.128 55.000 0.00 0.00 36.19 3.82
5853 9635 1.519408 CAACCCGTAAAGAGGTGTGG 58.481 55.000 0.00 0.00 36.19 4.17
5854 9636 1.071071 CAACCCGTAAAGAGGTGTGGA 59.929 52.381 0.00 0.00 36.19 4.02
5855 9637 1.426751 ACCCGTAAAGAGGTGTGGAA 58.573 50.000 0.00 0.00 34.20 3.53
5856 9638 1.071228 ACCCGTAAAGAGGTGTGGAAC 59.929 52.381 0.00 0.00 34.20 3.62
5864 9646 3.468063 GGTGTGGAACCGTCTCCT 58.532 61.111 2.08 0.00 39.81 3.69
5865 9647 1.004918 GGTGTGGAACCGTCTCCTG 60.005 63.158 2.08 0.00 39.81 3.86
5866 9648 1.746517 GTGTGGAACCGTCTCCTGT 59.253 57.895 2.08 0.00 36.35 4.00
5867 9649 0.600255 GTGTGGAACCGTCTCCTGTG 60.600 60.000 2.08 0.00 36.35 3.66
5868 9650 1.046472 TGTGGAACCGTCTCCTGTGT 61.046 55.000 2.08 0.00 36.35 3.72
5869 9651 0.963962 GTGGAACCGTCTCCTGTGTA 59.036 55.000 2.08 0.00 36.35 2.90
5870 9652 1.067776 GTGGAACCGTCTCCTGTGTAG 60.068 57.143 2.08 0.00 36.35 2.74
5871 9653 1.202964 TGGAACCGTCTCCTGTGTAGA 60.203 52.381 2.08 0.00 36.35 2.59
5872 9654 1.473278 GGAACCGTCTCCTGTGTAGAG 59.527 57.143 0.00 0.00 32.21 2.43
5873 9655 2.161030 GAACCGTCTCCTGTGTAGAGT 58.839 52.381 0.00 0.00 32.93 3.24
5874 9656 2.289592 ACCGTCTCCTGTGTAGAGTT 57.710 50.000 0.00 0.00 32.93 3.01
5875 9657 3.430042 ACCGTCTCCTGTGTAGAGTTA 57.570 47.619 0.00 0.00 32.93 2.24
5876 9658 3.965694 ACCGTCTCCTGTGTAGAGTTAT 58.034 45.455 0.00 0.00 32.93 1.89
5877 9659 3.695060 ACCGTCTCCTGTGTAGAGTTATG 59.305 47.826 0.00 0.00 32.93 1.90
5878 9660 3.066900 CCGTCTCCTGTGTAGAGTTATGG 59.933 52.174 0.00 0.00 32.93 2.74
5879 9661 3.945921 CGTCTCCTGTGTAGAGTTATGGA 59.054 47.826 0.00 0.00 32.93 3.41
5880 9662 4.398358 CGTCTCCTGTGTAGAGTTATGGAA 59.602 45.833 0.00 0.00 32.93 3.53
5881 9663 5.449314 CGTCTCCTGTGTAGAGTTATGGAAG 60.449 48.000 0.00 0.00 32.93 3.46
5882 9664 4.402793 TCTCCTGTGTAGAGTTATGGAAGC 59.597 45.833 0.00 0.00 32.93 3.86
5883 9665 4.093743 TCCTGTGTAGAGTTATGGAAGCA 58.906 43.478 0.00 0.00 0.00 3.91
5884 9666 4.160439 TCCTGTGTAGAGTTATGGAAGCAG 59.840 45.833 0.00 0.00 0.00 4.24
5885 9667 4.160439 CCTGTGTAGAGTTATGGAAGCAGA 59.840 45.833 0.00 0.00 0.00 4.26
5886 9668 5.337571 CCTGTGTAGAGTTATGGAAGCAGAA 60.338 44.000 0.00 0.00 0.00 3.02
5887 9669 6.109156 TGTGTAGAGTTATGGAAGCAGAAA 57.891 37.500 0.00 0.00 0.00 2.52
5888 9670 6.711277 TGTGTAGAGTTATGGAAGCAGAAAT 58.289 36.000 0.00 0.00 0.00 2.17
5889 9671 7.847096 TGTGTAGAGTTATGGAAGCAGAAATA 58.153 34.615 0.00 0.00 0.00 1.40
5890 9672 8.318412 TGTGTAGAGTTATGGAAGCAGAAATAA 58.682 33.333 0.00 0.00 0.00 1.40
5891 9673 9.331282 GTGTAGAGTTATGGAAGCAGAAATAAT 57.669 33.333 0.00 0.00 0.00 1.28
5892 9674 9.905713 TGTAGAGTTATGGAAGCAGAAATAATT 57.094 29.630 0.00 0.00 0.00 1.40
5894 9676 8.814038 AGAGTTATGGAAGCAGAAATAATTGT 57.186 30.769 0.00 0.00 0.00 2.71
5895 9677 9.247861 AGAGTTATGGAAGCAGAAATAATTGTT 57.752 29.630 0.00 0.00 0.00 2.83
5901 9683 7.999679 TGGAAGCAGAAATAATTGTTATGAGG 58.000 34.615 4.79 0.00 0.00 3.86
5902 9684 7.615365 TGGAAGCAGAAATAATTGTTATGAGGT 59.385 33.333 4.79 0.00 0.00 3.85
5903 9685 9.120538 GGAAGCAGAAATAATTGTTATGAGGTA 57.879 33.333 4.79 0.00 0.00 3.08
5928 9710 2.941480 CCTCTTGGATTCAGGGAATGG 58.059 52.381 0.00 0.00 31.89 3.16
5929 9711 2.423947 CCTCTTGGATTCAGGGAATGGG 60.424 54.545 0.00 0.00 31.89 4.00
5930 9712 1.063717 TCTTGGATTCAGGGAATGGGC 60.064 52.381 0.00 0.00 31.89 5.36
5931 9713 0.709397 TTGGATTCAGGGAATGGGCA 59.291 50.000 0.00 0.00 31.89 5.36
5932 9714 0.259647 TGGATTCAGGGAATGGGCAG 59.740 55.000 0.00 0.00 31.89 4.85
5933 9715 0.552848 GGATTCAGGGAATGGGCAGA 59.447 55.000 0.00 0.00 31.89 4.26
5934 9716 1.063717 GGATTCAGGGAATGGGCAGAA 60.064 52.381 0.00 0.00 31.89 3.02
5935 9717 2.305009 GATTCAGGGAATGGGCAGAAG 58.695 52.381 0.00 0.00 31.89 2.85
5936 9718 1.075601 TTCAGGGAATGGGCAGAAGT 58.924 50.000 0.00 0.00 0.00 3.01
5937 9719 0.329261 TCAGGGAATGGGCAGAAGTG 59.671 55.000 0.00 0.00 0.00 3.16
5951 9733 3.621794 CAGAAGTGCTTTTTGAGGAACG 58.378 45.455 0.00 0.00 0.00 3.95
5952 9734 3.312421 CAGAAGTGCTTTTTGAGGAACGA 59.688 43.478 0.00 0.00 0.00 3.85
5953 9735 4.023707 CAGAAGTGCTTTTTGAGGAACGAT 60.024 41.667 0.00 0.00 0.00 3.73
5954 9736 5.179368 CAGAAGTGCTTTTTGAGGAACGATA 59.821 40.000 0.00 0.00 0.00 2.92
5955 9737 5.940470 AGAAGTGCTTTTTGAGGAACGATAT 59.060 36.000 0.00 0.00 0.00 1.63
5956 9738 7.064609 CAGAAGTGCTTTTTGAGGAACGATATA 59.935 37.037 0.00 0.00 0.00 0.86
5957 9739 6.910536 AGTGCTTTTTGAGGAACGATATAG 57.089 37.500 0.00 0.00 0.00 1.31
5958 9740 6.407202 AGTGCTTTTTGAGGAACGATATAGT 58.593 36.000 0.00 0.00 0.00 2.12
5959 9741 6.879458 AGTGCTTTTTGAGGAACGATATAGTT 59.121 34.615 0.32 0.32 36.99 2.24
5960 9742 6.961554 GTGCTTTTTGAGGAACGATATAGTTG 59.038 38.462 5.89 0.00 34.00 3.16
5961 9743 6.093495 TGCTTTTTGAGGAACGATATAGTTGG 59.907 38.462 5.89 0.00 34.00 3.77
5962 9744 6.315393 GCTTTTTGAGGAACGATATAGTTGGA 59.685 38.462 5.89 0.00 34.00 3.53
5963 9745 7.012421 GCTTTTTGAGGAACGATATAGTTGGAT 59.988 37.037 5.89 0.00 34.00 3.41
5964 9746 8.801882 TTTTTGAGGAACGATATAGTTGGATT 57.198 30.769 5.89 0.00 34.00 3.01
5965 9747 9.893634 TTTTTGAGGAACGATATAGTTGGATTA 57.106 29.630 5.89 0.00 34.00 1.75
5966 9748 9.893634 TTTTGAGGAACGATATAGTTGGATTAA 57.106 29.630 5.89 0.00 34.00 1.40
5967 9749 9.542462 TTTGAGGAACGATATAGTTGGATTAAG 57.458 33.333 5.89 0.00 34.00 1.85
5968 9750 7.667557 TGAGGAACGATATAGTTGGATTAAGG 58.332 38.462 5.89 0.00 34.00 2.69
5969 9751 7.507956 TGAGGAACGATATAGTTGGATTAAGGA 59.492 37.037 5.89 0.00 34.00 3.36
5970 9752 7.668492 AGGAACGATATAGTTGGATTAAGGAC 58.332 38.462 5.89 0.00 34.00 3.85
5971 9753 6.585322 GGAACGATATAGTTGGATTAAGGACG 59.415 42.308 5.89 0.00 34.00 4.79
5972 9754 6.889301 ACGATATAGTTGGATTAAGGACGA 57.111 37.500 0.00 0.00 0.00 4.20
5973 9755 6.675987 ACGATATAGTTGGATTAAGGACGAC 58.324 40.000 0.00 0.00 0.00 4.34
5974 9756 6.091437 CGATATAGTTGGATTAAGGACGACC 58.909 44.000 0.00 0.00 0.00 4.79
5975 9757 4.684484 ATAGTTGGATTAAGGACGACCC 57.316 45.455 0.00 0.00 36.73 4.46
5976 9758 2.262637 AGTTGGATTAAGGACGACCCA 58.737 47.619 0.00 0.00 37.41 4.51
5977 9759 2.844348 AGTTGGATTAAGGACGACCCAT 59.156 45.455 0.00 0.00 37.41 4.00
5978 9760 2.943033 GTTGGATTAAGGACGACCCATG 59.057 50.000 0.00 0.00 37.41 3.66
5979 9761 1.488812 TGGATTAAGGACGACCCATGG 59.511 52.381 4.14 4.14 37.41 3.66
5980 9762 1.766496 GGATTAAGGACGACCCATGGA 59.234 52.381 15.22 0.00 37.41 3.41
5981 9763 2.224305 GGATTAAGGACGACCCATGGAG 60.224 54.545 15.22 5.95 37.41 3.86
5982 9764 1.200519 TTAAGGACGACCCATGGAGG 58.799 55.000 15.22 4.06 37.41 4.30
5983 9765 0.337082 TAAGGACGACCCATGGAGGA 59.663 55.000 15.22 0.00 41.22 3.71
5984 9766 0.326618 AAGGACGACCCATGGAGGAT 60.327 55.000 15.22 0.00 41.22 3.24
5985 9767 0.760945 AGGACGACCCATGGAGGATC 60.761 60.000 15.22 5.39 41.22 3.36
5986 9768 0.760945 GGACGACCCATGGAGGATCT 60.761 60.000 15.22 0.00 41.22 2.75
5987 9769 1.123928 GACGACCCATGGAGGATCTT 58.876 55.000 15.22 0.00 41.22 2.40
5988 9770 0.833287 ACGACCCATGGAGGATCTTG 59.167 55.000 15.22 0.00 41.22 3.02
5989 9771 0.533755 CGACCCATGGAGGATCTTGC 60.534 60.000 15.22 0.00 41.22 4.01
5990 9772 0.548031 GACCCATGGAGGATCTTGCA 59.452 55.000 15.22 0.51 41.22 4.08
5991 9773 1.002069 ACCCATGGAGGATCTTGCAA 58.998 50.000 15.22 0.00 41.22 4.08
5992 9774 1.341383 ACCCATGGAGGATCTTGCAAC 60.341 52.381 15.22 0.00 41.22 4.17
5993 9775 1.396653 CCATGGAGGATCTTGCAACC 58.603 55.000 5.56 0.00 41.22 3.77
5994 9776 1.019673 CATGGAGGATCTTGCAACCG 58.980 55.000 2.50 0.00 33.73 4.44
5995 9777 0.911769 ATGGAGGATCTTGCAACCGA 59.088 50.000 2.50 0.00 33.73 4.69
5996 9778 0.250234 TGGAGGATCTTGCAACCGAG 59.750 55.000 0.00 0.00 33.73 4.63
5997 9779 0.462759 GGAGGATCTTGCAACCGAGG 60.463 60.000 0.00 0.00 33.73 4.63
5998 9780 0.250513 GAGGATCTTGCAACCGAGGT 59.749 55.000 0.00 0.00 0.00 3.85
5999 9781 0.693049 AGGATCTTGCAACCGAGGTT 59.307 50.000 0.93 0.93 39.13 3.50
6000 9782 1.073923 AGGATCTTGCAACCGAGGTTT 59.926 47.619 4.52 0.00 36.00 3.27
6001 9783 1.886542 GGATCTTGCAACCGAGGTTTT 59.113 47.619 4.52 0.00 36.00 2.43
6002 9784 2.095212 GGATCTTGCAACCGAGGTTTTC 60.095 50.000 4.52 1.31 36.00 2.29
6003 9785 2.045561 TCTTGCAACCGAGGTTTTCA 57.954 45.000 4.52 3.92 36.00 2.69
6004 9786 2.370349 TCTTGCAACCGAGGTTTTCAA 58.630 42.857 4.52 11.00 36.00 2.69
6005 9787 2.955660 TCTTGCAACCGAGGTTTTCAAT 59.044 40.909 15.27 0.00 36.00 2.57
6006 9788 2.791383 TGCAACCGAGGTTTTCAATG 57.209 45.000 4.52 0.00 36.00 2.82
6007 9789 2.302260 TGCAACCGAGGTTTTCAATGA 58.698 42.857 4.52 0.00 36.00 2.57
6008 9790 2.890311 TGCAACCGAGGTTTTCAATGAT 59.110 40.909 4.52 0.00 36.00 2.45
6009 9791 3.244976 GCAACCGAGGTTTTCAATGATG 58.755 45.455 4.52 0.00 36.00 3.07
6010 9792 3.305335 GCAACCGAGGTTTTCAATGATGT 60.305 43.478 4.52 0.00 36.00 3.06
6011 9793 4.083003 GCAACCGAGGTTTTCAATGATGTA 60.083 41.667 4.52 0.00 36.00 2.29
6012 9794 5.563867 GCAACCGAGGTTTTCAATGATGTAA 60.564 40.000 4.52 0.00 36.00 2.41
6013 9795 6.442952 CAACCGAGGTTTTCAATGATGTAAA 58.557 36.000 4.52 0.00 36.00 2.01
6014 9796 6.834168 ACCGAGGTTTTCAATGATGTAAAT 57.166 33.333 0.00 0.00 30.08 1.40
6015 9797 6.852664 ACCGAGGTTTTCAATGATGTAAATC 58.147 36.000 0.00 0.00 30.08 2.17
6016 9798 6.127730 ACCGAGGTTTTCAATGATGTAAATCC 60.128 38.462 0.00 0.00 29.83 3.01
6017 9799 5.965334 CGAGGTTTTCAATGATGTAAATCCG 59.035 40.000 0.00 0.00 29.83 4.18
6018 9800 6.183360 CGAGGTTTTCAATGATGTAAATCCGA 60.183 38.462 0.00 0.00 29.83 4.55
6019 9801 7.467267 CGAGGTTTTCAATGATGTAAATCCGAT 60.467 37.037 0.00 0.00 29.83 4.18
6020 9802 7.707104 AGGTTTTCAATGATGTAAATCCGATC 58.293 34.615 0.00 0.00 29.83 3.69
6021 9803 6.632834 GGTTTTCAATGATGTAAATCCGATCG 59.367 38.462 8.51 8.51 30.08 3.69
6022 9804 6.918892 TTTCAATGATGTAAATCCGATCGT 57.081 33.333 15.09 0.00 0.00 3.73
6023 9805 6.525121 TTCAATGATGTAAATCCGATCGTC 57.475 37.500 15.09 2.71 0.00 4.20
6024 9806 5.596845 TCAATGATGTAAATCCGATCGTCA 58.403 37.500 15.09 8.74 0.00 4.35
6025 9807 5.462068 TCAATGATGTAAATCCGATCGTCAC 59.538 40.000 15.09 4.78 0.00 3.67
6026 9808 3.368495 TGATGTAAATCCGATCGTCACG 58.632 45.455 15.09 0.00 0.00 4.35
6027 9809 1.552226 TGTAAATCCGATCGTCACGC 58.448 50.000 15.09 0.37 0.00 5.34
6028 9810 1.135344 TGTAAATCCGATCGTCACGCA 60.135 47.619 15.09 3.07 0.00 5.24
6029 9811 1.517276 GTAAATCCGATCGTCACGCAG 59.483 52.381 15.09 0.00 0.00 5.18
6030 9812 0.172578 AAATCCGATCGTCACGCAGA 59.827 50.000 15.09 2.22 0.00 4.26
6031 9813 0.172578 AATCCGATCGTCACGCAGAA 59.827 50.000 15.09 0.00 0.00 3.02
6032 9814 0.385751 ATCCGATCGTCACGCAGAAT 59.614 50.000 15.09 0.00 0.00 2.40
6033 9815 0.248498 TCCGATCGTCACGCAGAATC 60.248 55.000 15.09 0.00 0.00 2.52
6034 9816 1.532343 CCGATCGTCACGCAGAATCG 61.532 60.000 15.09 11.04 0.00 3.34
6035 9817 0.861866 CGATCGTCACGCAGAATCGT 60.862 55.000 7.03 0.00 44.35 3.73
6036 9818 1.269166 GATCGTCACGCAGAATCGTT 58.731 50.000 0.00 0.00 41.21 3.85
6037 9819 1.654105 GATCGTCACGCAGAATCGTTT 59.346 47.619 0.00 0.00 41.21 3.60
6038 9820 1.057636 TCGTCACGCAGAATCGTTTC 58.942 50.000 0.00 0.00 41.21 2.78
6039 9821 1.060713 CGTCACGCAGAATCGTTTCT 58.939 50.000 2.83 2.83 43.09 2.52
6048 9830 3.305398 AGAATCGTTTCTGAAGCGACT 57.695 42.857 27.22 19.38 40.74 4.18
6049 9831 4.436242 AGAATCGTTTCTGAAGCGACTA 57.564 40.909 27.22 9.78 40.74 2.59
6050 9832 4.167268 AGAATCGTTTCTGAAGCGACTAC 58.833 43.478 27.22 20.44 40.74 2.73
6051 9833 3.851976 ATCGTTTCTGAAGCGACTACT 57.148 42.857 27.22 12.09 37.47 2.57
6052 9834 4.959596 ATCGTTTCTGAAGCGACTACTA 57.040 40.909 27.22 8.44 37.47 1.82
6053 9835 4.754372 TCGTTTCTGAAGCGACTACTAA 57.246 40.909 22.47 2.02 0.00 2.24
6054 9836 5.306532 TCGTTTCTGAAGCGACTACTAAT 57.693 39.130 22.47 0.00 0.00 1.73
6055 9837 5.706916 TCGTTTCTGAAGCGACTACTAATT 58.293 37.500 22.47 0.00 0.00 1.40
6056 9838 5.571741 TCGTTTCTGAAGCGACTACTAATTG 59.428 40.000 22.47 0.00 0.00 2.32
6057 9839 5.551893 GTTTCTGAAGCGACTACTAATTGC 58.448 41.667 0.00 0.00 0.00 3.56
6058 9840 4.450082 TCTGAAGCGACTACTAATTGCA 57.550 40.909 0.00 0.00 0.00 4.08
6059 9841 4.174009 TCTGAAGCGACTACTAATTGCAC 58.826 43.478 0.00 0.00 0.00 4.57
6060 9842 4.082190 TCTGAAGCGACTACTAATTGCACT 60.082 41.667 0.00 0.00 0.00 4.40
6061 9843 4.566004 TGAAGCGACTACTAATTGCACTT 58.434 39.130 0.00 0.00 0.00 3.16
6062 9844 4.388773 TGAAGCGACTACTAATTGCACTTG 59.611 41.667 0.00 0.00 0.00 3.16
6063 9845 3.262420 AGCGACTACTAATTGCACTTGG 58.738 45.455 0.00 0.00 0.00 3.61
6064 9846 3.056107 AGCGACTACTAATTGCACTTGGA 60.056 43.478 7.16 0.00 0.00 3.53
6065 9847 3.062234 GCGACTACTAATTGCACTTGGAC 59.938 47.826 7.16 0.00 0.00 4.02
6066 9848 3.617263 CGACTACTAATTGCACTTGGACC 59.383 47.826 7.16 0.00 0.00 4.46
6067 9849 4.575885 GACTACTAATTGCACTTGGACCA 58.424 43.478 7.16 0.00 0.00 4.02
6068 9850 4.980573 ACTACTAATTGCACTTGGACCAA 58.019 39.130 6.76 6.76 0.00 3.67
6069 9851 5.381757 ACTACTAATTGCACTTGGACCAAA 58.618 37.500 8.59 0.00 0.00 3.28
6070 9852 4.853924 ACTAATTGCACTTGGACCAAAG 57.146 40.909 8.59 5.22 0.00 2.77
6071 9853 4.469657 ACTAATTGCACTTGGACCAAAGA 58.530 39.130 8.59 0.00 0.00 2.52
6072 9854 5.079643 ACTAATTGCACTTGGACCAAAGAT 58.920 37.500 8.59 0.00 0.00 2.40
6073 9855 6.245408 ACTAATTGCACTTGGACCAAAGATA 58.755 36.000 8.59 0.00 0.00 1.98
6074 9856 6.891908 ACTAATTGCACTTGGACCAAAGATAT 59.108 34.615 8.59 0.00 0.00 1.63
6075 9857 6.610075 AATTGCACTTGGACCAAAGATATT 57.390 33.333 8.59 2.49 0.00 1.28
6076 9858 7.716799 AATTGCACTTGGACCAAAGATATTA 57.283 32.000 8.59 0.00 0.00 0.98
6077 9859 7.716799 ATTGCACTTGGACCAAAGATATTAA 57.283 32.000 8.59 0.00 0.00 1.40
6078 9860 6.757897 TGCACTTGGACCAAAGATATTAAG 57.242 37.500 8.59 0.00 0.00 1.85
6079 9861 5.652014 TGCACTTGGACCAAAGATATTAAGG 59.348 40.000 8.59 0.00 0.00 2.69
6080 9862 5.067805 GCACTTGGACCAAAGATATTAAGGG 59.932 44.000 8.59 0.00 0.00 3.95
6081 9863 6.187682 CACTTGGACCAAAGATATTAAGGGT 58.812 40.000 8.59 0.00 0.00 4.34
6082 9864 6.318900 CACTTGGACCAAAGATATTAAGGGTC 59.681 42.308 8.59 9.01 43.10 4.46
6083 9865 6.011981 ACTTGGACCAAAGATATTAAGGGTCA 60.012 38.462 8.59 4.04 45.07 4.02
6084 9866 6.001449 TGGACCAAAGATATTAAGGGTCAG 57.999 41.667 15.90 0.00 45.07 3.51
6085 9867 5.729229 TGGACCAAAGATATTAAGGGTCAGA 59.271 40.000 15.90 4.24 45.07 3.27
6086 9868 6.389869 TGGACCAAAGATATTAAGGGTCAGAT 59.610 38.462 15.90 0.00 45.07 2.90
6087 9869 7.091993 TGGACCAAAGATATTAAGGGTCAGATT 60.092 37.037 15.90 0.00 45.07 2.40
6088 9870 7.780271 GGACCAAAGATATTAAGGGTCAGATTT 59.220 37.037 15.90 0.00 45.07 2.17
6089 9871 9.190317 GACCAAAGATATTAAGGGTCAGATTTT 57.810 33.333 11.48 0.00 43.27 1.82
6090 9872 9.547279 ACCAAAGATATTAAGGGTCAGATTTTT 57.453 29.630 0.00 0.00 0.00 1.94
6094 9876 8.986929 AGATATTAAGGGTCAGATTTTTCTGG 57.013 34.615 3.35 0.00 38.23 3.86
6095 9877 5.921962 ATTAAGGGTCAGATTTTTCTGGC 57.078 39.130 3.35 1.24 41.29 4.85
6101 9883 4.629251 GTCAGATTTTTCTGGCCAGATC 57.371 45.455 35.42 27.77 36.42 2.75
6102 9884 4.268359 GTCAGATTTTTCTGGCCAGATCT 58.732 43.478 35.42 29.44 36.42 2.75
6103 9885 4.096081 GTCAGATTTTTCTGGCCAGATCTG 59.904 45.833 37.11 37.11 39.99 2.90
6104 9886 4.019051 TCAGATTTTTCTGGCCAGATCTGA 60.019 41.667 39.22 39.22 42.71 3.27
6105 9887 4.096081 CAGATTTTTCTGGCCAGATCTGAC 59.904 45.833 38.53 27.98 40.58 3.51
6106 9888 2.496899 TTTTCTGGCCAGATCTGACC 57.503 50.000 35.42 22.45 37.29 4.02
6107 9889 0.620556 TTTCTGGCCAGATCTGACCC 59.379 55.000 35.42 21.41 37.29 4.46
6108 9890 0.252881 TTCTGGCCAGATCTGACCCT 60.253 55.000 35.42 0.00 37.29 4.34
6109 9891 0.252881 TCTGGCCAGATCTGACCCTT 60.253 55.000 32.00 0.00 31.55 3.95
6110 9892 0.107312 CTGGCCAGATCTGACCCTTG 60.107 60.000 29.88 11.15 31.55 3.61
6111 9893 0.547471 TGGCCAGATCTGACCCTTGA 60.547 55.000 23.67 3.70 31.55 3.02
6112 9894 0.842635 GGCCAGATCTGACCCTTGAT 59.157 55.000 24.62 0.00 0.00 2.57
6113 9895 2.050144 GGCCAGATCTGACCCTTGATA 58.950 52.381 24.62 0.00 0.00 2.15
6114 9896 2.641815 GGCCAGATCTGACCCTTGATAT 59.358 50.000 24.62 0.00 0.00 1.63
6115 9897 3.073650 GGCCAGATCTGACCCTTGATATT 59.926 47.826 24.62 0.00 0.00 1.28
6116 9898 4.070716 GCCAGATCTGACCCTTGATATTG 58.929 47.826 24.62 3.46 0.00 1.90
6117 9899 4.445448 GCCAGATCTGACCCTTGATATTGT 60.445 45.833 24.62 0.00 0.00 2.71
6118 9900 5.061853 CCAGATCTGACCCTTGATATTGTG 58.938 45.833 24.62 0.00 0.00 3.33
6119 9901 5.061853 CAGATCTGACCCTTGATATTGTGG 58.938 45.833 18.34 0.00 0.00 4.17
6120 9902 3.931907 TCTGACCCTTGATATTGTGGG 57.068 47.619 0.00 0.00 44.89 4.61
6121 9903 3.459828 TCTGACCCTTGATATTGTGGGA 58.540 45.455 12.83 0.00 42.11 4.37
6122 9904 3.199946 TCTGACCCTTGATATTGTGGGAC 59.800 47.826 12.83 8.42 42.11 4.46
6123 9905 3.189606 TGACCCTTGATATTGTGGGACT 58.810 45.455 12.83 0.00 42.11 3.85
6124 9906 3.199946 TGACCCTTGATATTGTGGGACTC 59.800 47.826 12.83 4.18 42.11 3.36
6125 9907 2.170607 ACCCTTGATATTGTGGGACTCG 59.829 50.000 12.83 0.00 42.11 4.18
6126 9908 2.434336 CCCTTGATATTGTGGGACTCGA 59.566 50.000 0.00 0.00 42.11 4.04
6127 9909 3.118408 CCCTTGATATTGTGGGACTCGAA 60.118 47.826 0.00 0.00 42.11 3.71
6128 9910 4.444876 CCCTTGATATTGTGGGACTCGAAT 60.445 45.833 0.00 0.00 42.11 3.34
6129 9911 4.512944 CCTTGATATTGTGGGACTCGAATG 59.487 45.833 0.00 0.00 0.00 2.67
6130 9912 4.071961 TGATATTGTGGGACTCGAATGG 57.928 45.455 0.00 0.00 0.00 3.16
6131 9913 3.709141 TGATATTGTGGGACTCGAATGGA 59.291 43.478 0.00 0.00 0.00 3.41
6154 9936 9.470399 TGGAGTTATTTTTCCTAATAAAGTCCC 57.530 33.333 0.00 0.00 36.12 4.46
6155 9937 9.696572 GGAGTTATTTTTCCTAATAAAGTCCCT 57.303 33.333 0.00 0.00 33.81 4.20
6175 9957 9.765795 AGTCCCTATATAATTCTCTTTTCGTTG 57.234 33.333 0.00 0.00 0.00 4.10
6176 9958 8.496751 GTCCCTATATAATTCTCTTTTCGTTGC 58.503 37.037 0.00 0.00 0.00 4.17
6177 9959 8.208224 TCCCTATATAATTCTCTTTTCGTTGCA 58.792 33.333 0.00 0.00 0.00 4.08
6178 9960 8.499162 CCCTATATAATTCTCTTTTCGTTGCAG 58.501 37.037 0.00 0.00 0.00 4.41
6179 9961 8.012241 CCTATATAATTCTCTTTTCGTTGCAGC 58.988 37.037 0.00 0.00 0.00 5.25
6180 9962 2.601481 ATTCTCTTTTCGTTGCAGCG 57.399 45.000 17.58 17.58 0.00 5.18
6181 9963 1.577468 TTCTCTTTTCGTTGCAGCGA 58.423 45.000 22.26 22.26 39.28 4.93
6182 9964 1.795768 TCTCTTTTCGTTGCAGCGAT 58.204 45.000 26.28 0.00 40.76 4.58
6183 9965 1.726791 TCTCTTTTCGTTGCAGCGATC 59.273 47.619 26.28 0.00 40.76 3.69
6184 9966 1.460743 CTCTTTTCGTTGCAGCGATCA 59.539 47.619 26.28 13.42 40.76 2.92
6185 9967 1.870402 TCTTTTCGTTGCAGCGATCAA 59.130 42.857 26.28 19.41 40.76 2.57
6186 9968 2.483877 TCTTTTCGTTGCAGCGATCAAT 59.516 40.909 26.28 0.00 40.76 2.57
6187 9969 2.987413 TTTCGTTGCAGCGATCAATT 57.013 40.000 26.28 0.00 40.76 2.32
6188 9970 4.153296 TCTTTTCGTTGCAGCGATCAATTA 59.847 37.500 26.28 7.60 40.76 1.40
6189 9971 4.614555 TTTCGTTGCAGCGATCAATTAT 57.385 36.364 26.28 0.00 40.76 1.28
6190 9972 5.726729 TTTCGTTGCAGCGATCAATTATA 57.273 34.783 26.28 6.03 40.76 0.98
6191 9973 5.726729 TTCGTTGCAGCGATCAATTATAA 57.273 34.783 26.28 5.26 40.76 0.98
6192 9974 5.922739 TCGTTGCAGCGATCAATTATAAT 57.077 34.783 22.26 0.00 35.83 1.28
6193 9975 7.414814 TTCGTTGCAGCGATCAATTATAATA 57.585 32.000 26.28 3.94 40.76 0.98
6194 9976 6.817396 TCGTTGCAGCGATCAATTATAATAC 58.183 36.000 22.26 0.00 35.83 1.89
6195 9977 6.015504 CGTTGCAGCGATCAATTATAATACC 58.984 40.000 18.92 0.00 0.00 2.73
6196 9978 6.347321 CGTTGCAGCGATCAATTATAATACCA 60.347 38.462 18.92 0.00 0.00 3.25
6197 9979 7.359595 GTTGCAGCGATCAATTATAATACCAA 58.640 34.615 0.00 0.00 0.00 3.67
6198 9980 7.686438 TGCAGCGATCAATTATAATACCAAT 57.314 32.000 0.00 0.00 0.00 3.16
6199 9981 8.109705 TGCAGCGATCAATTATAATACCAATT 57.890 30.769 0.00 0.00 0.00 2.32
6200 9982 8.022550 TGCAGCGATCAATTATAATACCAATTG 58.977 33.333 0.00 0.00 41.44 2.32
6201 9983 7.008628 GCAGCGATCAATTATAATACCAATTGC 59.991 37.037 0.00 6.05 40.41 3.56
6202 9984 7.485913 CAGCGATCAATTATAATACCAATTGCC 59.514 37.037 0.00 0.00 40.41 4.52
6203 9985 7.176515 AGCGATCAATTATAATACCAATTGCCA 59.823 33.333 0.00 0.00 40.41 4.92
6204 9986 7.812191 GCGATCAATTATAATACCAATTGCCAA 59.188 33.333 0.00 0.00 40.41 4.52
6205 9987 9.345517 CGATCAATTATAATACCAATTGCCAAG 57.654 33.333 0.00 0.00 40.41 3.61
6206 9988 9.143631 GATCAATTATAATACCAATTGCCAAGC 57.856 33.333 0.00 0.00 40.41 4.01
6207 9989 7.441017 TCAATTATAATACCAATTGCCAAGCC 58.559 34.615 0.00 0.00 40.41 4.35
6208 9990 7.289782 TCAATTATAATACCAATTGCCAAGCCT 59.710 33.333 0.00 0.00 40.41 4.58
6209 9991 8.584157 CAATTATAATACCAATTGCCAAGCCTA 58.416 33.333 0.00 0.00 35.88 3.93
6210 9992 7.519032 TTATAATACCAATTGCCAAGCCTAC 57.481 36.000 0.00 0.00 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 1.566231 GGGAGGGGATGACAGTGAAAT 59.434 52.381 0.00 0.00 0.00 2.17
2 3 0.119155 AGGGAGGGGATGACAGTGAA 59.881 55.000 0.00 0.00 0.00 3.18
4 5 0.543749 GAAGGGAGGGGATGACAGTG 59.456 60.000 0.00 0.00 0.00 3.66
6 7 1.142465 CATGAAGGGAGGGGATGACAG 59.858 57.143 0.00 0.00 0.00 3.51
8 9 1.133976 CACATGAAGGGAGGGGATGAC 60.134 57.143 0.00 0.00 0.00 3.06
9 10 1.216064 CACATGAAGGGAGGGGATGA 58.784 55.000 0.00 0.00 0.00 2.92
10 11 0.184451 CCACATGAAGGGAGGGGATG 59.816 60.000 0.00 0.00 0.00 3.51
11 12 0.046242 TCCACATGAAGGGAGGGGAT 59.954 55.000 0.00 0.00 0.00 3.85
12 13 0.914417 GTCCACATGAAGGGAGGGGA 60.914 60.000 0.00 0.00 32.85 4.81
13 14 1.207488 TGTCCACATGAAGGGAGGGG 61.207 60.000 0.00 0.00 32.85 4.79
14 15 0.035056 GTGTCCACATGAAGGGAGGG 60.035 60.000 0.00 0.00 32.85 4.30
15 16 0.692476 TGTGTCCACATGAAGGGAGG 59.308 55.000 0.00 0.00 36.21 4.30
16 17 1.072173 TGTGTGTCCACATGAAGGGAG 59.928 52.381 0.00 0.00 46.45 4.30
17 18 1.135960 TGTGTGTCCACATGAAGGGA 58.864 50.000 0.00 0.00 46.45 4.20
18 19 3.723772 TGTGTGTCCACATGAAGGG 57.276 52.632 0.00 0.00 46.45 3.95
26 27 3.402628 ACTCCATTAGTGTGTGTCCAC 57.597 47.619 0.00 0.00 42.19 4.02
27 28 5.755409 ATTACTCCATTAGTGTGTGTCCA 57.245 39.130 0.00 0.00 39.39 4.02
28 29 8.732746 AATTATTACTCCATTAGTGTGTGTCC 57.267 34.615 0.00 0.00 39.39 4.02
44 45 9.471084 GGGCACGCAATTAAATTAATTATTACT 57.529 29.630 10.28 0.00 36.29 2.24
45 46 8.421701 CGGGCACGCAATTAAATTAATTATTAC 58.578 33.333 10.28 1.67 36.29 1.89
46 47 7.595502 CCGGGCACGCAATTAAATTAATTATTA 59.404 33.333 0.58 0.00 36.32 0.98
47 48 6.422400 CCGGGCACGCAATTAAATTAATTATT 59.578 34.615 0.58 0.00 36.32 1.40
48 49 5.923684 CCGGGCACGCAATTAAATTAATTAT 59.076 36.000 0.58 0.00 36.32 1.28
49 50 5.282510 CCGGGCACGCAATTAAATTAATTA 58.717 37.500 0.58 0.00 36.32 1.40
50 51 4.116238 CCGGGCACGCAATTAAATTAATT 58.884 39.130 0.58 5.23 39.22 1.40
51 52 3.712187 CCGGGCACGCAATTAAATTAAT 58.288 40.909 0.58 0.00 39.22 1.40
52 53 2.735762 GCCGGGCACGCAATTAAATTAA 60.736 45.455 15.62 0.00 39.22 1.40
53 54 1.202313 GCCGGGCACGCAATTAAATTA 60.202 47.619 15.62 0.00 39.22 1.40
54 55 0.459411 GCCGGGCACGCAATTAAATT 60.459 50.000 15.62 0.00 39.22 1.82
55 56 1.140804 GCCGGGCACGCAATTAAAT 59.859 52.632 15.62 0.00 39.22 1.40
56 57 2.569134 GCCGGGCACGCAATTAAA 59.431 55.556 15.62 0.00 39.22 1.52
57 58 3.444805 GGCCGGGCACGCAATTAA 61.445 61.111 25.33 0.00 39.22 1.40
107 108 2.039216 TGATTAGTTGGGGAGCGTTCAA 59.961 45.455 0.53 0.00 0.00 2.69
108 109 1.626321 TGATTAGTTGGGGAGCGTTCA 59.374 47.619 0.53 0.00 0.00 3.18
109 110 2.396590 TGATTAGTTGGGGAGCGTTC 57.603 50.000 0.00 0.00 0.00 3.95
110 111 2.711542 CTTGATTAGTTGGGGAGCGTT 58.288 47.619 0.00 0.00 0.00 4.84
111 112 1.679032 GCTTGATTAGTTGGGGAGCGT 60.679 52.381 0.00 0.00 0.00 5.07
112 113 1.017387 GCTTGATTAGTTGGGGAGCG 58.983 55.000 0.00 0.00 0.00 5.03
113 114 1.745653 GTGCTTGATTAGTTGGGGAGC 59.254 52.381 0.00 0.00 0.00 4.70
114 115 3.274288 GAGTGCTTGATTAGTTGGGGAG 58.726 50.000 0.00 0.00 0.00 4.30
115 116 2.026262 GGAGTGCTTGATTAGTTGGGGA 60.026 50.000 0.00 0.00 0.00 4.81
116 117 2.025887 AGGAGTGCTTGATTAGTTGGGG 60.026 50.000 0.00 0.00 0.00 4.96
117 118 3.274288 GAGGAGTGCTTGATTAGTTGGG 58.726 50.000 0.00 0.00 0.00 4.12
118 119 3.054802 AGGAGGAGTGCTTGATTAGTTGG 60.055 47.826 0.00 0.00 0.00 3.77
119 120 3.937706 CAGGAGGAGTGCTTGATTAGTTG 59.062 47.826 0.00 0.00 0.00 3.16
120 121 3.620966 GCAGGAGGAGTGCTTGATTAGTT 60.621 47.826 0.00 0.00 37.96 2.24
121 122 2.093235 GCAGGAGGAGTGCTTGATTAGT 60.093 50.000 0.00 0.00 37.96 2.24
122 123 2.559440 GCAGGAGGAGTGCTTGATTAG 58.441 52.381 0.00 0.00 37.96 1.73
123 124 2.698855 GCAGGAGGAGTGCTTGATTA 57.301 50.000 0.00 0.00 37.96 1.75
124 125 3.566130 GCAGGAGGAGTGCTTGATT 57.434 52.632 0.00 0.00 37.96 2.57
130 131 1.819905 GAGGTAGCAGGAGGAGTGC 59.180 63.158 0.00 0.00 41.54 4.40
131 132 1.388065 CCGAGGTAGCAGGAGGAGTG 61.388 65.000 0.74 0.00 0.00 3.51
132 133 1.076632 CCGAGGTAGCAGGAGGAGT 60.077 63.158 0.74 0.00 0.00 3.85
133 134 2.494530 GCCGAGGTAGCAGGAGGAG 61.495 68.421 10.15 0.00 0.00 3.69
134 135 2.442272 GCCGAGGTAGCAGGAGGA 60.442 66.667 10.15 0.00 0.00 3.71
135 136 2.093537 GATGCCGAGGTAGCAGGAGG 62.094 65.000 10.15 1.38 44.90 4.30
136 137 1.365633 GATGCCGAGGTAGCAGGAG 59.634 63.158 10.15 0.00 44.90 3.69
137 138 2.490148 CGATGCCGAGGTAGCAGGA 61.490 63.158 10.15 0.00 44.90 3.86
138 139 2.028190 CGATGCCGAGGTAGCAGG 59.972 66.667 0.00 0.00 44.90 4.85
139 140 1.299468 GTCGATGCCGAGGTAGCAG 60.299 63.158 0.00 0.00 46.52 4.24
140 141 1.753078 AGTCGATGCCGAGGTAGCA 60.753 57.895 0.00 0.00 46.52 3.49
141 142 1.299468 CAGTCGATGCCGAGGTAGC 60.299 63.158 0.00 0.00 46.52 3.58
142 143 0.955178 ATCAGTCGATGCCGAGGTAG 59.045 55.000 0.00 0.00 46.52 3.18
143 144 1.067060 CAATCAGTCGATGCCGAGGTA 59.933 52.381 0.00 0.00 46.52 3.08
144 145 0.179100 CAATCAGTCGATGCCGAGGT 60.179 55.000 0.00 0.00 46.52 3.85
145 146 1.493950 GCAATCAGTCGATGCCGAGG 61.494 60.000 0.00 0.00 46.52 4.63
146 147 0.529337 AGCAATCAGTCGATGCCGAG 60.529 55.000 4.38 0.00 46.52 4.63
147 148 0.528466 GAGCAATCAGTCGATGCCGA 60.528 55.000 4.38 0.00 43.35 5.54
148 149 0.807275 TGAGCAATCAGTCGATGCCG 60.807 55.000 4.38 0.00 37.07 5.69
149 150 1.372582 TTGAGCAATCAGTCGATGCC 58.627 50.000 4.38 0.00 30.13 4.40
150 151 3.360533 CAATTGAGCAATCAGTCGATGC 58.639 45.455 0.00 0.00 30.13 3.91
151 152 3.791122 GCCAATTGAGCAATCAGTCGATG 60.791 47.826 7.12 0.00 30.13 3.84
152 153 2.357009 GCCAATTGAGCAATCAGTCGAT 59.643 45.455 7.12 0.00 0.00 3.59
153 154 1.739466 GCCAATTGAGCAATCAGTCGA 59.261 47.619 7.12 0.00 0.00 4.20
154 155 1.530441 CGCCAATTGAGCAATCAGTCG 60.530 52.381 7.12 0.00 0.00 4.18
155 156 1.739466 TCGCCAATTGAGCAATCAGTC 59.261 47.619 7.12 0.00 0.00 3.51
156 157 1.741706 CTCGCCAATTGAGCAATCAGT 59.258 47.619 7.12 0.00 0.00 3.41
157 158 2.011947 TCTCGCCAATTGAGCAATCAG 58.988 47.619 7.12 3.16 33.41 2.90
158 159 2.112380 TCTCGCCAATTGAGCAATCA 57.888 45.000 7.12 0.00 33.41 2.57
159 160 2.287427 CCATCTCGCCAATTGAGCAATC 60.287 50.000 7.12 0.00 33.41 2.67
160 161 1.679680 CCATCTCGCCAATTGAGCAAT 59.320 47.619 7.12 0.70 33.41 3.56
161 162 1.097232 CCATCTCGCCAATTGAGCAA 58.903 50.000 7.12 0.00 33.41 3.91
162 163 0.252761 TCCATCTCGCCAATTGAGCA 59.747 50.000 7.12 0.00 33.41 4.26
163 164 0.659957 GTCCATCTCGCCAATTGAGC 59.340 55.000 7.12 7.89 33.41 4.26
164 165 0.933097 CGTCCATCTCGCCAATTGAG 59.067 55.000 7.12 0.47 34.72 3.02
165 166 0.461870 CCGTCCATCTCGCCAATTGA 60.462 55.000 7.12 0.00 0.00 2.57
166 167 0.461870 TCCGTCCATCTCGCCAATTG 60.462 55.000 0.00 0.00 0.00 2.32
167 168 0.462047 GTCCGTCCATCTCGCCAATT 60.462 55.000 0.00 0.00 0.00 2.32
168 169 1.144057 GTCCGTCCATCTCGCCAAT 59.856 57.895 0.00 0.00 0.00 3.16
169 170 2.577059 GTCCGTCCATCTCGCCAA 59.423 61.111 0.00 0.00 0.00 4.52
170 171 3.458163 GGTCCGTCCATCTCGCCA 61.458 66.667 0.00 0.00 35.97 5.69
171 172 3.458163 TGGTCCGTCCATCTCGCC 61.458 66.667 0.00 0.00 41.93 5.54
178 179 2.092861 TCTTTCTTTTGTGGTCCGTCCA 60.093 45.455 0.00 0.00 45.01 4.02
179 180 2.567985 TCTTTCTTTTGTGGTCCGTCC 58.432 47.619 0.00 0.00 0.00 4.79
180 181 4.537015 CAATCTTTCTTTTGTGGTCCGTC 58.463 43.478 0.00 0.00 0.00 4.79
181 182 3.317993 CCAATCTTTCTTTTGTGGTCCGT 59.682 43.478 0.00 0.00 0.00 4.69
182 183 3.857010 GCCAATCTTTCTTTTGTGGTCCG 60.857 47.826 0.00 0.00 0.00 4.79
183 184 3.554960 GGCCAATCTTTCTTTTGTGGTCC 60.555 47.826 0.00 0.00 0.00 4.46
184 185 3.653344 GGCCAATCTTTCTTTTGTGGTC 58.347 45.455 0.00 0.00 0.00 4.02
185 186 2.035832 CGGCCAATCTTTCTTTTGTGGT 59.964 45.455 2.24 0.00 0.00 4.16
186 187 2.035832 ACGGCCAATCTTTCTTTTGTGG 59.964 45.455 2.24 0.00 0.00 4.17
187 188 3.052036 CACGGCCAATCTTTCTTTTGTG 58.948 45.455 2.24 0.00 0.00 3.33
188 189 2.545742 GCACGGCCAATCTTTCTTTTGT 60.546 45.455 2.24 0.00 0.00 2.83
189 190 2.061028 GCACGGCCAATCTTTCTTTTG 58.939 47.619 2.24 0.00 0.00 2.44
190 191 2.438868 GCACGGCCAATCTTTCTTTT 57.561 45.000 2.24 0.00 0.00 2.27
203 204 0.740149 TCATCATCATTTGGCACGGC 59.260 50.000 0.00 0.00 0.00 5.68
204 205 3.720949 ATTCATCATCATTTGGCACGG 57.279 42.857 0.00 0.00 0.00 4.94
205 206 4.865925 ACAAATTCATCATCATTTGGCACG 59.134 37.500 8.94 0.00 42.40 5.34
206 207 6.539324 CAACAAATTCATCATCATTTGGCAC 58.461 36.000 8.94 0.00 42.40 5.01
207 208 5.122554 GCAACAAATTCATCATCATTTGGCA 59.877 36.000 8.94 0.00 42.40 4.92
208 209 5.122554 TGCAACAAATTCATCATCATTTGGC 59.877 36.000 8.94 4.87 42.40 4.52
209 210 6.370442 AGTGCAACAAATTCATCATCATTTGG 59.630 34.615 8.94 0.00 42.40 3.28
210 211 7.233689 CAGTGCAACAAATTCATCATCATTTG 58.766 34.615 0.00 3.60 43.31 2.32
211 212 6.370442 CCAGTGCAACAAATTCATCATCATTT 59.630 34.615 0.00 0.00 41.43 2.32
212 213 5.872617 CCAGTGCAACAAATTCATCATCATT 59.127 36.000 0.00 0.00 41.43 2.57
213 214 5.046878 ACCAGTGCAACAAATTCATCATCAT 60.047 36.000 0.00 0.00 41.43 2.45
214 215 4.281435 ACCAGTGCAACAAATTCATCATCA 59.719 37.500 0.00 0.00 41.43 3.07
215 216 4.813027 ACCAGTGCAACAAATTCATCATC 58.187 39.130 0.00 0.00 41.43 2.92
216 217 4.616604 CGACCAGTGCAACAAATTCATCAT 60.617 41.667 0.00 0.00 41.43 2.45
217 218 3.304592 CGACCAGTGCAACAAATTCATCA 60.305 43.478 0.00 0.00 41.43 3.07
218 219 3.236816 CGACCAGTGCAACAAATTCATC 58.763 45.455 0.00 0.00 41.43 2.92
219 220 2.607771 GCGACCAGTGCAACAAATTCAT 60.608 45.455 0.00 0.00 41.43 2.57
220 221 1.268999 GCGACCAGTGCAACAAATTCA 60.269 47.619 0.00 0.00 41.43 2.57
221 222 1.268999 TGCGACCAGTGCAACAAATTC 60.269 47.619 0.00 0.00 41.43 2.17
222 223 0.743688 TGCGACCAGTGCAACAAATT 59.256 45.000 0.00 0.00 41.43 1.82
223 224 0.743688 TTGCGACCAGTGCAACAAAT 59.256 45.000 0.00 0.00 46.62 2.32
224 225 2.184323 TTGCGACCAGTGCAACAAA 58.816 47.368 0.00 0.00 46.62 2.83
225 226 3.911137 TTGCGACCAGTGCAACAA 58.089 50.000 0.00 0.00 46.62 2.83
229 230 1.246649 ATTGAATTGCGACCAGTGCA 58.753 45.000 0.00 0.00 41.38 4.57
230 231 3.698029 ATATTGAATTGCGACCAGTGC 57.302 42.857 0.00 0.00 0.00 4.40
231 232 4.274069 CGAATATTGAATTGCGACCAGTG 58.726 43.478 0.00 0.00 0.00 3.66
232 233 3.242739 GCGAATATTGAATTGCGACCAGT 60.243 43.478 0.00 0.00 0.00 4.00
233 234 3.002656 AGCGAATATTGAATTGCGACCAG 59.997 43.478 0.00 0.00 0.00 4.00
234 235 2.942376 AGCGAATATTGAATTGCGACCA 59.058 40.909 0.00 0.00 0.00 4.02
235 236 3.609103 AGCGAATATTGAATTGCGACC 57.391 42.857 0.00 0.00 0.00 4.79
236 237 3.725740 CCAAGCGAATATTGAATTGCGAC 59.274 43.478 0.00 0.00 0.00 5.19
237 238 3.243035 CCCAAGCGAATATTGAATTGCGA 60.243 43.478 0.00 0.00 0.00 5.10
238 239 3.044986 CCCAAGCGAATATTGAATTGCG 58.955 45.455 0.00 0.00 0.00 4.85
252 253 7.716612 TCACATATATATACAGATCCCAAGCG 58.283 38.462 0.00 0.00 0.00 4.68
307 308 6.126768 ACCTTATATGTCATAGCACAACCAGT 60.127 38.462 0.00 0.00 0.00 4.00
309 310 6.054941 CACCTTATATGTCATAGCACAACCA 58.945 40.000 0.00 0.00 0.00 3.67
311 312 6.761242 TCACACCTTATATGTCATAGCACAAC 59.239 38.462 0.00 0.00 0.00 3.32
312 313 6.883744 TCACACCTTATATGTCATAGCACAA 58.116 36.000 0.00 0.00 0.00 3.33
313 314 6.478512 TCACACCTTATATGTCATAGCACA 57.521 37.500 0.00 0.00 0.00 4.57
314 315 6.309009 CGATCACACCTTATATGTCATAGCAC 59.691 42.308 0.00 0.00 0.00 4.40
316 317 5.289675 GCGATCACACCTTATATGTCATAGC 59.710 44.000 0.00 0.00 0.00 2.97
318 319 6.350194 GGAGCGATCACACCTTATATGTCATA 60.350 42.308 1.84 0.00 0.00 2.15
319 320 5.473931 GAGCGATCACACCTTATATGTCAT 58.526 41.667 0.00 0.00 0.00 3.06
320 321 4.262036 GGAGCGATCACACCTTATATGTCA 60.262 45.833 1.84 0.00 0.00 3.58
324 325 4.345257 ACAAGGAGCGATCACACCTTATAT 59.655 41.667 11.48 0.00 40.21 0.86
325 326 3.704566 ACAAGGAGCGATCACACCTTATA 59.295 43.478 11.48 0.00 40.21 0.98
326 327 2.501723 ACAAGGAGCGATCACACCTTAT 59.498 45.455 11.48 0.00 40.21 1.73
327 328 1.899814 ACAAGGAGCGATCACACCTTA 59.100 47.619 11.48 0.00 40.21 2.69
329 330 0.247736 GACAAGGAGCGATCACACCT 59.752 55.000 1.84 0.00 0.00 4.00
330 331 0.037326 TGACAAGGAGCGATCACACC 60.037 55.000 1.84 0.00 0.00 4.16
331 332 1.071605 GTGACAAGGAGCGATCACAC 58.928 55.000 1.84 1.00 40.95 3.82
332 333 0.969149 AGTGACAAGGAGCGATCACA 59.031 50.000 1.84 0.00 43.19 3.58
334 335 2.164422 CACTAGTGACAAGGAGCGATCA 59.836 50.000 18.45 0.00 0.00 2.92
335 336 2.480416 CCACTAGTGACAAGGAGCGATC 60.480 54.545 24.68 0.00 0.00 3.69
336 337 1.478510 CCACTAGTGACAAGGAGCGAT 59.521 52.381 24.68 0.00 0.00 4.58
338 339 0.737715 GCCACTAGTGACAAGGAGCG 60.738 60.000 24.68 5.09 0.00 5.03
340 341 0.888619 TCGCCACTAGTGACAAGGAG 59.111 55.000 24.68 8.94 0.00 3.69
341 342 0.888619 CTCGCCACTAGTGACAAGGA 59.111 55.000 24.68 11.68 0.00 3.36
342 343 0.737715 GCTCGCCACTAGTGACAAGG 60.738 60.000 24.68 8.16 0.00 3.61
344 345 0.679505 AAGCTCGCCACTAGTGACAA 59.320 50.000 24.68 7.57 0.00 3.18
346 347 1.469423 GGTAAGCTCGCCACTAGTGAC 60.469 57.143 24.68 12.19 0.00 3.67
348 349 0.530744 TGGTAAGCTCGCCACTAGTG 59.469 55.000 16.34 16.34 0.00 2.74
349 350 2.971676 TGGTAAGCTCGCCACTAGT 58.028 52.632 5.22 0.00 0.00 2.57
354 355 0.179121 CGTATGTGGTAAGCTCGCCA 60.179 55.000 5.22 5.22 0.00 5.69
355 356 0.101759 TCGTATGTGGTAAGCTCGCC 59.898 55.000 0.00 0.00 0.00 5.54
356 357 2.135664 ATCGTATGTGGTAAGCTCGC 57.864 50.000 0.00 0.00 0.00 5.03
357 358 5.332355 GCTTTAATCGTATGTGGTAAGCTCG 60.332 44.000 0.00 0.00 35.21 5.03
358 359 5.522460 TGCTTTAATCGTATGTGGTAAGCTC 59.478 40.000 0.00 0.00 38.02 4.09
359 360 5.424757 TGCTTTAATCGTATGTGGTAAGCT 58.575 37.500 0.00 0.00 38.02 3.74
362 363 5.464057 CCGATGCTTTAATCGTATGTGGTAA 59.536 40.000 5.92 0.00 46.32 2.85
363 364 4.986034 CCGATGCTTTAATCGTATGTGGTA 59.014 41.667 5.92 0.00 46.32 3.25
364 365 3.807622 CCGATGCTTTAATCGTATGTGGT 59.192 43.478 5.92 0.00 46.32 4.16
366 367 5.006261 TGAACCGATGCTTTAATCGTATGTG 59.994 40.000 5.92 0.00 46.32 3.21
368 369 5.234329 ACTGAACCGATGCTTTAATCGTATG 59.766 40.000 5.92 0.00 46.32 2.39
369 370 5.357257 ACTGAACCGATGCTTTAATCGTAT 58.643 37.500 5.92 0.00 46.32 3.06
370 371 4.751060 ACTGAACCGATGCTTTAATCGTA 58.249 39.130 5.92 0.00 46.32 3.43
374 375 4.222124 AGGACTGAACCGATGCTTTAAT 57.778 40.909 0.00 0.00 34.73 1.40
375 376 3.695830 AGGACTGAACCGATGCTTTAA 57.304 42.857 0.00 0.00 34.73 1.52
376 377 3.430374 GCTAGGACTGAACCGATGCTTTA 60.430 47.826 0.00 0.00 34.73 1.85
378 379 1.134670 GCTAGGACTGAACCGATGCTT 60.135 52.381 0.00 0.00 34.73 3.91
379 380 0.461961 GCTAGGACTGAACCGATGCT 59.538 55.000 0.00 0.00 34.73 3.79
380 381 0.461961 AGCTAGGACTGAACCGATGC 59.538 55.000 0.00 0.00 34.73 3.91
381 382 2.428890 AGAAGCTAGGACTGAACCGATG 59.571 50.000 0.00 0.00 34.73 3.84
382 383 2.741145 AGAAGCTAGGACTGAACCGAT 58.259 47.619 0.00 0.00 34.73 4.18
383 384 2.217510 AGAAGCTAGGACTGAACCGA 57.782 50.000 0.00 0.00 34.73 4.69
384 385 2.223618 GCTAGAAGCTAGGACTGAACCG 60.224 54.545 0.00 0.00 38.45 4.44
400 401 2.972713 ACTTGAACCCTTGTGAGCTAGA 59.027 45.455 0.00 0.00 0.00 2.43
403 404 1.771255 AGACTTGAACCCTTGTGAGCT 59.229 47.619 0.00 0.00 0.00 4.09
405 406 2.291741 GCAAGACTTGAACCCTTGTGAG 59.708 50.000 19.51 0.00 39.41 3.51
406 407 2.092429 AGCAAGACTTGAACCCTTGTGA 60.092 45.455 19.51 0.00 39.41 3.58
407 408 2.033801 CAGCAAGACTTGAACCCTTGTG 59.966 50.000 19.51 0.00 39.41 3.33
409 410 1.000938 GCAGCAAGACTTGAACCCTTG 60.001 52.381 19.51 7.43 40.00 3.61
411 412 0.475906 AGCAGCAAGACTTGAACCCT 59.524 50.000 19.51 3.38 0.00 4.34
412 413 0.877743 GAGCAGCAAGACTTGAACCC 59.122 55.000 19.51 0.92 0.00 4.11
413 414 1.803555 GAGAGCAGCAAGACTTGAACC 59.196 52.381 19.51 5.47 0.00 3.62
414 415 2.487934 TGAGAGCAGCAAGACTTGAAC 58.512 47.619 19.51 6.88 0.00 3.18
416 417 3.413846 AATGAGAGCAGCAAGACTTGA 57.586 42.857 19.51 0.00 0.00 3.02
419 420 4.880696 GGAATAAATGAGAGCAGCAAGACT 59.119 41.667 0.00 0.00 0.00 3.24
420 421 4.880696 AGGAATAAATGAGAGCAGCAAGAC 59.119 41.667 0.00 0.00 0.00 3.01
423 424 6.239217 TCTAGGAATAAATGAGAGCAGCAA 57.761 37.500 0.00 0.00 0.00 3.91
424 425 5.876651 TCTAGGAATAAATGAGAGCAGCA 57.123 39.130 0.00 0.00 0.00 4.41
425 426 7.742556 AAATCTAGGAATAAATGAGAGCAGC 57.257 36.000 0.00 0.00 0.00 5.25
441 442 7.649306 CGCCAAAAATCCTGAAATAAATCTAGG 59.351 37.037 0.00 0.00 0.00 3.02
443 444 8.287439 TCGCCAAAAATCCTGAAATAAATCTA 57.713 30.769 0.00 0.00 0.00 1.98
444 445 7.169158 TCGCCAAAAATCCTGAAATAAATCT 57.831 32.000 0.00 0.00 0.00 2.40
445 446 7.517259 GCATCGCCAAAAATCCTGAAATAAATC 60.517 37.037 0.00 0.00 0.00 2.17
446 447 6.258507 GCATCGCCAAAAATCCTGAAATAAAT 59.741 34.615 0.00 0.00 0.00 1.40
450 451 3.524541 GCATCGCCAAAAATCCTGAAAT 58.475 40.909 0.00 0.00 0.00 2.17
453 454 0.451383 CGCATCGCCAAAAATCCTGA 59.549 50.000 0.00 0.00 0.00 3.86
466 467 0.027194 CTTCCACTGAATGCGCATCG 59.973 55.000 25.53 17.09 0.00 3.84
467 468 0.379669 CCTTCCACTGAATGCGCATC 59.620 55.000 25.53 17.12 0.00 3.91
468 469 0.035152 TCCTTCCACTGAATGCGCAT 60.035 50.000 19.28 19.28 0.00 4.73
469 470 0.035152 ATCCTTCCACTGAATGCGCA 60.035 50.000 14.96 14.96 0.00 6.09
470 471 1.599542 GTATCCTTCCACTGAATGCGC 59.400 52.381 0.00 0.00 0.00 6.09
471 472 2.905075 TGTATCCTTCCACTGAATGCG 58.095 47.619 0.00 0.00 0.00 4.73
472 473 4.276926 GGAATGTATCCTTCCACTGAATGC 59.723 45.833 0.00 0.00 45.56 3.56
486 487 6.145209 CACTTCATCATCGACAGGAATGTATC 59.855 42.308 0.00 0.00 0.00 2.24
487 488 5.987953 CACTTCATCATCGACAGGAATGTAT 59.012 40.000 0.00 0.00 0.00 2.29
489 490 4.186926 CACTTCATCATCGACAGGAATGT 58.813 43.478 0.00 0.00 0.00 2.71
490 491 3.002042 GCACTTCATCATCGACAGGAATG 59.998 47.826 0.00 0.00 0.00 2.67
491 492 3.201290 GCACTTCATCATCGACAGGAAT 58.799 45.455 0.00 0.00 0.00 3.01
492 493 2.621338 GCACTTCATCATCGACAGGAA 58.379 47.619 0.00 0.00 0.00 3.36
493 494 1.134699 GGCACTTCATCATCGACAGGA 60.135 52.381 0.00 0.00 0.00 3.86
495 496 2.306341 AGGCACTTCATCATCGACAG 57.694 50.000 0.00 0.00 27.25 3.51
496 497 2.479560 CGTAGGCACTTCATCATCGACA 60.480 50.000 0.00 0.00 41.75 4.35
497 498 2.120232 CGTAGGCACTTCATCATCGAC 58.880 52.381 0.00 0.00 41.75 4.20
498 499 2.021457 TCGTAGGCACTTCATCATCGA 58.979 47.619 0.00 0.00 41.75 3.59
499 500 2.492019 TCGTAGGCACTTCATCATCG 57.508 50.000 0.00 0.00 41.75 3.84
500 501 3.738282 GTCATCGTAGGCACTTCATCATC 59.262 47.826 0.00 0.00 41.75 2.92
501 502 3.386078 AGTCATCGTAGGCACTTCATCAT 59.614 43.478 0.00 0.00 41.75 2.45
502 503 2.760650 AGTCATCGTAGGCACTTCATCA 59.239 45.455 0.00 0.00 41.75 3.07
503 504 3.444703 AGTCATCGTAGGCACTTCATC 57.555 47.619 0.00 0.00 41.75 2.92
505 506 2.415491 CGAAGTCATCGTAGGCACTTCA 60.415 50.000 15.78 0.00 46.52 3.02
506 507 2.186076 CGAAGTCATCGTAGGCACTTC 58.814 52.381 0.00 0.00 46.52 3.01
507 508 2.279582 CGAAGTCATCGTAGGCACTT 57.720 50.000 0.00 0.00 46.52 3.16
530 2697 9.807649 GACTGAACCAGCATATCATTTTAAAAT 57.192 29.630 7.64 7.64 34.37 1.82
531 2698 9.023962 AGACTGAACCAGCATATCATTTTAAAA 57.976 29.630 2.51 2.51 34.37 1.52
532 2699 8.579850 AGACTGAACCAGCATATCATTTTAAA 57.420 30.769 0.00 0.00 34.37 1.52
534 2701 8.579850 AAAGACTGAACCAGCATATCATTTTA 57.420 30.769 0.00 0.00 34.37 1.52
535 2702 7.472334 AAAGACTGAACCAGCATATCATTTT 57.528 32.000 0.00 0.00 34.37 1.82
536 2703 6.183360 CGAAAGACTGAACCAGCATATCATTT 60.183 38.462 0.00 0.00 34.37 2.32
537 2704 5.295292 CGAAAGACTGAACCAGCATATCATT 59.705 40.000 0.00 0.00 34.37 2.57
538 2705 4.813161 CGAAAGACTGAACCAGCATATCAT 59.187 41.667 0.00 0.00 34.37 2.45
539 2706 4.183865 CGAAAGACTGAACCAGCATATCA 58.816 43.478 0.00 0.00 34.37 2.15
541 2708 3.197766 TCCGAAAGACTGAACCAGCATAT 59.802 43.478 0.00 0.00 34.37 1.78
543 2710 1.347707 TCCGAAAGACTGAACCAGCAT 59.652 47.619 0.00 0.00 34.37 3.79
544 2711 0.756294 TCCGAAAGACTGAACCAGCA 59.244 50.000 0.00 0.00 34.37 4.41
545 2712 1.433534 CTCCGAAAGACTGAACCAGC 58.566 55.000 0.00 0.00 34.37 4.85
546 2713 1.344763 ACCTCCGAAAGACTGAACCAG 59.655 52.381 0.00 0.00 37.52 4.00
547 2714 1.070134 CACCTCCGAAAGACTGAACCA 59.930 52.381 0.00 0.00 0.00 3.67
548 2715 1.797025 CACCTCCGAAAGACTGAACC 58.203 55.000 0.00 0.00 0.00 3.62
549 2716 1.149148 GCACCTCCGAAAGACTGAAC 58.851 55.000 0.00 0.00 0.00 3.18
551 2718 0.603569 GAGCACCTCCGAAAGACTGA 59.396 55.000 0.00 0.00 0.00 3.41
552 2719 0.318441 TGAGCACCTCCGAAAGACTG 59.682 55.000 0.00 0.00 0.00 3.51
553 2720 1.270907 ATGAGCACCTCCGAAAGACT 58.729 50.000 0.00 0.00 0.00 3.24
554 2721 2.427453 TCTATGAGCACCTCCGAAAGAC 59.573 50.000 0.00 0.00 0.00 3.01
555 2722 2.690497 CTCTATGAGCACCTCCGAAAGA 59.310 50.000 0.00 0.00 0.00 2.52
557 2724 1.757118 CCTCTATGAGCACCTCCGAAA 59.243 52.381 0.00 0.00 0.00 3.46
558 2725 1.342076 ACCTCTATGAGCACCTCCGAA 60.342 52.381 0.00 0.00 0.00 4.30
559 2726 0.259065 ACCTCTATGAGCACCTCCGA 59.741 55.000 0.00 0.00 0.00 4.55
560 2727 1.883275 CTACCTCTATGAGCACCTCCG 59.117 57.143 0.00 0.00 0.00 4.63
561 2728 3.153919 CTCTACCTCTATGAGCACCTCC 58.846 54.545 0.00 0.00 0.00 4.30
563 2730 3.053245 ACACTCTACCTCTATGAGCACCT 60.053 47.826 0.00 0.00 0.00 4.00
564 2731 3.067461 CACACTCTACCTCTATGAGCACC 59.933 52.174 0.00 0.00 0.00 5.01
566 2733 2.690497 GCACACTCTACCTCTATGAGCA 59.310 50.000 0.00 0.00 0.00 4.26
567 2734 2.287308 CGCACACTCTACCTCTATGAGC 60.287 54.545 0.00 0.00 0.00 4.26
568 2735 3.206964 TCGCACACTCTACCTCTATGAG 58.793 50.000 0.00 0.00 0.00 2.90
569 2736 3.206964 CTCGCACACTCTACCTCTATGA 58.793 50.000 0.00 0.00 0.00 2.15
571 2738 2.946329 CACTCGCACACTCTACCTCTAT 59.054 50.000 0.00 0.00 0.00 1.98
572 2739 2.290134 ACACTCGCACACTCTACCTCTA 60.290 50.000 0.00 0.00 0.00 2.43
574 2741 0.882474 ACACTCGCACACTCTACCTC 59.118 55.000 0.00 0.00 0.00 3.85
575 2742 0.598562 CACACTCGCACACTCTACCT 59.401 55.000 0.00 0.00 0.00 3.08
576 2743 1.009389 GCACACTCGCACACTCTACC 61.009 60.000 0.00 0.00 0.00 3.18
578 2745 1.081442 CGCACACTCGCACACTCTA 60.081 57.895 0.00 0.00 0.00 2.43
579 2746 2.355126 CGCACACTCGCACACTCT 60.355 61.111 0.00 0.00 0.00 3.24
581 2748 0.528901 TAAACGCACACTCGCACACT 60.529 50.000 0.00 0.00 0.00 3.55
582 2749 0.511221 ATAAACGCACACTCGCACAC 59.489 50.000 0.00 0.00 0.00 3.82
583 2750 1.989864 CTATAAACGCACACTCGCACA 59.010 47.619 0.00 0.00 0.00 4.57
584 2751 1.990563 ACTATAAACGCACACTCGCAC 59.009 47.619 0.00 0.00 0.00 5.34
586 2753 1.323534 CCACTATAAACGCACACTCGC 59.676 52.381 0.00 0.00 0.00 5.03
587 2754 2.344441 CACCACTATAAACGCACACTCG 59.656 50.000 0.00 0.00 0.00 4.18
588 2755 3.122948 CACACCACTATAAACGCACACTC 59.877 47.826 0.00 0.00 0.00 3.51
589 2756 3.064207 CACACCACTATAAACGCACACT 58.936 45.455 0.00 0.00 0.00 3.55
590 2757 2.803956 ACACACCACTATAAACGCACAC 59.196 45.455 0.00 0.00 0.00 3.82
591 2758 2.803386 CACACACCACTATAAACGCACA 59.197 45.455 0.00 0.00 0.00 4.57
592 2759 2.803956 ACACACACCACTATAAACGCAC 59.196 45.455 0.00 0.00 0.00 5.34
593 2760 3.114668 ACACACACCACTATAAACGCA 57.885 42.857 0.00 0.00 0.00 5.24
594 2761 4.493545 GCATACACACACCACTATAAACGC 60.494 45.833 0.00 0.00 0.00 4.84
595 2762 4.259650 CGCATACACACACCACTATAAACG 60.260 45.833 0.00 0.00 0.00 3.60
597 2764 3.619483 GCGCATACACACACCACTATAAA 59.381 43.478 0.30 0.00 0.00 1.40
598 2765 3.118920 AGCGCATACACACACCACTATAA 60.119 43.478 11.47 0.00 0.00 0.98
599 2766 2.429250 AGCGCATACACACACCACTATA 59.571 45.455 11.47 0.00 0.00 1.31
600 2767 1.207089 AGCGCATACACACACCACTAT 59.793 47.619 11.47 0.00 0.00 2.12
601 2768 0.606096 AGCGCATACACACACCACTA 59.394 50.000 11.47 0.00 0.00 2.74
602 2769 0.250295 AAGCGCATACACACACCACT 60.250 50.000 11.47 0.00 0.00 4.00
603 2770 0.110238 CAAGCGCATACACACACCAC 60.110 55.000 11.47 0.00 0.00 4.16
605 2772 1.434555 TACAAGCGCATACACACACC 58.565 50.000 11.47 0.00 0.00 4.16
606 2773 4.506288 TCATATACAAGCGCATACACACAC 59.494 41.667 11.47 0.00 0.00 3.82
607 2774 4.688021 TCATATACAAGCGCATACACACA 58.312 39.130 11.47 0.00 0.00 3.72
609 2776 3.740832 GCTCATATACAAGCGCATACACA 59.259 43.478 11.47 0.00 0.00 3.72
618 2785 2.030457 ACGCAAACGCTCATATACAAGC 59.970 45.455 0.00 0.00 45.53 4.01
619 2786 3.551890 AGACGCAAACGCTCATATACAAG 59.448 43.478 0.00 0.00 45.53 3.16
620 2787 3.305897 CAGACGCAAACGCTCATATACAA 59.694 43.478 0.00 0.00 45.53 2.41
621 2788 2.857748 CAGACGCAAACGCTCATATACA 59.142 45.455 0.00 0.00 45.53 2.29
622 2789 2.858344 ACAGACGCAAACGCTCATATAC 59.142 45.455 0.00 0.00 45.53 1.47
627 4130 0.942410 GGTACAGACGCAAACGCTCA 60.942 55.000 0.00 0.00 45.53 4.26
636 4139 3.857923 TTTTTAACACGGTACAGACGC 57.142 42.857 0.00 0.00 34.00 5.19
655 4158 0.783579 GCGTTGCGTGCATCATTTTT 59.216 45.000 0.00 0.00 0.00 1.94
656 4159 1.008361 GGCGTTGCGTGCATCATTTT 61.008 50.000 0.00 0.00 0.00 1.82
665 4168 4.424430 GTAGTGCGGCGTTGCGTG 62.424 66.667 9.37 0.00 37.81 5.34
671 4174 2.419057 TTACCAACGTAGTGCGGCGT 62.419 55.000 9.37 0.31 45.00 5.68
672 4175 1.079875 ATTACCAACGTAGTGCGGCG 61.080 55.000 0.51 0.51 45.00 6.46
674 4177 2.599973 GTGTATTACCAACGTAGTGCGG 59.400 50.000 5.41 0.00 45.00 5.69
675 4178 3.894351 GTGTATTACCAACGTAGTGCG 57.106 47.619 0.00 0.00 45.00 5.34
686 4189 5.010999 GCGTGTGCAAGAGGTGTATTACC 62.011 52.174 0.00 0.00 45.26 2.85
690 4193 0.321671 AGCGTGTGCAAGAGGTGTAT 59.678 50.000 0.00 0.00 46.23 2.29
697 4202 1.675714 CCTCCATTAGCGTGTGCAAGA 60.676 52.381 0.00 0.00 46.23 3.02
743 4253 1.065854 AGTAAGACTGGCTCACATGGC 60.066 52.381 0.00 0.00 0.00 4.40
760 4287 3.056536 GTGCTCAGGTCAGAATGTGAGTA 60.057 47.826 0.00 0.00 38.54 2.59
763 4290 1.973515 AGTGCTCAGGTCAGAATGTGA 59.026 47.619 0.00 0.00 37.40 3.58
764 4291 2.074576 CAGTGCTCAGGTCAGAATGTG 58.925 52.381 0.00 0.00 37.40 3.21
765 4292 1.973515 TCAGTGCTCAGGTCAGAATGT 59.026 47.619 0.00 0.00 37.40 2.71
768 4326 1.342496 CAGTCAGTGCTCAGGTCAGAA 59.658 52.381 0.00 0.00 0.00 3.02
774 4332 0.108424 GTAGCCAGTCAGTGCTCAGG 60.108 60.000 0.00 0.00 39.00 3.86
777 4335 0.739112 GCTGTAGCCAGTCAGTGCTC 60.739 60.000 0.00 0.00 41.02 4.26
778 4336 1.294780 GCTGTAGCCAGTCAGTGCT 59.705 57.895 0.00 0.00 41.02 4.40
780 4338 2.097038 GCGCTGTAGCCAGTCAGTG 61.097 63.158 0.00 0.00 41.02 3.66
785 4343 3.633094 CTGACGCGCTGTAGCCAGT 62.633 63.158 5.73 0.00 41.02 4.00
799 4357 3.240069 TCTTAAAGCTTCGCGTACTGAC 58.760 45.455 5.77 0.00 0.00 3.51
829 4387 2.223876 CCACAGCAGTGCAAGATTTTGT 60.224 45.455 19.20 8.02 44.53 2.83
844 4405 2.290367 GGGAAAACATTTTTGCCACAGC 59.710 45.455 14.91 0.00 41.97 4.40
849 4410 1.587547 TGCGGGAAAACATTTTTGCC 58.412 45.000 10.91 10.91 39.59 4.52
850 4411 2.032117 CCTTGCGGGAAAACATTTTTGC 60.032 45.455 0.00 0.00 37.23 3.68
852 4413 2.158827 AGCCTTGCGGGAAAACATTTTT 60.159 40.909 0.00 0.00 37.23 1.94
857 4418 0.467290 AGAAGCCTTGCGGGAAAACA 60.467 50.000 0.00 0.00 37.23 2.83
859 4420 1.234615 CGAGAAGCCTTGCGGGAAAA 61.235 55.000 0.00 0.00 37.23 2.29
860 4421 1.671054 CGAGAAGCCTTGCGGGAAA 60.671 57.895 0.00 0.00 37.23 3.13
861 4422 2.047274 CGAGAAGCCTTGCGGGAA 60.047 61.111 0.00 0.00 37.23 3.97
862 4423 4.760047 GCGAGAAGCCTTGCGGGA 62.760 66.667 0.00 0.00 39.78 5.14
872 4433 2.715268 TGCGTTTTCTTTTGCGAGAAG 58.285 42.857 0.00 0.00 37.01 2.85
873 4434 2.834574 TGCGTTTTCTTTTGCGAGAA 57.165 40.000 0.00 0.00 34.00 2.87
874 4435 2.353269 TCTTGCGTTTTCTTTTGCGAGA 59.647 40.909 0.00 0.00 43.68 4.04
875 4436 2.715268 TCTTGCGTTTTCTTTTGCGAG 58.285 42.857 0.00 0.00 39.66 5.03
876 4437 2.353269 TCTCTTGCGTTTTCTTTTGCGA 59.647 40.909 0.00 0.00 0.00 5.10
877 4438 2.464016 GTCTCTTGCGTTTTCTTTTGCG 59.536 45.455 0.00 0.00 0.00 4.85
878 4439 3.434637 TGTCTCTTGCGTTTTCTTTTGC 58.565 40.909 0.00 0.00 0.00 3.68
879 4440 6.034898 ACATTTGTCTCTTGCGTTTTCTTTTG 59.965 34.615 0.00 0.00 0.00 2.44
880 4441 6.099341 ACATTTGTCTCTTGCGTTTTCTTTT 58.901 32.000 0.00 0.00 0.00 2.27
881 4442 5.650543 ACATTTGTCTCTTGCGTTTTCTTT 58.349 33.333 0.00 0.00 0.00 2.52
882 4443 5.248870 ACATTTGTCTCTTGCGTTTTCTT 57.751 34.783 0.00 0.00 0.00 2.52
883 4444 4.900635 ACATTTGTCTCTTGCGTTTTCT 57.099 36.364 0.00 0.00 0.00 2.52
884 4445 4.798387 ACAACATTTGTCTCTTGCGTTTTC 59.202 37.500 0.00 0.00 40.56 2.29
885 4446 4.743493 ACAACATTTGTCTCTTGCGTTTT 58.257 34.783 0.00 0.00 40.56 2.43
886 4447 4.370364 ACAACATTTGTCTCTTGCGTTT 57.630 36.364 0.00 0.00 40.56 3.60
887 4448 4.104776 CAACAACATTTGTCTCTTGCGTT 58.895 39.130 0.00 0.00 44.59 4.84
888 4449 3.128589 ACAACAACATTTGTCTCTTGCGT 59.871 39.130 0.00 0.00 44.59 5.24
889 4450 3.694734 ACAACAACATTTGTCTCTTGCG 58.305 40.909 0.00 0.00 44.59 4.85
903 4464 2.331451 GCCCGTGCTGACAACAAC 59.669 61.111 0.00 0.00 33.53 3.32
1008 4576 1.377333 CTTTCCAACCGGCCCTCTC 60.377 63.158 0.00 0.00 0.00 3.20
1101 4681 4.890306 GGGAGGGAGGGAGGAGGC 62.890 77.778 0.00 0.00 0.00 4.70
1102 4682 3.039526 AGGGAGGGAGGGAGGAGG 61.040 72.222 0.00 0.00 0.00 4.30
1103 4683 2.612251 GAGGGAGGGAGGGAGGAG 59.388 72.222 0.00 0.00 0.00 3.69
1104 4684 3.036959 GGAGGGAGGGAGGGAGGA 61.037 72.222 0.00 0.00 0.00 3.71
1105 4685 4.179599 GGGAGGGAGGGAGGGAGG 62.180 77.778 0.00 0.00 0.00 4.30
1106 4686 3.039526 AGGGAGGGAGGGAGGGAG 61.040 72.222 0.00 0.00 0.00 4.30
1107 4687 3.036959 GAGGGAGGGAGGGAGGGA 61.037 72.222 0.00 0.00 0.00 4.20
1108 4688 4.179599 GGAGGGAGGGAGGGAGGG 62.180 77.778 0.00 0.00 0.00 4.30
1245 4892 1.984570 TCCCGCCAAGAGACAGGAG 60.985 63.158 0.00 0.00 0.00 3.69
1440 5087 3.585862 CACGCCAATCAAGTAGTACTGT 58.414 45.455 5.39 0.00 0.00 3.55
1441 5088 2.930040 CCACGCCAATCAAGTAGTACTG 59.070 50.000 5.39 0.00 0.00 2.74
1442 5089 2.677037 GCCACGCCAATCAAGTAGTACT 60.677 50.000 0.00 0.00 0.00 2.73
1443 5090 1.664151 GCCACGCCAATCAAGTAGTAC 59.336 52.381 0.00 0.00 0.00 2.73
1444 5091 1.553248 AGCCACGCCAATCAAGTAGTA 59.447 47.619 0.00 0.00 0.00 1.82
1445 5092 0.324943 AGCCACGCCAATCAAGTAGT 59.675 50.000 0.00 0.00 0.00 2.73
1446 5093 0.729116 CAGCCACGCCAATCAAGTAG 59.271 55.000 0.00 0.00 0.00 2.57
1449 5096 0.314935 AAACAGCCACGCCAATCAAG 59.685 50.000 0.00 0.00 0.00 3.02
1464 5113 0.035036 TACGCCCACGAATCCAAACA 59.965 50.000 0.00 0.00 43.93 2.83
1465 5114 1.375551 ATACGCCCACGAATCCAAAC 58.624 50.000 0.00 0.00 43.93 2.93
1477 5126 0.179200 CAAGCACGACAAATACGCCC 60.179 55.000 0.00 0.00 0.00 6.13
1479 5128 0.165944 AGCAAGCACGACAAATACGC 59.834 50.000 0.00 0.00 0.00 4.42
1489 5138 1.774639 AAAGCAATTCAGCAAGCACG 58.225 45.000 0.00 0.00 36.85 5.34
1494 5143 4.247258 CAGGCATAAAAGCAATTCAGCAA 58.753 39.130 0.00 0.00 36.85 3.91
1495 5144 3.852286 CAGGCATAAAAGCAATTCAGCA 58.148 40.909 0.00 0.00 36.85 4.41
1496 5145 2.606272 GCAGGCATAAAAGCAATTCAGC 59.394 45.455 0.00 0.00 35.83 4.26
1497 5146 3.118884 AGGCAGGCATAAAAGCAATTCAG 60.119 43.478 0.00 0.00 35.83 3.02
1498 5147 2.833338 AGGCAGGCATAAAAGCAATTCA 59.167 40.909 0.00 0.00 35.83 2.57
1499 5148 3.531934 AGGCAGGCATAAAAGCAATTC 57.468 42.857 0.00 0.00 35.83 2.17
1500 5149 5.619132 ATTAGGCAGGCATAAAAGCAATT 57.381 34.783 2.31 0.00 35.83 2.32
1501 5150 5.604565 GAATTAGGCAGGCATAAAAGCAAT 58.395 37.500 2.31 0.00 35.83 3.56
1668 5344 4.202020 CGTTATTTCTCCCTGATCTCGTCA 60.202 45.833 0.00 0.00 35.05 4.35
1672 5348 5.011125 TCCATCGTTATTTCTCCCTGATCTC 59.989 44.000 0.00 0.00 0.00 2.75
1674 5350 5.215252 TCCATCGTTATTTCTCCCTGATC 57.785 43.478 0.00 0.00 0.00 2.92
1685 5361 8.786826 TTCTGACTACAATTTCCATCGTTATT 57.213 30.769 0.00 0.00 0.00 1.40
1686 5362 8.786826 TTTCTGACTACAATTTCCATCGTTAT 57.213 30.769 0.00 0.00 0.00 1.89
1687 5363 8.610248 TTTTCTGACTACAATTTCCATCGTTA 57.390 30.769 0.00 0.00 0.00 3.18
1704 5380 5.123027 CAGAGGAAGCCTGTATTTTTCTGAC 59.877 44.000 0.00 0.00 31.76 3.51
1721 5409 3.135994 GGACAAACGCTAAACAGAGGAA 58.864 45.455 0.00 0.00 0.00 3.36
1756 5460 2.973224 CCAGTTCGTCTGAAATTTTGCG 59.027 45.455 10.79 0.00 46.27 4.85
1770 5474 0.032952 TTTCCAGACGGACCAGTTCG 59.967 55.000 0.00 0.00 42.67 3.95
1836 5540 7.622713 TCCCCTAATTCTATCTACTCTACGAG 58.377 42.308 0.00 0.00 35.52 4.18
1837 5541 7.565190 TCCCCTAATTCTATCTACTCTACGA 57.435 40.000 0.00 0.00 0.00 3.43
1838 5542 7.884354 AGTTCCCCTAATTCTATCTACTCTACG 59.116 40.741 0.00 0.00 0.00 3.51
1839 5543 9.234827 GAGTTCCCCTAATTCTATCTACTCTAC 57.765 40.741 0.00 0.00 0.00 2.59
1840 5544 8.102047 CGAGTTCCCCTAATTCTATCTACTCTA 58.898 40.741 0.00 0.00 0.00 2.43
1841 5545 6.943718 CGAGTTCCCCTAATTCTATCTACTCT 59.056 42.308 0.00 0.00 0.00 3.24
1844 5548 6.897706 ACGAGTTCCCCTAATTCTATCTAC 57.102 41.667 0.00 0.00 0.00 2.59
1845 5549 7.173722 CCTACGAGTTCCCCTAATTCTATCTA 58.826 42.308 0.00 0.00 0.00 1.98
1847 5551 5.774184 ACCTACGAGTTCCCCTAATTCTATC 59.226 44.000 0.00 0.00 0.00 2.08
1849 5553 4.891756 CACCTACGAGTTCCCCTAATTCTA 59.108 45.833 0.00 0.00 0.00 2.10
1850 5554 3.705072 CACCTACGAGTTCCCCTAATTCT 59.295 47.826 0.00 0.00 0.00 2.40
1851 5555 3.703052 TCACCTACGAGTTCCCCTAATTC 59.297 47.826 0.00 0.00 0.00 2.17
1852 5556 3.716431 TCACCTACGAGTTCCCCTAATT 58.284 45.455 0.00 0.00 0.00 1.40
1853 5557 3.393426 TCACCTACGAGTTCCCCTAAT 57.607 47.619 0.00 0.00 0.00 1.73
1854 5558 2.905415 TCACCTACGAGTTCCCCTAA 57.095 50.000 0.00 0.00 0.00 2.69
1855 5559 2.662866 CATCACCTACGAGTTCCCCTA 58.337 52.381 0.00 0.00 0.00 3.53
1858 5562 0.527817 CGCATCACCTACGAGTTCCC 60.528 60.000 0.00 0.00 0.00 3.97
1859 5563 0.172803 ACGCATCACCTACGAGTTCC 59.827 55.000 0.00 0.00 0.00 3.62
1860 5564 2.838386 TACGCATCACCTACGAGTTC 57.162 50.000 0.00 0.00 0.00 3.01
1861 5565 2.686405 TCATACGCATCACCTACGAGTT 59.314 45.455 0.00 0.00 0.00 3.01
1862 5566 2.290916 CTCATACGCATCACCTACGAGT 59.709 50.000 0.00 0.00 0.00 4.18
1863 5567 2.290916 ACTCATACGCATCACCTACGAG 59.709 50.000 0.00 0.00 0.00 4.18
1864 5568 2.289820 GACTCATACGCATCACCTACGA 59.710 50.000 0.00 0.00 0.00 3.43
1871 5575 2.094957 TGACGTTGACTCATACGCATCA 60.095 45.455 11.35 7.68 41.24 3.07
1876 5580 3.482472 GCATACTGACGTTGACTCATACG 59.518 47.826 10.37 10.37 43.08 3.06
1880 5584 1.067142 GGGCATACTGACGTTGACTCA 60.067 52.381 0.00 0.00 0.00 3.41
1898 5602 1.606885 ATTGCGATGCAGGTTTGGGG 61.607 55.000 0.00 0.00 40.61 4.96
1899 5603 0.247185 AATTGCGATGCAGGTTTGGG 59.753 50.000 0.00 0.00 40.61 4.12
1908 5612 0.532115 ACAAAGGGGAATTGCGATGC 59.468 50.000 0.00 0.00 0.00 3.91
1909 5613 3.317603 AAACAAAGGGGAATTGCGATG 57.682 42.857 0.00 0.00 0.00 3.84
1948 5653 0.519175 CGAATTGCCAAGAAGACGCG 60.519 55.000 3.53 3.53 0.00 6.01
1960 5665 0.732196 TGTTTGCGCATCCGAATTGC 60.732 50.000 12.75 0.00 36.29 3.56
1967 5672 3.832276 TGTTTAGATTGTTTGCGCATCC 58.168 40.909 12.75 5.22 0.00 3.51
1975 5680 7.573968 ACTTGCTCTCTTGTTTAGATTGTTT 57.426 32.000 0.00 0.00 30.92 2.83
1991 5696 3.198853 GGTTGGATCCTTCTACTTGCTCT 59.801 47.826 14.23 0.00 0.00 4.09
1992 5697 3.198853 AGGTTGGATCCTTCTACTTGCTC 59.801 47.826 14.23 0.00 33.52 4.26
2013 5718 1.807742 TGAAACGGACGGCCAAATTAG 59.192 47.619 8.76 0.00 0.00 1.73
2028 5733 7.617041 AATAGAGTTACAGAGGCATTGAAAC 57.383 36.000 0.00 0.00 0.00 2.78
2072 5777 2.424601 ACATCAATCTCAAATGGTGGCG 59.575 45.455 0.00 0.00 31.86 5.69
2099 5804 0.239082 CAAAGATCAGCACGCAAGCA 59.761 50.000 0.00 0.00 45.62 3.91
2132 5837 6.919721 TGGTAGTTTATTTCCTTTGATGCAC 58.080 36.000 0.00 0.00 0.00 4.57
2197 5914 4.905866 CGTACAAGACATGAAGCAAAACAG 59.094 41.667 0.00 0.00 0.00 3.16
2208 5925 1.808411 AACCCTGCGTACAAGACATG 58.192 50.000 0.00 0.00 0.00 3.21
2209 5926 2.151202 CAAACCCTGCGTACAAGACAT 58.849 47.619 0.00 0.00 0.00 3.06
2210 5927 1.588674 CAAACCCTGCGTACAAGACA 58.411 50.000 0.00 0.00 0.00 3.41
2211 5928 0.237498 GCAAACCCTGCGTACAAGAC 59.763 55.000 0.00 0.00 42.37 3.01
2212 5929 2.624169 GCAAACCCTGCGTACAAGA 58.376 52.632 0.00 0.00 42.37 3.02
2263 5980 5.557576 TCTGGAACCCTCTGATGATAATG 57.442 43.478 0.00 0.00 0.00 1.90
2264 5981 5.669447 ACTTCTGGAACCCTCTGATGATAAT 59.331 40.000 0.00 0.00 0.00 1.28
2265 5982 5.032846 ACTTCTGGAACCCTCTGATGATAA 58.967 41.667 0.00 0.00 0.00 1.75
2274 5991 1.903183 ACTGCTACTTCTGGAACCCTC 59.097 52.381 0.00 0.00 0.00 4.30
2276 5993 1.339151 CCACTGCTACTTCTGGAACCC 60.339 57.143 0.00 0.00 0.00 4.11
2278 5995 3.526534 GATCCACTGCTACTTCTGGAAC 58.473 50.000 0.00 0.00 36.39 3.62
2378 6095 6.640499 TGTTTCCGAGTTGCAGAAATTTAATG 59.360 34.615 1.92 0.00 0.00 1.90
2450 6167 3.774066 AGCTGCAACAAGAAACAAACTC 58.226 40.909 1.02 0.00 0.00 3.01
2493 6210 2.231478 TCTCAAGGACCTCTTACGCTTG 59.769 50.000 0.00 0.00 33.68 4.01
2525 6242 5.055812 CAGAAGATAGAGAATGGTGGCTTC 58.944 45.833 0.00 0.00 0.00 3.86
2541 6267 7.855375 TCCTTGATTCTAACATCACAGAAGAT 58.145 34.615 0.00 0.00 34.43 2.40
2547 6273 7.283807 CCATGATTCCTTGATTCTAACATCACA 59.716 37.037 0.00 0.00 32.68 3.58
2548 6274 7.284034 ACCATGATTCCTTGATTCTAACATCAC 59.716 37.037 0.00 0.00 32.68 3.06
2555 6281 5.114764 TGCACCATGATTCCTTGATTCTA 57.885 39.130 0.00 0.00 0.00 2.10
2584 6310 6.128472 GGTTTTTCAGAAGCTATTGGCATTTG 60.128 38.462 0.00 0.00 44.79 2.32
2641 6367 5.588648 CAGGAAGAAAGTTGTTGTTACTGGA 59.411 40.000 1.24 0.00 0.00 3.86
2646 6372 5.355910 GGTCACAGGAAGAAAGTTGTTGTTA 59.644 40.000 0.00 0.00 0.00 2.41
2666 6392 2.509166 ATCCGAGACAGTACTGGTCA 57.491 50.000 26.12 8.54 37.74 4.02
2711 6437 0.035630 ACTGCCTCTGCCAAGATGAC 60.036 55.000 0.00 0.00 36.33 3.06
2749 6475 3.005791 CCACTGGATTCTTTTGGTGTTCC 59.994 47.826 0.00 0.00 0.00 3.62
2750 6476 3.552890 GCCACTGGATTCTTTTGGTGTTC 60.553 47.826 0.00 0.00 0.00 3.18
2865 6591 1.729517 TGGCGTAACATCGACATTGTG 59.270 47.619 0.00 0.00 44.20 3.33
2892 6618 2.163818 TCTGGTAACTGCGACCAAAG 57.836 50.000 3.22 0.00 46.27 2.77
2940 6666 4.460382 CCAGATTGTGTGTTCTTATGCCTT 59.540 41.667 0.00 0.00 0.00 4.35
2964 6690 5.798125 TTTTTACCATGTTGATTGCTCCA 57.202 34.783 0.00 0.00 0.00 3.86
3004 6730 5.178438 GTCTTCCTGTTGACAAATCAGACTC 59.822 44.000 7.25 0.00 35.83 3.36
3132 6858 2.415168 TGACGAAAAGCTTATCGCCTTG 59.585 45.455 0.00 0.00 42.61 3.61
3142 6868 0.035458 CTCCCACCTGACGAAAAGCT 59.965 55.000 0.00 0.00 0.00 3.74
3150 6876 1.386533 CATCAATGCTCCCACCTGAC 58.613 55.000 0.00 0.00 0.00 3.51
3153 6879 0.706433 AACCATCAATGCTCCCACCT 59.294 50.000 0.00 0.00 0.00 4.00
3159 6885 3.308438 ACTTGCAAACCATCAATGCTC 57.692 42.857 0.00 0.00 40.66 4.26
3238 6964 2.166870 TCCATTGATCATTTGCCACTGC 59.833 45.455 0.00 0.00 38.26 4.40
3353 7091 4.957684 ATATTTAGGAACGGAGGGAGTG 57.042 45.455 0.00 0.00 0.00 3.51
3355 7093 6.494146 AGACTTATATTTAGGAACGGAGGGAG 59.506 42.308 0.00 0.00 0.00 4.30
3356 7094 6.379579 AGACTTATATTTAGGAACGGAGGGA 58.620 40.000 0.00 0.00 0.00 4.20
3357 7095 6.667558 AGACTTATATTTAGGAACGGAGGG 57.332 41.667 0.00 0.00 0.00 4.30
3358 7096 8.959705 AAAAGACTTATATTTAGGAACGGAGG 57.040 34.615 0.00 0.00 0.00 4.30
3373 7111 9.944376 TGTAGTGCAATCTCTAAAAAGACTTAT 57.056 29.630 0.00 0.00 0.00 1.73
3374 7112 9.772973 TTGTAGTGCAATCTCTAAAAAGACTTA 57.227 29.630 0.00 0.00 31.07 2.24
3375 7113 8.677148 TTGTAGTGCAATCTCTAAAAAGACTT 57.323 30.769 0.00 0.00 31.07 3.01
3376 7114 8.560374 GTTTGTAGTGCAATCTCTAAAAAGACT 58.440 33.333 0.00 0.00 36.89 3.24
3377 7115 8.560374 AGTTTGTAGTGCAATCTCTAAAAAGAC 58.440 33.333 0.00 0.00 36.89 3.01
3378 7116 8.677148 AGTTTGTAGTGCAATCTCTAAAAAGA 57.323 30.769 0.00 0.00 36.89 2.52
3379 7117 9.813080 GTAGTTTGTAGTGCAATCTCTAAAAAG 57.187 33.333 7.69 0.00 37.97 2.27
3380 7118 9.332502 TGTAGTTTGTAGTGCAATCTCTAAAAA 57.667 29.630 7.69 0.00 37.97 1.94
3381 7119 8.896320 TGTAGTTTGTAGTGCAATCTCTAAAA 57.104 30.769 7.69 0.00 37.97 1.52
3383 7121 9.582431 GTATGTAGTTTGTAGTGCAATCTCTAA 57.418 33.333 7.69 0.00 37.97 2.10
3384 7122 7.913821 CGTATGTAGTTTGTAGTGCAATCTCTA 59.086 37.037 7.69 3.30 37.97 2.43
3385 7123 6.752351 CGTATGTAGTTTGTAGTGCAATCTCT 59.248 38.462 7.69 4.11 37.97 3.10
3386 7124 6.019801 CCGTATGTAGTTTGTAGTGCAATCTC 60.020 42.308 7.69 2.52 37.97 2.75
3387 7125 5.810587 CCGTATGTAGTTTGTAGTGCAATCT 59.189 40.000 9.16 9.16 39.60 2.40
3388 7126 5.808540 TCCGTATGTAGTTTGTAGTGCAATC 59.191 40.000 0.00 0.00 36.89 2.67
3389 7127 5.726397 TCCGTATGTAGTTTGTAGTGCAAT 58.274 37.500 0.00 0.00 36.89 3.56
3390 7128 5.136816 TCCGTATGTAGTTTGTAGTGCAA 57.863 39.130 0.00 0.00 34.87 4.08
3391 7129 4.787260 TCCGTATGTAGTTTGTAGTGCA 57.213 40.909 0.00 0.00 0.00 4.57
3392 7130 5.107133 ACATCCGTATGTAGTTTGTAGTGC 58.893 41.667 0.00 0.00 44.66 4.40
3449 7187 9.226606 CCACTATGGACTACATACAAAGAAAAA 57.773 33.333 0.00 0.00 40.96 1.94
3450 7188 8.598916 TCCACTATGGACTACATACAAAGAAAA 58.401 33.333 0.00 0.00 42.67 2.29
3451 7189 8.141298 TCCACTATGGACTACATACAAAGAAA 57.859 34.615 0.00 0.00 42.67 2.52
3452 7190 7.727578 TCCACTATGGACTACATACAAAGAA 57.272 36.000 0.00 0.00 42.67 2.52
3466 7204 6.158695 AGCCTTTTTAGAGATTCCACTATGGA 59.841 38.462 0.00 0.00 46.61 3.41
3467 7205 6.360618 AGCCTTTTTAGAGATTCCACTATGG 58.639 40.000 0.00 0.00 39.43 2.74
3468 7206 7.872113 AAGCCTTTTTAGAGATTCCACTATG 57.128 36.000 0.00 0.00 0.00 2.23
3480 7218 9.333724 CCGTTCCTAAATATAAGCCTTTTTAGA 57.666 33.333 8.15 0.00 34.90 2.10
3481 7219 9.333724 TCCGTTCCTAAATATAAGCCTTTTTAG 57.666 33.333 1.71 1.71 33.47 1.85
3482 7220 9.333724 CTCCGTTCCTAAATATAAGCCTTTTTA 57.666 33.333 0.00 0.00 0.00 1.52
3483 7221 7.284716 CCTCCGTTCCTAAATATAAGCCTTTTT 59.715 37.037 0.00 0.00 0.00 1.94
3484 7222 6.771267 CCTCCGTTCCTAAATATAAGCCTTTT 59.229 38.462 0.00 0.00 0.00 2.27
3485 7223 6.296803 CCTCCGTTCCTAAATATAAGCCTTT 58.703 40.000 0.00 0.00 0.00 3.11
3486 7224 5.221864 CCCTCCGTTCCTAAATATAAGCCTT 60.222 44.000 0.00 0.00 0.00 4.35
3487 7225 4.286291 CCCTCCGTTCCTAAATATAAGCCT 59.714 45.833 0.00 0.00 0.00 4.58
3488 7226 4.285260 TCCCTCCGTTCCTAAATATAAGCC 59.715 45.833 0.00 0.00 0.00 4.35
3489 7227 5.011840 ACTCCCTCCGTTCCTAAATATAAGC 59.988 44.000 0.00 0.00 0.00 3.09
3490 7228 6.041751 ACACTCCCTCCGTTCCTAAATATAAG 59.958 42.308 0.00 0.00 0.00 1.73
3491 7229 5.901276 ACACTCCCTCCGTTCCTAAATATAA 59.099 40.000 0.00 0.00 0.00 0.98
3492 7230 5.461327 ACACTCCCTCCGTTCCTAAATATA 58.539 41.667 0.00 0.00 0.00 0.86
3493 7231 4.296056 ACACTCCCTCCGTTCCTAAATAT 58.704 43.478 0.00 0.00 0.00 1.28
3494 7232 3.716431 ACACTCCCTCCGTTCCTAAATA 58.284 45.455 0.00 0.00 0.00 1.40
3495 7233 2.547990 ACACTCCCTCCGTTCCTAAAT 58.452 47.619 0.00 0.00 0.00 1.40
3496 7234 2.019807 ACACTCCCTCCGTTCCTAAA 57.980 50.000 0.00 0.00 0.00 1.85
3497 7235 2.905415 TACACTCCCTCCGTTCCTAA 57.095 50.000 0.00 0.00 0.00 2.69
3498 7236 3.028850 CAATACACTCCCTCCGTTCCTA 58.971 50.000 0.00 0.00 0.00 2.94
3499 7237 1.831736 CAATACACTCCCTCCGTTCCT 59.168 52.381 0.00 0.00 0.00 3.36
3500 7238 1.742750 GCAATACACTCCCTCCGTTCC 60.743 57.143 0.00 0.00 0.00 3.62
3501 7239 1.066430 TGCAATACACTCCCTCCGTTC 60.066 52.381 0.00 0.00 0.00 3.95
3502 7240 0.981183 TGCAATACACTCCCTCCGTT 59.019 50.000 0.00 0.00 0.00 4.44
3503 7241 1.139058 GATGCAATACACTCCCTCCGT 59.861 52.381 0.00 0.00 0.00 4.69
3504 7242 1.869754 CGATGCAATACACTCCCTCCG 60.870 57.143 0.00 0.00 0.00 4.63
3505 7243 1.541233 CCGATGCAATACACTCCCTCC 60.541 57.143 0.00 0.00 0.00 4.30
3506 7244 1.412710 TCCGATGCAATACACTCCCTC 59.587 52.381 0.00 0.00 0.00 4.30
3507 7245 1.414181 CTCCGATGCAATACACTCCCT 59.586 52.381 0.00 0.00 0.00 4.20
3508 7246 1.871080 CTCCGATGCAATACACTCCC 58.129 55.000 0.00 0.00 0.00 4.30
3509 7247 1.202580 AGCTCCGATGCAATACACTCC 60.203 52.381 0.00 0.00 34.99 3.85
3510 7248 2.231215 AGCTCCGATGCAATACACTC 57.769 50.000 0.00 0.00 34.99 3.51
3511 7249 2.679837 CAAAGCTCCGATGCAATACACT 59.320 45.455 0.00 0.00 34.99 3.55
3512 7250 2.223340 CCAAAGCTCCGATGCAATACAC 60.223 50.000 0.00 0.00 34.99 2.90
3513 7251 2.016318 CCAAAGCTCCGATGCAATACA 58.984 47.619 0.00 0.00 34.99 2.29
3514 7252 2.017049 ACCAAAGCTCCGATGCAATAC 58.983 47.619 0.00 0.00 34.99 1.89
3523 7261 2.699954 ACAGACATAACCAAAGCTCCG 58.300 47.619 0.00 0.00 0.00 4.63
3548 7286 4.524802 TGCCCCATGTTTCTGATTCTAT 57.475 40.909 0.00 0.00 0.00 1.98
3570 7309 5.598769 AGTAACGAGTAGCAAACAGAAACT 58.401 37.500 0.00 0.00 0.00 2.66
3583 7322 8.158169 TGAGAGAGTAAACAAAGTAACGAGTA 57.842 34.615 0.00 0.00 0.00 2.59
3619 7358 8.909923 ACTTTTACAAAATAACCACTTAGCAGT 58.090 29.630 0.00 0.00 0.00 4.40
3643 7389 3.258372 TGCTCCACGTTTCTGATTCTACT 59.742 43.478 0.00 0.00 0.00 2.57
3658 7404 1.338020 CAAACAGAAACCCTGCTCCAC 59.662 52.381 0.00 0.00 46.81 4.02
3769 7515 8.021396 ACATTTGAGGCGAAGTAAAATTAGAAC 58.979 33.333 0.00 0.00 0.00 3.01
3830 7576 1.512926 CAAGTGGACAGTGTACCTGC 58.487 55.000 2.17 0.00 45.68 4.85
3996 7742 5.516339 GGTTGATTGAAACATTAGAATGCCG 59.484 40.000 2.09 0.00 40.04 5.69
4027 7773 8.075574 TGAAAAGCAACACACAATTAGATACAG 58.924 33.333 0.00 0.00 0.00 2.74
4046 7793 2.424956 CTGGGGAGCTACATTGAAAAGC 59.575 50.000 0.00 0.00 36.48 3.51
4069 7816 1.683917 AGTATACGAGCTCAGGCCTTG 59.316 52.381 15.40 0.00 39.73 3.61
4082 7829 5.869888 AGTTTCTGCTGAAGGAAAGTATACG 59.130 40.000 6.13 0.00 34.55 3.06
4391 8138 1.220477 GAGCTTCCTGTCTGCCCTC 59.780 63.158 0.00 0.00 0.00 4.30
4484 8231 1.077140 TGGCGCCATATTCCTTGCA 60.077 52.632 29.03 0.00 0.00 4.08
4622 8369 2.868583 CCTGTCGATGTAATCTGCCAAG 59.131 50.000 0.00 0.00 42.58 3.61
4728 8475 1.001293 TGACAGCAACTCCAGCAGTAG 59.999 52.381 0.00 0.00 32.30 2.57
4856 8603 2.910977 GGGGAACTCTGACCTTAAGGAA 59.089 50.000 28.52 14.19 38.94 3.36
4964 8712 7.592736 TGTCCCATATACCCTATATCCTACAG 58.407 42.308 0.00 0.00 0.00 2.74
4979 8727 4.080582 CCACACCACTTCTTGTCCCATATA 60.081 45.833 0.00 0.00 0.00 0.86
4980 8728 3.308402 CCACACCACTTCTTGTCCCATAT 60.308 47.826 0.00 0.00 0.00 1.78
5057 8805 0.909610 TCTCCCACATTTCGCTCCCT 60.910 55.000 0.00 0.00 0.00 4.20
5064 8812 4.505313 GGAAACAACTCTCCCACATTTC 57.495 45.455 0.00 0.00 0.00 2.17
5094 8842 7.920151 CAGAATTGTAACAACTGACAAAATCCA 59.080 33.333 0.00 0.00 38.94 3.41
5096 8844 8.856490 ACAGAATTGTAACAACTGACAAAATC 57.144 30.769 0.00 0.00 38.94 2.17
5118 8867 3.594603 ACTGACCGACCTGATTTACAG 57.405 47.619 0.00 0.00 45.36 2.74
5166 8916 5.258685 TCTCGTGTACGCAATAACAAAAG 57.741 39.130 7.29 0.00 39.60 2.27
5208 8990 6.710597 TGAAGGAAACATATACGCTCTACT 57.289 37.500 0.00 0.00 0.00 2.57
5269 9051 7.436118 TCGCAAAACTAGAAACTTAGTCCTAA 58.564 34.615 0.00 0.00 32.84 2.69
5277 9059 5.123344 ACAACACTCGCAAAACTAGAAACTT 59.877 36.000 0.00 0.00 0.00 2.66
5279 9061 4.728608 CACAACACTCGCAAAACTAGAAAC 59.271 41.667 0.00 0.00 0.00 2.78
5283 9065 3.601586 CGACACAACACTCGCAAAACTAG 60.602 47.826 0.00 0.00 0.00 2.57
5290 9072 0.249280 ACATCGACACAACACTCGCA 60.249 50.000 0.00 0.00 0.00 5.10
5291 9073 0.859232 AACATCGACACAACACTCGC 59.141 50.000 0.00 0.00 0.00 5.03
5293 9075 1.597195 TGCAACATCGACACAACACTC 59.403 47.619 0.00 0.00 0.00 3.51
5295 9077 2.686558 ATGCAACATCGACACAACAC 57.313 45.000 0.00 0.00 0.00 3.32
5300 9082 4.475028 TCAATGAAATGCAACATCGACAC 58.525 39.130 0.00 0.00 0.00 3.67
5317 9099 7.854422 GCACAGTACATCAGTCAATATTCAATG 59.146 37.037 0.00 0.00 0.00 2.82
5318 9100 7.553760 TGCACAGTACATCAGTCAATATTCAAT 59.446 33.333 0.00 0.00 0.00 2.57
5319 9101 6.878389 TGCACAGTACATCAGTCAATATTCAA 59.122 34.615 0.00 0.00 0.00 2.69
5359 9141 8.875168 TGTTATCATGTAAAACCTCCCATTTTT 58.125 29.630 0.00 0.00 31.79 1.94
5360 9142 8.429237 TGTTATCATGTAAAACCTCCCATTTT 57.571 30.769 0.00 0.00 33.85 1.82
5361 9143 8.608185 ATGTTATCATGTAAAACCTCCCATTT 57.392 30.769 0.00 0.00 32.51 2.32
5362 9144 9.131791 GTATGTTATCATGTAAAACCTCCCATT 57.868 33.333 0.00 0.00 35.70 3.16
5363 9145 8.278639 TGTATGTTATCATGTAAAACCTCCCAT 58.721 33.333 0.00 0.00 35.70 4.00
5364 9146 7.554835 GTGTATGTTATCATGTAAAACCTCCCA 59.445 37.037 0.00 0.00 35.70 4.37
5365 9147 7.012989 GGTGTATGTTATCATGTAAAACCTCCC 59.987 40.741 0.00 0.00 35.70 4.30
5366 9148 7.012989 GGGTGTATGTTATCATGTAAAACCTCC 59.987 40.741 0.00 0.00 35.70 4.30
5367 9149 7.254658 CGGGTGTATGTTATCATGTAAAACCTC 60.255 40.741 0.00 0.00 35.70 3.85
5368 9150 6.540914 CGGGTGTATGTTATCATGTAAAACCT 59.459 38.462 0.00 0.00 35.70 3.50
5369 9151 6.721321 CGGGTGTATGTTATCATGTAAAACC 58.279 40.000 0.00 0.00 35.70 3.27
5370 9152 6.183360 TGCGGGTGTATGTTATCATGTAAAAC 60.183 38.462 0.00 0.00 35.70 2.43
5371 9153 5.880887 TGCGGGTGTATGTTATCATGTAAAA 59.119 36.000 0.00 0.00 35.70 1.52
5372 9154 5.429130 TGCGGGTGTATGTTATCATGTAAA 58.571 37.500 0.00 0.00 35.70 2.01
5373 9155 5.024785 TGCGGGTGTATGTTATCATGTAA 57.975 39.130 0.00 0.00 35.70 2.41
5374 9156 4.674281 TGCGGGTGTATGTTATCATGTA 57.326 40.909 0.00 0.00 35.70 2.29
5375 9157 3.552132 TGCGGGTGTATGTTATCATGT 57.448 42.857 0.00 0.00 35.70 3.21
5376 9158 4.497340 GGTTTGCGGGTGTATGTTATCATG 60.497 45.833 0.00 0.00 35.70 3.07
5377 9159 3.630312 GGTTTGCGGGTGTATGTTATCAT 59.370 43.478 0.00 0.00 38.00 2.45
5378 9160 3.011119 GGTTTGCGGGTGTATGTTATCA 58.989 45.455 0.00 0.00 0.00 2.15
5379 9161 3.011119 TGGTTTGCGGGTGTATGTTATC 58.989 45.455 0.00 0.00 0.00 1.75
5380 9162 3.013921 CTGGTTTGCGGGTGTATGTTAT 58.986 45.455 0.00 0.00 0.00 1.89
5381 9163 2.428491 CTGGTTTGCGGGTGTATGTTA 58.572 47.619 0.00 0.00 0.00 2.41
5382 9164 1.243902 CTGGTTTGCGGGTGTATGTT 58.756 50.000 0.00 0.00 0.00 2.71
5383 9165 0.608035 CCTGGTTTGCGGGTGTATGT 60.608 55.000 0.00 0.00 0.00 2.29
5384 9166 0.322098 TCCTGGTTTGCGGGTGTATG 60.322 55.000 0.00 0.00 0.00 2.39
5385 9167 0.402504 TTCCTGGTTTGCGGGTGTAT 59.597 50.000 0.00 0.00 0.00 2.29
5386 9168 0.183014 TTTCCTGGTTTGCGGGTGTA 59.817 50.000 0.00 0.00 0.00 2.90
5387 9169 1.076632 TTTCCTGGTTTGCGGGTGT 60.077 52.632 0.00 0.00 0.00 4.16
5388 9170 0.821711 TCTTTCCTGGTTTGCGGGTG 60.822 55.000 0.00 0.00 0.00 4.61
5389 9171 0.537371 CTCTTTCCTGGTTTGCGGGT 60.537 55.000 0.00 0.00 0.00 5.28
5390 9172 1.244019 CCTCTTTCCTGGTTTGCGGG 61.244 60.000 0.00 0.00 0.00 6.13
5391 9173 0.250727 TCCTCTTTCCTGGTTTGCGG 60.251 55.000 0.00 0.00 0.00 5.69
5392 9174 1.604604 TTCCTCTTTCCTGGTTTGCG 58.395 50.000 0.00 0.00 0.00 4.85
5393 9175 4.589908 TCTATTCCTCTTTCCTGGTTTGC 58.410 43.478 0.00 0.00 0.00 3.68
5394 9176 5.124617 GCTTCTATTCCTCTTTCCTGGTTTG 59.875 44.000 0.00 0.00 0.00 2.93
5395 9177 5.222130 TGCTTCTATTCCTCTTTCCTGGTTT 60.222 40.000 0.00 0.00 0.00 3.27
5396 9178 4.289672 TGCTTCTATTCCTCTTTCCTGGTT 59.710 41.667 0.00 0.00 0.00 3.67
5397 9179 3.846588 TGCTTCTATTCCTCTTTCCTGGT 59.153 43.478 0.00 0.00 0.00 4.00
5398 9180 4.494091 TGCTTCTATTCCTCTTTCCTGG 57.506 45.455 0.00 0.00 0.00 4.45
5399 9181 6.656693 TCTTTTGCTTCTATTCCTCTTTCCTG 59.343 38.462 0.00 0.00 0.00 3.86
5400 9182 6.657117 GTCTTTTGCTTCTATTCCTCTTTCCT 59.343 38.462 0.00 0.00 0.00 3.36
5401 9183 6.431234 TGTCTTTTGCTTCTATTCCTCTTTCC 59.569 38.462 0.00 0.00 0.00 3.13
5402 9184 7.440523 TGTCTTTTGCTTCTATTCCTCTTTC 57.559 36.000 0.00 0.00 0.00 2.62
5403 9185 7.823745 TTGTCTTTTGCTTCTATTCCTCTTT 57.176 32.000 0.00 0.00 0.00 2.52
5404 9186 7.503902 ACTTTGTCTTTTGCTTCTATTCCTCTT 59.496 33.333 0.00 0.00 0.00 2.85
5405 9187 7.001073 ACTTTGTCTTTTGCTTCTATTCCTCT 58.999 34.615 0.00 0.00 0.00 3.69
5406 9188 7.041098 TGACTTTGTCTTTTGCTTCTATTCCTC 60.041 37.037 0.00 0.00 33.15 3.71
5407 9189 6.772716 TGACTTTGTCTTTTGCTTCTATTCCT 59.227 34.615 0.00 0.00 33.15 3.36
5408 9190 6.858478 GTGACTTTGTCTTTTGCTTCTATTCC 59.142 38.462 0.00 0.00 33.15 3.01
5409 9191 7.417612 TGTGACTTTGTCTTTTGCTTCTATTC 58.582 34.615 0.00 0.00 33.15 1.75
5410 9192 7.333528 TGTGACTTTGTCTTTTGCTTCTATT 57.666 32.000 0.00 0.00 33.15 1.73
5411 9193 6.942532 TGTGACTTTGTCTTTTGCTTCTAT 57.057 33.333 0.00 0.00 33.15 1.98
5412 9194 6.751514 TTGTGACTTTGTCTTTTGCTTCTA 57.248 33.333 0.00 0.00 33.15 2.10
5413 9195 5.643379 TTGTGACTTTGTCTTTTGCTTCT 57.357 34.783 0.00 0.00 33.15 2.85
5414 9196 5.633182 TGTTTGTGACTTTGTCTTTTGCTTC 59.367 36.000 0.00 0.00 33.15 3.86
5415 9197 5.405269 GTGTTTGTGACTTTGTCTTTTGCTT 59.595 36.000 0.00 0.00 33.15 3.91
5416 9198 4.923281 GTGTTTGTGACTTTGTCTTTTGCT 59.077 37.500 0.00 0.00 33.15 3.91
5417 9199 4.683781 TGTGTTTGTGACTTTGTCTTTTGC 59.316 37.500 0.00 0.00 33.15 3.68
5418 9200 6.420604 AGTTGTGTTTGTGACTTTGTCTTTTG 59.579 34.615 0.00 0.00 33.15 2.44
5419 9201 6.512297 AGTTGTGTTTGTGACTTTGTCTTTT 58.488 32.000 0.00 0.00 33.15 2.27
5420 9202 6.084326 AGTTGTGTTTGTGACTTTGTCTTT 57.916 33.333 0.00 0.00 33.15 2.52
5421 9203 5.240623 TGAGTTGTGTTTGTGACTTTGTCTT 59.759 36.000 0.00 0.00 33.15 3.01
5422 9204 4.759693 TGAGTTGTGTTTGTGACTTTGTCT 59.240 37.500 0.00 0.00 33.15 3.41
5423 9205 4.851558 GTGAGTTGTGTTTGTGACTTTGTC 59.148 41.667 0.00 0.00 0.00 3.18
5424 9206 4.518970 AGTGAGTTGTGTTTGTGACTTTGT 59.481 37.500 0.00 0.00 0.00 2.83
5425 9207 5.046910 AGTGAGTTGTGTTTGTGACTTTG 57.953 39.130 0.00 0.00 0.00 2.77
5426 9208 5.703592 TGTAGTGAGTTGTGTTTGTGACTTT 59.296 36.000 0.00 0.00 0.00 2.66
5427 9209 5.242434 TGTAGTGAGTTGTGTTTGTGACTT 58.758 37.500 0.00 0.00 0.00 3.01
5428 9210 4.827692 TGTAGTGAGTTGTGTTTGTGACT 58.172 39.130 0.00 0.00 0.00 3.41
5429 9211 5.539582 TTGTAGTGAGTTGTGTTTGTGAC 57.460 39.130 0.00 0.00 0.00 3.67
5430 9212 6.751514 ATTTGTAGTGAGTTGTGTTTGTGA 57.248 33.333 0.00 0.00 0.00 3.58
5431 9213 7.850982 GTCTATTTGTAGTGAGTTGTGTTTGTG 59.149 37.037 0.00 0.00 0.00 3.33
5432 9214 7.254319 CGTCTATTTGTAGTGAGTTGTGTTTGT 60.254 37.037 0.00 0.00 0.00 2.83
5433 9215 7.042992 TCGTCTATTTGTAGTGAGTTGTGTTTG 60.043 37.037 0.00 0.00 0.00 2.93
5434 9216 6.982141 TCGTCTATTTGTAGTGAGTTGTGTTT 59.018 34.615 0.00 0.00 0.00 2.83
5435 9217 6.420008 GTCGTCTATTTGTAGTGAGTTGTGTT 59.580 38.462 0.00 0.00 0.00 3.32
5436 9218 5.919141 GTCGTCTATTTGTAGTGAGTTGTGT 59.081 40.000 0.00 0.00 0.00 3.72
5437 9219 5.345202 GGTCGTCTATTTGTAGTGAGTTGTG 59.655 44.000 0.00 0.00 0.00 3.33
5438 9220 5.010314 TGGTCGTCTATTTGTAGTGAGTTGT 59.990 40.000 0.00 0.00 0.00 3.32
5439 9221 5.466819 TGGTCGTCTATTTGTAGTGAGTTG 58.533 41.667 0.00 0.00 0.00 3.16
5440 9222 5.717078 TGGTCGTCTATTTGTAGTGAGTT 57.283 39.130 0.00 0.00 0.00 3.01
5441 9223 5.717078 TTGGTCGTCTATTTGTAGTGAGT 57.283 39.130 0.00 0.00 0.00 3.41
5442 9224 7.416154 TTTTTGGTCGTCTATTTGTAGTGAG 57.584 36.000 0.00 0.00 0.00 3.51
5463 9245 8.783093 TGTGTTCAATCGTCATATTCTCTTTTT 58.217 29.630 0.00 0.00 0.00 1.94
5464 9246 8.322906 TGTGTTCAATCGTCATATTCTCTTTT 57.677 30.769 0.00 0.00 0.00 2.27
5465 9247 7.905604 TGTGTTCAATCGTCATATTCTCTTT 57.094 32.000 0.00 0.00 0.00 2.52
5466 9248 7.905604 TTGTGTTCAATCGTCATATTCTCTT 57.094 32.000 0.00 0.00 0.00 2.85
5467 9249 7.905604 TTTGTGTTCAATCGTCATATTCTCT 57.094 32.000 0.00 0.00 33.32 3.10
5468 9250 7.214449 CGTTTTGTGTTCAATCGTCATATTCTC 59.786 37.037 0.00 0.00 33.32 2.87
5469 9251 7.015289 CGTTTTGTGTTCAATCGTCATATTCT 58.985 34.615 0.00 0.00 33.32 2.40
5470 9252 7.012943 TCGTTTTGTGTTCAATCGTCATATTC 58.987 34.615 0.00 0.00 35.06 1.75
5471 9253 6.893759 TCGTTTTGTGTTCAATCGTCATATT 58.106 32.000 0.00 0.00 35.06 1.28
5472 9254 6.474819 TCGTTTTGTGTTCAATCGTCATAT 57.525 33.333 0.00 0.00 35.06 1.78
5473 9255 5.908916 TCGTTTTGTGTTCAATCGTCATA 57.091 34.783 0.00 0.00 35.06 2.15
5474 9256 4.804608 TCGTTTTGTGTTCAATCGTCAT 57.195 36.364 0.00 0.00 35.06 3.06
5475 9257 4.330347 TCTTCGTTTTGTGTTCAATCGTCA 59.670 37.500 0.00 0.00 35.06 4.35
5476 9258 4.664851 GTCTTCGTTTTGTGTTCAATCGTC 59.335 41.667 0.00 0.00 35.06 4.20
5477 9259 4.093703 TGTCTTCGTTTTGTGTTCAATCGT 59.906 37.500 0.00 0.00 35.06 3.73
5478 9260 4.583426 TGTCTTCGTTTTGTGTTCAATCG 58.417 39.130 0.00 0.00 34.93 3.34
5479 9261 6.198687 TCATGTCTTCGTTTTGTGTTCAATC 58.801 36.000 0.00 0.00 33.32 2.67
5480 9262 6.130298 TCATGTCTTCGTTTTGTGTTCAAT 57.870 33.333 0.00 0.00 33.32 2.57
5481 9263 5.553290 TCATGTCTTCGTTTTGTGTTCAA 57.447 34.783 0.00 0.00 0.00 2.69
5482 9264 5.553290 TTCATGTCTTCGTTTTGTGTTCA 57.447 34.783 0.00 0.00 0.00 3.18
5483 9265 6.745450 TCTTTTCATGTCTTCGTTTTGTGTTC 59.255 34.615 0.00 0.00 0.00 3.18
5484 9266 6.616947 TCTTTTCATGTCTTCGTTTTGTGTT 58.383 32.000 0.00 0.00 0.00 3.32
5485 9267 6.128007 ACTCTTTTCATGTCTTCGTTTTGTGT 60.128 34.615 0.00 0.00 0.00 3.72
5486 9268 6.258160 ACTCTTTTCATGTCTTCGTTTTGTG 58.742 36.000 0.00 0.00 0.00 3.33
5487 9269 6.093495 TGACTCTTTTCATGTCTTCGTTTTGT 59.907 34.615 0.00 0.00 0.00 2.83
5488 9270 6.486248 TGACTCTTTTCATGTCTTCGTTTTG 58.514 36.000 0.00 0.00 0.00 2.44
5489 9271 6.677781 TGACTCTTTTCATGTCTTCGTTTT 57.322 33.333 0.00 0.00 0.00 2.43
5490 9272 6.677781 TTGACTCTTTTCATGTCTTCGTTT 57.322 33.333 0.00 0.00 0.00 3.60
5491 9273 6.867662 ATTGACTCTTTTCATGTCTTCGTT 57.132 33.333 0.00 0.00 0.00 3.85
5492 9274 6.867662 AATTGACTCTTTTCATGTCTTCGT 57.132 33.333 0.00 0.00 0.00 3.85
5493 9275 8.499162 AGTTAATTGACTCTTTTCATGTCTTCG 58.501 33.333 0.00 0.00 0.00 3.79
5494 9276 9.818796 GAGTTAATTGACTCTTTTCATGTCTTC 57.181 33.333 20.09 0.00 42.18 2.87
5495 9277 9.342308 TGAGTTAATTGACTCTTTTCATGTCTT 57.658 29.630 25.48 0.00 44.99 3.01
5496 9278 8.778358 GTGAGTTAATTGACTCTTTTCATGTCT 58.222 33.333 25.48 0.00 44.99 3.41
5497 9279 7.742089 CGTGAGTTAATTGACTCTTTTCATGTC 59.258 37.037 25.48 2.79 44.99 3.06
5498 9280 7.576236 CGTGAGTTAATTGACTCTTTTCATGT 58.424 34.615 25.48 0.00 44.99 3.21
5499 9281 6.521133 GCGTGAGTTAATTGACTCTTTTCATG 59.479 38.462 25.48 14.91 44.99 3.07
5500 9282 6.603095 GCGTGAGTTAATTGACTCTTTTCAT 58.397 36.000 25.48 0.00 44.99 2.57
5501 9283 5.333035 CGCGTGAGTTAATTGACTCTTTTCA 60.333 40.000 25.48 8.20 44.99 2.69
5502 9284 5.073478 CGCGTGAGTTAATTGACTCTTTTC 58.927 41.667 25.48 14.63 44.99 2.29
5503 9285 4.748102 TCGCGTGAGTTAATTGACTCTTTT 59.252 37.500 25.48 0.00 44.99 2.27
5504 9286 4.150098 GTCGCGTGAGTTAATTGACTCTTT 59.850 41.667 25.48 0.00 44.99 2.52
5505 9287 3.673809 GTCGCGTGAGTTAATTGACTCTT 59.326 43.478 25.48 0.00 44.99 2.85
5506 9288 3.243336 GTCGCGTGAGTTAATTGACTCT 58.757 45.455 25.48 3.18 44.99 3.24
5507 9289 2.344741 GGTCGCGTGAGTTAATTGACTC 59.655 50.000 20.45 20.45 44.97 3.36
5508 9290 2.334838 GGTCGCGTGAGTTAATTGACT 58.665 47.619 5.77 1.93 0.00 3.41
5509 9291 1.058695 CGGTCGCGTGAGTTAATTGAC 59.941 52.381 5.77 0.00 0.00 3.18
5510 9292 1.336148 ACGGTCGCGTGAGTTAATTGA 60.336 47.619 5.77 0.00 0.00 2.57
5511 9293 1.065358 ACGGTCGCGTGAGTTAATTG 58.935 50.000 5.77 0.00 0.00 2.32
5512 9294 1.065358 CACGGTCGCGTGAGTTAATT 58.935 50.000 5.77 0.00 41.92 1.40
5513 9295 0.734942 CCACGGTCGCGTGAGTTAAT 60.735 55.000 15.77 0.00 41.92 1.40
5514 9296 1.372004 CCACGGTCGCGTGAGTTAA 60.372 57.895 15.77 0.00 41.92 2.01
5515 9297 1.794151 TTCCACGGTCGCGTGAGTTA 61.794 55.000 15.77 0.00 41.92 2.24
5516 9298 2.632136 TTTCCACGGTCGCGTGAGTT 62.632 55.000 15.77 0.00 41.92 3.01
5517 9299 2.632136 TTTTCCACGGTCGCGTGAGT 62.632 55.000 15.77 1.14 41.92 3.41
5518 9300 1.492319 TTTTTCCACGGTCGCGTGAG 61.492 55.000 15.77 7.26 41.92 3.51
5519 9301 1.521010 TTTTTCCACGGTCGCGTGA 60.521 52.632 15.77 0.00 41.92 4.35
5520 9302 1.368374 GTTTTTCCACGGTCGCGTG 60.368 57.895 5.77 8.39 39.36 5.34
5521 9303 2.873604 CGTTTTTCCACGGTCGCGT 61.874 57.895 5.77 0.00 36.47 6.01
5522 9304 1.547292 TACGTTTTTCCACGGTCGCG 61.547 55.000 0.00 0.00 44.82 5.87
5523 9305 0.792031 ATACGTTTTTCCACGGTCGC 59.208 50.000 0.00 0.00 44.82 5.19
5524 9306 3.858812 TGATATACGTTTTTCCACGGTCG 59.141 43.478 0.00 0.00 44.82 4.79
5525 9307 5.978934 ATGATATACGTTTTTCCACGGTC 57.021 39.130 0.00 0.00 44.82 4.79
5526 9308 7.846644 TTTATGATATACGTTTTTCCACGGT 57.153 32.000 0.00 0.00 44.82 4.83
5527 9309 9.165014 CATTTTATGATATACGTTTTTCCACGG 57.835 33.333 0.00 0.00 44.82 4.94
5528 9310 9.923786 TCATTTTATGATATACGTTTTTCCACG 57.076 29.630 0.00 0.00 39.15 4.94
5535 9317 9.646336 GCTCGTTTCATTTTATGATATACGTTT 57.354 29.630 0.00 0.00 39.39 3.60
5536 9318 8.822855 TGCTCGTTTCATTTTATGATATACGTT 58.177 29.630 0.00 0.00 39.39 3.99
5537 9319 8.360325 TGCTCGTTTCATTTTATGATATACGT 57.640 30.769 0.00 0.00 39.39 3.57
5538 9320 9.306280 CTTGCTCGTTTCATTTTATGATATACG 57.694 33.333 10.55 10.55 39.39 3.06
5541 9323 9.113838 AGTCTTGCTCGTTTCATTTTATGATAT 57.886 29.630 0.00 0.00 39.39 1.63
5542 9324 8.492673 AGTCTTGCTCGTTTCATTTTATGATA 57.507 30.769 0.00 0.00 39.39 2.15
5543 9325 7.383102 AGTCTTGCTCGTTTCATTTTATGAT 57.617 32.000 0.00 0.00 39.39 2.45
5544 9326 6.801539 AGTCTTGCTCGTTTCATTTTATGA 57.198 33.333 0.00 0.00 37.55 2.15
5545 9327 6.684555 GCTAGTCTTGCTCGTTTCATTTTATG 59.315 38.462 0.00 0.00 0.00 1.90
5546 9328 6.455646 CGCTAGTCTTGCTCGTTTCATTTTAT 60.456 38.462 4.76 0.00 0.00 1.40
5547 9329 5.163992 CGCTAGTCTTGCTCGTTTCATTTTA 60.164 40.000 4.76 0.00 0.00 1.52
5548 9330 4.377431 CGCTAGTCTTGCTCGTTTCATTTT 60.377 41.667 4.76 0.00 0.00 1.82
5549 9331 3.123621 CGCTAGTCTTGCTCGTTTCATTT 59.876 43.478 4.76 0.00 0.00 2.32
5550 9332 2.668457 CGCTAGTCTTGCTCGTTTCATT 59.332 45.455 4.76 0.00 0.00 2.57
5551 9333 2.263077 CGCTAGTCTTGCTCGTTTCAT 58.737 47.619 4.76 0.00 0.00 2.57
5552 9334 1.000607 ACGCTAGTCTTGCTCGTTTCA 60.001 47.619 4.76 0.00 0.00 2.69
5553 9335 1.649662 GACGCTAGTCTTGCTCGTTTC 59.350 52.381 4.76 0.00 43.80 2.78
5554 9336 1.669211 GGACGCTAGTCTTGCTCGTTT 60.669 52.381 4.76 0.00 46.29 3.60
5555 9337 0.109226 GGACGCTAGTCTTGCTCGTT 60.109 55.000 4.76 0.00 46.29 3.85
5556 9338 1.507174 GGACGCTAGTCTTGCTCGT 59.493 57.895 4.76 0.00 46.29 4.18
5557 9339 1.583967 CGGACGCTAGTCTTGCTCG 60.584 63.158 4.76 2.72 46.29 5.03
5558 9340 0.523757 GACGGACGCTAGTCTTGCTC 60.524 60.000 4.76 1.91 46.29 4.26
5559 9341 1.507174 GACGGACGCTAGTCTTGCT 59.493 57.895 4.76 0.00 46.29 3.91
5560 9342 1.516603 GGACGGACGCTAGTCTTGC 60.517 63.158 0.00 0.00 46.29 4.01
5561 9343 0.456221 ATGGACGGACGCTAGTCTTG 59.544 55.000 5.05 0.00 46.29 3.02
5562 9344 1.135083 CAATGGACGGACGCTAGTCTT 60.135 52.381 5.05 0.00 46.29 3.01
5563 9345 0.456221 CAATGGACGGACGCTAGTCT 59.544 55.000 5.05 0.00 46.29 3.24
5564 9346 1.146358 GCAATGGACGGACGCTAGTC 61.146 60.000 0.00 0.00 46.34 2.59
5565 9347 1.153628 GCAATGGACGGACGCTAGT 60.154 57.895 0.00 0.00 0.00 2.57
5566 9348 0.530650 ATGCAATGGACGGACGCTAG 60.531 55.000 0.00 0.00 0.00 3.42
5567 9349 0.747852 TATGCAATGGACGGACGCTA 59.252 50.000 0.00 0.00 0.00 4.26
5568 9350 0.530650 CTATGCAATGGACGGACGCT 60.531 55.000 0.00 0.00 0.00 5.07
5569 9351 1.934463 CTATGCAATGGACGGACGC 59.066 57.895 0.00 0.00 0.00 5.19
5570 9352 0.809636 TGCTATGCAATGGACGGACG 60.810 55.000 0.00 0.00 34.76 4.79
5571 9353 1.532868 GATGCTATGCAATGGACGGAC 59.467 52.381 0.00 0.00 43.62 4.79
5572 9354 1.873486 CGATGCTATGCAATGGACGGA 60.873 52.381 0.00 0.00 43.62 4.69
5573 9355 0.514255 CGATGCTATGCAATGGACGG 59.486 55.000 0.00 0.00 43.62 4.79
5574 9356 1.458445 CTCGATGCTATGCAATGGACG 59.542 52.381 0.00 0.00 43.62 4.79
5575 9357 2.759191 TCTCGATGCTATGCAATGGAC 58.241 47.619 0.00 0.00 43.62 4.02
5576 9358 3.593096 GATCTCGATGCTATGCAATGGA 58.407 45.455 0.00 0.00 43.62 3.41
5577 9359 2.347755 CGATCTCGATGCTATGCAATGG 59.652 50.000 0.00 0.00 43.62 3.16
5578 9360 3.248266 TCGATCTCGATGCTATGCAATG 58.752 45.455 0.00 0.00 44.22 2.82
5579 9361 3.582714 TCGATCTCGATGCTATGCAAT 57.417 42.857 0.00 0.00 44.22 3.56
5591 9373 3.843541 GCGAAGAATAGTCATCGATCTCG 59.156 47.826 20.38 4.76 45.50 4.04
5592 9374 4.788690 TGCGAAGAATAGTCATCGATCTC 58.211 43.478 20.38 4.42 45.50 2.75
5593 9375 4.277174 ACTGCGAAGAATAGTCATCGATCT 59.723 41.667 20.38 0.00 45.50 2.75
5594 9376 4.381270 CACTGCGAAGAATAGTCATCGATC 59.619 45.833 20.38 5.41 45.50 3.69
5595 9377 4.294232 CACTGCGAAGAATAGTCATCGAT 58.706 43.478 20.38 3.36 45.50 3.59
5596 9378 3.489229 CCACTGCGAAGAATAGTCATCGA 60.489 47.826 20.38 6.02 45.50 3.59
5597 9379 2.791560 CCACTGCGAAGAATAGTCATCG 59.208 50.000 12.92 12.92 45.44 3.84
5598 9380 2.541762 GCCACTGCGAAGAATAGTCATC 59.458 50.000 0.00 0.00 0.00 2.92
5599 9381 2.093500 TGCCACTGCGAAGAATAGTCAT 60.093 45.455 0.00 0.00 41.78 3.06
5600 9382 1.275010 TGCCACTGCGAAGAATAGTCA 59.725 47.619 0.00 0.00 41.78 3.41
5601 9383 2.010145 TGCCACTGCGAAGAATAGTC 57.990 50.000 0.00 0.00 41.78 2.59
5602 9384 2.289694 ACTTGCCACTGCGAAGAATAGT 60.290 45.455 0.00 0.00 41.78 2.12
5603 9385 2.350522 ACTTGCCACTGCGAAGAATAG 58.649 47.619 0.00 0.00 41.78 1.73
5604 9386 2.472695 ACTTGCCACTGCGAAGAATA 57.527 45.000 0.00 0.00 41.78 1.75
5605 9387 2.472695 TACTTGCCACTGCGAAGAAT 57.527 45.000 0.00 0.00 41.78 2.40
5606 9388 2.076100 CATACTTGCCACTGCGAAGAA 58.924 47.619 0.00 0.00 41.78 2.52
5607 9389 1.001974 ACATACTTGCCACTGCGAAGA 59.998 47.619 0.00 0.00 41.78 2.87
5608 9390 1.129251 CACATACTTGCCACTGCGAAG 59.871 52.381 0.00 0.00 41.78 3.79
5609 9391 1.155889 CACATACTTGCCACTGCGAA 58.844 50.000 0.00 0.00 41.78 4.70
5610 9392 0.034756 ACACATACTTGCCACTGCGA 59.965 50.000 0.00 0.00 41.78 5.10
5611 9393 0.874390 AACACATACTTGCCACTGCG 59.126 50.000 0.00 0.00 41.78 5.18
5612 9394 1.666888 GCAACACATACTTGCCACTGC 60.667 52.381 0.00 0.00 38.48 4.40
5613 9395 1.881973 AGCAACACATACTTGCCACTG 59.118 47.619 0.00 0.00 44.36 3.66
5614 9396 1.881973 CAGCAACACATACTTGCCACT 59.118 47.619 0.00 0.00 44.36 4.00
5615 9397 1.879380 TCAGCAACACATACTTGCCAC 59.121 47.619 0.00 0.00 44.36 5.01
5616 9398 2.268762 TCAGCAACACATACTTGCCA 57.731 45.000 0.00 0.00 44.36 4.92
5617 9399 3.641437 TTTCAGCAACACATACTTGCC 57.359 42.857 0.00 0.00 44.36 4.52
5618 9400 3.735746 GGTTTTCAGCAACACATACTTGC 59.264 43.478 0.00 0.00 43.74 4.01
5619 9401 4.930963 TGGTTTTCAGCAACACATACTTG 58.069 39.130 0.00 0.00 0.00 3.16
5620 9402 5.068987 ACATGGTTTTCAGCAACACATACTT 59.931 36.000 0.00 0.00 33.01 2.24
5621 9403 4.584325 ACATGGTTTTCAGCAACACATACT 59.416 37.500 0.00 0.00 33.01 2.12
5622 9404 4.870363 ACATGGTTTTCAGCAACACATAC 58.130 39.130 0.00 0.00 33.01 2.39
5623 9405 5.163468 ACAACATGGTTTTCAGCAACACATA 60.163 36.000 0.00 0.00 33.01 2.29
5624 9406 4.121317 CAACATGGTTTTCAGCAACACAT 58.879 39.130 0.00 0.00 33.01 3.21
5625 9407 3.056250 ACAACATGGTTTTCAGCAACACA 60.056 39.130 0.00 0.00 33.01 3.72
5626 9408 3.520569 ACAACATGGTTTTCAGCAACAC 58.479 40.909 0.00 0.00 33.01 3.32
5627 9409 3.883830 ACAACATGGTTTTCAGCAACA 57.116 38.095 0.00 0.00 33.01 3.33
5628 9410 3.555547 GGAACAACATGGTTTTCAGCAAC 59.444 43.478 11.57 0.00 33.01 4.17
5629 9411 3.450457 AGGAACAACATGGTTTTCAGCAA 59.550 39.130 11.57 0.00 33.01 3.91
5630 9412 3.030291 AGGAACAACATGGTTTTCAGCA 58.970 40.909 11.57 0.00 34.07 4.41
5631 9413 3.319122 AGAGGAACAACATGGTTTTCAGC 59.681 43.478 11.57 2.95 0.00 4.26
5632 9414 4.022849 GGAGAGGAACAACATGGTTTTCAG 60.023 45.833 11.57 0.00 0.00 3.02
5633 9415 3.888930 GGAGAGGAACAACATGGTTTTCA 59.111 43.478 11.57 0.00 0.00 2.69
5634 9416 3.255888 GGGAGAGGAACAACATGGTTTTC 59.744 47.826 0.74 0.74 0.00 2.29
5635 9417 3.117131 AGGGAGAGGAACAACATGGTTTT 60.117 43.478 0.00 0.00 0.00 2.43
5636 9418 2.447047 AGGGAGAGGAACAACATGGTTT 59.553 45.455 0.00 0.00 0.00 3.27
5637 9419 2.040412 GAGGGAGAGGAACAACATGGTT 59.960 50.000 0.00 0.00 0.00 3.67
5638 9420 1.630878 GAGGGAGAGGAACAACATGGT 59.369 52.381 0.00 0.00 0.00 3.55
5639 9421 1.065126 GGAGGGAGAGGAACAACATGG 60.065 57.143 0.00 0.00 0.00 3.66
5640 9422 1.630369 TGGAGGGAGAGGAACAACATG 59.370 52.381 0.00 0.00 0.00 3.21
5641 9423 2.044793 TGGAGGGAGAGGAACAACAT 57.955 50.000 0.00 0.00 0.00 2.71
5642 9424 1.814429 TTGGAGGGAGAGGAACAACA 58.186 50.000 0.00 0.00 0.00 3.33
5643 9425 2.951229 TTTGGAGGGAGAGGAACAAC 57.049 50.000 0.00 0.00 0.00 3.32
5644 9426 2.555227 GCATTTGGAGGGAGAGGAACAA 60.555 50.000 0.00 0.00 0.00 2.83
5645 9427 1.004745 GCATTTGGAGGGAGAGGAACA 59.995 52.381 0.00 0.00 0.00 3.18
5646 9428 1.683319 GGCATTTGGAGGGAGAGGAAC 60.683 57.143 0.00 0.00 0.00 3.62
5647 9429 0.625849 GGCATTTGGAGGGAGAGGAA 59.374 55.000 0.00 0.00 0.00 3.36
5648 9430 1.281925 GGGCATTTGGAGGGAGAGGA 61.282 60.000 0.00 0.00 0.00 3.71
5649 9431 1.228510 GGGCATTTGGAGGGAGAGG 59.771 63.158 0.00 0.00 0.00 3.69
5650 9432 1.228510 GGGGCATTTGGAGGGAGAG 59.771 63.158 0.00 0.00 0.00 3.20
5651 9433 0.925720 ATGGGGCATTTGGAGGGAGA 60.926 55.000 0.00 0.00 0.00 3.71
5652 9434 0.852842 TATGGGGCATTTGGAGGGAG 59.147 55.000 0.00 0.00 0.00 4.30
5653 9435 1.147608 CATATGGGGCATTTGGAGGGA 59.852 52.381 0.00 0.00 0.00 4.20
5654 9436 1.147608 TCATATGGGGCATTTGGAGGG 59.852 52.381 2.13 0.00 0.00 4.30
5655 9437 2.681319 TCATATGGGGCATTTGGAGG 57.319 50.000 2.13 0.00 0.00 4.30
5656 9438 4.708421 CCTAATCATATGGGGCATTTGGAG 59.292 45.833 2.13 0.00 0.00 3.86
5657 9439 4.356492 TCCTAATCATATGGGGCATTTGGA 59.644 41.667 11.45 11.45 30.64 3.53
5658 9440 4.676109 TCCTAATCATATGGGGCATTTGG 58.324 43.478 2.13 6.03 0.00 3.28
5659 9441 4.159135 GCTCCTAATCATATGGGGCATTTG 59.841 45.833 2.13 0.00 46.03 2.32
5660 9442 4.347607 GCTCCTAATCATATGGGGCATTT 58.652 43.478 2.13 0.00 46.03 2.32
5661 9443 3.973425 GCTCCTAATCATATGGGGCATT 58.027 45.455 2.13 0.00 46.03 3.56
5662 9444 3.659183 GCTCCTAATCATATGGGGCAT 57.341 47.619 2.13 0.00 46.03 4.40
5664 9446 2.619074 GGTGCTCCTAATCATATGGGGC 60.619 54.545 2.13 0.00 46.87 5.80
5665 9447 2.644299 TGGTGCTCCTAATCATATGGGG 59.356 50.000 6.34 1.22 34.23 4.96
5666 9448 4.371624 TTGGTGCTCCTAATCATATGGG 57.628 45.455 6.34 0.00 34.23 4.00
5667 9449 5.563592 TCATTGGTGCTCCTAATCATATGG 58.436 41.667 6.34 0.00 34.23 2.74
5668 9450 7.698506 AATCATTGGTGCTCCTAATCATATG 57.301 36.000 6.34 0.00 34.23 1.78
5669 9451 8.716674 AAAATCATTGGTGCTCCTAATCATAT 57.283 30.769 6.34 0.00 34.23 1.78
5670 9452 9.288576 CTAAAATCATTGGTGCTCCTAATCATA 57.711 33.333 6.34 0.00 34.23 2.15
5671 9453 8.000709 TCTAAAATCATTGGTGCTCCTAATCAT 58.999 33.333 6.34 0.00 34.23 2.45
5672 9454 7.345691 TCTAAAATCATTGGTGCTCCTAATCA 58.654 34.615 6.34 0.00 34.23 2.57
5673 9455 7.521261 GCTCTAAAATCATTGGTGCTCCTAATC 60.521 40.741 6.34 0.00 34.23 1.75
5674 9456 6.264067 GCTCTAAAATCATTGGTGCTCCTAAT 59.736 38.462 6.34 1.98 34.23 1.73
5675 9457 5.590259 GCTCTAAAATCATTGGTGCTCCTAA 59.410 40.000 6.34 0.00 34.23 2.69
5676 9458 5.126067 GCTCTAAAATCATTGGTGCTCCTA 58.874 41.667 6.34 0.00 34.23 2.94
5677 9459 3.950395 GCTCTAAAATCATTGGTGCTCCT 59.050 43.478 6.34 0.00 34.23 3.69
5678 9460 3.067320 GGCTCTAAAATCATTGGTGCTCC 59.933 47.826 0.00 0.00 0.00 4.70
5679 9461 3.950395 AGGCTCTAAAATCATTGGTGCTC 59.050 43.478 0.00 0.00 0.00 4.26
5680 9462 3.973425 AGGCTCTAAAATCATTGGTGCT 58.027 40.909 0.00 0.00 0.00 4.40
5681 9463 4.440663 GGAAGGCTCTAAAATCATTGGTGC 60.441 45.833 0.00 0.00 0.00 5.01
5682 9464 4.952335 AGGAAGGCTCTAAAATCATTGGTG 59.048 41.667 0.00 0.00 0.00 4.17
5683 9465 5.044550 AGAGGAAGGCTCTAAAATCATTGGT 60.045 40.000 0.00 0.00 0.00 3.67
5684 9466 5.444176 AGAGGAAGGCTCTAAAATCATTGG 58.556 41.667 0.00 0.00 0.00 3.16
5685 9467 7.401955 AAAGAGGAAGGCTCTAAAATCATTG 57.598 36.000 0.00 0.00 0.00 2.82
5686 9468 7.452813 ACAAAAGAGGAAGGCTCTAAAATCATT 59.547 33.333 0.00 0.00 0.00 2.57
5687 9469 6.950619 ACAAAAGAGGAAGGCTCTAAAATCAT 59.049 34.615 0.00 0.00 0.00 2.45
5688 9470 6.207417 CACAAAAGAGGAAGGCTCTAAAATCA 59.793 38.462 0.00 0.00 0.00 2.57
5689 9471 6.616017 CACAAAAGAGGAAGGCTCTAAAATC 58.384 40.000 0.00 0.00 0.00 2.17
5690 9472 5.047731 GCACAAAAGAGGAAGGCTCTAAAAT 60.048 40.000 0.00 0.00 0.00 1.82
5691 9473 4.278419 GCACAAAAGAGGAAGGCTCTAAAA 59.722 41.667 0.00 0.00 0.00 1.52
5692 9474 3.821033 GCACAAAAGAGGAAGGCTCTAAA 59.179 43.478 0.00 0.00 0.00 1.85
5693 9475 3.412386 GCACAAAAGAGGAAGGCTCTAA 58.588 45.455 0.00 0.00 0.00 2.10
5694 9476 2.290323 GGCACAAAAGAGGAAGGCTCTA 60.290 50.000 0.00 0.00 0.00 2.43
5695 9477 1.546548 GGCACAAAAGAGGAAGGCTCT 60.547 52.381 0.00 0.00 0.00 4.09
5696 9478 0.884514 GGCACAAAAGAGGAAGGCTC 59.115 55.000 0.00 0.00 0.00 4.70
5697 9479 0.185901 TGGCACAAAAGAGGAAGGCT 59.814 50.000 0.00 0.00 31.92 4.58
5698 9480 0.315251 GTGGCACAAAAGAGGAAGGC 59.685 55.000 13.86 0.00 44.16 4.35
5699 9481 0.593128 CGTGGCACAAAAGAGGAAGG 59.407 55.000 19.09 0.00 44.16 3.46
5700 9482 1.532868 CTCGTGGCACAAAAGAGGAAG 59.467 52.381 19.09 0.00 44.16 3.46
5701 9483 1.134220 ACTCGTGGCACAAAAGAGGAA 60.134 47.619 19.09 0.00 44.16 3.36
5702 9484 0.468226 ACTCGTGGCACAAAAGAGGA 59.532 50.000 19.09 3.71 44.16 3.71
5703 9485 1.264288 GAACTCGTGGCACAAAAGAGG 59.736 52.381 19.09 0.00 44.16 3.69
5704 9486 2.213499 AGAACTCGTGGCACAAAAGAG 58.787 47.619 19.09 17.15 44.16 2.85
5705 9487 2.210116 GAGAACTCGTGGCACAAAAGA 58.790 47.619 19.09 5.61 44.16 2.52
5706 9488 1.070577 CGAGAACTCGTGGCACAAAAG 60.071 52.381 19.09 13.54 46.99 2.27
5707 9489 0.934496 CGAGAACTCGTGGCACAAAA 59.066 50.000 19.09 1.14 46.99 2.44
5708 9490 2.600388 CGAGAACTCGTGGCACAAA 58.400 52.632 19.09 3.87 46.99 2.83
5709 9491 4.336581 CGAGAACTCGTGGCACAA 57.663 55.556 19.09 0.00 46.99 3.33
5718 9500 1.513622 GAGGCCAGGTCGAGAACTC 59.486 63.158 5.01 0.00 0.00 3.01
5719 9501 1.985116 GGAGGCCAGGTCGAGAACT 60.985 63.158 5.01 0.00 0.00 3.01
5720 9502 0.683504 TAGGAGGCCAGGTCGAGAAC 60.684 60.000 5.01 0.00 0.00 3.01
5721 9503 0.683504 GTAGGAGGCCAGGTCGAGAA 60.684 60.000 5.01 0.00 0.00 2.87
5722 9504 1.076923 GTAGGAGGCCAGGTCGAGA 60.077 63.158 5.01 0.00 0.00 4.04
5723 9505 2.128507 GGTAGGAGGCCAGGTCGAG 61.129 68.421 5.01 0.00 0.00 4.04
5724 9506 2.043248 GGTAGGAGGCCAGGTCGA 60.043 66.667 5.01 0.00 0.00 4.20
5725 9507 2.363795 TGGTAGGAGGCCAGGTCG 60.364 66.667 5.01 0.00 0.00 4.79
5726 9508 2.368011 GGTGGTAGGAGGCCAGGTC 61.368 68.421 5.01 0.00 36.57 3.85
5727 9509 2.285442 GGTGGTAGGAGGCCAGGT 60.285 66.667 5.01 0.00 36.57 4.00
5728 9510 2.285368 TGGTGGTAGGAGGCCAGG 60.285 66.667 5.01 0.00 36.57 4.45
5729 9511 1.613630 AGTGGTGGTAGGAGGCCAG 60.614 63.158 5.01 0.00 36.57 4.85
5730 9512 1.612442 GAGTGGTGGTAGGAGGCCA 60.612 63.158 5.01 0.00 0.00 5.36
5731 9513 0.983378 ATGAGTGGTGGTAGGAGGCC 60.983 60.000 0.00 0.00 0.00 5.19
5732 9514 0.466124 GATGAGTGGTGGTAGGAGGC 59.534 60.000 0.00 0.00 0.00 4.70
5733 9515 2.166907 AGATGAGTGGTGGTAGGAGG 57.833 55.000 0.00 0.00 0.00 4.30
5734 9516 4.039730 CCAATAGATGAGTGGTGGTAGGAG 59.960 50.000 0.00 0.00 38.56 3.69
5735 9517 3.967326 CCAATAGATGAGTGGTGGTAGGA 59.033 47.826 0.00 0.00 38.56 2.94
5736 9518 3.967326 TCCAATAGATGAGTGGTGGTAGG 59.033 47.826 0.00 0.00 44.10 3.18
5737 9519 5.363868 TCTTCCAATAGATGAGTGGTGGTAG 59.636 44.000 0.00 0.00 44.10 3.18
5738 9520 5.277250 TCTTCCAATAGATGAGTGGTGGTA 58.723 41.667 0.00 0.00 44.10 3.25
5739 9521 4.104086 TCTTCCAATAGATGAGTGGTGGT 58.896 43.478 0.00 0.00 44.10 4.16
5740 9522 4.760530 TCTTCCAATAGATGAGTGGTGG 57.239 45.455 0.00 0.00 44.10 4.61
5741 9523 5.065731 GCTTTCTTCCAATAGATGAGTGGTG 59.934 44.000 0.00 0.00 44.10 4.17
5742 9524 5.189180 GCTTTCTTCCAATAGATGAGTGGT 58.811 41.667 0.00 0.00 44.10 4.16
5743 9525 4.578105 GGCTTTCTTCCAATAGATGAGTGG 59.422 45.833 0.00 0.00 45.15 4.00
5744 9526 4.578105 GGGCTTTCTTCCAATAGATGAGTG 59.422 45.833 0.00 0.00 30.88 3.51
5745 9527 4.684485 CGGGCTTTCTTCCAATAGATGAGT 60.684 45.833 0.00 0.00 30.88 3.41
5746 9528 3.812053 CGGGCTTTCTTCCAATAGATGAG 59.188 47.826 0.00 0.00 30.88 2.90
5747 9529 3.454447 TCGGGCTTTCTTCCAATAGATGA 59.546 43.478 0.00 0.00 0.00 2.92
5748 9530 3.808728 TCGGGCTTTCTTCCAATAGATG 58.191 45.455 0.00 0.00 0.00 2.90
5749 9531 3.181450 CCTCGGGCTTTCTTCCAATAGAT 60.181 47.826 0.00 0.00 0.00 1.98
5750 9532 2.170607 CCTCGGGCTTTCTTCCAATAGA 59.829 50.000 0.00 0.00 0.00 1.98
5751 9533 2.565841 CCTCGGGCTTTCTTCCAATAG 58.434 52.381 0.00 0.00 0.00 1.73
5752 9534 1.408266 GCCTCGGGCTTTCTTCCAATA 60.408 52.381 7.58 0.00 46.69 1.90
5753 9535 0.681243 GCCTCGGGCTTTCTTCCAAT 60.681 55.000 7.58 0.00 46.69 3.16
5754 9536 1.303317 GCCTCGGGCTTTCTTCCAA 60.303 57.895 7.58 0.00 46.69 3.53
5755 9537 2.351276 GCCTCGGGCTTTCTTCCA 59.649 61.111 7.58 0.00 46.69 3.53
5765 9547 2.587194 CAAGATCGCTGCCTCGGG 60.587 66.667 0.00 0.00 0.00 5.14
5766 9548 3.267860 GCAAGATCGCTGCCTCGG 61.268 66.667 10.74 0.00 0.00 4.63
5767 9549 2.202851 AGCAAGATCGCTGCCTCG 60.203 61.111 16.42 0.00 41.85 4.63
5768 9550 1.152989 CTGAGCAAGATCGCTGCCTC 61.153 60.000 16.42 13.66 44.01 4.70
5769 9551 1.153409 CTGAGCAAGATCGCTGCCT 60.153 57.895 16.42 6.79 44.01 4.75
5770 9552 0.532417 ATCTGAGCAAGATCGCTGCC 60.532 55.000 16.42 10.28 42.27 4.85
5771 9553 1.297664 AATCTGAGCAAGATCGCTGC 58.702 50.000 13.25 13.25 45.37 5.25
5772 9554 2.539142 GCAAATCTGAGCAAGATCGCTG 60.539 50.000 0.00 0.00 45.37 5.18
5773 9555 1.669779 GCAAATCTGAGCAAGATCGCT 59.330 47.619 12.69 0.00 45.37 4.93
5774 9556 1.268437 GGCAAATCTGAGCAAGATCGC 60.268 52.381 12.01 12.01 45.37 4.58
5775 9557 1.332997 GGGCAAATCTGAGCAAGATCG 59.667 52.381 2.70 0.03 45.37 3.69
5776 9558 2.372264 TGGGCAAATCTGAGCAAGATC 58.628 47.619 2.70 0.00 45.37 2.75
5777 9559 6.479205 GCAATGGGCAAATCTGAGCAAGAT 62.479 45.833 0.00 0.00 44.73 2.40
5778 9560 2.494471 CAATGGGCAAATCTGAGCAAGA 59.506 45.455 0.00 0.00 39.94 3.02
5779 9561 2.888594 CAATGGGCAAATCTGAGCAAG 58.111 47.619 0.00 0.00 0.00 4.01
5780 9562 1.066716 GCAATGGGCAAATCTGAGCAA 60.067 47.619 0.00 0.00 43.97 3.91
5781 9563 0.533491 GCAATGGGCAAATCTGAGCA 59.467 50.000 0.00 0.00 43.97 4.26
5782 9564 3.357504 GCAATGGGCAAATCTGAGC 57.642 52.632 0.00 0.00 43.97 4.26
5792 9574 1.668793 GCTTGGTGTTGCAATGGGC 60.669 57.895 0.59 0.00 45.13 5.36
5793 9575 0.320073 CAGCTTGGTGTTGCAATGGG 60.320 55.000 0.59 0.00 0.00 4.00
5794 9576 3.204505 CAGCTTGGTGTTGCAATGG 57.795 52.632 0.59 0.00 0.00 3.16
5800 9582 2.512485 TCATTTGCAGCTTGGTGTTG 57.488 45.000 0.00 0.00 0.00 3.33
5801 9583 2.629137 TGATCATTTGCAGCTTGGTGTT 59.371 40.909 0.00 0.00 0.00 3.32
5802 9584 2.241160 TGATCATTTGCAGCTTGGTGT 58.759 42.857 0.00 0.00 0.00 4.16
5803 9585 3.306917 TTGATCATTTGCAGCTTGGTG 57.693 42.857 0.00 0.00 0.00 4.17
5804 9586 4.339872 TTTTGATCATTTGCAGCTTGGT 57.660 36.364 0.00 0.00 0.00 3.67
5805 9587 4.932799 TCATTTTGATCATTTGCAGCTTGG 59.067 37.500 0.00 0.00 0.00 3.61
5806 9588 5.407084 TGTCATTTTGATCATTTGCAGCTTG 59.593 36.000 0.00 0.00 0.00 4.01
5807 9589 5.407387 GTGTCATTTTGATCATTTGCAGCTT 59.593 36.000 0.00 0.00 0.00 3.74
5808 9590 4.927425 GTGTCATTTTGATCATTTGCAGCT 59.073 37.500 0.00 0.00 0.00 4.24
5809 9591 4.927425 AGTGTCATTTTGATCATTTGCAGC 59.073 37.500 0.00 0.00 0.00 5.25
5810 9592 5.163992 GCAGTGTCATTTTGATCATTTGCAG 60.164 40.000 0.00 0.00 30.89 4.41
5811 9593 4.687018 GCAGTGTCATTTTGATCATTTGCA