Multiple sequence alignment - TraesCS5B01G486800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G486800 chr5B 100.000 2264 0 0 1 2264 658084102 658086365 0.000000e+00 4181
1 TraesCS5B01G486800 chr5B 98.739 1745 21 1 1 1744 426532762 426534506 0.000000e+00 3099
2 TraesCS5B01G486800 chr5B 89.068 311 20 8 1954 2263 433000448 433000151 7.640000e-100 374
3 TraesCS5B01G486800 chr5B 88.746 311 21 8 1954 2263 471292869 471292572 3.550000e-98 368
4 TraesCS5B01G486800 chr5B 88.852 305 20 8 1960 2263 281830665 281830374 1.650000e-96 363
5 TraesCS5B01G486800 chr5B 88.525 305 21 8 1960 2263 351467545 351467254 7.690000e-95 357
6 TraesCS5B01G486800 chr5B 87.702 309 24 8 1956 2263 436478702 436478997 4.630000e-92 348
7 TraesCS5B01G486800 chr5B 87.981 208 16 4 1782 1989 281831106 281830908 1.050000e-58 237
8 TraesCS5B01G486800 chr5B 91.753 97 3 1 2173 2264 528750744 528750840 1.820000e-26 130
9 TraesCS5B01G486800 chr5B 100.000 60 0 0 1724 1783 426534430 426534489 6.610000e-21 111
10 TraesCS5B01G486800 chr5B 98.333 60 1 0 1724 1783 658085769 658085828 3.080000e-19 106
11 TraesCS5B01G486800 chr5B 85.047 107 10 4 2158 2264 454663167 454663267 1.110000e-18 104
12 TraesCS5B01G486800 chr6A 95.822 1819 61 10 1 1809 387215231 387217044 0.000000e+00 2924
13 TraesCS5B01G486800 chr7D 92.773 1868 107 18 1 1857 16799692 16797842 0.000000e+00 2676
14 TraesCS5B01G486800 chr7D 93.351 767 41 7 1 757 21074538 21073772 0.000000e+00 1125
15 TraesCS5B01G486800 chr7D 93.361 241 16 0 1 241 133434293 133434533 7.690000e-95 357
16 TraesCS5B01G486800 chr6B 96.517 1608 42 9 581 2185 650646109 650644513 0.000000e+00 2647
17 TraesCS5B01G486800 chr6B 92.124 1003 54 18 1271 2264 694764793 694765779 0.000000e+00 1391
18 TraesCS5B01G486800 chr6B 100.000 60 0 0 1724 1783 650645028 650644969 6.610000e-21 111
19 TraesCS5B01G486800 chr4A 91.512 1944 128 25 1 1932 514407625 514405707 0.000000e+00 2641
20 TraesCS5B01G486800 chr4A 96.310 1572 50 4 615 2185 712878098 712879662 0.000000e+00 2575
21 TraesCS5B01G486800 chr2B 92.132 1881 114 28 1 1865 579908104 579909966 0.000000e+00 2623
22 TraesCS5B01G486800 chr2B 93.473 1578 78 16 615 2185 138732415 138733974 0.000000e+00 2320
23 TraesCS5B01G486800 chr2B 94.815 405 19 2 1782 2185 717653799 717654202 4.100000e-177 630
24 TraesCS5B01G486800 chr2B 84.211 323 25 15 1954 2263 798603092 798603401 7.910000e-75 291
25 TraesCS5B01G486800 chr2B 87.967 241 16 7 2025 2264 154583305 154583077 2.870000e-69 272
26 TraesCS5B01G486800 chr4B 91.911 1879 115 23 1 1863 598448945 598447088 0.000000e+00 2593
27 TraesCS5B01G486800 chr3B 93.249 1733 107 5 1 1730 40993581 40991856 0.000000e+00 2543
28 TraesCS5B01G486800 chr3B 95.041 484 12 3 1782 2264 803582984 803582512 0.000000e+00 750
29 TraesCS5B01G486800 chr3B 82.635 334 22 12 1954 2263 179360868 179360547 1.720000e-66 263
30 TraesCS5B01G486800 chr3B 100.000 60 0 0 1724 1783 393330736 393330795 6.610000e-21 111
31 TraesCS5B01G486800 chr7B 93.062 1571 65 16 615 2183 235457474 235455946 0.000000e+00 2257
32 TraesCS5B01G486800 chr7B 93.725 1514 56 14 674 2185 130334634 130336110 0.000000e+00 2233
33 TraesCS5B01G486800 chr1B 93.007 1573 66 15 615 2185 550439478 550437948 0.000000e+00 2255
34 TraesCS5B01G486800 chr1B 98.333 60 1 0 1724 1783 357900494 357900435 3.080000e-19 106
35 TraesCS5B01G486800 chr2D 96.016 728 28 1 1 727 524910339 524909612 0.000000e+00 1182


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G486800 chr5B 658084102 658086365 2263 False 2143.5 4181 99.1665 1 2264 2 chr5B.!!$F5 2263
1 TraesCS5B01G486800 chr5B 426532762 426534506 1744 False 1605.0 3099 99.3695 1 1783 2 chr5B.!!$F4 1782
2 TraesCS5B01G486800 chr5B 281830374 281831106 732 True 300.0 363 88.4165 1782 2263 2 chr5B.!!$R4 481
3 TraesCS5B01G486800 chr6A 387215231 387217044 1813 False 2924.0 2924 95.8220 1 1809 1 chr6A.!!$F1 1808
4 TraesCS5B01G486800 chr7D 16797842 16799692 1850 True 2676.0 2676 92.7730 1 1857 1 chr7D.!!$R1 1856
5 TraesCS5B01G486800 chr7D 21073772 21074538 766 True 1125.0 1125 93.3510 1 757 1 chr7D.!!$R2 756
6 TraesCS5B01G486800 chr6B 694764793 694765779 986 False 1391.0 1391 92.1240 1271 2264 1 chr6B.!!$F1 993
7 TraesCS5B01G486800 chr6B 650644513 650646109 1596 True 1379.0 2647 98.2585 581 2185 2 chr6B.!!$R1 1604
8 TraesCS5B01G486800 chr4A 514405707 514407625 1918 True 2641.0 2641 91.5120 1 1932 1 chr4A.!!$R1 1931
9 TraesCS5B01G486800 chr4A 712878098 712879662 1564 False 2575.0 2575 96.3100 615 2185 1 chr4A.!!$F1 1570
10 TraesCS5B01G486800 chr2B 579908104 579909966 1862 False 2623.0 2623 92.1320 1 1865 1 chr2B.!!$F2 1864
11 TraesCS5B01G486800 chr2B 138732415 138733974 1559 False 2320.0 2320 93.4730 615 2185 1 chr2B.!!$F1 1570
12 TraesCS5B01G486800 chr4B 598447088 598448945 1857 True 2593.0 2593 91.9110 1 1863 1 chr4B.!!$R1 1862
13 TraesCS5B01G486800 chr3B 40991856 40993581 1725 True 2543.0 2543 93.2490 1 1730 1 chr3B.!!$R1 1729
14 TraesCS5B01G486800 chr7B 235455946 235457474 1528 True 2257.0 2257 93.0620 615 2183 1 chr7B.!!$R1 1568
15 TraesCS5B01G486800 chr7B 130334634 130336110 1476 False 2233.0 2233 93.7250 674 2185 1 chr7B.!!$F1 1511
16 TraesCS5B01G486800 chr1B 550437948 550439478 1530 True 2255.0 2255 93.0070 615 2185 1 chr1B.!!$R2 1570
17 TraesCS5B01G486800 chr2D 524909612 524910339 727 True 1182.0 1182 96.0160 1 727 1 chr2D.!!$R1 726

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
171 172 1.732941 TGCTCGCATTTGATAACGGT 58.267 45.0 0.0 0.0 0.0 4.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1594 1752 1.271543 CCCTTCTTGTCATGTGCCTCA 60.272 52.381 0.0 0.0 0.0 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
171 172 1.732941 TGCTCGCATTTGATAACGGT 58.267 45.000 0.00 0.00 0.00 4.83
291 292 2.819348 GCCCTTTCTTGGACCAATCACT 60.819 50.000 7.54 0.00 0.00 3.41
337 338 5.908831 TCATATTAGGCCAAACCCTCTTCTA 59.091 40.000 5.01 0.00 40.58 2.10
1123 1281 1.246649 GCACACACCATCATGTTGGA 58.753 50.000 26.22 0.00 39.25 3.53
1594 1752 2.037053 CGATGCACGAGAGGAGGAT 58.963 57.895 0.00 0.00 45.77 3.24
1602 1760 1.039785 CGAGAGGAGGATGAGGCACA 61.040 60.000 0.00 0.00 0.00 4.57
1947 2164 4.574828 AGACAGAAGCGTGTGTAAAAACAT 59.425 37.500 1.68 0.00 29.80 2.71
2019 2390 0.179018 GCAGGTGACCAGACAAGGTT 60.179 55.000 3.63 0.00 43.38 3.50
2067 2557 3.311110 ACGGTCCATGGCGTCTGT 61.311 61.111 6.96 8.36 0.00 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
171 172 0.248012 TATGTTTCTCGCCTTCGCCA 59.752 50.000 0.00 0.0 35.26 5.69
291 292 1.990424 CCATGGTACTCAGGCCACA 59.010 57.895 5.01 0.0 37.62 4.17
326 327 3.583526 GTCTCCACCTTTAGAAGAGGGTT 59.416 47.826 0.00 0.0 38.65 4.11
337 338 1.900486 CTACCCTTCGTCTCCACCTTT 59.100 52.381 0.00 0.0 0.00 3.11
563 565 1.213013 CCGTCACCTCTTCGACCTG 59.787 63.158 0.00 0.0 0.00 4.00
568 570 1.372997 CACCACCGTCACCTCTTCG 60.373 63.158 0.00 0.0 0.00 3.79
1123 1281 3.743521 TCAGCTTACAAACATCAGCACT 58.256 40.909 0.00 0.0 34.49 4.40
1594 1752 1.271543 CCCTTCTTGTCATGTGCCTCA 60.272 52.381 0.00 0.0 0.00 3.86
1602 1760 2.519013 GCCACTTTCCCTTCTTGTCAT 58.481 47.619 0.00 0.0 0.00 3.06
1664 1823 5.741388 ACAAAGTCTTGACAGTTCATCAC 57.259 39.130 3.49 0.0 36.33 3.06
1947 2164 2.207229 CGTCTGGGTGTGGACCTGA 61.207 63.158 0.00 0.0 42.66 3.86
2019 2390 2.254546 GTCCATCAGACACACCAACA 57.745 50.000 0.00 0.0 45.55 3.33
2067 2557 3.311110 GCGTCTGGGTGTGGGAGA 61.311 66.667 0.00 0.0 0.00 3.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.