Multiple sequence alignment - TraesCS5B01G485200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G485200 chr5B 100.000 3873 0 0 1 3873 656725143 656729015 0.000000e+00 7153
1 TraesCS5B01G485200 chr5B 91.370 1124 67 14 900 1997 656468221 656469340 0.000000e+00 1511
2 TraesCS5B01G485200 chr5B 91.557 687 58 0 2175 2861 656469374 656470060 0.000000e+00 948
3 TraesCS5B01G485200 chr5B 94.636 261 13 1 594 853 609892262 609892002 1.680000e-108 403
4 TraesCS5B01G485200 chr5B 97.030 202 6 0 310 511 656725662 656725863 1.330000e-89 340
5 TraesCS5B01G485200 chr5B 90.066 151 14 1 2028 2178 176588378 176588229 1.100000e-45 195
6 TraesCS5B01G485200 chr5B 90.476 147 12 1 2028 2174 665744469 665744613 3.950000e-45 193
7 TraesCS5B01G485200 chr5B 87.898 157 16 3 2018 2174 208523292 208523445 8.550000e-42 182
8 TraesCS5B01G485200 chr5D 92.166 2004 124 17 882 2861 520839216 520841210 0.000000e+00 2800
9 TraesCS5B01G485200 chr5D 90.766 1083 76 15 900 1961 520805084 520806163 0.000000e+00 1424
10 TraesCS5B01G485200 chr5D 87.558 643 73 3 2219 2861 520806330 520806965 0.000000e+00 737
11 TraesCS5B01G485200 chr5D 89.796 147 15 0 2028 2174 164604999 164604853 5.110000e-44 189
12 TraesCS5B01G485200 chr5A 89.671 1065 79 6 925 1961 649364991 649366052 0.000000e+00 1328
13 TraesCS5B01G485200 chr5A 89.628 646 64 3 2217 2861 649366184 649366827 0.000000e+00 819
14 TraesCS5B01G485200 chr7D 81.886 944 129 13 1023 1960 629498012 629497105 0.000000e+00 758
15 TraesCS5B01G485200 chr7D 88.015 267 15 5 1 257 47216181 47216440 2.260000e-77 300
16 TraesCS5B01G485200 chr7D 90.476 147 14 0 2028 2174 34757018 34756872 1.100000e-45 195
17 TraesCS5B01G485200 chr6B 79.339 847 135 32 1136 1963 160899159 160899984 3.380000e-155 558
18 TraesCS5B01G485200 chr3B 96.498 257 8 1 600 856 174451715 174451970 1.290000e-114 424
19 TraesCS5B01G485200 chr3B 90.336 238 12 1 667 893 576048198 576048435 6.290000e-78 302
20 TraesCS5B01G485200 chr3B 95.833 120 5 0 392 511 606376355 606376236 1.100000e-45 195
21 TraesCS5B01G485200 chr3B 95.082 122 6 0 390 511 174451715 174451836 3.950000e-45 193
22 TraesCS5B01G485200 chr7A 96.429 252 9 0 602 853 21815515 21815766 2.150000e-112 416
23 TraesCS5B01G485200 chr7A 89.796 147 15 0 2028 2174 421785006 421785152 5.110000e-44 189
24 TraesCS5B01G485200 chr7A 92.308 130 10 0 381 510 124071816 124071687 6.610000e-43 185
25 TraesCS5B01G485200 chr2B 96.429 252 9 0 602 853 597223421 597223170 2.150000e-112 416
26 TraesCS5B01G485200 chr2B 96.667 120 4 0 392 511 101069460 101069579 2.360000e-47 200
27 TraesCS5B01G485200 chr2B 94.355 124 7 0 388 511 33847657 33847534 1.420000e-44 191
28 TraesCS5B01G485200 chr4B 95.669 254 11 0 602 855 40215227 40215480 3.600000e-110 409
29 TraesCS5B01G485200 chr4B 89.286 308 21 2 603 899 93769917 93770223 3.650000e-100 375
30 TraesCS5B01G485200 chr4B 95.082 122 6 0 390 511 641550768 641550889 3.950000e-45 193
31 TraesCS5B01G485200 chr4A 91.475 305 14 2 597 889 666202307 666202003 3.600000e-110 409
32 TraesCS5B01G485200 chr6A 95.294 255 12 0 602 856 12297720 12297466 4.660000e-109 405
33 TraesCS5B01G485200 chr6A 89.735 302 18 3 604 893 7704996 7704696 1.310000e-99 374
34 TraesCS5B01G485200 chr6A 76.603 624 134 8 2234 2857 101859581 101860192 2.230000e-87 333
35 TraesCS5B01G485200 chr3A 89.394 330 23 2 588 905 644611413 644611084 4.660000e-109 405
36 TraesCS5B01G485200 chr3A 86.142 267 20 4 1 257 655651807 655652066 4.930000e-69 272
37 TraesCS5B01G485200 chr3A 85.393 267 22 4 1 257 655661555 655661814 1.070000e-65 261
38 TraesCS5B01G485200 chr1B 92.226 283 17 2 602 880 668053098 668053379 2.800000e-106 396
39 TraesCS5B01G485200 chr1B 87.220 313 28 4 598 899 571499346 571499657 2.860000e-91 346
40 TraesCS5B01G485200 chr1B 87.117 163 18 3 2028 2189 632021077 632020917 8.550000e-42 182
41 TraesCS5B01G485200 chr7B 88.474 321 24 3 601 910 186273748 186273430 3.650000e-100 375
42 TraesCS5B01G485200 chr7B 88.599 307 22 3 604 899 533560653 533560957 1.020000e-95 361
43 TraesCS5B01G485200 chr7B 85.385 260 25 3 652 899 52657526 52657784 1.380000e-64 257
44 TraesCS5B01G485200 chr7B 85.000 260 26 3 652 899 52678908 52679166 6.420000e-63 252
45 TraesCS5B01G485200 chr7B 95.833 120 5 0 392 511 750048314 750048433 1.100000e-45 195
46 TraesCS5B01G485200 chrUn 77.886 615 122 10 2238 2851 95189130 95189731 1.700000e-98 370
47 TraesCS5B01G485200 chr6D 77.258 620 129 8 2234 2853 84649077 84649684 1.710000e-93 353
48 TraesCS5B01G485200 chr6D 76.129 620 136 8 2237 2856 85625492 85624885 8.080000e-82 315
49 TraesCS5B01G485200 chr6D 90.476 147 14 0 2028 2174 392273074 392273220 1.100000e-45 195
50 TraesCS5B01G485200 chr1A 86.989 269 20 3 1 260 522240240 522239978 4.900000e-74 289
51 TraesCS5B01G485200 chr1A 88.079 151 9 5 49 199 99070687 99070828 1.850000e-38 171
52 TraesCS5B01G485200 chr2A 94.400 125 6 1 388 511 585704270 585704146 1.420000e-44 191


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G485200 chr5B 656725143 656729015 3872 False 3746.5 7153 98.5150 1 3873 2 chr5B.!!$F4 3872
1 TraesCS5B01G485200 chr5B 656468221 656470060 1839 False 1229.5 1511 91.4635 900 2861 2 chr5B.!!$F3 1961
2 TraesCS5B01G485200 chr5D 520839216 520841210 1994 False 2800.0 2800 92.1660 882 2861 1 chr5D.!!$F1 1979
3 TraesCS5B01G485200 chr5D 520805084 520806965 1881 False 1080.5 1424 89.1620 900 2861 2 chr5D.!!$F2 1961
4 TraesCS5B01G485200 chr5A 649364991 649366827 1836 False 1073.5 1328 89.6495 925 2861 2 chr5A.!!$F1 1936
5 TraesCS5B01G485200 chr7D 629497105 629498012 907 True 758.0 758 81.8860 1023 1960 1 chr7D.!!$R2 937
6 TraesCS5B01G485200 chr6B 160899159 160899984 825 False 558.0 558 79.3390 1136 1963 1 chr6B.!!$F1 827
7 TraesCS5B01G485200 chr6A 101859581 101860192 611 False 333.0 333 76.6030 2234 2857 1 chr6A.!!$F1 623
8 TraesCS5B01G485200 chrUn 95189130 95189731 601 False 370.0 370 77.8860 2238 2851 1 chrUn.!!$F1 613
9 TraesCS5B01G485200 chr6D 84649077 84649684 607 False 353.0 353 77.2580 2234 2853 1 chr6D.!!$F1 619
10 TraesCS5B01G485200 chr6D 85624885 85625492 607 True 315.0 315 76.1290 2237 2856 1 chr6D.!!$R1 619


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
243 244 0.034059 GGACCTCCCATGCACGATAG 59.966 60.0 0.0 0.0 37.14 2.08 F
846 847 0.035152 ATGCGAGCACCAGGATTTGA 60.035 50.0 0.0 0.0 0.00 2.69 F
848 849 0.169009 GCGAGCACCAGGATTTGAAC 59.831 55.0 0.0 0.0 0.00 3.18 F
867 868 0.541863 CCCTGATACCACTGTCCACC 59.458 60.0 0.0 0.0 0.00 4.61 F
987 1004 0.752054 AGCAGCCATAGTCTCAGAGC 59.248 55.0 0.0 0.0 0.00 4.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1607 1643 0.955919 CACCCTGAAGAACTTCCCGC 60.956 60.000 11.3 0.0 38.77 6.13 R
2271 2331 0.036388 GGCGAACTCCAGGACAATGA 60.036 55.000 0.0 0.0 0.00 2.57 R
2719 2783 1.078848 GTTGGCGAGCATGACCTCT 60.079 57.895 0.0 0.0 0.00 3.69 R
2822 2886 1.859302 ATGAGCTTCTCCTTCCGACT 58.141 50.000 0.0 0.0 0.00 4.18 R
2886 2950 0.606096 TACTACGGTGTGCTGTGCAT 59.394 50.000 0.0 0.0 41.91 3.96 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
65 66 8.611654 ATTCAAGATTGATTTTGTTTGGAAGG 57.388 30.769 0.00 0.00 37.00 3.46
66 67 5.990996 TCAAGATTGATTTTGTTTGGAAGGC 59.009 36.000 0.00 0.00 31.01 4.35
67 68 5.813513 AGATTGATTTTGTTTGGAAGGCT 57.186 34.783 0.00 0.00 0.00 4.58
68 69 6.178607 AGATTGATTTTGTTTGGAAGGCTT 57.821 33.333 0.00 0.00 0.00 4.35
69 70 6.226052 AGATTGATTTTGTTTGGAAGGCTTC 58.774 36.000 18.98 18.98 0.00 3.86
70 71 5.350504 TTGATTTTGTTTGGAAGGCTTCA 57.649 34.783 27.17 11.78 0.00 3.02
71 72 5.549742 TGATTTTGTTTGGAAGGCTTCAT 57.450 34.783 27.17 10.49 0.00 2.57
72 73 5.927819 TGATTTTGTTTGGAAGGCTTCATT 58.072 33.333 27.17 2.94 0.00 2.57
73 74 7.060383 TGATTTTGTTTGGAAGGCTTCATTA 57.940 32.000 27.17 11.24 0.00 1.90
74 75 6.928492 TGATTTTGTTTGGAAGGCTTCATTAC 59.072 34.615 27.17 19.80 0.00 1.89
75 76 4.497473 TTGTTTGGAAGGCTTCATTACG 57.503 40.909 27.17 0.00 0.00 3.18
76 77 3.745799 TGTTTGGAAGGCTTCATTACGA 58.254 40.909 27.17 8.18 0.00 3.43
77 78 3.751175 TGTTTGGAAGGCTTCATTACGAG 59.249 43.478 27.17 0.00 0.00 4.18
78 79 3.973206 TTGGAAGGCTTCATTACGAGA 57.027 42.857 27.17 2.41 0.00 4.04
79 80 3.973206 TGGAAGGCTTCATTACGAGAA 57.027 42.857 27.17 0.07 0.00 2.87
80 81 4.280436 TGGAAGGCTTCATTACGAGAAA 57.720 40.909 27.17 0.00 0.00 2.52
81 82 4.843728 TGGAAGGCTTCATTACGAGAAAT 58.156 39.130 27.17 0.00 0.00 2.17
82 83 4.635765 TGGAAGGCTTCATTACGAGAAATG 59.364 41.667 27.17 0.00 38.05 2.32
83 84 4.496507 GGAAGGCTTCATTACGAGAAATGC 60.497 45.833 27.17 2.38 36.89 3.56
84 85 3.609853 AGGCTTCATTACGAGAAATGCA 58.390 40.909 0.00 0.00 36.89 3.96
85 86 3.375299 AGGCTTCATTACGAGAAATGCAC 59.625 43.478 0.00 0.00 36.89 4.57
86 87 3.126858 GGCTTCATTACGAGAAATGCACA 59.873 43.478 0.00 0.00 36.89 4.57
87 88 4.201950 GGCTTCATTACGAGAAATGCACAT 60.202 41.667 0.00 0.00 36.89 3.21
88 89 4.731961 GCTTCATTACGAGAAATGCACATG 59.268 41.667 0.00 0.00 36.89 3.21
89 90 5.674569 GCTTCATTACGAGAAATGCACATGT 60.675 40.000 0.00 0.00 36.89 3.21
90 91 5.220557 TCATTACGAGAAATGCACATGTG 57.779 39.130 21.83 21.83 36.89 3.21
101 102 2.718094 CACATGTGCAACCAGGTGA 58.282 52.632 13.94 0.00 46.96 4.02
102 103 1.250328 CACATGTGCAACCAGGTGAT 58.750 50.000 13.94 0.00 46.96 3.06
103 104 2.435422 CACATGTGCAACCAGGTGATA 58.565 47.619 13.94 0.00 46.96 2.15
104 105 2.819019 CACATGTGCAACCAGGTGATAA 59.181 45.455 13.94 0.00 46.96 1.75
105 106 3.255395 CACATGTGCAACCAGGTGATAAA 59.745 43.478 13.94 0.00 46.96 1.40
106 107 4.082081 CACATGTGCAACCAGGTGATAAAT 60.082 41.667 13.94 0.00 46.96 1.40
107 108 4.527816 ACATGTGCAACCAGGTGATAAATT 59.472 37.500 0.00 0.00 34.36 1.82
108 109 5.011943 ACATGTGCAACCAGGTGATAAATTT 59.988 36.000 0.00 0.00 34.36 1.82
109 110 4.880759 TGTGCAACCAGGTGATAAATTTG 58.119 39.130 0.00 0.00 34.36 2.32
110 111 4.586421 TGTGCAACCAGGTGATAAATTTGA 59.414 37.500 0.00 0.00 34.36 2.69
111 112 4.923281 GTGCAACCAGGTGATAAATTTGAC 59.077 41.667 0.00 0.00 0.00 3.18
112 113 4.832266 TGCAACCAGGTGATAAATTTGACT 59.168 37.500 0.00 0.00 0.00 3.41
113 114 5.304101 TGCAACCAGGTGATAAATTTGACTT 59.696 36.000 0.00 0.00 0.00 3.01
114 115 5.634859 GCAACCAGGTGATAAATTTGACTTG 59.365 40.000 0.00 2.02 0.00 3.16
115 116 5.982890 ACCAGGTGATAAATTTGACTTGG 57.017 39.130 18.52 18.52 40.48 3.61
116 117 5.393866 ACCAGGTGATAAATTTGACTTGGT 58.606 37.500 19.40 19.40 42.27 3.67
117 118 5.243730 ACCAGGTGATAAATTTGACTTGGTG 59.756 40.000 22.14 6.19 44.54 4.17
118 119 5.243730 CCAGGTGATAAATTTGACTTGGTGT 59.756 40.000 14.70 0.00 32.37 4.16
119 120 6.239289 CCAGGTGATAAATTTGACTTGGTGTT 60.239 38.462 14.70 0.00 32.37 3.32
120 121 6.863126 CAGGTGATAAATTTGACTTGGTGTTC 59.137 38.462 0.00 0.00 0.00 3.18
121 122 6.549364 AGGTGATAAATTTGACTTGGTGTTCA 59.451 34.615 0.00 0.00 0.00 3.18
122 123 7.069331 AGGTGATAAATTTGACTTGGTGTTCAA 59.931 33.333 0.00 0.00 0.00 2.69
123 124 7.708752 GGTGATAAATTTGACTTGGTGTTCAAA 59.291 33.333 0.00 0.00 36.66 2.69
124 125 9.260002 GTGATAAATTTGACTTGGTGTTCAAAT 57.740 29.630 0.00 4.15 42.42 2.32
125 126 9.258826 TGATAAATTTGACTTGGTGTTCAAATG 57.741 29.630 9.65 0.00 40.54 2.32
126 127 9.474920 GATAAATTTGACTTGGTGTTCAAATGA 57.525 29.630 9.65 3.38 40.54 2.57
129 130 9.829507 AAATTTGACTTGGTGTTCAAATGATAA 57.170 25.926 9.65 0.00 40.54 1.75
130 131 9.829507 AATTTGACTTGGTGTTCAAATGATAAA 57.170 25.926 9.65 0.00 40.54 1.40
131 132 9.829507 ATTTGACTTGGTGTTCAAATGATAAAA 57.170 25.926 8.40 0.00 40.11 1.52
132 133 9.829507 TTTGACTTGGTGTTCAAATGATAAAAT 57.170 25.926 0.00 0.00 34.56 1.82
133 134 9.829507 TTGACTTGGTGTTCAAATGATAAAATT 57.170 25.926 0.00 0.00 34.56 1.82
134 135 9.258826 TGACTTGGTGTTCAAATGATAAAATTG 57.741 29.630 0.00 0.00 34.56 2.32
135 136 9.474920 GACTTGGTGTTCAAATGATAAAATTGA 57.525 29.630 0.00 0.00 34.56 2.57
180 181 5.806654 AAAAATATGGGTGAGTTGCACTT 57.193 34.783 0.00 0.00 46.86 3.16
181 182 4.789012 AAATATGGGTGAGTTGCACTTG 57.211 40.909 0.00 0.00 46.86 3.16
182 183 1.533625 TATGGGTGAGTTGCACTTGC 58.466 50.000 0.00 0.00 46.86 4.01
192 193 3.169198 GCACTTGCACGGTCTAGC 58.831 61.111 0.00 0.00 41.59 3.42
193 194 1.667830 GCACTTGCACGGTCTAGCA 60.668 57.895 0.00 0.00 41.59 3.49
194 195 1.901650 GCACTTGCACGGTCTAGCAC 61.902 60.000 0.00 0.00 41.05 4.40
195 196 1.372997 ACTTGCACGGTCTAGCACG 60.373 57.895 0.00 4.65 41.05 5.34
196 197 1.080772 CTTGCACGGTCTAGCACGA 60.081 57.895 11.93 0.00 41.05 4.35
197 198 0.666274 CTTGCACGGTCTAGCACGAA 60.666 55.000 11.93 0.00 41.05 3.85
198 199 0.037697 TTGCACGGTCTAGCACGAAT 60.038 50.000 11.93 0.00 41.05 3.34
199 200 0.812549 TGCACGGTCTAGCACGAATA 59.187 50.000 11.93 0.00 35.51 1.75
200 201 1.202817 TGCACGGTCTAGCACGAATAA 59.797 47.619 11.93 0.00 35.51 1.40
201 202 1.587034 GCACGGTCTAGCACGAATAAC 59.413 52.381 11.93 0.00 0.00 1.89
223 224 1.667236 CGTAGCAATCAATGGCTGGA 58.333 50.000 1.98 0.00 41.25 3.86
224 225 1.600957 CGTAGCAATCAATGGCTGGAG 59.399 52.381 1.98 0.00 41.25 3.86
225 226 1.952296 GTAGCAATCAATGGCTGGAGG 59.048 52.381 1.98 0.00 41.25 4.30
226 227 0.627451 AGCAATCAATGGCTGGAGGA 59.373 50.000 0.00 0.00 39.30 3.71
227 228 0.743097 GCAATCAATGGCTGGAGGAC 59.257 55.000 0.00 0.00 0.00 3.85
228 229 1.396653 CAATCAATGGCTGGAGGACC 58.603 55.000 0.00 0.00 0.00 4.46
229 230 1.064166 CAATCAATGGCTGGAGGACCT 60.064 52.381 0.00 0.00 37.04 3.85
230 231 0.842635 ATCAATGGCTGGAGGACCTC 59.157 55.000 13.60 13.60 37.04 3.85
238 239 2.592308 GGAGGACCTCCCATGCAC 59.408 66.667 28.16 2.54 44.36 4.57
239 240 2.187946 GAGGACCTCCCATGCACG 59.812 66.667 10.74 0.00 37.41 5.34
240 241 2.284625 AGGACCTCCCATGCACGA 60.285 61.111 0.00 0.00 37.41 4.35
241 242 1.690219 GAGGACCTCCCATGCACGAT 61.690 60.000 10.74 0.00 37.41 3.73
242 243 0.398522 AGGACCTCCCATGCACGATA 60.399 55.000 0.00 0.00 37.41 2.92
243 244 0.034059 GGACCTCCCATGCACGATAG 59.966 60.000 0.00 0.00 37.14 2.08
244 245 2.644988 GGACCTCCCATGCACGATAGT 61.645 57.143 0.00 0.00 43.21 2.12
245 246 4.126441 GGACCTCCCATGCACGATAGTT 62.126 54.545 0.00 0.00 41.14 2.24
246 247 4.816055 GGACCTCCCATGCACGATAGTTA 61.816 52.174 0.00 0.00 41.14 2.24
247 248 6.251409 GGACCTCCCATGCACGATAGTTAA 62.251 50.000 0.00 0.00 41.14 2.01
248 249 7.485760 GGACCTCCCATGCACGATAGTTAAT 62.486 48.000 0.00 0.00 41.14 1.40
291 292 5.456192 CGATAGTTGCACTCTTGTTAAGG 57.544 43.478 0.00 0.00 0.00 2.69
292 293 5.168569 CGATAGTTGCACTCTTGTTAAGGA 58.831 41.667 0.00 0.00 0.00 3.36
293 294 5.062308 CGATAGTTGCACTCTTGTTAAGGAC 59.938 44.000 0.00 0.00 0.00 3.85
294 295 4.150897 AGTTGCACTCTTGTTAAGGACA 57.849 40.909 0.00 0.00 36.19 4.02
295 296 4.718961 AGTTGCACTCTTGTTAAGGACAT 58.281 39.130 0.00 0.00 38.26 3.06
296 297 4.516698 AGTTGCACTCTTGTTAAGGACATG 59.483 41.667 0.00 0.00 38.26 3.21
297 298 4.085357 TGCACTCTTGTTAAGGACATGT 57.915 40.909 0.00 0.00 38.26 3.21
298 299 4.460263 TGCACTCTTGTTAAGGACATGTT 58.540 39.130 0.00 0.00 38.26 2.71
299 300 4.887071 TGCACTCTTGTTAAGGACATGTTT 59.113 37.500 0.00 0.00 38.26 2.83
300 301 5.008613 TGCACTCTTGTTAAGGACATGTTTC 59.991 40.000 0.00 0.00 38.26 2.78
301 302 5.008613 GCACTCTTGTTAAGGACATGTTTCA 59.991 40.000 0.00 0.00 38.26 2.69
302 303 6.662616 CACTCTTGTTAAGGACATGTTTCAG 58.337 40.000 0.00 0.00 38.26 3.02
303 304 5.765182 ACTCTTGTTAAGGACATGTTTCAGG 59.235 40.000 0.00 0.00 38.26 3.86
304 305 4.518970 TCTTGTTAAGGACATGTTTCAGGC 59.481 41.667 0.00 0.00 38.26 4.85
305 306 3.153919 TGTTAAGGACATGTTTCAGGCC 58.846 45.455 0.00 0.00 32.00 5.19
306 307 3.153919 GTTAAGGACATGTTTCAGGCCA 58.846 45.455 5.01 0.00 0.00 5.36
307 308 2.380064 AAGGACATGTTTCAGGCCAA 57.620 45.000 5.01 0.00 0.00 4.52
308 309 2.380064 AGGACATGTTTCAGGCCAAA 57.620 45.000 5.01 0.00 0.00 3.28
309 310 2.676748 AGGACATGTTTCAGGCCAAAA 58.323 42.857 5.01 1.68 0.00 2.44
310 311 3.242011 AGGACATGTTTCAGGCCAAAAT 58.758 40.909 5.01 0.00 0.00 1.82
311 312 3.007182 AGGACATGTTTCAGGCCAAAATG 59.993 43.478 5.01 4.02 0.00 2.32
312 313 3.244181 GGACATGTTTCAGGCCAAAATGT 60.244 43.478 5.01 7.74 0.00 2.71
313 314 4.021544 GGACATGTTTCAGGCCAAAATGTA 60.022 41.667 5.01 0.00 0.00 2.29
314 315 4.881920 ACATGTTTCAGGCCAAAATGTAC 58.118 39.130 5.01 0.00 0.00 2.90
315 316 4.343526 ACATGTTTCAGGCCAAAATGTACA 59.656 37.500 5.01 0.00 0.00 2.90
316 317 4.582701 TGTTTCAGGCCAAAATGTACAG 57.417 40.909 5.01 0.00 0.00 2.74
317 318 4.211125 TGTTTCAGGCCAAAATGTACAGA 58.789 39.130 5.01 0.00 0.00 3.41
318 319 4.278170 TGTTTCAGGCCAAAATGTACAGAG 59.722 41.667 5.01 0.00 0.00 3.35
319 320 4.365514 TTCAGGCCAAAATGTACAGAGA 57.634 40.909 5.01 0.00 0.00 3.10
320 321 4.365514 TCAGGCCAAAATGTACAGAGAA 57.634 40.909 5.01 0.00 0.00 2.87
321 322 4.922206 TCAGGCCAAAATGTACAGAGAAT 58.078 39.130 5.01 0.00 0.00 2.40
322 323 4.701651 TCAGGCCAAAATGTACAGAGAATG 59.298 41.667 5.01 0.00 0.00 2.67
323 324 4.019174 AGGCCAAAATGTACAGAGAATGG 58.981 43.478 5.01 6.64 0.00 3.16
324 325 4.016444 GGCCAAAATGTACAGAGAATGGA 58.984 43.478 15.89 0.00 0.00 3.41
325 326 4.462483 GGCCAAAATGTACAGAGAATGGAA 59.538 41.667 15.89 0.00 0.00 3.53
326 327 5.393461 GGCCAAAATGTACAGAGAATGGAAG 60.393 44.000 15.89 0.00 0.00 3.46
327 328 5.415701 GCCAAAATGTACAGAGAATGGAAGA 59.584 40.000 15.89 0.00 0.00 2.87
328 329 6.071952 GCCAAAATGTACAGAGAATGGAAGAA 60.072 38.462 15.89 0.00 0.00 2.52
329 330 7.523709 GCCAAAATGTACAGAGAATGGAAGAAA 60.524 37.037 15.89 0.00 0.00 2.52
330 331 8.025445 CCAAAATGTACAGAGAATGGAAGAAAG 58.975 37.037 0.33 0.00 0.00 2.62
331 332 8.786898 CAAAATGTACAGAGAATGGAAGAAAGA 58.213 33.333 0.33 0.00 0.00 2.52
332 333 9.525826 AAAATGTACAGAGAATGGAAGAAAGAT 57.474 29.630 0.33 0.00 0.00 2.40
333 334 8.729805 AATGTACAGAGAATGGAAGAAAGATC 57.270 34.615 0.33 0.00 0.00 2.75
334 335 7.487822 TGTACAGAGAATGGAAGAAAGATCT 57.512 36.000 0.00 0.00 37.57 2.75
350 351 7.946207 AGAAAGATCTTCAGAAAAAGAAACCC 58.054 34.615 8.78 0.00 38.69 4.11
351 352 6.656632 AAGATCTTCAGAAAAAGAAACCCC 57.343 37.500 0.88 0.00 38.69 4.95
352 353 4.762251 AGATCTTCAGAAAAAGAAACCCCG 59.238 41.667 0.00 0.00 38.69 5.73
353 354 4.159244 TCTTCAGAAAAAGAAACCCCGA 57.841 40.909 0.00 0.00 32.42 5.14
354 355 4.134563 TCTTCAGAAAAAGAAACCCCGAG 58.865 43.478 0.00 0.00 32.42 4.63
355 356 3.849563 TCAGAAAAAGAAACCCCGAGA 57.150 42.857 0.00 0.00 0.00 4.04
356 357 3.473625 TCAGAAAAAGAAACCCCGAGAC 58.526 45.455 0.00 0.00 0.00 3.36
357 358 3.118186 TCAGAAAAAGAAACCCCGAGACA 60.118 43.478 0.00 0.00 0.00 3.41
358 359 3.821033 CAGAAAAAGAAACCCCGAGACAT 59.179 43.478 0.00 0.00 0.00 3.06
359 360 5.001232 CAGAAAAAGAAACCCCGAGACATA 58.999 41.667 0.00 0.00 0.00 2.29
360 361 5.001874 AGAAAAAGAAACCCCGAGACATAC 58.998 41.667 0.00 0.00 0.00 2.39
361 362 4.360951 AAAAGAAACCCCGAGACATACA 57.639 40.909 0.00 0.00 0.00 2.29
362 363 3.329929 AAGAAACCCCGAGACATACAC 57.670 47.619 0.00 0.00 0.00 2.90
363 364 1.553704 AGAAACCCCGAGACATACACC 59.446 52.381 0.00 0.00 0.00 4.16
364 365 1.276989 GAAACCCCGAGACATACACCA 59.723 52.381 0.00 0.00 0.00 4.17
365 366 0.611714 AACCCCGAGACATACACCAC 59.388 55.000 0.00 0.00 0.00 4.16
366 367 0.252103 ACCCCGAGACATACACCACT 60.252 55.000 0.00 0.00 0.00 4.00
367 368 0.175760 CCCCGAGACATACACCACTG 59.824 60.000 0.00 0.00 0.00 3.66
368 369 1.182667 CCCGAGACATACACCACTGA 58.817 55.000 0.00 0.00 0.00 3.41
369 370 1.757118 CCCGAGACATACACCACTGAT 59.243 52.381 0.00 0.00 0.00 2.90
370 371 2.168521 CCCGAGACATACACCACTGATT 59.831 50.000 0.00 0.00 0.00 2.57
371 372 3.383505 CCCGAGACATACACCACTGATTA 59.616 47.826 0.00 0.00 0.00 1.75
372 373 4.039245 CCCGAGACATACACCACTGATTAT 59.961 45.833 0.00 0.00 0.00 1.28
373 374 5.223382 CCGAGACATACACCACTGATTATC 58.777 45.833 0.00 0.00 0.00 1.75
374 375 5.223382 CGAGACATACACCACTGATTATCC 58.777 45.833 0.00 0.00 0.00 2.59
375 376 5.201713 AGACATACACCACTGATTATCCG 57.798 43.478 0.00 0.00 0.00 4.18
376 377 4.649674 AGACATACACCACTGATTATCCGT 59.350 41.667 0.00 0.00 0.00 4.69
377 378 4.693283 ACATACACCACTGATTATCCGTG 58.307 43.478 9.35 9.35 0.00 4.94
382 383 3.386768 CCACTGATTATCCGTGGTAGG 57.613 52.381 22.31 2.82 42.45 3.18
383 384 2.548067 CCACTGATTATCCGTGGTAGGC 60.548 54.545 22.31 0.00 42.45 3.93
384 385 2.102420 CACTGATTATCCGTGGTAGGCA 59.898 50.000 8.58 0.00 0.00 4.75
385 386 2.972713 ACTGATTATCCGTGGTAGGCAT 59.027 45.455 0.00 0.00 0.00 4.40
386 387 3.244215 ACTGATTATCCGTGGTAGGCATG 60.244 47.826 0.00 0.00 0.00 4.06
387 388 2.038426 TGATTATCCGTGGTAGGCATGG 59.962 50.000 0.00 0.00 0.00 3.66
388 389 1.502690 TTATCCGTGGTAGGCATGGT 58.497 50.000 0.00 0.00 0.00 3.55
389 390 1.502690 TATCCGTGGTAGGCATGGTT 58.497 50.000 0.00 0.00 0.00 3.67
390 391 0.107214 ATCCGTGGTAGGCATGGTTG 60.107 55.000 0.00 0.00 0.00 3.77
391 392 1.002624 CCGTGGTAGGCATGGTTGT 60.003 57.895 0.00 0.00 0.00 3.32
392 393 0.608035 CCGTGGTAGGCATGGTTGTT 60.608 55.000 0.00 0.00 0.00 2.83
393 394 1.243902 CGTGGTAGGCATGGTTGTTT 58.756 50.000 0.00 0.00 0.00 2.83
394 395 1.611491 CGTGGTAGGCATGGTTGTTTT 59.389 47.619 0.00 0.00 0.00 2.43
395 396 2.035321 CGTGGTAGGCATGGTTGTTTTT 59.965 45.455 0.00 0.00 0.00 1.94
420 421 4.335400 TGAGCATCAGTACAGACACAAA 57.665 40.909 0.00 0.00 42.56 2.83
421 422 4.898320 TGAGCATCAGTACAGACACAAAT 58.102 39.130 0.00 0.00 42.56 2.32
422 423 4.692155 TGAGCATCAGTACAGACACAAATG 59.308 41.667 0.00 0.00 42.56 2.32
423 424 3.438087 AGCATCAGTACAGACACAAATGC 59.562 43.478 0.00 0.00 38.16 3.56
424 425 3.438087 GCATCAGTACAGACACAAATGCT 59.562 43.478 0.00 0.00 36.47 3.79
425 426 4.436584 GCATCAGTACAGACACAAATGCTC 60.437 45.833 0.00 0.00 36.47 4.26
426 427 4.335400 TCAGTACAGACACAAATGCTCA 57.665 40.909 0.00 0.00 0.00 4.26
427 428 4.898320 TCAGTACAGACACAAATGCTCAT 58.102 39.130 0.00 0.00 0.00 2.90
428 429 6.036577 TCAGTACAGACACAAATGCTCATA 57.963 37.500 0.00 0.00 0.00 2.15
429 430 6.643388 TCAGTACAGACACAAATGCTCATAT 58.357 36.000 0.00 0.00 0.00 1.78
430 431 7.781056 TCAGTACAGACACAAATGCTCATATA 58.219 34.615 0.00 0.00 0.00 0.86
431 432 7.706607 TCAGTACAGACACAAATGCTCATATAC 59.293 37.037 0.00 0.00 0.00 1.47
432 433 7.492344 CAGTACAGACACAAATGCTCATATACA 59.508 37.037 0.00 0.00 0.00 2.29
433 434 6.668541 ACAGACACAAATGCTCATATACAC 57.331 37.500 0.00 0.00 0.00 2.90
434 435 5.291858 ACAGACACAAATGCTCATATACACG 59.708 40.000 0.00 0.00 0.00 4.49
435 436 4.271049 AGACACAAATGCTCATATACACGC 59.729 41.667 0.00 0.00 0.00 5.34
436 437 3.001228 ACACAAATGCTCATATACACGCG 59.999 43.478 3.53 3.53 0.00 6.01
437 438 2.032894 ACAAATGCTCATATACACGCGC 60.033 45.455 5.73 0.00 0.00 6.86
438 439 1.864565 AATGCTCATATACACGCGCA 58.135 45.000 5.73 0.00 0.00 6.09
439 440 2.084610 ATGCTCATATACACGCGCAT 57.915 45.000 5.73 0.00 33.67 4.73
440 441 2.715737 TGCTCATATACACGCGCATA 57.284 45.000 5.73 1.53 0.00 3.14
441 442 2.324860 TGCTCATATACACGCGCATAC 58.675 47.619 5.73 0.00 0.00 2.39
442 443 2.287909 TGCTCATATACACGCGCATACA 60.288 45.455 5.73 0.00 0.00 2.29
443 444 2.090658 GCTCATATACACGCGCATACAC 59.909 50.000 5.73 0.00 0.00 2.90
444 445 3.565516 CTCATATACACGCGCATACACT 58.434 45.455 5.73 0.00 0.00 3.55
445 446 3.561503 TCATATACACGCGCATACACTC 58.438 45.455 5.73 0.00 0.00 3.51
446 447 3.003897 TCATATACACGCGCATACACTCA 59.996 43.478 5.73 0.00 0.00 3.41
447 448 1.556564 ATACACGCGCATACACTCAC 58.443 50.000 5.73 0.00 0.00 3.51
448 449 0.457166 TACACGCGCATACACTCACC 60.457 55.000 5.73 0.00 0.00 4.02
449 450 2.125673 ACGCGCATACACTCACCC 60.126 61.111 5.73 0.00 0.00 4.61
450 451 2.890474 CGCGCATACACTCACCCC 60.890 66.667 8.75 0.00 0.00 4.95
451 452 2.584608 GCGCATACACTCACCCCT 59.415 61.111 0.30 0.00 0.00 4.79
452 453 1.820581 GCGCATACACTCACCCCTA 59.179 57.895 0.30 0.00 0.00 3.53
453 454 0.393077 GCGCATACACTCACCCCTAT 59.607 55.000 0.30 0.00 0.00 2.57
454 455 1.873903 GCGCATACACTCACCCCTATG 60.874 57.143 0.30 0.00 0.00 2.23
455 456 1.686587 CGCATACACTCACCCCTATGA 59.313 52.381 0.00 0.00 0.00 2.15
456 457 2.102420 CGCATACACTCACCCCTATGAA 59.898 50.000 0.00 0.00 0.00 2.57
457 458 3.467803 GCATACACTCACCCCTATGAAC 58.532 50.000 0.00 0.00 0.00 3.18
458 459 3.717707 CATACACTCACCCCTATGAACG 58.282 50.000 0.00 0.00 0.00 3.95
459 460 0.249398 ACACTCACCCCTATGAACGC 59.751 55.000 0.00 0.00 0.00 4.84
460 461 0.249120 CACTCACCCCTATGAACGCA 59.751 55.000 0.00 0.00 0.00 5.24
461 462 0.249398 ACTCACCCCTATGAACGCAC 59.751 55.000 0.00 0.00 0.00 5.34
462 463 0.249120 CTCACCCCTATGAACGCACA 59.751 55.000 0.00 0.00 0.00 4.57
463 464 0.036765 TCACCCCTATGAACGCACAC 60.037 55.000 0.00 0.00 0.00 3.82
464 465 0.321210 CACCCCTATGAACGCACACA 60.321 55.000 0.00 0.00 0.00 3.72
465 466 0.618458 ACCCCTATGAACGCACACAT 59.382 50.000 0.00 0.00 0.00 3.21
466 467 1.016627 CCCCTATGAACGCACACATG 58.983 55.000 0.00 0.00 0.00 3.21
478 479 1.442769 CACACATGCACACTCTACCC 58.557 55.000 0.00 0.00 0.00 3.69
479 480 0.324943 ACACATGCACACTCTACCCC 59.675 55.000 0.00 0.00 0.00 4.95
480 481 0.615331 CACATGCACACTCTACCCCT 59.385 55.000 0.00 0.00 0.00 4.79
481 482 1.831106 CACATGCACACTCTACCCCTA 59.169 52.381 0.00 0.00 0.00 3.53
482 483 2.435805 CACATGCACACTCTACCCCTAT 59.564 50.000 0.00 0.00 0.00 2.57
483 484 2.435805 ACATGCACACTCTACCCCTATG 59.564 50.000 0.00 0.00 0.00 2.23
484 485 2.543037 TGCACACTCTACCCCTATGA 57.457 50.000 0.00 0.00 0.00 2.15
485 486 2.827755 TGCACACTCTACCCCTATGAA 58.172 47.619 0.00 0.00 0.00 2.57
486 487 2.500098 TGCACACTCTACCCCTATGAAC 59.500 50.000 0.00 0.00 0.00 3.18
487 488 2.500098 GCACACTCTACCCCTATGAACA 59.500 50.000 0.00 0.00 0.00 3.18
488 489 3.679083 GCACACTCTACCCCTATGAACAC 60.679 52.174 0.00 0.00 0.00 3.32
489 490 3.105283 ACACTCTACCCCTATGAACACC 58.895 50.000 0.00 0.00 0.00 4.16
490 491 3.246021 ACACTCTACCCCTATGAACACCT 60.246 47.826 0.00 0.00 0.00 4.00
491 492 3.385111 CACTCTACCCCTATGAACACCTC 59.615 52.174 0.00 0.00 0.00 3.85
492 493 2.966516 CTCTACCCCTATGAACACCTCC 59.033 54.545 0.00 0.00 0.00 4.30
493 494 1.687123 CTACCCCTATGAACACCTCCG 59.313 57.143 0.00 0.00 0.00 4.63
494 495 0.042131 ACCCCTATGAACACCTCCGA 59.958 55.000 0.00 0.00 0.00 4.55
495 496 1.200519 CCCCTATGAACACCTCCGAA 58.799 55.000 0.00 0.00 0.00 4.30
496 497 1.557832 CCCCTATGAACACCTCCGAAA 59.442 52.381 0.00 0.00 0.00 3.46
497 498 2.420129 CCCCTATGAACACCTCCGAAAG 60.420 54.545 0.00 0.00 0.00 2.62
498 499 2.500098 CCCTATGAACACCTCCGAAAGA 59.500 50.000 0.00 0.00 0.00 2.52
499 500 3.522553 CCTATGAACACCTCCGAAAGAC 58.477 50.000 0.00 0.00 0.00 3.01
500 501 3.195825 CCTATGAACACCTCCGAAAGACT 59.804 47.826 0.00 0.00 0.00 3.24
501 502 2.526304 TGAACACCTCCGAAAGACTG 57.474 50.000 0.00 0.00 0.00 3.51
502 503 2.036387 TGAACACCTCCGAAAGACTGA 58.964 47.619 0.00 0.00 0.00 3.41
503 504 2.035961 TGAACACCTCCGAAAGACTGAG 59.964 50.000 0.00 0.00 0.00 3.35
504 505 0.318762 ACACCTCCGAAAGACTGAGC 59.681 55.000 0.00 0.00 0.00 4.26
505 506 0.390472 CACCTCCGAAAGACTGAGCC 60.390 60.000 0.00 0.00 0.00 4.70
506 507 1.153745 CCTCCGAAAGACTGAGCCG 60.154 63.158 0.00 0.00 0.00 5.52
507 508 1.153745 CTCCGAAAGACTGAGCCGG 60.154 63.158 0.00 0.00 41.36 6.13
508 509 2.815647 CCGAAAGACTGAGCCGGC 60.816 66.667 21.89 21.89 33.47 6.13
509 510 2.048222 CGAAAGACTGAGCCGGCA 60.048 61.111 31.54 7.98 0.00 5.69
510 511 1.448540 CGAAAGACTGAGCCGGCAT 60.449 57.895 31.54 14.28 0.00 4.40
511 512 1.699656 CGAAAGACTGAGCCGGCATG 61.700 60.000 31.54 19.90 0.00 4.06
512 513 1.986575 GAAAGACTGAGCCGGCATGC 61.987 60.000 31.54 18.05 0.00 4.06
513 514 2.753009 AAAGACTGAGCCGGCATGCA 62.753 55.000 31.54 21.76 0.00 3.96
514 515 3.503363 GACTGAGCCGGCATGCAC 61.503 66.667 31.54 13.17 0.00 4.57
519 520 3.680620 GAGCCGGCATGCACCACTA 62.681 63.158 31.54 0.00 0.00 2.74
520 521 2.516930 GCCGGCATGCACCACTAT 60.517 61.111 24.80 0.00 0.00 2.12
521 522 2.837883 GCCGGCATGCACCACTATG 61.838 63.158 24.80 0.00 0.00 2.23
522 523 1.451927 CCGGCATGCACCACTATGT 60.452 57.895 21.36 0.00 0.00 2.29
523 524 0.179059 CCGGCATGCACCACTATGTA 60.179 55.000 21.36 0.00 0.00 2.29
524 525 0.937304 CGGCATGCACCACTATGTAC 59.063 55.000 21.36 0.00 0.00 2.90
525 526 1.742071 CGGCATGCACCACTATGTACA 60.742 52.381 21.36 0.00 0.00 2.90
526 527 1.942657 GGCATGCACCACTATGTACAG 59.057 52.381 21.36 0.00 0.00 2.74
527 528 2.419990 GGCATGCACCACTATGTACAGA 60.420 50.000 21.36 0.00 0.00 3.41
528 529 2.868583 GCATGCACCACTATGTACAGAG 59.131 50.000 15.85 15.85 0.00 3.35
529 530 3.430790 GCATGCACCACTATGTACAGAGA 60.431 47.826 23.74 0.52 0.00 3.10
530 531 4.758688 CATGCACCACTATGTACAGAGAA 58.241 43.478 23.74 2.97 0.00 2.87
531 532 5.363101 CATGCACCACTATGTACAGAGAAT 58.637 41.667 23.74 5.87 0.00 2.40
532 533 4.758688 TGCACCACTATGTACAGAGAATG 58.241 43.478 23.74 17.23 0.00 2.67
533 534 4.122776 GCACCACTATGTACAGAGAATGG 58.877 47.826 23.74 21.64 0.00 3.16
534 535 4.141937 GCACCACTATGTACAGAGAATGGA 60.142 45.833 25.69 0.00 0.00 3.41
535 536 5.626809 GCACCACTATGTACAGAGAATGGAA 60.627 44.000 25.69 0.00 0.00 3.53
536 537 6.045318 CACCACTATGTACAGAGAATGGAAG 58.955 44.000 25.69 16.61 0.00 3.46
537 538 5.958380 ACCACTATGTACAGAGAATGGAAGA 59.042 40.000 25.69 0.00 0.00 2.87
538 539 6.440647 ACCACTATGTACAGAGAATGGAAGAA 59.559 38.462 25.69 0.00 0.00 2.52
539 540 7.038302 ACCACTATGTACAGAGAATGGAAGAAA 60.038 37.037 25.69 0.00 0.00 2.52
540 541 7.493971 CCACTATGTACAGAGAATGGAAGAAAG 59.506 40.741 23.74 0.00 0.00 2.62
541 542 8.253810 CACTATGTACAGAGAATGGAAGAAAGA 58.746 37.037 23.74 0.00 0.00 2.52
542 543 8.986991 ACTATGTACAGAGAATGGAAGAAAGAT 58.013 33.333 23.74 0.00 0.00 2.40
543 544 9.474920 CTATGTACAGAGAATGGAAGAAAGATC 57.525 37.037 12.22 0.00 0.00 2.75
544 545 7.487822 TGTACAGAGAATGGAAGAAAGATCT 57.512 36.000 0.00 0.00 37.57 2.75
560 561 7.946207 AGAAAGATCTTCAGAAAAAGAAACCC 58.054 34.615 8.78 0.00 38.69 4.11
561 562 6.656632 AAGATCTTCAGAAAAAGAAACCCC 57.343 37.500 0.88 0.00 38.69 4.95
562 563 4.762251 AGATCTTCAGAAAAAGAAACCCCG 59.238 41.667 0.00 0.00 38.69 5.73
563 564 4.159244 TCTTCAGAAAAAGAAACCCCGA 57.841 40.909 0.00 0.00 32.42 5.14
564 565 4.134563 TCTTCAGAAAAAGAAACCCCGAG 58.865 43.478 0.00 0.00 32.42 4.63
565 566 3.849563 TCAGAAAAAGAAACCCCGAGA 57.150 42.857 0.00 0.00 0.00 4.04
566 567 3.473625 TCAGAAAAAGAAACCCCGAGAC 58.526 45.455 0.00 0.00 0.00 3.36
567 568 3.118186 TCAGAAAAAGAAACCCCGAGACA 60.118 43.478 0.00 0.00 0.00 3.41
568 569 3.821033 CAGAAAAAGAAACCCCGAGACAT 59.179 43.478 0.00 0.00 0.00 3.06
569 570 3.821033 AGAAAAAGAAACCCCGAGACATG 59.179 43.478 0.00 0.00 0.00 3.21
570 571 1.534729 AAAGAAACCCCGAGACATGC 58.465 50.000 0.00 0.00 0.00 4.06
571 572 0.400213 AAGAAACCCCGAGACATGCA 59.600 50.000 0.00 0.00 0.00 3.96
572 573 0.321653 AGAAACCCCGAGACATGCAC 60.322 55.000 0.00 0.00 0.00 4.57
573 574 1.303317 AAACCCCGAGACATGCACC 60.303 57.895 0.00 0.00 0.00 5.01
574 575 2.063015 AAACCCCGAGACATGCACCA 62.063 55.000 0.00 0.00 0.00 4.17
575 576 2.436646 CCCCGAGACATGCACCAC 60.437 66.667 0.00 0.00 0.00 4.16
576 577 2.665000 CCCGAGACATGCACCACT 59.335 61.111 0.00 0.00 0.00 4.00
577 578 1.742880 CCCGAGACATGCACCACTG 60.743 63.158 0.00 0.00 0.00 3.66
578 579 1.293179 CCGAGACATGCACCACTGA 59.707 57.895 0.00 0.00 0.00 3.41
579 580 0.107993 CCGAGACATGCACCACTGAT 60.108 55.000 0.00 0.00 0.00 2.90
580 581 1.676916 CCGAGACATGCACCACTGATT 60.677 52.381 0.00 0.00 0.00 2.57
581 582 2.418609 CCGAGACATGCACCACTGATTA 60.419 50.000 0.00 0.00 0.00 1.75
582 583 3.461061 CGAGACATGCACCACTGATTAT 58.539 45.455 0.00 0.00 0.00 1.28
583 584 3.492383 CGAGACATGCACCACTGATTATC 59.508 47.826 0.00 0.00 0.00 1.75
584 585 3.812053 GAGACATGCACCACTGATTATCC 59.188 47.826 0.00 0.00 0.00 2.59
585 586 2.545526 GACATGCACCACTGATTATCCG 59.454 50.000 0.00 0.00 0.00 4.18
586 587 2.092968 ACATGCACCACTGATTATCCGT 60.093 45.455 0.00 0.00 0.00 4.69
587 588 2.022764 TGCACCACTGATTATCCGTG 57.977 50.000 9.35 9.35 0.00 4.94
592 593 3.386768 CCACTGATTATCCGTGGTAGG 57.613 52.381 22.31 2.82 42.45 3.18
593 594 2.548067 CCACTGATTATCCGTGGTAGGC 60.548 54.545 22.31 0.00 42.45 3.93
594 595 2.102420 CACTGATTATCCGTGGTAGGCA 59.898 50.000 8.58 0.00 0.00 4.75
595 596 2.972713 ACTGATTATCCGTGGTAGGCAT 59.027 45.455 0.00 0.00 0.00 4.40
596 597 3.244215 ACTGATTATCCGTGGTAGGCATG 60.244 47.826 0.00 0.00 0.00 4.06
597 598 2.076863 GATTATCCGTGGTAGGCATGC 58.923 52.381 9.90 9.90 0.00 4.06
598 599 1.128200 TTATCCGTGGTAGGCATGCT 58.872 50.000 18.92 6.26 0.00 3.79
599 600 1.128200 TATCCGTGGTAGGCATGCTT 58.872 50.000 18.92 13.45 0.00 3.91
600 601 0.464373 ATCCGTGGTAGGCATGCTTG 60.464 55.000 18.92 0.00 0.00 4.01
601 602 1.377202 CCGTGGTAGGCATGCTTGT 60.377 57.895 18.92 5.30 0.00 3.16
602 603 0.960364 CCGTGGTAGGCATGCTTGTT 60.960 55.000 18.92 3.79 0.00 2.83
603 604 0.881118 CGTGGTAGGCATGCTTGTTT 59.119 50.000 18.92 1.24 0.00 2.83
604 605 1.269448 CGTGGTAGGCATGCTTGTTTT 59.731 47.619 18.92 0.00 0.00 2.43
605 606 2.288152 CGTGGTAGGCATGCTTGTTTTT 60.288 45.455 18.92 0.00 0.00 1.94
630 631 4.335400 TGAGCATCAGTACAGACACAAA 57.665 40.909 0.00 0.00 42.56 2.83
631 632 4.058124 TGAGCATCAGTACAGACACAAAC 58.942 43.478 0.00 0.00 42.56 2.93
632 633 3.059884 AGCATCAGTACAGACACAAACG 58.940 45.455 0.00 0.00 0.00 3.60
633 634 2.411547 GCATCAGTACAGACACAAACGC 60.412 50.000 0.00 0.00 0.00 4.84
634 635 2.882927 TCAGTACAGACACAAACGCT 57.117 45.000 0.00 0.00 0.00 5.07
635 636 2.739292 TCAGTACAGACACAAACGCTC 58.261 47.619 0.00 0.00 0.00 5.03
636 637 2.100087 TCAGTACAGACACAAACGCTCA 59.900 45.455 0.00 0.00 0.00 4.26
637 638 3.059884 CAGTACAGACACAAACGCTCAT 58.940 45.455 0.00 0.00 0.00 2.90
638 639 4.022676 TCAGTACAGACACAAACGCTCATA 60.023 41.667 0.00 0.00 0.00 2.15
639 640 4.864806 CAGTACAGACACAAACGCTCATAT 59.135 41.667 0.00 0.00 0.00 1.78
640 641 6.033966 CAGTACAGACACAAACGCTCATATA 58.966 40.000 0.00 0.00 0.00 0.86
641 642 6.020599 CAGTACAGACACAAACGCTCATATAC 60.021 42.308 0.00 0.00 0.00 1.47
642 643 4.816392 ACAGACACAAACGCTCATATACA 58.184 39.130 0.00 0.00 0.00 2.29
643 644 4.625742 ACAGACACAAACGCTCATATACAC 59.374 41.667 0.00 0.00 0.00 2.90
644 645 3.857665 AGACACAAACGCTCATATACACG 59.142 43.478 0.00 0.00 0.00 4.49
645 646 2.347452 ACACAAACGCTCATATACACGC 59.653 45.455 0.00 0.00 0.00 5.34
648 649 3.916439 CGCTCATATACACGCGCA 58.084 55.556 5.73 0.00 39.11 6.09
649 650 2.434688 CGCTCATATACACGCGCAT 58.565 52.632 5.73 0.00 39.11 4.73
650 651 1.613270 CGCTCATATACACGCGCATA 58.387 50.000 5.73 1.53 39.11 3.14
651 652 1.317611 CGCTCATATACACGCGCATAC 59.682 52.381 5.73 0.00 39.11 2.39
652 653 2.324860 GCTCATATACACGCGCATACA 58.675 47.619 5.73 0.00 0.00 2.29
653 654 2.090658 GCTCATATACACGCGCATACAC 59.909 50.000 5.73 0.00 0.00 2.90
654 655 3.565516 CTCATATACACGCGCATACACT 58.434 45.455 5.73 0.00 0.00 3.55
655 656 3.561503 TCATATACACGCGCATACACTC 58.438 45.455 5.73 0.00 0.00 3.51
656 657 3.003897 TCATATACACGCGCATACACTCA 59.996 43.478 5.73 0.00 0.00 3.41
657 658 1.556564 ATACACGCGCATACACTCAC 58.443 50.000 5.73 0.00 0.00 3.51
658 659 0.457166 TACACGCGCATACACTCACC 60.457 55.000 5.73 0.00 0.00 4.02
659 660 2.125673 ACGCGCATACACTCACCC 60.126 61.111 5.73 0.00 0.00 4.61
660 661 2.890474 CGCGCATACACTCACCCC 60.890 66.667 8.75 0.00 0.00 4.95
661 662 2.584608 GCGCATACACTCACCCCT 59.415 61.111 0.30 0.00 0.00 4.79
662 663 1.820581 GCGCATACACTCACCCCTA 59.179 57.895 0.30 0.00 0.00 3.53
663 664 0.393077 GCGCATACACTCACCCCTAT 59.607 55.000 0.30 0.00 0.00 2.57
664 665 1.873903 GCGCATACACTCACCCCTATG 60.874 57.143 0.30 0.00 0.00 2.23
665 666 1.686587 CGCATACACTCACCCCTATGA 59.313 52.381 0.00 0.00 0.00 2.15
666 667 2.102420 CGCATACACTCACCCCTATGAA 59.898 50.000 0.00 0.00 0.00 2.57
667 668 3.467803 GCATACACTCACCCCTATGAAC 58.532 50.000 0.00 0.00 0.00 3.18
668 669 3.717707 CATACACTCACCCCTATGAACG 58.282 50.000 0.00 0.00 0.00 3.95
669 670 0.249398 ACACTCACCCCTATGAACGC 59.751 55.000 0.00 0.00 0.00 4.84
670 671 0.249120 CACTCACCCCTATGAACGCA 59.751 55.000 0.00 0.00 0.00 5.24
671 672 0.249398 ACTCACCCCTATGAACGCAC 59.751 55.000 0.00 0.00 0.00 5.34
672 673 0.249120 CTCACCCCTATGAACGCACA 59.751 55.000 0.00 0.00 0.00 4.57
673 674 0.036765 TCACCCCTATGAACGCACAC 60.037 55.000 0.00 0.00 0.00 3.82
674 675 0.321210 CACCCCTATGAACGCACACA 60.321 55.000 0.00 0.00 0.00 3.72
675 676 0.321298 ACCCCTATGAACGCACACAC 60.321 55.000 0.00 0.00 0.00 3.82
676 677 1.358725 CCCCTATGAACGCACACACG 61.359 60.000 0.00 0.00 39.50 4.49
677 678 1.419922 CCTATGAACGCACACACGC 59.580 57.895 0.00 0.00 36.19 5.34
678 679 1.288419 CCTATGAACGCACACACGCA 61.288 55.000 0.00 0.00 36.19 5.24
679 680 0.179250 CTATGAACGCACACACGCAC 60.179 55.000 0.00 0.00 36.19 5.34
680 681 0.876342 TATGAACGCACACACGCACA 60.876 50.000 0.00 0.00 36.19 4.57
681 682 2.350760 GAACGCACACACGCACAC 60.351 61.111 0.00 0.00 36.19 3.82
682 683 3.783588 GAACGCACACACGCACACC 62.784 63.158 0.00 0.00 36.19 4.16
685 686 2.280524 GCACACACGCACACCCTA 60.281 61.111 0.00 0.00 0.00 3.53
686 687 2.604174 GCACACACGCACACCCTAC 61.604 63.158 0.00 0.00 0.00 3.18
687 688 1.959226 CACACACGCACACCCTACC 60.959 63.158 0.00 0.00 0.00 3.18
688 689 2.358247 CACACGCACACCCTACCC 60.358 66.667 0.00 0.00 0.00 3.69
689 690 3.633116 ACACGCACACCCTACCCC 61.633 66.667 0.00 0.00 0.00 4.95
690 691 3.319198 CACGCACACCCTACCCCT 61.319 66.667 0.00 0.00 0.00 4.79
691 692 1.985662 CACGCACACCCTACCCCTA 60.986 63.158 0.00 0.00 0.00 3.53
692 693 1.002533 ACGCACACCCTACCCCTAT 59.997 57.895 0.00 0.00 0.00 2.57
693 694 1.335132 ACGCACACCCTACCCCTATG 61.335 60.000 0.00 0.00 0.00 2.23
694 695 1.046472 CGCACACCCTACCCCTATGA 61.046 60.000 0.00 0.00 0.00 2.15
695 696 1.209621 GCACACCCTACCCCTATGAA 58.790 55.000 0.00 0.00 0.00 2.57
696 697 1.134189 GCACACCCTACCCCTATGAAC 60.134 57.143 0.00 0.00 0.00 3.18
697 698 2.193127 CACACCCTACCCCTATGAACA 58.807 52.381 0.00 0.00 0.00 3.18
698 699 2.093128 CACACCCTACCCCTATGAACAC 60.093 54.545 0.00 0.00 0.00 3.32
699 700 1.489230 CACCCTACCCCTATGAACACC 59.511 57.143 0.00 0.00 0.00 4.16
700 701 1.368558 ACCCTACCCCTATGAACACCT 59.631 52.381 0.00 0.00 0.00 4.00
701 702 2.226065 ACCCTACCCCTATGAACACCTT 60.226 50.000 0.00 0.00 0.00 3.50
702 703 2.438392 CCCTACCCCTATGAACACCTTC 59.562 54.545 0.00 0.00 0.00 3.46
703 704 2.102588 CCTACCCCTATGAACACCTTCG 59.897 54.545 0.00 0.00 0.00 3.79
704 705 1.946984 ACCCCTATGAACACCTTCGA 58.053 50.000 0.00 0.00 0.00 3.71
705 706 2.262637 ACCCCTATGAACACCTTCGAA 58.737 47.619 0.00 0.00 0.00 3.71
706 707 2.640826 ACCCCTATGAACACCTTCGAAA 59.359 45.455 0.00 0.00 0.00 3.46
707 708 3.270877 CCCCTATGAACACCTTCGAAAG 58.729 50.000 0.00 0.00 0.00 2.62
708 709 3.055385 CCCCTATGAACACCTTCGAAAGA 60.055 47.826 0.00 0.00 39.20 2.52
709 710 3.933332 CCCTATGAACACCTTCGAAAGAC 59.067 47.826 0.00 0.00 41.84 3.01
710 711 4.322801 CCCTATGAACACCTTCGAAAGACT 60.323 45.833 0.00 0.00 41.84 3.24
711 712 4.627467 CCTATGAACACCTTCGAAAGACTG 59.373 45.833 0.00 0.00 41.84 3.51
712 713 3.812156 TGAACACCTTCGAAAGACTGA 57.188 42.857 0.00 0.00 41.84 3.41
713 714 3.717707 TGAACACCTTCGAAAGACTGAG 58.282 45.455 0.00 0.00 41.84 3.35
714 715 2.156343 ACACCTTCGAAAGACTGAGC 57.844 50.000 0.00 0.00 41.84 4.26
715 716 1.270358 ACACCTTCGAAAGACTGAGCC 60.270 52.381 0.00 0.00 41.84 4.70
716 717 0.038159 ACCTTCGAAAGACTGAGCCG 60.038 55.000 0.00 0.00 41.84 5.52
717 718 0.737715 CCTTCGAAAGACTGAGCCGG 60.738 60.000 0.00 0.00 41.84 6.13
718 719 1.355066 CTTCGAAAGACTGAGCCGGC 61.355 60.000 21.89 21.89 41.84 6.13
719 720 2.048222 CGAAAGACTGAGCCGGCA 60.048 61.111 31.54 7.98 0.00 5.69
720 721 1.448540 CGAAAGACTGAGCCGGCAT 60.449 57.895 31.54 14.28 0.00 4.40
721 722 0.179111 CGAAAGACTGAGCCGGCATA 60.179 55.000 31.54 16.21 0.00 3.14
722 723 1.539065 CGAAAGACTGAGCCGGCATAT 60.539 52.381 31.54 8.11 0.00 1.78
723 724 2.139118 GAAAGACTGAGCCGGCATATC 58.861 52.381 31.54 18.63 0.00 1.63
724 725 1.123077 AAGACTGAGCCGGCATATCA 58.877 50.000 31.54 22.44 0.00 2.15
725 726 1.346062 AGACTGAGCCGGCATATCAT 58.654 50.000 31.54 13.17 0.00 2.45
726 727 1.274728 AGACTGAGCCGGCATATCATC 59.725 52.381 31.54 19.98 0.00 2.92
727 728 1.274728 GACTGAGCCGGCATATCATCT 59.725 52.381 31.54 11.40 0.00 2.90
728 729 1.696336 ACTGAGCCGGCATATCATCTT 59.304 47.619 31.54 3.33 0.00 2.40
729 730 2.074576 CTGAGCCGGCATATCATCTTG 58.925 52.381 31.54 7.95 0.00 3.02
730 731 1.693606 TGAGCCGGCATATCATCTTGA 59.306 47.619 31.54 0.00 0.00 3.02
731 732 2.289257 TGAGCCGGCATATCATCTTGAG 60.289 50.000 31.54 0.00 0.00 3.02
732 733 1.973515 AGCCGGCATATCATCTTGAGA 59.026 47.619 31.54 0.00 0.00 3.27
733 734 2.570752 AGCCGGCATATCATCTTGAGAT 59.429 45.455 31.54 0.00 34.56 2.75
734 735 3.008813 AGCCGGCATATCATCTTGAGATT 59.991 43.478 31.54 0.00 31.21 2.40
735 736 3.755378 GCCGGCATATCATCTTGAGATTT 59.245 43.478 24.80 0.00 31.21 2.17
736 737 4.937620 GCCGGCATATCATCTTGAGATTTA 59.062 41.667 24.80 0.00 31.21 1.40
737 738 5.163814 GCCGGCATATCATCTTGAGATTTAC 60.164 44.000 24.80 0.00 31.21 2.01
738 739 5.062683 CCGGCATATCATCTTGAGATTTACG 59.937 44.000 0.00 0.00 31.21 3.18
739 740 5.863935 CGGCATATCATCTTGAGATTTACGA 59.136 40.000 0.00 0.00 31.21 3.43
740 741 6.366061 CGGCATATCATCTTGAGATTTACGAA 59.634 38.462 0.00 0.00 31.21 3.85
741 742 7.411264 CGGCATATCATCTTGAGATTTACGAAG 60.411 40.741 0.00 0.00 31.21 3.79
742 743 7.232994 GCATATCATCTTGAGATTTACGAAGC 58.767 38.462 0.00 0.00 31.21 3.86
743 744 7.623089 GCATATCATCTTGAGATTTACGAAGCC 60.623 40.741 0.00 0.00 31.21 4.35
744 745 5.084818 TCATCTTGAGATTTACGAAGCCA 57.915 39.130 0.00 0.00 31.21 4.75
745 746 4.870426 TCATCTTGAGATTTACGAAGCCAC 59.130 41.667 0.00 0.00 31.21 5.01
746 747 3.596214 TCTTGAGATTTACGAAGCCACC 58.404 45.455 0.00 0.00 0.00 4.61
747 748 2.004583 TGAGATTTACGAAGCCACCG 57.995 50.000 0.00 0.00 0.00 4.94
748 749 1.274167 TGAGATTTACGAAGCCACCGT 59.726 47.619 0.00 0.00 43.26 4.83
749 750 2.492881 TGAGATTTACGAAGCCACCGTA 59.507 45.455 0.00 0.00 40.95 4.02
750 751 3.114065 GAGATTTACGAAGCCACCGTAG 58.886 50.000 0.00 0.00 42.42 3.51
762 763 2.431942 CCGTAGGCGCTTTGTCGT 60.432 61.111 7.64 0.00 46.14 4.34
763 764 2.442188 CCGTAGGCGCTTTGTCGTC 61.442 63.158 7.64 0.00 46.14 4.20
764 765 2.774951 CGTAGGCGCTTTGTCGTCG 61.775 63.158 7.64 0.00 39.34 5.12
765 766 1.443194 GTAGGCGCTTTGTCGTCGA 60.443 57.895 7.64 0.00 39.34 4.20
766 767 1.443194 TAGGCGCTTTGTCGTCGAC 60.443 57.895 18.51 18.51 39.34 4.20
767 768 4.117372 GGCGCTTTGTCGTCGACG 62.117 66.667 31.30 31.30 41.45 5.12
783 784 3.998156 CGAGAACGTCTCCTCCCA 58.002 61.111 8.73 0.00 40.34 4.37
784 785 1.507174 CGAGAACGTCTCCTCCCAC 59.493 63.158 8.73 0.00 40.34 4.61
785 786 0.961358 CGAGAACGTCTCCTCCCACT 60.961 60.000 8.73 0.00 40.34 4.00
786 787 0.528470 GAGAACGTCTCCTCCCACTG 59.472 60.000 0.00 0.00 37.55 3.66
787 788 0.112606 AGAACGTCTCCTCCCACTGA 59.887 55.000 0.00 0.00 0.00 3.41
788 789 0.966920 GAACGTCTCCTCCCACTGAA 59.033 55.000 0.00 0.00 0.00 3.02
789 790 1.343465 GAACGTCTCCTCCCACTGAAA 59.657 52.381 0.00 0.00 0.00 2.69
790 791 0.969894 ACGTCTCCTCCCACTGAAAG 59.030 55.000 0.00 0.00 42.29 2.62
791 792 0.390472 CGTCTCCTCCCACTGAAAGC 60.390 60.000 0.00 0.00 37.60 3.51
792 793 0.687354 GTCTCCTCCCACTGAAAGCA 59.313 55.000 0.00 0.00 37.60 3.91
793 794 0.687354 TCTCCTCCCACTGAAAGCAC 59.313 55.000 0.00 0.00 37.60 4.40
794 795 0.397941 CTCCTCCCACTGAAAGCACA 59.602 55.000 0.00 0.00 37.60 4.57
795 796 1.004044 CTCCTCCCACTGAAAGCACAT 59.996 52.381 0.00 0.00 37.60 3.21
796 797 1.003580 TCCTCCCACTGAAAGCACATC 59.996 52.381 0.00 0.00 37.60 3.06
797 798 1.081892 CTCCCACTGAAAGCACATCG 58.918 55.000 0.00 0.00 37.60 3.84
798 799 0.955428 TCCCACTGAAAGCACATCGC 60.955 55.000 0.00 0.00 37.60 4.58
799 800 1.503542 CCACTGAAAGCACATCGCC 59.496 57.895 0.00 0.00 44.04 5.54
800 801 1.133253 CACTGAAAGCACATCGCCG 59.867 57.895 0.00 0.00 44.04 6.46
801 802 2.034879 ACTGAAAGCACATCGCCGG 61.035 57.895 0.00 0.00 44.04 6.13
802 803 1.741401 CTGAAAGCACATCGCCGGA 60.741 57.895 5.05 0.00 44.04 5.14
803 804 1.298157 CTGAAAGCACATCGCCGGAA 61.298 55.000 5.05 0.00 44.04 4.30
804 805 0.886938 TGAAAGCACATCGCCGGAAA 60.887 50.000 5.05 0.00 44.04 3.13
805 806 0.451783 GAAAGCACATCGCCGGAAAT 59.548 50.000 5.05 0.00 44.04 2.17
806 807 0.451783 AAAGCACATCGCCGGAAATC 59.548 50.000 5.05 0.00 44.04 2.17
807 808 1.376609 AAGCACATCGCCGGAAATCC 61.377 55.000 5.05 0.00 44.04 3.01
808 809 1.819632 GCACATCGCCGGAAATCCT 60.820 57.895 5.05 0.00 32.94 3.24
809 810 2.016961 CACATCGCCGGAAATCCTG 58.983 57.895 5.05 0.00 0.00 3.86
810 811 0.461870 CACATCGCCGGAAATCCTGA 60.462 55.000 5.05 0.00 0.00 3.86
811 812 0.251916 ACATCGCCGGAAATCCTGAA 59.748 50.000 5.05 0.00 0.00 3.02
812 813 1.339631 ACATCGCCGGAAATCCTGAAA 60.340 47.619 5.05 0.00 0.00 2.69
813 814 1.949525 CATCGCCGGAAATCCTGAAAT 59.050 47.619 5.05 0.00 0.00 2.17
814 815 2.992124 TCGCCGGAAATCCTGAAATA 57.008 45.000 5.05 0.00 0.00 1.40
815 816 3.269538 TCGCCGGAAATCCTGAAATAA 57.730 42.857 5.05 0.00 0.00 1.40
816 817 3.611970 TCGCCGGAAATCCTGAAATAAA 58.388 40.909 5.05 0.00 0.00 1.40
817 818 4.204012 TCGCCGGAAATCCTGAAATAAAT 58.796 39.130 5.05 0.00 0.00 1.40
818 819 4.274950 TCGCCGGAAATCCTGAAATAAATC 59.725 41.667 5.05 0.00 0.00 2.17
819 820 4.556699 CGCCGGAAATCCTGAAATAAATCC 60.557 45.833 5.05 0.00 0.00 3.01
820 821 4.340950 GCCGGAAATCCTGAAATAAATCCA 59.659 41.667 5.05 0.00 0.00 3.41
821 822 5.507985 GCCGGAAATCCTGAAATAAATCCAG 60.508 44.000 5.05 0.00 0.00 3.86
822 823 5.827797 CCGGAAATCCTGAAATAAATCCAGA 59.172 40.000 0.00 0.00 0.00 3.86
823 824 6.321181 CCGGAAATCCTGAAATAAATCCAGAA 59.679 38.462 0.00 0.00 0.00 3.02
824 825 7.147915 CCGGAAATCCTGAAATAAATCCAGAAA 60.148 37.037 0.00 0.00 0.00 2.52
825 826 8.416329 CGGAAATCCTGAAATAAATCCAGAAAT 58.584 33.333 0.00 0.00 0.00 2.17
831 832 8.352201 TCCTGAAATAAATCCAGAAATAATGCG 58.648 33.333 0.00 0.00 0.00 4.73
832 833 8.352201 CCTGAAATAAATCCAGAAATAATGCGA 58.648 33.333 0.00 0.00 0.00 5.10
833 834 9.390795 CTGAAATAAATCCAGAAATAATGCGAG 57.609 33.333 0.00 0.00 0.00 5.03
834 835 7.862372 TGAAATAAATCCAGAAATAATGCGAGC 59.138 33.333 0.00 0.00 0.00 5.03
835 836 6.882610 ATAAATCCAGAAATAATGCGAGCA 57.117 33.333 0.00 0.00 0.00 4.26
836 837 4.558538 AATCCAGAAATAATGCGAGCAC 57.441 40.909 0.00 0.00 0.00 4.40
837 838 2.288666 TCCAGAAATAATGCGAGCACC 58.711 47.619 0.00 0.00 0.00 5.01
838 839 2.016318 CCAGAAATAATGCGAGCACCA 58.984 47.619 0.00 0.00 0.00 4.17
839 840 2.032550 CCAGAAATAATGCGAGCACCAG 59.967 50.000 0.00 0.00 0.00 4.00
840 841 2.032550 CAGAAATAATGCGAGCACCAGG 59.967 50.000 0.00 0.00 0.00 4.45
841 842 2.092968 AGAAATAATGCGAGCACCAGGA 60.093 45.455 0.00 0.00 0.00 3.86
842 843 2.645838 AATAATGCGAGCACCAGGAT 57.354 45.000 0.00 0.00 0.00 3.24
843 844 2.645838 ATAATGCGAGCACCAGGATT 57.354 45.000 0.00 0.00 33.17 3.01
844 845 2.418368 TAATGCGAGCACCAGGATTT 57.582 45.000 0.00 0.00 31.11 2.17
845 846 0.813184 AATGCGAGCACCAGGATTTG 59.187 50.000 0.00 0.00 0.00 2.32
846 847 0.035152 ATGCGAGCACCAGGATTTGA 60.035 50.000 0.00 0.00 0.00 2.69
847 848 0.250684 TGCGAGCACCAGGATTTGAA 60.251 50.000 0.00 0.00 0.00 2.69
848 849 0.169009 GCGAGCACCAGGATTTGAAC 59.831 55.000 0.00 0.00 0.00 3.18
849 850 0.804989 CGAGCACCAGGATTTGAACC 59.195 55.000 0.00 0.00 0.00 3.62
850 851 1.177401 GAGCACCAGGATTTGAACCC 58.823 55.000 0.00 0.00 0.00 4.11
851 852 0.779997 AGCACCAGGATTTGAACCCT 59.220 50.000 0.00 0.00 0.00 4.34
859 860 4.236527 AGGATTTGAACCCTGATACCAC 57.763 45.455 0.00 0.00 0.00 4.16
860 861 3.852578 AGGATTTGAACCCTGATACCACT 59.147 43.478 0.00 0.00 0.00 4.00
861 862 3.947834 GGATTTGAACCCTGATACCACTG 59.052 47.826 0.00 0.00 0.00 3.66
862 863 4.567747 GGATTTGAACCCTGATACCACTGT 60.568 45.833 0.00 0.00 0.00 3.55
863 864 3.695830 TTGAACCCTGATACCACTGTC 57.304 47.619 0.00 0.00 0.00 3.51
864 865 1.906574 TGAACCCTGATACCACTGTCC 59.093 52.381 0.00 0.00 0.00 4.02
865 866 1.906574 GAACCCTGATACCACTGTCCA 59.093 52.381 0.00 0.00 0.00 4.02
866 867 1.276622 ACCCTGATACCACTGTCCAC 58.723 55.000 0.00 0.00 0.00 4.02
867 868 0.541863 CCCTGATACCACTGTCCACC 59.458 60.000 0.00 0.00 0.00 4.61
868 869 1.573108 CCTGATACCACTGTCCACCT 58.427 55.000 0.00 0.00 0.00 4.00
869 870 2.625883 CCCTGATACCACTGTCCACCTA 60.626 54.545 0.00 0.00 0.00 3.08
870 871 3.104512 CCTGATACCACTGTCCACCTAA 58.895 50.000 0.00 0.00 0.00 2.69
871 872 3.118738 CCTGATACCACTGTCCACCTAAC 60.119 52.174 0.00 0.00 0.00 2.34
872 873 2.835764 TGATACCACTGTCCACCTAACC 59.164 50.000 0.00 0.00 0.00 2.85
873 874 2.402182 TACCACTGTCCACCTAACCA 57.598 50.000 0.00 0.00 0.00 3.67
874 875 1.742308 ACCACTGTCCACCTAACCAT 58.258 50.000 0.00 0.00 0.00 3.55
875 876 1.628846 ACCACTGTCCACCTAACCATC 59.371 52.381 0.00 0.00 0.00 3.51
876 877 1.909302 CCACTGTCCACCTAACCATCT 59.091 52.381 0.00 0.00 0.00 2.90
877 878 2.093447 CCACTGTCCACCTAACCATCTC 60.093 54.545 0.00 0.00 0.00 2.75
878 879 2.567169 CACTGTCCACCTAACCATCTCA 59.433 50.000 0.00 0.00 0.00 3.27
879 880 3.007940 CACTGTCCACCTAACCATCTCAA 59.992 47.826 0.00 0.00 0.00 3.02
880 881 3.846588 ACTGTCCACCTAACCATCTCAAT 59.153 43.478 0.00 0.00 0.00 2.57
881 882 4.080863 ACTGTCCACCTAACCATCTCAATC 60.081 45.833 0.00 0.00 0.00 2.67
882 883 3.843619 TGTCCACCTAACCATCTCAATCA 59.156 43.478 0.00 0.00 0.00 2.57
883 884 4.192317 GTCCACCTAACCATCTCAATCAC 58.808 47.826 0.00 0.00 0.00 3.06
884 885 3.199946 TCCACCTAACCATCTCAATCACC 59.800 47.826 0.00 0.00 0.00 4.02
885 886 3.198068 CACCTAACCATCTCAATCACCG 58.802 50.000 0.00 0.00 0.00 4.94
886 887 2.170607 ACCTAACCATCTCAATCACCGG 59.829 50.000 0.00 0.00 0.00 5.28
887 888 2.170607 CCTAACCATCTCAATCACCGGT 59.829 50.000 0.00 0.00 0.00 5.28
888 889 2.879103 AACCATCTCAATCACCGGTT 57.121 45.000 2.97 0.00 31.97 4.44
889 890 3.992943 AACCATCTCAATCACCGGTTA 57.007 42.857 2.97 0.00 35.04 2.85
893 894 4.164221 ACCATCTCAATCACCGGTTAATCT 59.836 41.667 2.97 0.00 0.00 2.40
895 896 3.531538 TCTCAATCACCGGTTAATCTGC 58.468 45.455 2.97 0.00 0.00 4.26
934 938 1.605710 GATGAATTGCATCCACCCTCG 59.394 52.381 0.00 0.00 46.23 4.63
969 974 1.864862 CGCACCAACAAGAGAGCAG 59.135 57.895 0.00 0.00 0.00 4.24
987 1004 0.752054 AGCAGCCATAGTCTCAGAGC 59.248 55.000 0.00 0.00 0.00 4.09
990 1007 2.298446 GCAGCCATAGTCTCAGAGCATA 59.702 50.000 0.00 0.00 0.00 3.14
1014 1031 3.936372 GGCGATATGGCTCAAGTACTA 57.064 47.619 9.71 0.00 40.72 1.82
1015 1032 3.576648 GGCGATATGGCTCAAGTACTAC 58.423 50.000 9.71 0.00 40.72 2.73
1016 1033 3.256136 GGCGATATGGCTCAAGTACTACT 59.744 47.826 9.71 0.00 40.72 2.57
1026 1043 5.337652 GGCTCAAGTACTACTCACCATCTTT 60.338 44.000 0.00 0.00 0.00 2.52
1072 1095 3.766676 TGCTCTGCTTCTTCGTAGTAG 57.233 47.619 0.00 0.00 0.00 2.57
1117 1149 1.068402 CAGCGAACAATTGCCATGACA 60.068 47.619 5.05 0.00 36.53 3.58
1293 1328 2.045143 GTCGTCTCCTCCCCGAGT 60.045 66.667 0.00 0.00 0.00 4.18
1323 1358 2.150218 CGTTCTACGCACGCACGAT 61.150 57.895 4.54 0.00 33.65 3.73
1587 1623 1.518572 CGGCGCCTTCACTAACGAT 60.519 57.895 26.68 0.00 0.00 3.73
1625 1661 1.375326 GCGGGAAGTTCTTCAGGGT 59.625 57.895 13.44 0.00 0.00 4.34
1848 1884 4.215908 CATGGCTAGTAGGAGGAGTACAA 58.784 47.826 0.00 0.00 0.00 2.41
1893 1947 2.564947 AGACAGAGACTTGGTGGATGTC 59.435 50.000 0.00 0.00 36.65 3.06
1976 2030 5.347635 TGGTAATTCTCTGAATTTCGTGACG 59.652 40.000 10.25 0.00 0.00 4.35
1999 2059 9.382244 GACGCTTAAATAGTATTGCCAATTAAG 57.618 33.333 0.00 0.00 33.94 1.85
2005 2065 3.616219 AGTATTGCCAATTAAGCCGACA 58.384 40.909 0.00 0.00 0.00 4.35
2008 2068 5.825679 AGTATTGCCAATTAAGCCGACATTA 59.174 36.000 0.00 0.00 0.00 1.90
2010 2070 5.392767 TTGCCAATTAAGCCGACATTAAA 57.607 34.783 0.00 0.00 0.00 1.52
2012 2072 5.164954 TGCCAATTAAGCCGACATTAAAAC 58.835 37.500 0.00 0.00 0.00 2.43
2036 2096 6.706270 ACATGTGCTAATTAATTACTCCCTCG 59.294 38.462 0.00 0.00 0.00 4.63
2052 2112 2.161609 CCCTCGGTTCACAAACATAAGC 59.838 50.000 0.00 0.00 37.10 3.09
2053 2113 3.074412 CCTCGGTTCACAAACATAAGCT 58.926 45.455 0.00 0.00 37.10 3.74
2057 2117 3.749088 CGGTTCACAAACATAAGCTGGTA 59.251 43.478 0.00 0.00 37.10 3.25
2108 2168 6.443876 AGACGTATTTTAGTGTGTTCGTTC 57.556 37.500 0.00 0.00 0.00 3.95
2112 2172 6.074676 ACGTATTTTAGTGTGTTCGTTCACTC 60.075 38.462 12.11 9.34 42.77 3.51
2124 2184 2.035449 TCGTTCACTCATTTCAGTCCGT 59.965 45.455 0.00 0.00 0.00 4.69
2132 2192 5.744345 CACTCATTTCAGTCCGTATGTAGTC 59.256 44.000 0.00 0.00 0.00 2.59
2140 2200 5.831525 TCAGTCCGTATGTAGTCCATATTGT 59.168 40.000 0.00 0.00 38.29 2.71
2147 2207 9.745880 CCGTATGTAGTCCATATTGTAATATCC 57.254 37.037 0.00 0.00 38.29 2.59
2148 2208 9.447040 CGTATGTAGTCCATATTGTAATATCCG 57.553 37.037 0.00 0.00 38.29 4.18
2171 2231 6.905076 CCGAAACATCTTATATTTGTGAACGG 59.095 38.462 0.00 0.00 32.51 4.44
2271 2331 0.949105 GCGGGAACAGACACGTCATT 60.949 55.000 0.00 0.00 39.03 2.57
2617 2681 1.320344 CGGAGAGGTTCATGGACGGA 61.320 60.000 0.00 0.00 0.00 4.69
2660 2724 2.367947 AGGGAGGGATTTCCAGTTCT 57.632 50.000 0.00 0.00 39.09 3.01
2719 2783 2.925706 TTCGGGCTGGCCACTGTA 60.926 61.111 21.03 0.00 37.98 2.74
2822 2886 1.067974 ACGTGTTTGGAGTGACGATGA 59.932 47.619 0.00 0.00 35.77 2.92
2840 2904 1.178276 GAGTCGGAAGGAGAAGCTCA 58.822 55.000 0.00 0.00 31.08 4.26
2853 2917 2.303022 AGAAGCTCATTCTTGTCCCGAA 59.697 45.455 0.00 0.00 46.49 4.30
2861 2925 5.505780 TCATTCTTGTCCCGAAAATACCAT 58.494 37.500 0.00 0.00 0.00 3.55
2862 2926 6.654959 TCATTCTTGTCCCGAAAATACCATA 58.345 36.000 0.00 0.00 0.00 2.74
2863 2927 6.540914 TCATTCTTGTCCCGAAAATACCATAC 59.459 38.462 0.00 0.00 0.00 2.39
2864 2928 4.773013 TCTTGTCCCGAAAATACCATACC 58.227 43.478 0.00 0.00 0.00 2.73
2865 2929 4.225492 TCTTGTCCCGAAAATACCATACCA 59.775 41.667 0.00 0.00 0.00 3.25
2866 2930 3.876341 TGTCCCGAAAATACCATACCAC 58.124 45.455 0.00 0.00 0.00 4.16
2867 2931 3.208594 GTCCCGAAAATACCATACCACC 58.791 50.000 0.00 0.00 0.00 4.61
2868 2932 2.844966 TCCCGAAAATACCATACCACCA 59.155 45.455 0.00 0.00 0.00 4.17
2869 2933 2.946990 CCCGAAAATACCATACCACCAC 59.053 50.000 0.00 0.00 0.00 4.16
2870 2934 3.371166 CCCGAAAATACCATACCACCACT 60.371 47.826 0.00 0.00 0.00 4.00
2871 2935 4.141665 CCCGAAAATACCATACCACCACTA 60.142 45.833 0.00 0.00 0.00 2.74
2872 2936 5.430007 CCGAAAATACCATACCACCACTAA 58.570 41.667 0.00 0.00 0.00 2.24
2873 2937 5.881443 CCGAAAATACCATACCACCACTAAA 59.119 40.000 0.00 0.00 0.00 1.85
2874 2938 6.544564 CCGAAAATACCATACCACCACTAAAT 59.455 38.462 0.00 0.00 0.00 1.40
2875 2939 7.414436 CGAAAATACCATACCACCACTAAATG 58.586 38.462 0.00 0.00 0.00 2.32
2876 2940 6.709018 AAATACCATACCACCACTAAATGC 57.291 37.500 0.00 0.00 0.00 3.56
2877 2941 3.730215 ACCATACCACCACTAAATGCA 57.270 42.857 0.00 0.00 0.00 3.96
2878 2942 4.040936 ACCATACCACCACTAAATGCAA 57.959 40.909 0.00 0.00 0.00 4.08
2879 2943 4.016444 ACCATACCACCACTAAATGCAAG 58.984 43.478 0.00 0.00 0.00 4.01
2880 2944 4.016444 CCATACCACCACTAAATGCAAGT 58.984 43.478 0.00 0.00 0.00 3.16
2881 2945 5.189928 CCATACCACCACTAAATGCAAGTA 58.810 41.667 0.00 0.00 0.00 2.24
2882 2946 5.065988 CCATACCACCACTAAATGCAAGTAC 59.934 44.000 0.00 0.00 0.00 2.73
2883 2947 4.367039 ACCACCACTAAATGCAAGTACT 57.633 40.909 0.00 0.00 0.00 2.73
2884 2948 4.072131 ACCACCACTAAATGCAAGTACTG 58.928 43.478 0.00 0.00 0.00 2.74
2894 2958 3.689224 CAAGTACTGCATGCACAGC 57.311 52.632 18.46 9.34 41.60 4.40
2895 2959 0.876399 CAAGTACTGCATGCACAGCA 59.124 50.000 18.46 14.22 44.86 4.41
2896 2960 0.877071 AAGTACTGCATGCACAGCAC 59.123 50.000 18.46 9.28 43.04 4.40
2897 2961 0.250424 AGTACTGCATGCACAGCACA 60.250 50.000 18.46 0.00 43.04 4.57
2898 2962 0.110056 GTACTGCATGCACAGCACAC 60.110 55.000 18.46 8.81 43.04 3.82
2899 2963 1.236616 TACTGCATGCACAGCACACC 61.237 55.000 18.46 0.00 43.04 4.16
2900 2964 3.604494 CTGCATGCACAGCACACCG 62.604 63.158 18.46 0.00 43.04 4.94
2901 2965 3.663176 GCATGCACAGCACACCGT 61.663 61.111 14.21 0.00 43.04 4.83
2902 2966 2.324330 GCATGCACAGCACACCGTA 61.324 57.895 14.21 0.00 43.04 4.02
2903 2967 1.789751 CATGCACAGCACACCGTAG 59.210 57.895 0.00 0.00 43.04 3.51
2904 2968 0.950555 CATGCACAGCACACCGTAGT 60.951 55.000 0.00 0.00 43.04 2.73
2905 2969 0.606096 ATGCACAGCACACCGTAGTA 59.394 50.000 0.00 0.00 43.04 1.82
2906 2970 0.606096 TGCACAGCACACCGTAGTAT 59.394 50.000 0.00 0.00 31.71 2.12
2907 2971 1.819903 TGCACAGCACACCGTAGTATA 59.180 47.619 0.00 0.00 31.71 1.47
2908 2972 2.159296 TGCACAGCACACCGTAGTATAG 60.159 50.000 0.00 0.00 31.71 1.31
2909 2973 2.460918 CACAGCACACCGTAGTATAGC 58.539 52.381 0.00 0.00 0.00 2.97
2910 2974 2.099263 CACAGCACACCGTAGTATAGCT 59.901 50.000 0.00 0.00 0.00 3.32
2911 2975 2.758979 ACAGCACACCGTAGTATAGCTT 59.241 45.455 0.00 0.00 0.00 3.74
2912 2976 3.949754 ACAGCACACCGTAGTATAGCTTA 59.050 43.478 0.00 0.00 0.00 3.09
2913 2977 4.400251 ACAGCACACCGTAGTATAGCTTAA 59.600 41.667 0.00 0.00 0.00 1.85
2914 2978 5.105635 ACAGCACACCGTAGTATAGCTTAAA 60.106 40.000 0.00 0.00 0.00 1.52
2915 2979 5.983720 CAGCACACCGTAGTATAGCTTAAAT 59.016 40.000 0.00 0.00 0.00 1.40
2916 2980 6.479001 CAGCACACCGTAGTATAGCTTAAATT 59.521 38.462 0.00 0.00 0.00 1.82
2917 2981 7.011109 CAGCACACCGTAGTATAGCTTAAATTT 59.989 37.037 0.00 0.00 0.00 1.82
2918 2982 8.199449 AGCACACCGTAGTATAGCTTAAATTTA 58.801 33.333 0.00 0.00 0.00 1.40
2919 2983 8.985805 GCACACCGTAGTATAGCTTAAATTTAT 58.014 33.333 0.00 0.00 0.00 1.40
2942 3006 9.713713 TTATACGAATTCCGATATGATTTTCCA 57.286 29.630 0.00 0.00 41.76 3.53
2943 3007 6.935741 ACGAATTCCGATATGATTTTCCAA 57.064 33.333 0.00 0.00 41.76 3.53
2944 3008 7.510549 ACGAATTCCGATATGATTTTCCAAT 57.489 32.000 0.00 0.00 41.76 3.16
2945 3009 8.615878 ACGAATTCCGATATGATTTTCCAATA 57.384 30.769 0.00 0.00 41.76 1.90
2946 3010 9.062524 ACGAATTCCGATATGATTTTCCAATAA 57.937 29.630 0.00 0.00 41.76 1.40
2947 3011 9.329913 CGAATTCCGATATGATTTTCCAATAAC 57.670 33.333 0.00 0.00 41.76 1.89
2948 3012 9.329913 GAATTCCGATATGATTTTCCAATAACG 57.670 33.333 0.00 0.00 0.00 3.18
2949 3013 7.795482 TTCCGATATGATTTTCCAATAACGT 57.205 32.000 0.00 0.00 0.00 3.99
2950 3014 7.184800 TCCGATATGATTTTCCAATAACGTG 57.815 36.000 0.00 0.00 0.00 4.49
2951 3015 6.203915 TCCGATATGATTTTCCAATAACGTGG 59.796 38.462 0.00 0.00 40.33 4.94
2952 3016 6.370593 CGATATGATTTTCCAATAACGTGGG 58.629 40.000 0.00 0.00 39.34 4.61
2953 3017 6.203915 CGATATGATTTTCCAATAACGTGGGA 59.796 38.462 0.00 0.00 39.34 4.37
2954 3018 5.835113 ATGATTTTCCAATAACGTGGGAG 57.165 39.130 0.00 0.00 39.34 4.30
2955 3019 4.912586 TGATTTTCCAATAACGTGGGAGA 58.087 39.130 0.00 0.00 39.34 3.71
2956 3020 4.698304 TGATTTTCCAATAACGTGGGAGAC 59.302 41.667 0.00 0.00 39.34 3.36
2957 3021 4.360951 TTTTCCAATAACGTGGGAGACT 57.639 40.909 0.00 0.00 39.34 3.24
2958 3022 5.486735 TTTTCCAATAACGTGGGAGACTA 57.513 39.130 0.00 0.00 39.34 2.59
2959 3023 4.460948 TTCCAATAACGTGGGAGACTAC 57.539 45.455 0.00 0.00 39.34 2.73
2960 3024 3.433343 TCCAATAACGTGGGAGACTACA 58.567 45.455 0.00 0.00 42.92 2.74
2961 3025 3.833650 TCCAATAACGTGGGAGACTACAA 59.166 43.478 0.00 0.00 42.92 2.41
2962 3026 4.468510 TCCAATAACGTGGGAGACTACAAT 59.531 41.667 0.00 0.00 42.92 2.71
2963 3027 5.657745 TCCAATAACGTGGGAGACTACAATA 59.342 40.000 0.00 0.00 42.92 1.90
2964 3028 5.751990 CCAATAACGTGGGAGACTACAATAC 59.248 44.000 0.00 0.00 42.92 1.89
2965 3029 6.334989 CAATAACGTGGGAGACTACAATACA 58.665 40.000 0.00 0.00 42.92 2.29
2966 3030 4.877378 AACGTGGGAGACTACAATACAA 57.123 40.909 0.00 0.00 42.92 2.41
2967 3031 4.451629 ACGTGGGAGACTACAATACAAG 57.548 45.455 0.00 0.00 42.92 3.16
2968 3032 3.187700 CGTGGGAGACTACAATACAAGC 58.812 50.000 0.00 0.00 42.92 4.01
2969 3033 3.119101 CGTGGGAGACTACAATACAAGCT 60.119 47.826 0.00 0.00 42.92 3.74
2970 3034 4.097437 CGTGGGAGACTACAATACAAGCTA 59.903 45.833 0.00 0.00 42.92 3.32
2971 3035 5.393787 CGTGGGAGACTACAATACAAGCTAA 60.394 44.000 0.00 0.00 42.92 3.09
2972 3036 5.811100 GTGGGAGACTACAATACAAGCTAAC 59.189 44.000 0.00 0.00 42.23 2.34
2973 3037 5.105064 TGGGAGACTACAATACAAGCTAACC 60.105 44.000 0.00 0.00 0.00 2.85
2974 3038 5.105064 GGGAGACTACAATACAAGCTAACCA 60.105 44.000 0.00 0.00 0.00 3.67
2975 3039 6.408206 GGGAGACTACAATACAAGCTAACCAT 60.408 42.308 0.00 0.00 0.00 3.55
2976 3040 7.201974 GGGAGACTACAATACAAGCTAACCATA 60.202 40.741 0.00 0.00 0.00 2.74
2977 3041 7.868415 GGAGACTACAATACAAGCTAACCATAG 59.132 40.741 0.00 0.00 0.00 2.23
2978 3042 7.727181 AGACTACAATACAAGCTAACCATAGG 58.273 38.462 0.00 0.00 0.00 2.57
2979 3043 7.344871 AGACTACAATACAAGCTAACCATAGGT 59.655 37.037 0.00 0.00 41.53 3.08
2985 3049 3.449746 AAGCTAACCATAGGTTGCCAA 57.550 42.857 11.51 0.00 46.35 4.52
2986 3050 3.449746 AGCTAACCATAGGTTGCCAAA 57.550 42.857 11.51 0.00 46.35 3.28
2987 3051 3.773560 AGCTAACCATAGGTTGCCAAAA 58.226 40.909 11.51 0.00 46.35 2.44
2988 3052 4.352893 AGCTAACCATAGGTTGCCAAAAT 58.647 39.130 11.51 0.00 46.35 1.82
2989 3053 5.515106 AGCTAACCATAGGTTGCCAAAATA 58.485 37.500 11.51 0.00 46.35 1.40
2990 3054 5.594317 AGCTAACCATAGGTTGCCAAAATAG 59.406 40.000 11.51 0.00 46.35 1.73
2991 3055 5.592688 GCTAACCATAGGTTGCCAAAATAGA 59.407 40.000 11.51 0.00 46.35 1.98
2992 3056 6.096282 GCTAACCATAGGTTGCCAAAATAGAA 59.904 38.462 11.51 0.00 46.35 2.10
2993 3057 6.926630 AACCATAGGTTGCCAAAATAGAAA 57.073 33.333 0.00 0.00 45.07 2.52
2994 3058 6.926630 ACCATAGGTTGCCAAAATAGAAAA 57.073 33.333 0.00 0.00 27.29 2.29
2995 3059 7.494922 ACCATAGGTTGCCAAAATAGAAAAT 57.505 32.000 0.00 0.00 27.29 1.82
2996 3060 7.917003 ACCATAGGTTGCCAAAATAGAAAATT 58.083 30.769 0.00 0.00 27.29 1.82
2997 3061 7.823799 ACCATAGGTTGCCAAAATAGAAAATTG 59.176 33.333 0.00 0.00 27.29 2.32
2998 3062 8.040132 CCATAGGTTGCCAAAATAGAAAATTGA 58.960 33.333 0.00 0.00 0.00 2.57
2999 3063 9.434420 CATAGGTTGCCAAAATAGAAAATTGAA 57.566 29.630 0.00 0.00 0.00 2.69
3001 3065 8.326680 AGGTTGCCAAAATAGAAAATTGAATG 57.673 30.769 0.00 0.00 0.00 2.67
3002 3066 7.938490 AGGTTGCCAAAATAGAAAATTGAATGT 59.062 29.630 0.00 0.00 0.00 2.71
3003 3067 8.016801 GGTTGCCAAAATAGAAAATTGAATGTG 58.983 33.333 0.00 0.00 0.00 3.21
3004 3068 8.772705 GTTGCCAAAATAGAAAATTGAATGTGA 58.227 29.630 0.00 0.00 0.00 3.58
3005 3069 8.899427 TGCCAAAATAGAAAATTGAATGTGAA 57.101 26.923 0.00 0.00 0.00 3.18
3006 3070 8.772705 TGCCAAAATAGAAAATTGAATGTGAAC 58.227 29.630 0.00 0.00 0.00 3.18
3007 3071 8.229811 GCCAAAATAGAAAATTGAATGTGAACC 58.770 33.333 0.00 0.00 0.00 3.62
3008 3072 8.434661 CCAAAATAGAAAATTGAATGTGAACCG 58.565 33.333 0.00 0.00 0.00 4.44
3009 3073 7.581011 AAATAGAAAATTGAATGTGAACCGC 57.419 32.000 0.00 0.00 0.00 5.68
3010 3074 3.913089 AGAAAATTGAATGTGAACCGCC 58.087 40.909 0.00 0.00 0.00 6.13
3011 3075 2.346099 AAATTGAATGTGAACCGCCG 57.654 45.000 0.00 0.00 0.00 6.46
3012 3076 0.525761 AATTGAATGTGAACCGCCGG 59.474 50.000 0.00 0.00 0.00 6.13
3013 3077 0.322098 ATTGAATGTGAACCGCCGGA 60.322 50.000 11.71 0.00 0.00 5.14
3014 3078 0.322098 TTGAATGTGAACCGCCGGAT 60.322 50.000 11.71 0.00 0.00 4.18
3015 3079 0.742990 TGAATGTGAACCGCCGGATC 60.743 55.000 11.71 8.73 0.00 3.36
3016 3080 0.462047 GAATGTGAACCGCCGGATCT 60.462 55.000 11.71 0.00 0.00 2.75
3017 3081 0.035439 AATGTGAACCGCCGGATCTT 60.035 50.000 11.71 0.00 0.00 2.40
3018 3082 0.744414 ATGTGAACCGCCGGATCTTG 60.744 55.000 11.71 0.00 0.00 3.02
3019 3083 2.106683 GTGAACCGCCGGATCTTGG 61.107 63.158 11.71 0.00 0.00 3.61
3020 3084 2.287274 TGAACCGCCGGATCTTGGA 61.287 57.895 11.71 0.00 0.00 3.53
3021 3085 1.146263 GAACCGCCGGATCTTGGAT 59.854 57.895 11.71 0.00 0.00 3.41
3022 3086 1.153168 AACCGCCGGATCTTGGATG 60.153 57.895 11.71 1.69 0.00 3.51
3023 3087 2.281070 CCGCCGGATCTTGGATGG 60.281 66.667 5.05 5.57 0.00 3.51
3024 3088 2.807107 CCGCCGGATCTTGGATGGA 61.807 63.158 5.05 0.00 0.00 3.41
3025 3089 1.372683 CGCCGGATCTTGGATGGAT 59.627 57.895 5.05 0.00 0.00 3.41
3026 3090 0.952497 CGCCGGATCTTGGATGGATG 60.952 60.000 5.05 0.00 0.00 3.51
3027 3091 1.239968 GCCGGATCTTGGATGGATGC 61.240 60.000 5.05 0.00 0.00 3.91
3028 3092 0.607489 CCGGATCTTGGATGGATGCC 60.607 60.000 0.00 0.00 0.00 4.40
3029 3093 0.607489 CGGATCTTGGATGGATGCCC 60.607 60.000 0.00 0.00 0.00 5.36
3030 3094 0.251519 GGATCTTGGATGGATGCCCC 60.252 60.000 0.00 0.00 0.00 5.80
3042 3106 3.326521 TGGATGCCCCATATTCTAGTGT 58.673 45.455 0.00 0.00 40.82 3.55
3043 3107 4.498493 TGGATGCCCCATATTCTAGTGTA 58.502 43.478 0.00 0.00 40.82 2.90
3044 3108 4.532126 TGGATGCCCCATATTCTAGTGTAG 59.468 45.833 0.00 0.00 40.82 2.74
3045 3109 4.080863 GGATGCCCCATATTCTAGTGTAGG 60.081 50.000 0.00 0.00 34.14 3.18
3046 3110 4.207698 TGCCCCATATTCTAGTGTAGGA 57.792 45.455 0.00 0.00 0.00 2.94
3047 3111 4.160329 TGCCCCATATTCTAGTGTAGGAG 58.840 47.826 0.00 0.00 0.00 3.69
3048 3112 3.055747 GCCCCATATTCTAGTGTAGGAGC 60.056 52.174 0.00 0.00 0.00 4.70
3049 3113 4.421131 CCCCATATTCTAGTGTAGGAGCT 58.579 47.826 0.00 0.00 0.00 4.09
3050 3114 4.221703 CCCCATATTCTAGTGTAGGAGCTG 59.778 50.000 0.00 0.00 0.00 4.24
3051 3115 4.322349 CCCATATTCTAGTGTAGGAGCTGC 60.322 50.000 0.00 0.00 0.00 5.25
3052 3116 4.526262 CCATATTCTAGTGTAGGAGCTGCT 59.474 45.833 13.92 13.92 0.00 4.24
3053 3117 5.468592 CATATTCTAGTGTAGGAGCTGCTG 58.531 45.833 19.25 0.00 0.00 4.41
3054 3118 1.769026 TCTAGTGTAGGAGCTGCTGG 58.231 55.000 19.25 1.36 0.00 4.85
3055 3119 1.285078 TCTAGTGTAGGAGCTGCTGGA 59.715 52.381 19.25 0.40 0.00 3.86
3056 3120 1.680735 CTAGTGTAGGAGCTGCTGGAG 59.319 57.143 19.25 3.83 0.00 3.86
3057 3121 0.975040 AGTGTAGGAGCTGCTGGAGG 60.975 60.000 19.25 0.00 0.00 4.30
3058 3122 1.687146 TGTAGGAGCTGCTGGAGGG 60.687 63.158 19.25 0.00 0.00 4.30
3059 3123 2.765807 TAGGAGCTGCTGGAGGGC 60.766 66.667 19.25 0.00 0.00 5.19
3060 3124 3.323394 TAGGAGCTGCTGGAGGGCT 62.323 63.158 19.25 0.00 39.16 5.19
3061 3125 2.829639 TAGGAGCTGCTGGAGGGCTT 62.830 60.000 19.25 0.00 36.37 4.35
3062 3126 2.354343 GAGCTGCTGGAGGGCTTT 59.646 61.111 7.01 0.00 36.37 3.51
3063 3127 2.035312 AGCTGCTGGAGGGCTTTG 59.965 61.111 0.00 0.00 31.81 2.77
3064 3128 2.282745 GCTGCTGGAGGGCTTTGT 60.283 61.111 0.00 0.00 0.00 2.83
3065 3129 1.905354 GCTGCTGGAGGGCTTTGTT 60.905 57.895 0.00 0.00 0.00 2.83
3066 3130 1.871126 GCTGCTGGAGGGCTTTGTTC 61.871 60.000 0.00 0.00 0.00 3.18
3067 3131 0.538057 CTGCTGGAGGGCTTTGTTCA 60.538 55.000 0.00 0.00 0.00 3.18
3068 3132 0.112995 TGCTGGAGGGCTTTGTTCAT 59.887 50.000 0.00 0.00 0.00 2.57
3069 3133 1.260544 GCTGGAGGGCTTTGTTCATT 58.739 50.000 0.00 0.00 0.00 2.57
3070 3134 1.620323 GCTGGAGGGCTTTGTTCATTT 59.380 47.619 0.00 0.00 0.00 2.32
3071 3135 2.353109 GCTGGAGGGCTTTGTTCATTTC 60.353 50.000 0.00 0.00 0.00 2.17
3072 3136 2.892852 CTGGAGGGCTTTGTTCATTTCA 59.107 45.455 0.00 0.00 0.00 2.69
3073 3137 2.627699 TGGAGGGCTTTGTTCATTTCAC 59.372 45.455 0.00 0.00 0.00 3.18
3074 3138 2.351738 GGAGGGCTTTGTTCATTTCACG 60.352 50.000 0.00 0.00 0.00 4.35
3075 3139 2.552315 GAGGGCTTTGTTCATTTCACGA 59.448 45.455 0.00 0.00 0.00 4.35
3076 3140 2.554032 AGGGCTTTGTTCATTTCACGAG 59.446 45.455 0.00 0.00 0.00 4.18
3077 3141 2.319472 GGCTTTGTTCATTTCACGAGC 58.681 47.619 0.00 0.00 0.00 5.03
3078 3142 2.319472 GCTTTGTTCATTTCACGAGCC 58.681 47.619 0.00 0.00 0.00 4.70
3079 3143 2.030805 GCTTTGTTCATTTCACGAGCCT 60.031 45.455 0.00 0.00 0.00 4.58
3080 3144 3.558505 CTTTGTTCATTTCACGAGCCTG 58.441 45.455 0.00 0.00 0.00 4.85
3081 3145 0.874390 TGTTCATTTCACGAGCCTGC 59.126 50.000 0.00 0.00 0.00 4.85
3082 3146 1.160137 GTTCATTTCACGAGCCTGCT 58.840 50.000 0.00 0.00 0.00 4.24
3083 3147 1.129437 GTTCATTTCACGAGCCTGCTC 59.871 52.381 9.11 9.11 39.55 4.26
3084 3148 0.610174 TCATTTCACGAGCCTGCTCT 59.390 50.000 16.45 1.98 40.69 4.09
3085 3149 1.002430 TCATTTCACGAGCCTGCTCTT 59.998 47.619 16.45 4.95 40.69 2.85
3086 3150 2.233676 TCATTTCACGAGCCTGCTCTTA 59.766 45.455 16.45 0.00 40.69 2.10
3087 3151 2.370281 TTTCACGAGCCTGCTCTTAG 57.630 50.000 16.45 6.76 40.69 2.18
3088 3152 0.108615 TTCACGAGCCTGCTCTTAGC 60.109 55.000 16.45 0.00 42.82 3.09
3089 3153 1.520342 CACGAGCCTGCTCTTAGCC 60.520 63.158 16.45 0.00 41.51 3.93
3090 3154 1.984570 ACGAGCCTGCTCTTAGCCA 60.985 57.895 16.45 0.00 41.51 4.75
3091 3155 1.219124 CGAGCCTGCTCTTAGCCAA 59.781 57.895 16.45 0.00 41.51 4.52
3092 3156 0.179062 CGAGCCTGCTCTTAGCCAAT 60.179 55.000 16.45 0.00 41.51 3.16
3093 3157 1.592064 GAGCCTGCTCTTAGCCAATC 58.408 55.000 11.82 0.00 41.51 2.67
3094 3158 1.140652 GAGCCTGCTCTTAGCCAATCT 59.859 52.381 11.82 0.00 41.51 2.40
3095 3159 2.366916 GAGCCTGCTCTTAGCCAATCTA 59.633 50.000 11.82 0.00 41.51 1.98
3096 3160 2.368221 AGCCTGCTCTTAGCCAATCTAG 59.632 50.000 0.00 0.00 41.51 2.43
3097 3161 2.366916 GCCTGCTCTTAGCCAATCTAGA 59.633 50.000 0.00 0.00 41.51 2.43
3098 3162 3.554752 GCCTGCTCTTAGCCAATCTAGAG 60.555 52.174 0.00 0.00 41.51 2.43
3099 3163 3.554752 CCTGCTCTTAGCCAATCTAGAGC 60.555 52.174 14.27 14.27 41.51 4.09
3100 3164 3.033909 TGCTCTTAGCCAATCTAGAGCA 58.966 45.455 18.57 18.57 45.40 4.26
3101 3165 3.181471 TGCTCTTAGCCAATCTAGAGCAC 60.181 47.826 18.57 0.00 44.28 4.40
3102 3166 3.801983 GCTCTTAGCCAATCTAGAGCACC 60.802 52.174 15.79 0.00 42.10 5.01
3103 3167 2.700897 TCTTAGCCAATCTAGAGCACCC 59.299 50.000 0.00 0.00 0.00 4.61
3104 3168 2.174685 TAGCCAATCTAGAGCACCCA 57.825 50.000 0.00 0.00 0.00 4.51
3105 3169 1.516110 AGCCAATCTAGAGCACCCAT 58.484 50.000 0.00 0.00 0.00 4.00
3106 3170 1.419387 AGCCAATCTAGAGCACCCATC 59.581 52.381 0.00 0.00 0.00 3.51
3107 3171 1.875576 GCCAATCTAGAGCACCCATCG 60.876 57.143 0.00 0.00 0.00 3.84
3108 3172 1.688735 CCAATCTAGAGCACCCATCGA 59.311 52.381 0.00 0.00 0.00 3.59
3109 3173 2.301296 CCAATCTAGAGCACCCATCGAT 59.699 50.000 0.00 0.00 0.00 3.59
3110 3174 3.583806 CAATCTAGAGCACCCATCGATC 58.416 50.000 0.00 0.00 0.00 3.69
3111 3175 1.621992 TCTAGAGCACCCATCGATCC 58.378 55.000 0.00 0.00 0.00 3.36
3112 3176 0.242286 CTAGAGCACCCATCGATCCG 59.758 60.000 0.00 0.00 0.00 4.18
3113 3177 0.179001 TAGAGCACCCATCGATCCGA 60.179 55.000 0.00 0.00 41.13 4.55
3114 3178 1.006805 GAGCACCCATCGATCCGAG 60.007 63.158 0.00 0.00 39.91 4.63
3115 3179 1.455773 AGCACCCATCGATCCGAGA 60.456 57.895 0.00 0.00 39.91 4.04
3116 3180 0.829602 AGCACCCATCGATCCGAGAT 60.830 55.000 0.00 0.00 39.91 2.75
3117 3181 0.034059 GCACCCATCGATCCGAGATT 59.966 55.000 0.00 0.00 39.91 2.40
3118 3182 1.541233 GCACCCATCGATCCGAGATTT 60.541 52.381 0.00 0.00 39.91 2.17
3119 3183 2.138320 CACCCATCGATCCGAGATTTG 58.862 52.381 0.00 0.00 39.91 2.32
3120 3184 2.039418 ACCCATCGATCCGAGATTTGA 58.961 47.619 0.00 0.00 39.91 2.69
3121 3185 2.634940 ACCCATCGATCCGAGATTTGAT 59.365 45.455 0.00 0.00 39.91 2.57
3122 3186 2.998670 CCCATCGATCCGAGATTTGATG 59.001 50.000 0.00 15.33 39.91 3.07
3123 3187 2.998670 CCATCGATCCGAGATTTGATGG 59.001 50.000 20.97 20.97 44.70 3.51
3124 3188 3.555795 CCATCGATCCGAGATTTGATGGT 60.556 47.826 23.21 0.00 44.90 3.55
3125 3189 3.819564 TCGATCCGAGATTTGATGGTT 57.180 42.857 0.00 0.00 0.00 3.67
3126 3190 4.929819 TCGATCCGAGATTTGATGGTTA 57.070 40.909 0.00 0.00 0.00 2.85
3127 3191 4.617959 TCGATCCGAGATTTGATGGTTAC 58.382 43.478 0.00 0.00 0.00 2.50
3128 3192 3.741344 CGATCCGAGATTTGATGGTTACC 59.259 47.826 0.00 0.00 0.00 2.85
3129 3193 4.501571 CGATCCGAGATTTGATGGTTACCT 60.502 45.833 2.07 0.00 0.00 3.08
3130 3194 4.837093 TCCGAGATTTGATGGTTACCTT 57.163 40.909 2.07 0.00 0.00 3.50
3131 3195 5.174037 TCCGAGATTTGATGGTTACCTTT 57.826 39.130 2.07 0.00 0.00 3.11
3132 3196 6.302535 TCCGAGATTTGATGGTTACCTTTA 57.697 37.500 2.07 0.00 0.00 1.85
3133 3197 6.110707 TCCGAGATTTGATGGTTACCTTTAC 58.889 40.000 2.07 0.00 0.00 2.01
3134 3198 6.070424 TCCGAGATTTGATGGTTACCTTTACT 60.070 38.462 2.07 0.00 0.00 2.24
3135 3199 6.598064 CCGAGATTTGATGGTTACCTTTACTT 59.402 38.462 2.07 0.00 0.00 2.24
3136 3200 7.201617 CCGAGATTTGATGGTTACCTTTACTTC 60.202 40.741 2.07 0.00 0.00 3.01
3137 3201 7.549488 CGAGATTTGATGGTTACCTTTACTTCT 59.451 37.037 2.07 0.00 0.00 2.85
3138 3202 9.232473 GAGATTTGATGGTTACCTTTACTTCTT 57.768 33.333 2.07 0.00 0.00 2.52
3139 3203 9.588096 AGATTTGATGGTTACCTTTACTTCTTT 57.412 29.630 2.07 0.00 0.00 2.52
3162 3226 3.449746 TTTTGCACCCTATGGTAAGCT 57.550 42.857 0.00 0.00 45.57 3.74
3163 3227 3.449746 TTTGCACCCTATGGTAAGCTT 57.550 42.857 3.48 3.48 45.57 3.74
3164 3228 2.418368 TGCACCCTATGGTAAGCTTG 57.582 50.000 9.86 0.00 45.57 4.01
3165 3229 1.633432 TGCACCCTATGGTAAGCTTGT 59.367 47.619 9.86 0.00 45.57 3.16
3166 3230 2.841266 TGCACCCTATGGTAAGCTTGTA 59.159 45.455 9.86 0.00 45.57 2.41
3167 3231 3.458118 TGCACCCTATGGTAAGCTTGTAT 59.542 43.478 9.86 3.28 45.57 2.29
3168 3232 4.080015 TGCACCCTATGGTAAGCTTGTATT 60.080 41.667 9.86 0.00 45.57 1.89
3169 3233 4.275936 GCACCCTATGGTAAGCTTGTATTG 59.724 45.833 9.86 2.01 45.57 1.90
3170 3234 4.275936 CACCCTATGGTAAGCTTGTATTGC 59.724 45.833 9.86 0.00 45.57 3.56
3171 3235 4.080015 ACCCTATGGTAAGCTTGTATTGCA 60.080 41.667 9.86 0.00 45.45 4.08
3172 3236 4.275936 CCCTATGGTAAGCTTGTATTGCAC 59.724 45.833 9.86 0.00 0.00 4.57
3173 3237 4.275936 CCTATGGTAAGCTTGTATTGCACC 59.724 45.833 9.86 7.31 0.00 5.01
3174 3238 2.442413 TGGTAAGCTTGTATTGCACCC 58.558 47.619 9.86 0.00 0.00 4.61
3175 3239 2.041081 TGGTAAGCTTGTATTGCACCCT 59.959 45.455 9.86 0.00 0.00 4.34
3176 3240 2.683362 GGTAAGCTTGTATTGCACCCTC 59.317 50.000 9.86 0.00 0.00 4.30
3177 3241 1.839424 AAGCTTGTATTGCACCCTCC 58.161 50.000 0.00 0.00 0.00 4.30
3178 3242 0.034089 AGCTTGTATTGCACCCTCCC 60.034 55.000 0.00 0.00 0.00 4.30
3179 3243 0.034089 GCTTGTATTGCACCCTCCCT 60.034 55.000 0.00 0.00 0.00 4.20
3180 3244 2.019156 GCTTGTATTGCACCCTCCCTC 61.019 57.143 0.00 0.00 0.00 4.30
3181 3245 0.623723 TTGTATTGCACCCTCCCTCC 59.376 55.000 0.00 0.00 0.00 4.30
3182 3246 0.548926 TGTATTGCACCCTCCCTCCA 60.549 55.000 0.00 0.00 0.00 3.86
3183 3247 0.623723 GTATTGCACCCTCCCTCCAA 59.376 55.000 0.00 0.00 0.00 3.53
3184 3248 1.005450 GTATTGCACCCTCCCTCCAAA 59.995 52.381 0.00 0.00 0.00 3.28
3185 3249 0.040204 ATTGCACCCTCCCTCCAAAG 59.960 55.000 0.00 0.00 0.00 2.77
3186 3250 1.065410 TTGCACCCTCCCTCCAAAGA 61.065 55.000 0.00 0.00 0.00 2.52
3187 3251 0.846427 TGCACCCTCCCTCCAAAGAT 60.846 55.000 0.00 0.00 0.00 2.40
3188 3252 1.213296 GCACCCTCCCTCCAAAGATA 58.787 55.000 0.00 0.00 0.00 1.98
3189 3253 1.141858 GCACCCTCCCTCCAAAGATAG 59.858 57.143 0.00 0.00 0.00 2.08
3190 3254 1.771255 CACCCTCCCTCCAAAGATAGG 59.229 57.143 0.00 0.00 0.00 2.57
3191 3255 1.657162 ACCCTCCCTCCAAAGATAGGA 59.343 52.381 0.00 0.00 34.58 2.94
3198 3262 1.807814 TCCAAAGATAGGAGGAGGCC 58.192 55.000 0.00 0.00 0.00 5.19
3199 3263 1.295292 TCCAAAGATAGGAGGAGGCCT 59.705 52.381 3.86 3.86 42.15 5.19
3200 3264 1.419387 CCAAAGATAGGAGGAGGCCTG 59.581 57.143 12.00 0.00 39.08 4.85
3201 3265 2.122768 CAAAGATAGGAGGAGGCCTGT 58.877 52.381 12.00 0.00 39.08 4.00
3202 3266 2.095604 AAGATAGGAGGAGGCCTGTC 57.904 55.000 12.00 6.57 44.03 3.51
3203 3267 3.861002 GATAGGAGGAGGCCTGTCT 57.139 57.895 12.00 7.62 41.44 3.41
3204 3268 2.095604 GATAGGAGGAGGCCTGTCTT 57.904 55.000 12.00 5.68 41.44 3.01
3205 3269 2.403561 GATAGGAGGAGGCCTGTCTTT 58.596 52.381 12.00 3.09 41.44 2.52
3206 3270 2.344093 TAGGAGGAGGCCTGTCTTTT 57.656 50.000 12.00 2.72 39.08 2.27
3207 3271 0.988063 AGGAGGAGGCCTGTCTTTTC 59.012 55.000 12.00 0.00 36.76 2.29
3208 3272 0.693049 GGAGGAGGCCTGTCTTTTCA 59.307 55.000 12.00 0.00 31.76 2.69
3209 3273 1.283321 GGAGGAGGCCTGTCTTTTCAT 59.717 52.381 12.00 0.00 31.76 2.57
3210 3274 2.291217 GGAGGAGGCCTGTCTTTTCATT 60.291 50.000 12.00 0.00 31.76 2.57
3211 3275 3.054361 GGAGGAGGCCTGTCTTTTCATTA 60.054 47.826 12.00 0.00 31.76 1.90
3212 3276 4.567747 GGAGGAGGCCTGTCTTTTCATTAA 60.568 45.833 12.00 0.00 31.76 1.40
3213 3277 4.593956 AGGAGGCCTGTCTTTTCATTAAG 58.406 43.478 12.00 0.00 29.57 1.85
3214 3278 3.696548 GGAGGCCTGTCTTTTCATTAAGG 59.303 47.826 12.00 0.00 0.00 2.69
3215 3279 3.696548 GAGGCCTGTCTTTTCATTAAGGG 59.303 47.826 12.00 0.00 0.00 3.95
3216 3280 2.760650 GGCCTGTCTTTTCATTAAGGGG 59.239 50.000 0.00 0.00 0.00 4.79
3217 3281 3.563479 GGCCTGTCTTTTCATTAAGGGGA 60.563 47.826 0.00 0.00 0.00 4.81
3218 3282 4.086457 GCCTGTCTTTTCATTAAGGGGAA 58.914 43.478 0.00 0.00 0.00 3.97
3219 3283 4.526650 GCCTGTCTTTTCATTAAGGGGAAA 59.473 41.667 0.00 0.00 0.00 3.13
3220 3284 5.336770 GCCTGTCTTTTCATTAAGGGGAAAG 60.337 44.000 9.26 9.26 34.77 2.62
3221 3285 6.010219 CCTGTCTTTTCATTAAGGGGAAAGA 58.990 40.000 12.41 12.41 34.77 2.52
3222 3286 6.151817 CCTGTCTTTTCATTAAGGGGAAAGAG 59.848 42.308 15.14 8.38 34.77 2.85
3223 3287 6.610830 TGTCTTTTCATTAAGGGGAAAGAGT 58.389 36.000 15.14 0.00 34.77 3.24
3224 3288 7.066781 TGTCTTTTCATTAAGGGGAAAGAGTT 58.933 34.615 15.14 0.00 34.77 3.01
3225 3289 7.563556 TGTCTTTTCATTAAGGGGAAAGAGTTT 59.436 33.333 15.14 0.00 34.77 2.66
3226 3290 9.074576 GTCTTTTCATTAAGGGGAAAGAGTTTA 57.925 33.333 15.14 0.00 34.77 2.01
3227 3291 9.822727 TCTTTTCATTAAGGGGAAAGAGTTTAT 57.177 29.630 12.41 0.00 34.77 1.40
3237 3301 8.388656 AGGGGAAAGAGTTTATATGTACAAGA 57.611 34.615 0.00 0.00 0.00 3.02
3238 3302 8.832735 AGGGGAAAGAGTTTATATGTACAAGAA 58.167 33.333 0.00 0.00 0.00 2.52
3239 3303 9.457436 GGGGAAAGAGTTTATATGTACAAGAAA 57.543 33.333 0.00 0.00 0.00 2.52
3247 3311 9.355215 AGTTTATATGTACAAGAAACTGTCTCG 57.645 33.333 22.39 0.00 38.55 4.04
3248 3312 9.136952 GTTTATATGTACAAGAAACTGTCTCGT 57.863 33.333 17.07 0.00 34.56 4.18
3249 3313 9.701098 TTTATATGTACAAGAAACTGTCTCGTT 57.299 29.630 0.00 0.00 34.56 3.85
3250 3314 9.701098 TTATATGTACAAGAAACTGTCTCGTTT 57.299 29.630 0.00 0.00 39.63 3.60
3252 3316 9.701098 ATATGTACAAGAAACTGTCTCGTTTAA 57.299 29.630 0.00 0.00 37.24 1.52
3253 3317 7.459394 TGTACAAGAAACTGTCTCGTTTAAG 57.541 36.000 0.00 0.00 37.24 1.85
3254 3318 5.986004 ACAAGAAACTGTCTCGTTTAAGG 57.014 39.130 0.00 0.00 37.24 2.69
3255 3319 4.814771 ACAAGAAACTGTCTCGTTTAAGGG 59.185 41.667 0.00 0.00 37.24 3.95
3256 3320 4.004196 AGAAACTGTCTCGTTTAAGGGG 57.996 45.455 0.00 0.00 37.24 4.79
3257 3321 3.644738 AGAAACTGTCTCGTTTAAGGGGA 59.355 43.478 0.00 0.00 37.24 4.81
3258 3322 4.102054 AGAAACTGTCTCGTTTAAGGGGAA 59.898 41.667 0.00 0.00 37.24 3.97
3259 3323 3.397849 ACTGTCTCGTTTAAGGGGAAC 57.602 47.619 0.00 0.00 0.00 3.62
3260 3324 2.970640 ACTGTCTCGTTTAAGGGGAACT 59.029 45.455 0.00 0.00 0.00 3.01
3261 3325 3.244112 ACTGTCTCGTTTAAGGGGAACTG 60.244 47.826 0.00 0.00 0.00 3.16
3262 3326 2.967201 TGTCTCGTTTAAGGGGAACTGA 59.033 45.455 0.00 0.00 0.00 3.41
3263 3327 3.006537 TGTCTCGTTTAAGGGGAACTGAG 59.993 47.826 0.00 0.00 33.30 3.35
3264 3328 3.257624 GTCTCGTTTAAGGGGAACTGAGA 59.742 47.826 0.00 0.00 35.93 3.27
3265 3329 3.510360 TCTCGTTTAAGGGGAACTGAGAG 59.490 47.826 0.00 0.00 34.72 3.20
3266 3330 2.028385 TCGTTTAAGGGGAACTGAGAGC 60.028 50.000 0.00 0.00 0.00 4.09
3267 3331 2.028020 CGTTTAAGGGGAACTGAGAGCT 60.028 50.000 0.00 0.00 0.00 4.09
3268 3332 3.601435 GTTTAAGGGGAACTGAGAGCTC 58.399 50.000 5.27 5.27 0.00 4.09
3269 3333 1.867363 TAAGGGGAACTGAGAGCTCC 58.133 55.000 10.93 2.40 0.00 4.70
3271 3335 2.896443 GGGAACTGAGAGCTCCCG 59.104 66.667 10.93 1.20 39.59 5.14
3272 3336 2.726351 GGGAACTGAGAGCTCCCGG 61.726 68.421 10.93 6.25 39.59 5.73
3273 3337 2.185608 GAACTGAGAGCTCCCGGC 59.814 66.667 10.93 0.00 42.19 6.13
3274 3338 2.604686 AACTGAGAGCTCCCGGCA 60.605 61.111 10.93 3.06 44.79 5.69
3275 3339 2.172483 GAACTGAGAGCTCCCGGCAA 62.172 60.000 10.93 0.00 44.79 4.52
3276 3340 2.125350 CTGAGAGCTCCCGGCAAC 60.125 66.667 10.93 0.00 44.79 4.17
3277 3341 2.922503 TGAGAGCTCCCGGCAACA 60.923 61.111 10.93 0.00 44.79 3.33
3278 3342 2.249413 CTGAGAGCTCCCGGCAACAT 62.249 60.000 10.93 0.00 44.79 2.71
3279 3343 0.975556 TGAGAGCTCCCGGCAACATA 60.976 55.000 10.93 0.00 44.79 2.29
3280 3344 0.530870 GAGAGCTCCCGGCAACATAC 60.531 60.000 10.93 0.00 44.79 2.39
3281 3345 1.883084 GAGCTCCCGGCAACATACG 60.883 63.158 0.87 0.00 44.79 3.06
3286 3350 3.098555 CCGGCAACATACGGCTTC 58.901 61.111 0.00 0.00 43.96 3.86
3287 3351 1.449601 CCGGCAACATACGGCTTCT 60.450 57.895 0.00 0.00 43.96 2.85
3288 3352 0.179094 CCGGCAACATACGGCTTCTA 60.179 55.000 0.00 0.00 43.96 2.10
3289 3353 1.647346 CGGCAACATACGGCTTCTAA 58.353 50.000 0.00 0.00 0.00 2.10
3290 3354 2.210116 CGGCAACATACGGCTTCTAAT 58.790 47.619 0.00 0.00 0.00 1.73
3291 3355 2.612212 CGGCAACATACGGCTTCTAATT 59.388 45.455 0.00 0.00 0.00 1.40
3292 3356 3.303132 CGGCAACATACGGCTTCTAATTC 60.303 47.826 0.00 0.00 0.00 2.17
3293 3357 3.877508 GGCAACATACGGCTTCTAATTCT 59.122 43.478 0.00 0.00 0.00 2.40
3294 3358 5.054477 GGCAACATACGGCTTCTAATTCTA 58.946 41.667 0.00 0.00 0.00 2.10
3295 3359 5.177696 GGCAACATACGGCTTCTAATTCTAG 59.822 44.000 0.00 0.00 0.00 2.43
3296 3360 5.753921 GCAACATACGGCTTCTAATTCTAGT 59.246 40.000 0.00 0.00 0.00 2.57
3297 3361 6.258068 GCAACATACGGCTTCTAATTCTAGTT 59.742 38.462 0.00 0.00 0.00 2.24
3298 3362 7.437267 GCAACATACGGCTTCTAATTCTAGTTA 59.563 37.037 0.00 0.00 0.00 2.24
3299 3363 9.477484 CAACATACGGCTTCTAATTCTAGTTAT 57.523 33.333 0.00 0.00 0.00 1.89
3300 3364 9.477484 AACATACGGCTTCTAATTCTAGTTATG 57.523 33.333 0.00 0.00 0.00 1.90
3301 3365 7.599245 ACATACGGCTTCTAATTCTAGTTATGC 59.401 37.037 0.00 0.00 0.00 3.14
3302 3366 6.163135 ACGGCTTCTAATTCTAGTTATGCT 57.837 37.500 0.00 0.00 0.00 3.79
3303 3367 6.583562 ACGGCTTCTAATTCTAGTTATGCTT 58.416 36.000 0.00 0.00 0.00 3.91
3304 3368 6.702282 ACGGCTTCTAATTCTAGTTATGCTTC 59.298 38.462 0.00 0.00 0.00 3.86
3305 3369 6.926272 CGGCTTCTAATTCTAGTTATGCTTCT 59.074 38.462 0.00 0.00 0.00 2.85
3306 3370 7.439655 CGGCTTCTAATTCTAGTTATGCTTCTT 59.560 37.037 0.00 0.00 0.00 2.52
3307 3371 8.769891 GGCTTCTAATTCTAGTTATGCTTCTTC 58.230 37.037 0.00 0.00 0.00 2.87
3308 3372 9.319143 GCTTCTAATTCTAGTTATGCTTCTTCA 57.681 33.333 0.00 0.00 0.00 3.02
3325 3389 9.383519 TGCTTCTTCAGAATAATAGTTAAGGTG 57.616 33.333 0.00 0.00 33.01 4.00
3326 3390 9.384764 GCTTCTTCAGAATAATAGTTAAGGTGT 57.615 33.333 0.00 0.00 33.01 4.16
3332 3396 9.653287 TCAGAATAATAGTTAAGGTGTGTTGAG 57.347 33.333 0.00 0.00 0.00 3.02
3333 3397 9.436957 CAGAATAATAGTTAAGGTGTGTTGAGT 57.563 33.333 0.00 0.00 0.00 3.41
3342 3406 9.623000 AGTTAAGGTGTGTTGAGTAATTTAGTT 57.377 29.630 0.00 0.00 0.00 2.24
3343 3407 9.659830 GTTAAGGTGTGTTGAGTAATTTAGTTG 57.340 33.333 0.00 0.00 0.00 3.16
3344 3408 9.616156 TTAAGGTGTGTTGAGTAATTTAGTTGA 57.384 29.630 0.00 0.00 0.00 3.18
3345 3409 7.730364 AGGTGTGTTGAGTAATTTAGTTGAG 57.270 36.000 0.00 0.00 0.00 3.02
3346 3410 7.280356 AGGTGTGTTGAGTAATTTAGTTGAGT 58.720 34.615 0.00 0.00 0.00 3.41
3347 3411 7.773690 AGGTGTGTTGAGTAATTTAGTTGAGTT 59.226 33.333 0.00 0.00 0.00 3.01
3348 3412 8.068380 GGTGTGTTGAGTAATTTAGTTGAGTTC 58.932 37.037 0.00 0.00 0.00 3.01
3349 3413 8.609176 GTGTGTTGAGTAATTTAGTTGAGTTCA 58.391 33.333 0.00 0.00 0.00 3.18
3350 3414 9.337396 TGTGTTGAGTAATTTAGTTGAGTTCAT 57.663 29.630 0.00 0.00 0.00 2.57
3351 3415 9.599322 GTGTTGAGTAATTTAGTTGAGTTCATG 57.401 33.333 0.00 0.00 0.00 3.07
3352 3416 8.289618 TGTTGAGTAATTTAGTTGAGTTCATGC 58.710 33.333 0.00 0.00 0.00 4.06
3353 3417 7.977789 TGAGTAATTTAGTTGAGTTCATGCA 57.022 32.000 0.00 0.00 0.00 3.96
3354 3418 8.565896 TGAGTAATTTAGTTGAGTTCATGCAT 57.434 30.769 0.00 0.00 0.00 3.96
3355 3419 8.453320 TGAGTAATTTAGTTGAGTTCATGCATG 58.547 33.333 21.07 21.07 0.00 4.06
3356 3420 7.253422 AGTAATTTAGTTGAGTTCATGCATGC 58.747 34.615 22.25 11.82 0.00 4.06
3357 3421 5.648178 ATTTAGTTGAGTTCATGCATGCA 57.352 34.783 25.04 25.04 0.00 3.96
3358 3422 5.648178 TTTAGTTGAGTTCATGCATGCAT 57.352 34.783 27.46 27.46 37.08 3.96
3389 3453 8.885693 AAAAACCTTAAGATCCAAGCTATTCT 57.114 30.769 3.36 0.00 0.00 2.40
3390 3454 8.885693 AAAACCTTAAGATCCAAGCTATTCTT 57.114 30.769 3.36 0.00 34.78 2.52
3391 3455 8.885693 AAACCTTAAGATCCAAGCTATTCTTT 57.114 30.769 3.36 0.00 31.27 2.52
3392 3456 7.872113 ACCTTAAGATCCAAGCTATTCTTTG 57.128 36.000 3.36 0.00 31.27 2.77
3393 3457 6.319911 ACCTTAAGATCCAAGCTATTCTTTGC 59.680 38.462 3.36 0.00 31.27 3.68
3394 3458 4.889832 AAGATCCAAGCTATTCTTTGCG 57.110 40.909 0.00 0.00 31.27 4.85
3395 3459 2.615912 AGATCCAAGCTATTCTTTGCGC 59.384 45.455 0.00 0.00 31.27 6.09
3396 3460 1.094785 TCCAAGCTATTCTTTGCGCC 58.905 50.000 4.18 0.00 31.27 6.53
3397 3461 1.098050 CCAAGCTATTCTTTGCGCCT 58.902 50.000 4.18 0.00 31.27 5.52
3398 3462 1.474077 CCAAGCTATTCTTTGCGCCTT 59.526 47.619 4.18 0.00 31.27 4.35
3399 3463 2.523015 CAAGCTATTCTTTGCGCCTTG 58.477 47.619 4.18 3.74 31.27 3.61
3400 3464 1.826385 AGCTATTCTTTGCGCCTTGT 58.174 45.000 4.18 0.00 0.00 3.16
3401 3465 1.470098 AGCTATTCTTTGCGCCTTGTG 59.530 47.619 4.18 0.00 0.00 3.33
3402 3466 1.468054 GCTATTCTTTGCGCCTTGTGG 60.468 52.381 4.18 0.00 0.00 4.17
3403 3467 2.083774 CTATTCTTTGCGCCTTGTGGA 58.916 47.619 4.18 0.00 34.57 4.02
3404 3468 1.549203 ATTCTTTGCGCCTTGTGGAT 58.451 45.000 4.18 0.00 34.57 3.41
3405 3469 0.597568 TTCTTTGCGCCTTGTGGATG 59.402 50.000 4.18 0.00 34.57 3.51
3406 3470 0.250684 TCTTTGCGCCTTGTGGATGA 60.251 50.000 4.18 0.00 34.57 2.92
3407 3471 0.597568 CTTTGCGCCTTGTGGATGAA 59.402 50.000 4.18 0.00 34.57 2.57
3408 3472 0.597568 TTTGCGCCTTGTGGATGAAG 59.402 50.000 4.18 0.00 34.57 3.02
3409 3473 0.537143 TTGCGCCTTGTGGATGAAGT 60.537 50.000 4.18 0.00 34.57 3.01
3410 3474 0.323302 TGCGCCTTGTGGATGAAGTA 59.677 50.000 4.18 0.00 34.57 2.24
3411 3475 1.271108 TGCGCCTTGTGGATGAAGTAA 60.271 47.619 4.18 0.00 34.57 2.24
3412 3476 1.810151 GCGCCTTGTGGATGAAGTAAA 59.190 47.619 0.00 0.00 34.57 2.01
3413 3477 2.227865 GCGCCTTGTGGATGAAGTAAAA 59.772 45.455 0.00 0.00 34.57 1.52
3414 3478 3.119495 GCGCCTTGTGGATGAAGTAAAAT 60.119 43.478 0.00 0.00 34.57 1.82
3415 3479 4.414852 CGCCTTGTGGATGAAGTAAAATG 58.585 43.478 0.00 0.00 34.57 2.32
3416 3480 4.155826 CGCCTTGTGGATGAAGTAAAATGA 59.844 41.667 0.00 0.00 34.57 2.57
3417 3481 5.163622 CGCCTTGTGGATGAAGTAAAATGAT 60.164 40.000 0.00 0.00 34.57 2.45
3418 3482 6.268566 GCCTTGTGGATGAAGTAAAATGATC 58.731 40.000 0.00 0.00 34.57 2.92
3419 3483 6.681368 GCCTTGTGGATGAAGTAAAATGATCC 60.681 42.308 0.00 0.00 34.31 3.36
3420 3484 6.435430 TTGTGGATGAAGTAAAATGATCCG 57.565 37.500 0.00 0.00 36.18 4.18
3421 3485 4.335315 TGTGGATGAAGTAAAATGATCCGC 59.665 41.667 0.00 0.00 41.93 5.54
3422 3486 4.335315 GTGGATGAAGTAAAATGATCCGCA 59.665 41.667 0.00 0.00 41.44 5.69
3423 3487 4.576053 TGGATGAAGTAAAATGATCCGCAG 59.424 41.667 0.00 0.00 36.18 5.18
3424 3488 4.576463 GGATGAAGTAAAATGATCCGCAGT 59.424 41.667 0.00 0.00 0.00 4.40
3425 3489 5.066505 GGATGAAGTAAAATGATCCGCAGTT 59.933 40.000 0.00 0.00 36.14 3.16
3426 3490 5.295431 TGAAGTAAAATGATCCGCAGTTG 57.705 39.130 0.00 0.00 34.60 3.16
3427 3491 3.764885 AGTAAAATGATCCGCAGTTGC 57.235 42.857 0.00 0.00 34.60 4.17
3437 3501 4.294523 GCAGTTGCGTACCATGGA 57.705 55.556 21.47 0.00 0.00 3.41
3438 3502 2.089854 GCAGTTGCGTACCATGGAG 58.910 57.895 21.47 10.47 0.00 3.86
3439 3503 0.673644 GCAGTTGCGTACCATGGAGT 60.674 55.000 21.47 0.00 0.00 3.85
3440 3504 1.404986 GCAGTTGCGTACCATGGAGTA 60.405 52.381 21.47 6.02 0.00 2.59
3441 3505 2.268298 CAGTTGCGTACCATGGAGTAC 58.732 52.381 21.47 10.67 39.41 2.73
3442 3506 1.897133 AGTTGCGTACCATGGAGTACA 59.103 47.619 21.47 8.48 42.29 2.90
3443 3507 2.094182 AGTTGCGTACCATGGAGTACAG 60.094 50.000 21.47 8.98 42.29 2.74
3444 3508 0.821517 TGCGTACCATGGAGTACAGG 59.178 55.000 21.47 4.75 42.29 4.00
3445 3509 0.529992 GCGTACCATGGAGTACAGGC 60.530 60.000 21.47 10.78 42.29 4.85
3446 3510 0.248907 CGTACCATGGAGTACAGGCG 60.249 60.000 21.47 6.68 42.29 5.52
3447 3511 1.108776 GTACCATGGAGTACAGGCGA 58.891 55.000 21.47 0.00 41.87 5.54
3448 3512 1.479323 GTACCATGGAGTACAGGCGAA 59.521 52.381 21.47 0.00 41.87 4.70
3449 3513 0.249398 ACCATGGAGTACAGGCGAAC 59.751 55.000 21.47 0.00 0.00 3.95
3450 3514 0.249120 CCATGGAGTACAGGCGAACA 59.751 55.000 5.56 0.00 0.00 3.18
3451 3515 1.338674 CCATGGAGTACAGGCGAACAA 60.339 52.381 5.56 0.00 0.00 2.83
3452 3516 2.632377 CATGGAGTACAGGCGAACAAT 58.368 47.619 0.00 0.00 0.00 2.71
3453 3517 2.851263 TGGAGTACAGGCGAACAATT 57.149 45.000 0.00 0.00 0.00 2.32
3454 3518 3.134574 TGGAGTACAGGCGAACAATTT 57.865 42.857 0.00 0.00 0.00 1.82
3455 3519 4.274602 TGGAGTACAGGCGAACAATTTA 57.725 40.909 0.00 0.00 0.00 1.40
3456 3520 4.643463 TGGAGTACAGGCGAACAATTTAA 58.357 39.130 0.00 0.00 0.00 1.52
3457 3521 5.064558 TGGAGTACAGGCGAACAATTTAAA 58.935 37.500 0.00 0.00 0.00 1.52
3458 3522 5.049267 TGGAGTACAGGCGAACAATTTAAAC 60.049 40.000 0.00 0.00 0.00 2.01
3459 3523 5.180680 GGAGTACAGGCGAACAATTTAAACT 59.819 40.000 0.00 0.00 0.00 2.66
3460 3524 6.237313 AGTACAGGCGAACAATTTAAACTC 57.763 37.500 0.00 0.00 0.00 3.01
3461 3525 5.761234 AGTACAGGCGAACAATTTAAACTCA 59.239 36.000 0.00 0.00 0.00 3.41
3462 3526 5.108385 ACAGGCGAACAATTTAAACTCAG 57.892 39.130 0.00 0.00 0.00 3.35
3463 3527 4.819630 ACAGGCGAACAATTTAAACTCAGA 59.180 37.500 0.00 0.00 0.00 3.27
3464 3528 5.298276 ACAGGCGAACAATTTAAACTCAGAA 59.702 36.000 0.00 0.00 0.00 3.02
3465 3529 5.853282 CAGGCGAACAATTTAAACTCAGAAG 59.147 40.000 0.00 0.00 0.00 2.85
3466 3530 5.048713 AGGCGAACAATTTAAACTCAGAAGG 60.049 40.000 0.00 0.00 0.00 3.46
3467 3531 5.278315 GGCGAACAATTTAAACTCAGAAGGT 60.278 40.000 0.00 0.00 0.00 3.50
3468 3532 6.206498 GCGAACAATTTAAACTCAGAAGGTT 58.794 36.000 0.00 0.00 36.14 3.50
3469 3533 6.695713 GCGAACAATTTAAACTCAGAAGGTTT 59.304 34.615 0.00 0.00 39.70 3.27
3470 3534 7.096599 GCGAACAATTTAAACTCAGAAGGTTTC 60.097 37.037 0.00 0.00 37.88 2.78
3471 3535 7.378728 CGAACAATTTAAACTCAGAAGGTTTCC 59.621 37.037 0.00 0.00 37.88 3.13
3472 3536 7.898014 ACAATTTAAACTCAGAAGGTTTCCT 57.102 32.000 0.00 0.00 37.88 3.36
3473 3537 7.941919 ACAATTTAAACTCAGAAGGTTTCCTC 58.058 34.615 0.00 0.00 37.88 3.71
3474 3538 7.559897 ACAATTTAAACTCAGAAGGTTTCCTCA 59.440 33.333 0.00 0.00 37.88 3.86
3475 3539 6.937436 TTTAAACTCAGAAGGTTTCCTCAC 57.063 37.500 0.00 0.00 37.88 3.51
3476 3540 4.503714 AAACTCAGAAGGTTTCCTCACA 57.496 40.909 0.00 0.00 32.26 3.58
3477 3541 4.713792 AACTCAGAAGGTTTCCTCACAT 57.286 40.909 0.00 0.00 30.89 3.21
3478 3542 5.825593 AACTCAGAAGGTTTCCTCACATA 57.174 39.130 0.00 0.00 30.89 2.29
3479 3543 5.825593 ACTCAGAAGGTTTCCTCACATAA 57.174 39.130 0.00 0.00 30.89 1.90
3480 3544 6.187727 ACTCAGAAGGTTTCCTCACATAAA 57.812 37.500 0.00 0.00 30.89 1.40
3481 3545 5.998363 ACTCAGAAGGTTTCCTCACATAAAC 59.002 40.000 0.00 0.00 35.34 2.01
3482 3546 6.183361 ACTCAGAAGGTTTCCTCACATAAACT 60.183 38.462 0.00 0.00 36.17 2.66
3483 3547 5.997746 TCAGAAGGTTTCCTCACATAAACTG 59.002 40.000 0.00 0.00 36.17 3.16
3484 3548 5.182001 CAGAAGGTTTCCTCACATAAACTGG 59.818 44.000 0.00 0.00 36.17 4.00
3485 3549 3.421844 AGGTTTCCTCACATAAACTGGC 58.578 45.455 0.00 0.00 36.17 4.85
3486 3550 3.074538 AGGTTTCCTCACATAAACTGGCT 59.925 43.478 0.00 0.00 36.17 4.75
3487 3551 3.191371 GGTTTCCTCACATAAACTGGCTG 59.809 47.826 0.00 0.00 36.17 4.85
3488 3552 4.072131 GTTTCCTCACATAAACTGGCTGA 58.928 43.478 0.00 0.00 33.71 4.26
3489 3553 4.574674 TTCCTCACATAAACTGGCTGAT 57.425 40.909 0.00 0.00 0.00 2.90
3490 3554 4.574674 TCCTCACATAAACTGGCTGATT 57.425 40.909 0.00 0.00 0.00 2.57
3491 3555 4.517285 TCCTCACATAAACTGGCTGATTC 58.483 43.478 0.00 0.00 0.00 2.52
3492 3556 4.225942 TCCTCACATAAACTGGCTGATTCT 59.774 41.667 0.00 0.00 0.00 2.40
3493 3557 5.425217 TCCTCACATAAACTGGCTGATTCTA 59.575 40.000 0.00 0.00 0.00 2.10
3494 3558 6.100279 TCCTCACATAAACTGGCTGATTCTAT 59.900 38.462 0.00 0.00 0.00 1.98
3495 3559 6.769822 CCTCACATAAACTGGCTGATTCTATT 59.230 38.462 0.00 0.00 0.00 1.73
3496 3560 7.255035 CCTCACATAAACTGGCTGATTCTATTG 60.255 40.741 0.00 0.00 0.00 1.90
3497 3561 6.038603 TCACATAAACTGGCTGATTCTATTGC 59.961 38.462 0.00 0.00 0.00 3.56
3498 3562 5.300286 ACATAAACTGGCTGATTCTATTGCC 59.700 40.000 0.00 0.00 45.10 4.52
3499 3563 2.355010 ACTGGCTGATTCTATTGCCC 57.645 50.000 0.00 0.00 44.32 5.36
3500 3564 1.565759 ACTGGCTGATTCTATTGCCCA 59.434 47.619 0.00 0.00 44.32 5.36
3501 3565 2.176364 ACTGGCTGATTCTATTGCCCAT 59.824 45.455 0.00 0.00 44.32 4.00
3502 3566 2.818432 CTGGCTGATTCTATTGCCCATC 59.182 50.000 0.00 0.00 44.32 3.51
3503 3567 2.175284 TGGCTGATTCTATTGCCCATCA 59.825 45.455 0.00 0.00 44.32 3.07
3504 3568 2.555757 GGCTGATTCTATTGCCCATCAC 59.444 50.000 0.00 0.00 39.49 3.06
3505 3569 3.216800 GCTGATTCTATTGCCCATCACA 58.783 45.455 0.00 0.00 0.00 3.58
3506 3570 3.633525 GCTGATTCTATTGCCCATCACAA 59.366 43.478 0.00 0.00 0.00 3.33
3507 3571 4.280174 GCTGATTCTATTGCCCATCACAAT 59.720 41.667 0.00 0.00 40.68 2.71
3508 3572 5.769367 CTGATTCTATTGCCCATCACAATG 58.231 41.667 0.00 0.00 38.20 2.82
3509 3573 4.038282 TGATTCTATTGCCCATCACAATGC 59.962 41.667 0.00 0.00 38.20 3.56
3510 3574 3.015675 TCTATTGCCCATCACAATGCA 57.984 42.857 0.00 0.00 38.20 3.96
3511 3575 2.953648 TCTATTGCCCATCACAATGCAG 59.046 45.455 0.00 0.00 38.20 4.41
3512 3576 0.828022 ATTGCCCATCACAATGCAGG 59.172 50.000 0.00 0.00 36.41 4.85
3513 3577 1.259142 TTGCCCATCACAATGCAGGG 61.259 55.000 0.55 0.55 42.55 4.45
3514 3578 1.380246 GCCCATCACAATGCAGGGA 60.380 57.895 9.05 0.00 42.25 4.20
3515 3579 0.971959 GCCCATCACAATGCAGGGAA 60.972 55.000 9.05 0.00 42.25 3.97
3516 3580 1.108776 CCCATCACAATGCAGGGAAG 58.891 55.000 0.00 0.00 42.25 3.46
3517 3581 1.617804 CCCATCACAATGCAGGGAAGT 60.618 52.381 0.00 0.00 42.25 3.01
3518 3582 1.475280 CCATCACAATGCAGGGAAGTG 59.525 52.381 0.00 0.00 0.00 3.16
3519 3583 2.165167 CATCACAATGCAGGGAAGTGT 58.835 47.619 0.00 0.00 0.00 3.55
3520 3584 2.363306 TCACAATGCAGGGAAGTGTT 57.637 45.000 0.00 0.00 0.00 3.32
3521 3585 2.229792 TCACAATGCAGGGAAGTGTTC 58.770 47.619 0.00 0.00 0.00 3.18
3522 3586 1.069022 CACAATGCAGGGAAGTGTTCG 60.069 52.381 0.00 0.00 0.00 3.95
3523 3587 1.238439 CAATGCAGGGAAGTGTTCGT 58.762 50.000 0.00 0.00 0.00 3.85
3524 3588 2.224426 ACAATGCAGGGAAGTGTTCGTA 60.224 45.455 0.00 0.00 0.00 3.43
3525 3589 2.094762 ATGCAGGGAAGTGTTCGTAC 57.905 50.000 0.00 0.00 0.00 3.67
3526 3590 0.753867 TGCAGGGAAGTGTTCGTACA 59.246 50.000 0.00 0.00 0.00 2.90
3527 3591 1.346395 TGCAGGGAAGTGTTCGTACAT 59.654 47.619 0.00 0.00 36.50 2.29
3528 3592 2.224426 TGCAGGGAAGTGTTCGTACATT 60.224 45.455 0.00 0.00 36.50 2.71
3529 3593 2.159627 GCAGGGAAGTGTTCGTACATTG 59.840 50.000 0.00 0.00 36.50 2.82
3530 3594 2.742053 CAGGGAAGTGTTCGTACATTGG 59.258 50.000 0.00 0.00 36.50 3.16
3531 3595 2.081462 GGGAAGTGTTCGTACATTGGG 58.919 52.381 0.00 0.00 36.50 4.12
3532 3596 2.289819 GGGAAGTGTTCGTACATTGGGA 60.290 50.000 0.00 0.00 36.50 4.37
3533 3597 3.404899 GGAAGTGTTCGTACATTGGGAA 58.595 45.455 0.00 0.00 36.50 3.97
3534 3598 3.187842 GGAAGTGTTCGTACATTGGGAAC 59.812 47.826 0.00 9.30 40.26 3.62
3535 3599 2.774687 AGTGTTCGTACATTGGGAACC 58.225 47.619 0.00 0.00 43.17 3.62
3561 3625 5.924475 TCGGAAGAACTTTAAGCTCAAAG 57.076 39.130 7.87 7.87 37.05 2.77
3562 3626 4.755123 TCGGAAGAACTTTAAGCTCAAAGG 59.245 41.667 13.97 2.11 36.07 3.11
3563 3627 4.083271 CGGAAGAACTTTAAGCTCAAAGGG 60.083 45.833 13.97 0.00 39.39 3.95
3564 3628 4.321304 GGAAGAACTTTAAGCTCAAAGGGC 60.321 45.833 13.97 5.12 39.39 5.19
3565 3629 3.832527 AGAACTTTAAGCTCAAAGGGCA 58.167 40.909 13.97 0.00 39.39 5.36
3566 3630 4.411013 AGAACTTTAAGCTCAAAGGGCAT 58.589 39.130 13.97 0.00 39.39 4.40
3567 3631 5.570320 AGAACTTTAAGCTCAAAGGGCATA 58.430 37.500 13.97 0.00 39.39 3.14
3568 3632 5.649831 AGAACTTTAAGCTCAAAGGGCATAG 59.350 40.000 13.97 0.00 39.39 2.23
3569 3633 5.179452 ACTTTAAGCTCAAAGGGCATAGA 57.821 39.130 13.97 0.00 39.39 1.98
3570 3634 5.760131 ACTTTAAGCTCAAAGGGCATAGAT 58.240 37.500 13.97 0.00 39.39 1.98
3571 3635 6.900194 ACTTTAAGCTCAAAGGGCATAGATA 58.100 36.000 13.97 0.00 39.39 1.98
3572 3636 7.346471 ACTTTAAGCTCAAAGGGCATAGATAA 58.654 34.615 13.97 0.00 39.39 1.75
3573 3637 7.834181 ACTTTAAGCTCAAAGGGCATAGATAAA 59.166 33.333 13.97 0.00 39.39 1.40
3574 3638 8.588290 TTTAAGCTCAAAGGGCATAGATAAAA 57.412 30.769 0.00 0.00 0.00 1.52
3575 3639 8.588290 TTAAGCTCAAAGGGCATAGATAAAAA 57.412 30.769 0.00 0.00 0.00 1.94
3576 3640 6.456795 AGCTCAAAGGGCATAGATAAAAAC 57.543 37.500 0.00 0.00 0.00 2.43
3577 3641 5.951747 AGCTCAAAGGGCATAGATAAAAACA 59.048 36.000 0.00 0.00 0.00 2.83
3578 3642 6.608808 AGCTCAAAGGGCATAGATAAAAACAT 59.391 34.615 0.00 0.00 0.00 2.71
3579 3643 7.124750 AGCTCAAAGGGCATAGATAAAAACATT 59.875 33.333 0.00 0.00 0.00 2.71
3580 3644 7.765819 GCTCAAAGGGCATAGATAAAAACATTT 59.234 33.333 0.00 0.00 0.00 2.32
3581 3645 9.305925 CTCAAAGGGCATAGATAAAAACATTTC 57.694 33.333 0.00 0.00 0.00 2.17
3582 3646 8.257306 TCAAAGGGCATAGATAAAAACATTTCC 58.743 33.333 0.00 0.00 0.00 3.13
3583 3647 7.732222 AAGGGCATAGATAAAAACATTTCCA 57.268 32.000 0.00 0.00 0.00 3.53
3584 3648 7.919385 AGGGCATAGATAAAAACATTTCCAT 57.081 32.000 0.00 0.00 0.00 3.41
3585 3649 9.432982 AAGGGCATAGATAAAAACATTTCCATA 57.567 29.630 0.00 0.00 0.00 2.74
3586 3650 9.082313 AGGGCATAGATAAAAACATTTCCATAG 57.918 33.333 0.00 0.00 0.00 2.23
3587 3651 8.860088 GGGCATAGATAAAAACATTTCCATAGT 58.140 33.333 0.00 0.00 0.00 2.12
3605 3669 8.607441 TCCATAGTTCATAGATCAAATTTCGG 57.393 34.615 0.00 0.00 0.00 4.30
3606 3670 8.428852 TCCATAGTTCATAGATCAAATTTCGGA 58.571 33.333 0.00 0.00 0.00 4.55
3607 3671 9.056005 CCATAGTTCATAGATCAAATTTCGGAA 57.944 33.333 0.00 0.00 0.00 4.30
3609 3673 7.020914 AGTTCATAGATCAAATTTCGGAAGC 57.979 36.000 0.00 0.00 0.00 3.86
3610 3674 6.825721 AGTTCATAGATCAAATTTCGGAAGCT 59.174 34.615 0.00 0.00 0.00 3.74
3611 3675 7.987458 AGTTCATAGATCAAATTTCGGAAGCTA 59.013 33.333 0.00 0.00 0.00 3.32
3612 3676 7.715265 TCATAGATCAAATTTCGGAAGCTAC 57.285 36.000 0.00 0.00 0.00 3.58
3613 3677 7.272244 TCATAGATCAAATTTCGGAAGCTACA 58.728 34.615 0.00 0.00 0.00 2.74
3614 3678 7.768582 TCATAGATCAAATTTCGGAAGCTACAA 59.231 33.333 0.00 0.00 0.00 2.41
3615 3679 6.183309 AGATCAAATTTCGGAAGCTACAAC 57.817 37.500 0.00 0.00 0.00 3.32
3616 3680 5.705441 AGATCAAATTTCGGAAGCTACAACA 59.295 36.000 0.00 0.00 0.00 3.33
3617 3681 5.103290 TCAAATTTCGGAAGCTACAACAC 57.897 39.130 0.00 0.00 0.00 3.32
3618 3682 4.576873 TCAAATTTCGGAAGCTACAACACA 59.423 37.500 0.00 0.00 0.00 3.72
3619 3683 4.483476 AATTTCGGAAGCTACAACACAC 57.517 40.909 0.00 0.00 0.00 3.82
3620 3684 2.605837 TTCGGAAGCTACAACACACA 57.394 45.000 0.00 0.00 0.00 3.72
3621 3685 2.831685 TCGGAAGCTACAACACACAT 57.168 45.000 0.00 0.00 0.00 3.21
3622 3686 3.120321 TCGGAAGCTACAACACACATT 57.880 42.857 0.00 0.00 0.00 2.71
3623 3687 2.805671 TCGGAAGCTACAACACACATTG 59.194 45.455 0.00 0.00 35.59 2.82
3624 3688 2.548057 CGGAAGCTACAACACACATTGT 59.452 45.455 0.00 0.00 44.87 2.71
3626 3690 4.537015 GGAAGCTACAACACACATTGTTC 58.463 43.478 0.00 0.00 46.05 3.18
3627 3691 4.036262 GGAAGCTACAACACACATTGTTCA 59.964 41.667 0.00 0.00 46.05 3.18
3628 3692 5.278463 GGAAGCTACAACACACATTGTTCAT 60.278 40.000 0.00 0.00 46.05 2.57
3629 3693 6.072728 GGAAGCTACAACACACATTGTTCATA 60.073 38.462 0.00 0.00 46.05 2.15
3630 3694 6.486253 AGCTACAACACACATTGTTCATAG 57.514 37.500 0.00 0.00 46.05 2.23
3631 3695 6.230472 AGCTACAACACACATTGTTCATAGA 58.770 36.000 0.00 0.00 46.05 1.98
3632 3696 6.881065 AGCTACAACACACATTGTTCATAGAT 59.119 34.615 0.00 1.64 46.05 1.98
3633 3697 7.065085 AGCTACAACACACATTGTTCATAGATC 59.935 37.037 0.00 0.00 46.05 2.75
3634 3698 7.148423 GCTACAACACACATTGTTCATAGATCA 60.148 37.037 0.00 0.00 46.05 2.92
3635 3699 7.509141 ACAACACACATTGTTCATAGATCAA 57.491 32.000 0.00 0.00 46.05 2.57
3636 3700 7.939782 ACAACACACATTGTTCATAGATCAAA 58.060 30.769 0.00 0.00 46.05 2.69
3637 3701 8.579006 ACAACACACATTGTTCATAGATCAAAT 58.421 29.630 0.00 0.00 46.05 2.32
3638 3702 9.414295 CAACACACATTGTTCATAGATCAAATT 57.586 29.630 0.00 0.00 46.05 1.82
3639 3703 9.985730 AACACACATTGTTCATAGATCAAATTT 57.014 25.926 0.00 0.00 46.05 1.82
3640 3704 9.985730 ACACACATTGTTCATAGATCAAATTTT 57.014 25.926 0.00 0.00 33.09 1.82
3646 3710 8.894409 TTGTTCATAGATCAAATTTTAGTGCG 57.106 30.769 0.00 0.00 0.00 5.34
3647 3711 8.262715 TGTTCATAGATCAAATTTTAGTGCGA 57.737 30.769 0.00 0.00 0.00 5.10
3648 3712 8.892723 TGTTCATAGATCAAATTTTAGTGCGAT 58.107 29.630 0.00 0.00 0.00 4.58
3652 3716 9.680946 CATAGATCAAATTTTAGTGCGATATCG 57.319 33.333 20.79 20.79 43.27 2.92
3653 3717 7.946655 AGATCAAATTTTAGTGCGATATCGA 57.053 32.000 28.63 10.90 43.02 3.59
3654 3718 8.365399 AGATCAAATTTTAGTGCGATATCGAA 57.635 30.769 28.63 16.48 43.02 3.71
3655 3719 8.826710 AGATCAAATTTTAGTGCGATATCGAAA 58.173 29.630 28.63 18.35 43.02 3.46
3656 3720 8.767944 ATCAAATTTTAGTGCGATATCGAAAC 57.232 30.769 28.63 22.78 43.02 2.78
3657 3721 7.744059 TCAAATTTTAGTGCGATATCGAAACA 58.256 30.769 28.63 14.04 43.02 2.83
3658 3722 8.394877 TCAAATTTTAGTGCGATATCGAAACAT 58.605 29.630 28.63 15.57 43.02 2.71
3659 3723 9.009327 CAAATTTTAGTGCGATATCGAAACATT 57.991 29.630 28.63 15.25 43.02 2.71
3660 3724 9.567848 AAATTTTAGTGCGATATCGAAACATTT 57.432 25.926 28.63 19.64 43.02 2.32
3661 3725 9.567848 AATTTTAGTGCGATATCGAAACATTTT 57.432 25.926 28.63 11.49 43.02 1.82
3662 3726 7.946918 TTTAGTGCGATATCGAAACATTTTG 57.053 32.000 28.63 0.00 43.02 2.44
3663 3727 4.908736 AGTGCGATATCGAAACATTTTGG 58.091 39.130 28.63 0.00 43.02 3.28
3664 3728 4.634004 AGTGCGATATCGAAACATTTTGGA 59.366 37.500 28.63 0.00 43.02 3.53
3665 3729 5.123186 AGTGCGATATCGAAACATTTTGGAA 59.877 36.000 28.63 0.00 43.02 3.53
3666 3730 5.452302 GTGCGATATCGAAACATTTTGGAAG 59.548 40.000 28.63 0.00 43.02 3.46
3667 3731 5.352846 TGCGATATCGAAACATTTTGGAAGA 59.647 36.000 28.63 0.00 43.02 2.87
3668 3732 5.904080 GCGATATCGAAACATTTTGGAAGAG 59.096 40.000 28.63 0.00 43.02 2.85
3669 3733 6.238103 GCGATATCGAAACATTTTGGAAGAGA 60.238 38.462 28.63 0.00 43.02 3.10
3670 3734 7.519008 GCGATATCGAAACATTTTGGAAGAGAT 60.519 37.037 28.63 0.00 43.02 2.75
3671 3735 8.338259 CGATATCGAAACATTTTGGAAGAGATT 58.662 33.333 20.50 0.00 43.02 2.40
3675 3739 9.846248 ATCGAAACATTTTGGAAGAGATTTAAG 57.154 29.630 0.00 0.00 0.00 1.85
3676 3740 7.807907 TCGAAACATTTTGGAAGAGATTTAAGC 59.192 33.333 0.00 0.00 0.00 3.09
3677 3741 7.809806 CGAAACATTTTGGAAGAGATTTAAGCT 59.190 33.333 0.00 0.00 0.00 3.74
3678 3742 9.133627 GAAACATTTTGGAAGAGATTTAAGCTC 57.866 33.333 1.52 1.52 0.00 4.09
3679 3743 7.765695 ACATTTTGGAAGAGATTTAAGCTCA 57.234 32.000 12.86 0.00 34.85 4.26
3680 3744 8.181904 ACATTTTGGAAGAGATTTAAGCTCAA 57.818 30.769 12.86 0.00 34.85 3.02
3681 3745 8.641541 ACATTTTGGAAGAGATTTAAGCTCAAA 58.358 29.630 12.86 4.35 34.85 2.69
3682 3746 9.136952 CATTTTGGAAGAGATTTAAGCTCAAAG 57.863 33.333 12.86 0.00 34.85 2.77
3683 3747 6.824305 TTGGAAGAGATTTAAGCTCAAAGG 57.176 37.500 12.86 0.00 34.85 3.11
3684 3748 5.256474 TGGAAGAGATTTAAGCTCAAAGGG 58.744 41.667 12.86 0.00 34.85 3.95
3685 3749 4.097135 GGAAGAGATTTAAGCTCAAAGGGC 59.903 45.833 12.86 0.00 34.85 5.19
3686 3750 4.307032 AGAGATTTAAGCTCAAAGGGCA 57.693 40.909 12.86 0.00 34.85 5.36
3687 3751 4.864726 AGAGATTTAAGCTCAAAGGGCAT 58.135 39.130 12.86 0.00 34.85 4.40
3688 3752 5.267587 AGAGATTTAAGCTCAAAGGGCATT 58.732 37.500 12.86 0.00 34.85 3.56
3689 3753 5.359292 AGAGATTTAAGCTCAAAGGGCATTC 59.641 40.000 12.86 0.00 34.85 2.67
3690 3754 5.267587 AGATTTAAGCTCAAAGGGCATTCT 58.732 37.500 0.00 0.00 0.00 2.40
3691 3755 5.718607 AGATTTAAGCTCAAAGGGCATTCTT 59.281 36.000 0.00 0.00 0.00 2.52
3692 3756 5.806654 TTTAAGCTCAAAGGGCATTCTTT 57.193 34.783 0.00 0.00 37.44 2.52
3693 3757 3.949842 AAGCTCAAAGGGCATTCTTTC 57.050 42.857 0.00 0.00 35.04 2.62
3694 3758 2.880443 AGCTCAAAGGGCATTCTTTCA 58.120 42.857 0.00 0.00 35.04 2.69
3695 3759 3.438183 AGCTCAAAGGGCATTCTTTCAT 58.562 40.909 0.00 0.00 35.04 2.57
3696 3760 4.603131 AGCTCAAAGGGCATTCTTTCATA 58.397 39.130 0.00 0.00 35.04 2.15
3697 3761 5.018809 AGCTCAAAGGGCATTCTTTCATAA 58.981 37.500 0.00 0.00 35.04 1.90
3698 3762 5.105063 GCTCAAAGGGCATTCTTTCATAAC 58.895 41.667 0.00 0.00 35.04 1.89
3699 3763 5.105595 GCTCAAAGGGCATTCTTTCATAACT 60.106 40.000 0.00 0.00 35.04 2.24
3700 3764 6.573094 GCTCAAAGGGCATTCTTTCATAACTT 60.573 38.462 0.00 0.00 35.04 2.66
3701 3765 7.362920 GCTCAAAGGGCATTCTTTCATAACTTA 60.363 37.037 0.00 0.00 35.04 2.24
3702 3766 8.593945 TCAAAGGGCATTCTTTCATAACTTAT 57.406 30.769 0.00 0.00 35.04 1.73
3703 3767 9.693739 TCAAAGGGCATTCTTTCATAACTTATA 57.306 29.630 0.00 0.00 35.04 0.98
3706 3770 9.700831 AAGGGCATTCTTTCATAACTTATAACT 57.299 29.630 0.00 0.00 0.00 2.24
3707 3771 9.700831 AGGGCATTCTTTCATAACTTATAACTT 57.299 29.630 0.00 0.00 0.00 2.66
3735 3799 9.553064 AGCTACAATCTATTGAATCTGTTAAGG 57.447 33.333 9.60 0.00 40.14 2.69
3736 3800 8.778358 GCTACAATCTATTGAATCTGTTAAGGG 58.222 37.037 9.60 0.00 40.14 3.95
3737 3801 9.838339 CTACAATCTATTGAATCTGTTAAGGGT 57.162 33.333 9.60 0.00 40.14 4.34
3738 3802 8.511604 ACAATCTATTGAATCTGTTAAGGGTG 57.488 34.615 9.60 0.00 40.14 4.61
3739 3803 8.109634 ACAATCTATTGAATCTGTTAAGGGTGT 58.890 33.333 9.60 0.00 40.14 4.16
3740 3804 8.960591 CAATCTATTGAATCTGTTAAGGGTGTT 58.039 33.333 0.00 0.00 40.14 3.32
3741 3805 8.738645 ATCTATTGAATCTGTTAAGGGTGTTC 57.261 34.615 0.00 0.00 0.00 3.18
3742 3806 7.918076 TCTATTGAATCTGTTAAGGGTGTTCT 58.082 34.615 0.00 0.00 0.00 3.01
3743 3807 6.824305 ATTGAATCTGTTAAGGGTGTTCTG 57.176 37.500 0.00 0.00 0.00 3.02
3744 3808 4.651778 TGAATCTGTTAAGGGTGTTCTGG 58.348 43.478 0.00 0.00 0.00 3.86
3745 3809 4.349636 TGAATCTGTTAAGGGTGTTCTGGA 59.650 41.667 0.00 0.00 0.00 3.86
3746 3810 4.993705 ATCTGTTAAGGGTGTTCTGGAA 57.006 40.909 0.00 0.00 0.00 3.53
3747 3811 4.993705 TCTGTTAAGGGTGTTCTGGAAT 57.006 40.909 0.00 0.00 0.00 3.01
3748 3812 4.651778 TCTGTTAAGGGTGTTCTGGAATG 58.348 43.478 0.00 0.00 0.00 2.67
3749 3813 3.153919 TGTTAAGGGTGTTCTGGAATGC 58.846 45.455 0.00 0.00 0.00 3.56
3750 3814 3.181434 TGTTAAGGGTGTTCTGGAATGCT 60.181 43.478 0.00 0.00 0.00 3.79
3751 3815 2.683211 AAGGGTGTTCTGGAATGCTT 57.317 45.000 0.00 0.00 0.00 3.91
3752 3816 1.915141 AGGGTGTTCTGGAATGCTTG 58.085 50.000 0.00 0.00 0.00 4.01
3753 3817 1.145738 AGGGTGTTCTGGAATGCTTGT 59.854 47.619 0.00 0.00 0.00 3.16
3754 3818 1.270550 GGGTGTTCTGGAATGCTTGTG 59.729 52.381 0.00 0.00 0.00 3.33
3755 3819 1.956477 GGTGTTCTGGAATGCTTGTGT 59.044 47.619 0.00 0.00 0.00 3.72
3756 3820 2.030805 GGTGTTCTGGAATGCTTGTGTC 60.031 50.000 0.00 0.00 0.00 3.67
3757 3821 2.618241 GTGTTCTGGAATGCTTGTGTCA 59.382 45.455 0.00 0.00 0.00 3.58
3758 3822 3.066621 GTGTTCTGGAATGCTTGTGTCAA 59.933 43.478 0.00 0.00 0.00 3.18
3759 3823 3.698539 TGTTCTGGAATGCTTGTGTCAAA 59.301 39.130 0.00 0.00 0.00 2.69
3760 3824 4.341806 TGTTCTGGAATGCTTGTGTCAAAT 59.658 37.500 0.00 0.00 0.00 2.32
3761 3825 4.771590 TCTGGAATGCTTGTGTCAAATC 57.228 40.909 0.00 0.00 0.00 2.17
3762 3826 3.507233 TCTGGAATGCTTGTGTCAAATCC 59.493 43.478 0.00 0.00 0.00 3.01
3763 3827 2.228582 TGGAATGCTTGTGTCAAATCCG 59.771 45.455 0.00 0.00 0.00 4.18
3764 3828 2.228822 GGAATGCTTGTGTCAAATCCGT 59.771 45.455 0.00 0.00 0.00 4.69
3765 3829 2.995466 ATGCTTGTGTCAAATCCGTG 57.005 45.000 0.00 0.00 0.00 4.94
3766 3830 0.950836 TGCTTGTGTCAAATCCGTGG 59.049 50.000 0.00 0.00 0.00 4.94
3767 3831 1.234821 GCTTGTGTCAAATCCGTGGA 58.765 50.000 0.00 0.00 0.00 4.02
3768 3832 1.606668 GCTTGTGTCAAATCCGTGGAA 59.393 47.619 0.00 0.00 0.00 3.53
3769 3833 2.034053 GCTTGTGTCAAATCCGTGGAAA 59.966 45.455 0.00 0.00 0.00 3.13
3770 3834 3.305335 GCTTGTGTCAAATCCGTGGAAAT 60.305 43.478 0.00 0.00 0.00 2.17
3771 3835 4.475944 CTTGTGTCAAATCCGTGGAAATC 58.524 43.478 0.00 0.00 0.00 2.17
3772 3836 3.481453 TGTGTCAAATCCGTGGAAATCA 58.519 40.909 0.00 0.00 0.00 2.57
3773 3837 4.078537 TGTGTCAAATCCGTGGAAATCAT 58.921 39.130 0.00 0.00 0.00 2.45
3774 3838 4.155826 TGTGTCAAATCCGTGGAAATCATC 59.844 41.667 0.00 0.00 0.00 2.92
3791 3855 9.835389 GGAAATCATCCCATTCAATTTTATGAA 57.165 29.630 0.00 0.00 43.00 2.57
3796 3860 9.985730 TCATCCCATTCAATTTTATGAATTAGC 57.014 29.630 0.01 0.00 45.39 3.09
3797 3861 9.767228 CATCCCATTCAATTTTATGAATTAGCA 57.233 29.630 0.01 0.00 45.39 3.49
3798 3862 9.991906 ATCCCATTCAATTTTATGAATTAGCAG 57.008 29.630 0.01 0.00 45.39 4.24
3799 3863 8.980596 TCCCATTCAATTTTATGAATTAGCAGT 58.019 29.630 0.01 0.00 45.39 4.40
3800 3864 9.037737 CCCATTCAATTTTATGAATTAGCAGTG 57.962 33.333 0.01 0.00 45.39 3.66
3801 3865 8.545420 CCATTCAATTTTATGAATTAGCAGTGC 58.455 33.333 7.13 7.13 45.39 4.40
3802 3866 9.089601 CATTCAATTTTATGAATTAGCAGTGCA 57.910 29.630 19.20 0.00 45.39 4.57
3803 3867 9.826574 ATTCAATTTTATGAATTAGCAGTGCAT 57.173 25.926 19.20 3.06 45.39 3.96
3804 3868 8.861033 TCAATTTTATGAATTAGCAGTGCATC 57.139 30.769 19.20 10.27 0.00 3.91
3805 3869 8.468399 TCAATTTTATGAATTAGCAGTGCATCA 58.532 29.630 19.20 15.48 0.00 3.07
3806 3870 9.256477 CAATTTTATGAATTAGCAGTGCATCAT 57.744 29.630 19.20 20.61 0.00 2.45
3810 3874 5.851047 TGAATTAGCAGTGCATCATATCG 57.149 39.130 19.20 0.00 0.00 2.92
3811 3875 5.299949 TGAATTAGCAGTGCATCATATCGT 58.700 37.500 19.20 0.00 0.00 3.73
3812 3876 5.406477 TGAATTAGCAGTGCATCATATCGTC 59.594 40.000 19.20 2.58 0.00 4.20
3813 3877 2.896745 AGCAGTGCATCATATCGTCA 57.103 45.000 19.20 0.00 0.00 4.35
3814 3878 3.183793 AGCAGTGCATCATATCGTCAA 57.816 42.857 19.20 0.00 0.00 3.18
3815 3879 3.129109 AGCAGTGCATCATATCGTCAAG 58.871 45.455 19.20 0.00 0.00 3.02
3816 3880 2.349249 GCAGTGCATCATATCGTCAAGC 60.349 50.000 11.09 0.00 0.00 4.01
3817 3881 2.867975 CAGTGCATCATATCGTCAAGCA 59.132 45.455 0.00 0.00 0.00 3.91
3818 3882 3.059800 CAGTGCATCATATCGTCAAGCAG 60.060 47.826 0.00 0.00 0.00 4.24
3819 3883 3.126073 GTGCATCATATCGTCAAGCAGA 58.874 45.455 0.00 0.00 0.00 4.26
3820 3884 3.557185 GTGCATCATATCGTCAAGCAGAA 59.443 43.478 0.00 0.00 0.00 3.02
3821 3885 4.034394 GTGCATCATATCGTCAAGCAGAAA 59.966 41.667 0.00 0.00 0.00 2.52
3822 3886 4.635324 TGCATCATATCGTCAAGCAGAAAA 59.365 37.500 0.00 0.00 0.00 2.29
3823 3887 5.203370 GCATCATATCGTCAAGCAGAAAAG 58.797 41.667 0.00 0.00 0.00 2.27
3824 3888 5.220739 GCATCATATCGTCAAGCAGAAAAGT 60.221 40.000 0.00 0.00 0.00 2.66
3825 3889 6.018751 GCATCATATCGTCAAGCAGAAAAGTA 60.019 38.462 0.00 0.00 0.00 2.24
3826 3890 7.465916 GCATCATATCGTCAAGCAGAAAAGTAA 60.466 37.037 0.00 0.00 0.00 2.24
3827 3891 7.899178 TCATATCGTCAAGCAGAAAAGTAAA 57.101 32.000 0.00 0.00 0.00 2.01
3828 3892 8.492673 TCATATCGTCAAGCAGAAAAGTAAAT 57.507 30.769 0.00 0.00 0.00 1.40
3829 3893 8.946085 TCATATCGTCAAGCAGAAAAGTAAATT 58.054 29.630 0.00 0.00 0.00 1.82
3830 3894 9.559958 CATATCGTCAAGCAGAAAAGTAAATTT 57.440 29.630 0.00 0.00 0.00 1.82
3831 3895 7.858052 ATCGTCAAGCAGAAAAGTAAATTTG 57.142 32.000 0.00 0.00 0.00 2.32
3832 3896 6.791303 TCGTCAAGCAGAAAAGTAAATTTGT 58.209 32.000 0.00 0.00 0.00 2.83
3833 3897 7.921787 TCGTCAAGCAGAAAAGTAAATTTGTA 58.078 30.769 0.00 0.00 0.00 2.41
3834 3898 7.853929 TCGTCAAGCAGAAAAGTAAATTTGTAC 59.146 33.333 0.00 0.00 0.00 2.90
3835 3899 7.855904 CGTCAAGCAGAAAAGTAAATTTGTACT 59.144 33.333 0.00 0.00 35.80 2.73
3838 3902 9.612620 CAAGCAGAAAAGTAAATTTGTACTAGG 57.387 33.333 0.00 0.00 33.05 3.02
3839 3903 9.569122 AAGCAGAAAAGTAAATTTGTACTAGGA 57.431 29.630 0.00 0.00 33.05 2.94
3840 3904 9.000486 AGCAGAAAAGTAAATTTGTACTAGGAC 58.000 33.333 0.00 0.00 33.05 3.85
3841 3905 9.000486 GCAGAAAAGTAAATTTGTACTAGGACT 58.000 33.333 6.66 0.00 33.05 3.85
3844 3908 9.608617 GAAAAGTAAATTTGTACTAGGACTTGC 57.391 33.333 6.66 0.00 33.05 4.01
3845 3909 7.683437 AAGTAAATTTGTACTAGGACTTGCC 57.317 36.000 6.66 0.00 33.05 4.52
3846 3910 6.775708 AGTAAATTTGTACTAGGACTTGCCA 58.224 36.000 6.66 0.00 40.02 4.92
3847 3911 7.402862 AGTAAATTTGTACTAGGACTTGCCAT 58.597 34.615 6.66 0.00 40.02 4.40
3848 3912 6.759497 AAATTTGTACTAGGACTTGCCATC 57.241 37.500 6.66 0.00 40.02 3.51
3849 3913 5.700402 ATTTGTACTAGGACTTGCCATCT 57.300 39.130 6.66 0.00 40.02 2.90
3850 3914 4.471904 TTGTACTAGGACTTGCCATCTG 57.528 45.455 6.66 0.00 40.02 2.90
3851 3915 3.708451 TGTACTAGGACTTGCCATCTGA 58.292 45.455 6.66 0.00 40.02 3.27
3852 3916 4.093743 TGTACTAGGACTTGCCATCTGAA 58.906 43.478 6.66 0.00 40.02 3.02
3853 3917 4.716784 TGTACTAGGACTTGCCATCTGAAT 59.283 41.667 6.66 0.00 40.02 2.57
3854 3918 4.851639 ACTAGGACTTGCCATCTGAATT 57.148 40.909 0.00 0.00 40.02 2.17
3855 3919 5.184892 ACTAGGACTTGCCATCTGAATTT 57.815 39.130 0.00 0.00 40.02 1.82
3856 3920 5.574188 ACTAGGACTTGCCATCTGAATTTT 58.426 37.500 0.00 0.00 40.02 1.82
3857 3921 4.796038 AGGACTTGCCATCTGAATTTTG 57.204 40.909 0.00 0.00 40.02 2.44
3858 3922 4.154942 AGGACTTGCCATCTGAATTTTGT 58.845 39.130 0.00 0.00 40.02 2.83
3859 3923 4.590222 AGGACTTGCCATCTGAATTTTGTT 59.410 37.500 0.00 0.00 40.02 2.83
3860 3924 5.774690 AGGACTTGCCATCTGAATTTTGTTA 59.225 36.000 0.00 0.00 40.02 2.41
3861 3925 6.267471 AGGACTTGCCATCTGAATTTTGTTAA 59.733 34.615 0.00 0.00 40.02 2.01
3862 3926 6.366061 GGACTTGCCATCTGAATTTTGTTAAC 59.634 38.462 0.00 0.00 36.34 2.01
3863 3927 6.223120 ACTTGCCATCTGAATTTTGTTAACC 58.777 36.000 2.48 0.00 0.00 2.85
3864 3928 5.146010 TGCCATCTGAATTTTGTTAACCC 57.854 39.130 2.48 0.00 0.00 4.11
3865 3929 4.173256 GCCATCTGAATTTTGTTAACCCG 58.827 43.478 2.48 0.00 0.00 5.28
3866 3930 4.743493 CCATCTGAATTTTGTTAACCCGG 58.257 43.478 2.48 0.00 0.00 5.73
3867 3931 4.219725 CCATCTGAATTTTGTTAACCCGGT 59.780 41.667 0.00 0.00 0.00 5.28
3868 3932 5.279256 CCATCTGAATTTTGTTAACCCGGTT 60.279 40.000 8.17 8.17 0.00 4.44
3869 3933 5.855740 TCTGAATTTTGTTAACCCGGTTT 57.144 34.783 8.44 0.00 0.00 3.27
3870 3934 6.223351 TCTGAATTTTGTTAACCCGGTTTT 57.777 33.333 8.44 0.00 0.00 2.43
3871 3935 7.344095 TCTGAATTTTGTTAACCCGGTTTTA 57.656 32.000 8.44 0.00 0.00 1.52
3872 3936 7.779073 TCTGAATTTTGTTAACCCGGTTTTAA 58.221 30.769 8.44 0.62 0.00 1.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
39 40 9.709495 CCTTCCAAACAAAATCAATCTTGAATA 57.291 29.630 0.00 0.00 41.13 1.75
40 41 7.173735 GCCTTCCAAACAAAATCAATCTTGAAT 59.826 33.333 0.00 0.00 41.13 2.57
41 42 6.482973 GCCTTCCAAACAAAATCAATCTTGAA 59.517 34.615 0.00 0.00 41.13 2.69
42 43 5.990996 GCCTTCCAAACAAAATCAATCTTGA 59.009 36.000 0.00 0.00 42.14 3.02
43 44 5.993441 AGCCTTCCAAACAAAATCAATCTTG 59.007 36.000 0.00 0.00 0.00 3.02
44 45 6.178607 AGCCTTCCAAACAAAATCAATCTT 57.821 33.333 0.00 0.00 0.00 2.40
45 46 5.813513 AGCCTTCCAAACAAAATCAATCT 57.186 34.783 0.00 0.00 0.00 2.40
46 47 5.990996 TGAAGCCTTCCAAACAAAATCAATC 59.009 36.000 1.21 0.00 0.00 2.67
47 48 5.927819 TGAAGCCTTCCAAACAAAATCAAT 58.072 33.333 1.21 0.00 0.00 2.57
48 49 5.350504 TGAAGCCTTCCAAACAAAATCAA 57.649 34.783 1.21 0.00 0.00 2.57
49 50 5.549742 ATGAAGCCTTCCAAACAAAATCA 57.450 34.783 1.21 0.00 0.00 2.57
50 51 6.089417 CGTAATGAAGCCTTCCAAACAAAATC 59.911 38.462 1.21 0.00 0.00 2.17
51 52 5.925969 CGTAATGAAGCCTTCCAAACAAAAT 59.074 36.000 1.21 0.00 0.00 1.82
52 53 5.067936 TCGTAATGAAGCCTTCCAAACAAAA 59.932 36.000 1.21 0.00 0.00 2.44
53 54 4.580995 TCGTAATGAAGCCTTCCAAACAAA 59.419 37.500 1.21 0.00 0.00 2.83
54 55 4.138290 TCGTAATGAAGCCTTCCAAACAA 58.862 39.130 1.21 0.00 0.00 2.83
55 56 3.745799 TCGTAATGAAGCCTTCCAAACA 58.254 40.909 1.21 0.00 0.00 2.83
56 57 4.000988 TCTCGTAATGAAGCCTTCCAAAC 58.999 43.478 1.21 0.00 0.00 2.93
57 58 4.280436 TCTCGTAATGAAGCCTTCCAAA 57.720 40.909 1.21 0.00 0.00 3.28
58 59 3.973206 TCTCGTAATGAAGCCTTCCAA 57.027 42.857 1.21 0.00 0.00 3.53
59 60 3.973206 TTCTCGTAATGAAGCCTTCCA 57.027 42.857 1.21 0.00 0.00 3.53
60 61 4.496507 GCATTTCTCGTAATGAAGCCTTCC 60.497 45.833 1.21 0.00 37.65 3.46
61 62 4.094887 TGCATTTCTCGTAATGAAGCCTTC 59.905 41.667 0.00 0.00 37.65 3.46
62 63 4.009675 TGCATTTCTCGTAATGAAGCCTT 58.990 39.130 10.37 0.00 37.65 4.35
63 64 3.375299 GTGCATTTCTCGTAATGAAGCCT 59.625 43.478 10.37 0.00 37.65 4.58
64 65 3.126858 TGTGCATTTCTCGTAATGAAGCC 59.873 43.478 10.37 0.00 37.65 4.35
65 66 4.340894 TGTGCATTTCTCGTAATGAAGC 57.659 40.909 10.37 0.00 37.65 3.86
66 67 5.735892 CACATGTGCATTTCTCGTAATGAAG 59.264 40.000 13.94 0.00 37.65 3.02
67 68 5.630061 CACATGTGCATTTCTCGTAATGAA 58.370 37.500 13.94 0.00 37.65 2.57
68 69 5.220557 CACATGTGCATTTCTCGTAATGA 57.779 39.130 13.94 0.00 37.65 2.57
83 84 1.250328 ATCACCTGGTTGCACATGTG 58.750 50.000 21.83 21.83 38.03 3.21
84 85 2.877097 TATCACCTGGTTGCACATGT 57.123 45.000 0.00 0.00 0.00 3.21
85 86 4.724074 ATTTATCACCTGGTTGCACATG 57.276 40.909 0.00 0.00 0.00 3.21
86 87 5.245751 TCAAATTTATCACCTGGTTGCACAT 59.754 36.000 0.00 0.00 0.00 3.21
87 88 4.586421 TCAAATTTATCACCTGGTTGCACA 59.414 37.500 0.00 0.00 0.00 4.57
88 89 4.923281 GTCAAATTTATCACCTGGTTGCAC 59.077 41.667 0.00 0.00 0.00 4.57
89 90 4.832266 AGTCAAATTTATCACCTGGTTGCA 59.168 37.500 0.00 0.00 0.00 4.08
90 91 5.391312 AGTCAAATTTATCACCTGGTTGC 57.609 39.130 0.00 0.00 0.00 4.17
91 92 6.158598 CCAAGTCAAATTTATCACCTGGTTG 58.841 40.000 0.00 0.00 0.00 3.77
92 93 5.838521 ACCAAGTCAAATTTATCACCTGGTT 59.161 36.000 0.00 0.00 0.00 3.67
93 94 5.243730 CACCAAGTCAAATTTATCACCTGGT 59.756 40.000 9.88 9.88 0.00 4.00
94 95 5.243730 ACACCAAGTCAAATTTATCACCTGG 59.756 40.000 8.97 8.97 0.00 4.45
95 96 6.331369 ACACCAAGTCAAATTTATCACCTG 57.669 37.500 0.00 0.00 0.00 4.00
96 97 6.549364 TGAACACCAAGTCAAATTTATCACCT 59.451 34.615 0.00 0.00 0.00 4.00
97 98 6.744112 TGAACACCAAGTCAAATTTATCACC 58.256 36.000 0.00 0.00 0.00 4.02
98 99 8.641499 TTTGAACACCAAGTCAAATTTATCAC 57.359 30.769 0.00 0.00 35.94 3.06
99 100 9.258826 CATTTGAACACCAAGTCAAATTTATCA 57.741 29.630 8.51 0.00 36.61 2.15
100 101 9.474920 TCATTTGAACACCAAGTCAAATTTATC 57.525 29.630 8.51 0.00 36.61 1.75
103 104 9.829507 TTATCATTTGAACACCAAGTCAAATTT 57.170 25.926 8.51 3.77 36.61 1.82
104 105 9.829507 TTTATCATTTGAACACCAAGTCAAATT 57.170 25.926 8.51 0.38 36.61 1.82
105 106 9.829507 TTTTATCATTTGAACACCAAGTCAAAT 57.170 25.926 5.94 5.94 37.90 2.32
106 107 9.829507 ATTTTATCATTTGAACACCAAGTCAAA 57.170 25.926 1.68 1.68 35.94 2.69
107 108 9.829507 AATTTTATCATTTGAACACCAAGTCAA 57.170 25.926 0.00 0.00 35.94 3.18
108 109 9.258826 CAATTTTATCATTTGAACACCAAGTCA 57.741 29.630 0.00 0.00 35.94 3.41
109 110 9.474920 TCAATTTTATCATTTGAACACCAAGTC 57.525 29.630 0.00 0.00 35.94 3.01
175 176 1.667830 TGCTAGACCGTGCAAGTGC 60.668 57.895 0.00 0.00 42.50 4.40
176 177 1.617755 CGTGCTAGACCGTGCAAGTG 61.618 60.000 0.00 0.00 41.10 3.16
177 178 1.372997 CGTGCTAGACCGTGCAAGT 60.373 57.895 0.00 0.00 41.10 3.16
178 179 0.666274 TTCGTGCTAGACCGTGCAAG 60.666 55.000 0.00 0.00 41.10 4.01
179 180 0.037697 ATTCGTGCTAGACCGTGCAA 60.038 50.000 0.00 0.00 41.10 4.08
180 181 0.812549 TATTCGTGCTAGACCGTGCA 59.187 50.000 0.00 0.00 36.79 4.57
181 182 1.587034 GTTATTCGTGCTAGACCGTGC 59.413 52.381 0.00 0.00 0.00 5.34
182 183 1.844357 CGTTATTCGTGCTAGACCGTG 59.156 52.381 0.00 0.00 34.52 4.94
183 184 1.202222 CCGTTATTCGTGCTAGACCGT 60.202 52.381 0.00 0.00 37.94 4.83
184 185 1.474017 CCGTTATTCGTGCTAGACCG 58.526 55.000 0.00 0.00 37.94 4.79
185 186 1.206523 GCCGTTATTCGTGCTAGACC 58.793 55.000 0.00 0.00 37.94 3.85
186 187 0.844503 CGCCGTTATTCGTGCTAGAC 59.155 55.000 0.00 0.00 37.94 2.59
187 188 0.452987 ACGCCGTTATTCGTGCTAGA 59.547 50.000 0.00 0.00 37.55 2.43
188 189 2.041966 CTACGCCGTTATTCGTGCTAG 58.958 52.381 0.00 0.00 39.46 3.42
189 190 1.861202 GCTACGCCGTTATTCGTGCTA 60.861 52.381 0.00 0.00 39.46 3.49
190 191 1.143969 GCTACGCCGTTATTCGTGCT 61.144 55.000 0.00 0.00 39.46 4.40
191 192 1.271840 GCTACGCCGTTATTCGTGC 59.728 57.895 0.00 0.00 39.46 5.34
192 193 0.993532 TTGCTACGCCGTTATTCGTG 59.006 50.000 0.00 0.00 39.46 4.35
193 194 1.856597 GATTGCTACGCCGTTATTCGT 59.143 47.619 0.00 0.00 42.09 3.85
194 195 1.855978 TGATTGCTACGCCGTTATTCG 59.144 47.619 0.00 0.00 39.52 3.34
195 196 3.936902 TTGATTGCTACGCCGTTATTC 57.063 42.857 0.00 0.00 0.00 1.75
196 197 3.003275 CCATTGATTGCTACGCCGTTATT 59.997 43.478 0.00 0.00 0.00 1.40
197 198 2.548057 CCATTGATTGCTACGCCGTTAT 59.452 45.455 0.00 0.00 0.00 1.89
198 199 1.937223 CCATTGATTGCTACGCCGTTA 59.063 47.619 0.00 0.00 0.00 3.18
199 200 0.732571 CCATTGATTGCTACGCCGTT 59.267 50.000 0.00 0.00 0.00 4.44
200 201 1.714899 GCCATTGATTGCTACGCCGT 61.715 55.000 0.00 0.00 0.00 5.68
201 202 1.009675 GCCATTGATTGCTACGCCG 60.010 57.895 0.00 0.00 0.00 6.46
202 203 0.029834 CAGCCATTGATTGCTACGCC 59.970 55.000 0.00 0.00 35.69 5.68
203 204 0.029834 CCAGCCATTGATTGCTACGC 59.970 55.000 0.00 0.00 35.69 4.42
204 205 1.600957 CTCCAGCCATTGATTGCTACG 59.399 52.381 0.00 0.00 35.69 3.51
205 206 1.952296 CCTCCAGCCATTGATTGCTAC 59.048 52.381 0.00 0.00 35.69 3.58
206 207 1.845791 TCCTCCAGCCATTGATTGCTA 59.154 47.619 0.00 0.00 35.69 3.49
207 208 0.627451 TCCTCCAGCCATTGATTGCT 59.373 50.000 0.00 0.00 38.67 3.91
208 209 0.743097 GTCCTCCAGCCATTGATTGC 59.257 55.000 0.00 0.00 0.00 3.56
209 210 1.064166 AGGTCCTCCAGCCATTGATTG 60.064 52.381 0.00 0.00 35.89 2.67
210 211 1.213926 GAGGTCCTCCAGCCATTGATT 59.786 52.381 7.78 0.00 35.89 2.57
211 212 0.842635 GAGGTCCTCCAGCCATTGAT 59.157 55.000 7.78 0.00 35.89 2.57
212 213 2.300996 GAGGTCCTCCAGCCATTGA 58.699 57.895 7.78 0.00 35.89 2.57
213 214 4.972875 GAGGTCCTCCAGCCATTG 57.027 61.111 7.78 0.00 35.89 2.82
222 223 1.690219 ATCGTGCATGGGAGGTCCTC 61.690 60.000 10.78 10.78 36.20 3.71
223 224 0.398522 TATCGTGCATGGGAGGTCCT 60.399 55.000 5.98 0.00 36.20 3.85
224 225 0.034059 CTATCGTGCATGGGAGGTCC 59.966 60.000 5.98 0.00 0.00 4.46
225 226 0.753262 ACTATCGTGCATGGGAGGTC 59.247 55.000 5.98 0.00 0.00 3.85
226 227 1.204146 AACTATCGTGCATGGGAGGT 58.796 50.000 5.98 0.00 0.00 3.85
227 228 3.469008 TTAACTATCGTGCATGGGAGG 57.531 47.619 5.98 0.00 0.00 4.30
228 229 3.997021 GGATTAACTATCGTGCATGGGAG 59.003 47.826 5.98 6.28 33.82 4.30
229 230 3.389656 TGGATTAACTATCGTGCATGGGA 59.610 43.478 5.98 0.00 33.82 4.37
230 231 3.738982 TGGATTAACTATCGTGCATGGG 58.261 45.455 5.98 0.00 33.82 4.00
231 232 4.380531 ACTGGATTAACTATCGTGCATGG 58.619 43.478 5.98 0.00 33.82 3.66
232 233 5.292765 AGACTGGATTAACTATCGTGCATG 58.707 41.667 0.00 0.00 33.82 4.06
233 234 5.069119 TGAGACTGGATTAACTATCGTGCAT 59.931 40.000 0.00 0.00 33.82 3.96
234 235 4.401202 TGAGACTGGATTAACTATCGTGCA 59.599 41.667 0.00 0.00 33.82 4.57
235 236 4.933330 TGAGACTGGATTAACTATCGTGC 58.067 43.478 0.00 0.00 33.82 5.34
268 269 9.559880 TGTCCTTAACAAGAGTGCAACTATCGT 62.560 40.741 0.00 0.00 37.45 3.73
269 270 7.283833 TGTCCTTAACAAGAGTGCAACTATCG 61.284 42.308 0.00 0.00 37.45 2.92
270 271 5.932303 TGTCCTTAACAAGAGTGCAACTATC 59.068 40.000 0.00 0.00 37.45 2.08
271 272 5.865085 TGTCCTTAACAAGAGTGCAACTAT 58.135 37.500 0.00 0.00 42.43 2.12
272 273 5.284861 TGTCCTTAACAAGAGTGCAACTA 57.715 39.130 0.00 0.00 41.21 2.24
273 274 4.150897 TGTCCTTAACAAGAGTGCAACT 57.849 40.909 0.00 0.00 43.26 3.16
274 275 4.275936 ACATGTCCTTAACAAGAGTGCAAC 59.724 41.667 0.00 0.00 42.37 4.17
275 276 4.460263 ACATGTCCTTAACAAGAGTGCAA 58.540 39.130 0.00 0.00 42.37 4.08
276 277 4.085357 ACATGTCCTTAACAAGAGTGCA 57.915 40.909 0.00 0.00 42.37 4.57
277 278 5.008613 TGAAACATGTCCTTAACAAGAGTGC 59.991 40.000 0.00 0.00 42.37 4.40
278 279 6.293626 CCTGAAACATGTCCTTAACAAGAGTG 60.294 42.308 0.00 0.00 42.37 3.51
279 280 5.765182 CCTGAAACATGTCCTTAACAAGAGT 59.235 40.000 0.00 0.00 42.37 3.24
280 281 5.335191 GCCTGAAACATGTCCTTAACAAGAG 60.335 44.000 0.00 0.00 42.37 2.85
281 282 4.518970 GCCTGAAACATGTCCTTAACAAGA 59.481 41.667 0.00 0.00 42.37 3.02
282 283 4.321230 GGCCTGAAACATGTCCTTAACAAG 60.321 45.833 0.00 0.00 42.37 3.16
283 284 3.572255 GGCCTGAAACATGTCCTTAACAA 59.428 43.478 0.00 0.00 42.37 2.83
284 285 3.153919 GGCCTGAAACATGTCCTTAACA 58.846 45.455 0.00 0.00 43.51 2.41
285 286 3.153919 TGGCCTGAAACATGTCCTTAAC 58.846 45.455 3.32 0.00 0.00 2.01
286 287 3.517296 TGGCCTGAAACATGTCCTTAA 57.483 42.857 3.32 0.00 0.00 1.85
287 288 3.517296 TTGGCCTGAAACATGTCCTTA 57.483 42.857 3.32 0.00 0.00 2.69
288 289 2.380064 TTGGCCTGAAACATGTCCTT 57.620 45.000 3.32 0.00 0.00 3.36
289 290 2.380064 TTTGGCCTGAAACATGTCCT 57.620 45.000 3.32 0.00 0.00 3.85
290 291 3.244181 ACATTTTGGCCTGAAACATGTCC 60.244 43.478 3.32 0.00 0.00 4.02
291 292 3.993920 ACATTTTGGCCTGAAACATGTC 58.006 40.909 3.32 0.00 0.00 3.06
292 293 4.343526 TGTACATTTTGGCCTGAAACATGT 59.656 37.500 3.32 7.77 0.00 3.21
293 294 4.880759 TGTACATTTTGGCCTGAAACATG 58.119 39.130 3.32 1.34 0.00 3.21
294 295 4.832266 TCTGTACATTTTGGCCTGAAACAT 59.168 37.500 3.32 0.26 0.00 2.71
295 296 4.211125 TCTGTACATTTTGGCCTGAAACA 58.789 39.130 3.32 3.66 0.00 2.83
296 297 4.518970 TCTCTGTACATTTTGGCCTGAAAC 59.481 41.667 3.32 0.00 0.00 2.78
297 298 4.724399 TCTCTGTACATTTTGGCCTGAAA 58.276 39.130 3.32 5.76 0.00 2.69
298 299 4.365514 TCTCTGTACATTTTGGCCTGAA 57.634 40.909 3.32 0.00 0.00 3.02
299 300 4.365514 TTCTCTGTACATTTTGGCCTGA 57.634 40.909 3.32 0.00 0.00 3.86
300 301 4.142315 CCATTCTCTGTACATTTTGGCCTG 60.142 45.833 3.32 0.00 0.00 4.85
301 302 4.019174 CCATTCTCTGTACATTTTGGCCT 58.981 43.478 3.32 0.00 0.00 5.19
302 303 4.016444 TCCATTCTCTGTACATTTTGGCC 58.984 43.478 0.00 0.00 0.00 5.36
303 304 5.415701 TCTTCCATTCTCTGTACATTTTGGC 59.584 40.000 0.00 0.00 0.00 4.52
304 305 7.452880 TTCTTCCATTCTCTGTACATTTTGG 57.547 36.000 0.00 0.23 0.00 3.28
305 306 8.786898 TCTTTCTTCCATTCTCTGTACATTTTG 58.213 33.333 0.00 0.00 0.00 2.44
306 307 8.924511 TCTTTCTTCCATTCTCTGTACATTTT 57.075 30.769 0.00 0.00 0.00 1.82
307 308 9.171877 GATCTTTCTTCCATTCTCTGTACATTT 57.828 33.333 0.00 0.00 0.00 2.32
308 309 8.547173 AGATCTTTCTTCCATTCTCTGTACATT 58.453 33.333 0.00 0.00 0.00 2.71
309 310 8.088463 AGATCTTTCTTCCATTCTCTGTACAT 57.912 34.615 0.00 0.00 0.00 2.29
310 311 7.487822 AGATCTTTCTTCCATTCTCTGTACA 57.512 36.000 0.00 0.00 0.00 2.90
324 325 8.417106 GGGTTTCTTTTTCTGAAGATCTTTCTT 58.583 33.333 9.87 0.00 44.99 2.52
325 326 7.014711 GGGGTTTCTTTTTCTGAAGATCTTTCT 59.985 37.037 9.87 0.00 35.70 2.52
326 327 7.148641 GGGGTTTCTTTTTCTGAAGATCTTTC 58.851 38.462 9.87 3.85 35.70 2.62
327 328 6.239036 CGGGGTTTCTTTTTCTGAAGATCTTT 60.239 38.462 9.87 0.00 35.70 2.52
328 329 5.241728 CGGGGTTTCTTTTTCTGAAGATCTT 59.758 40.000 7.95 7.95 35.70 2.40
329 330 4.762251 CGGGGTTTCTTTTTCTGAAGATCT 59.238 41.667 0.00 0.00 35.70 2.75
330 331 4.760204 TCGGGGTTTCTTTTTCTGAAGATC 59.240 41.667 0.00 0.00 35.70 2.75
331 332 4.725490 TCGGGGTTTCTTTTTCTGAAGAT 58.275 39.130 0.00 0.00 35.70 2.40
332 333 4.134563 CTCGGGGTTTCTTTTTCTGAAGA 58.865 43.478 0.00 0.00 34.00 2.87
333 334 4.023963 GTCTCGGGGTTTCTTTTTCTGAAG 60.024 45.833 0.00 0.00 0.00 3.02
334 335 3.881089 GTCTCGGGGTTTCTTTTTCTGAA 59.119 43.478 0.00 0.00 0.00 3.02
335 336 3.118186 TGTCTCGGGGTTTCTTTTTCTGA 60.118 43.478 0.00 0.00 0.00 3.27
336 337 3.211045 TGTCTCGGGGTTTCTTTTTCTG 58.789 45.455 0.00 0.00 0.00 3.02
337 338 3.570912 TGTCTCGGGGTTTCTTTTTCT 57.429 42.857 0.00 0.00 0.00 2.52
338 339 4.758165 TGTATGTCTCGGGGTTTCTTTTTC 59.242 41.667 0.00 0.00 0.00 2.29
339 340 4.517832 GTGTATGTCTCGGGGTTTCTTTTT 59.482 41.667 0.00 0.00 0.00 1.94
340 341 4.070009 GTGTATGTCTCGGGGTTTCTTTT 58.930 43.478 0.00 0.00 0.00 2.27
341 342 3.558533 GGTGTATGTCTCGGGGTTTCTTT 60.559 47.826 0.00 0.00 0.00 2.52
342 343 2.027469 GGTGTATGTCTCGGGGTTTCTT 60.027 50.000 0.00 0.00 0.00 2.52
343 344 1.553704 GGTGTATGTCTCGGGGTTTCT 59.446 52.381 0.00 0.00 0.00 2.52
344 345 1.276989 TGGTGTATGTCTCGGGGTTTC 59.723 52.381 0.00 0.00 0.00 2.78
345 346 1.002773 GTGGTGTATGTCTCGGGGTTT 59.997 52.381 0.00 0.00 0.00 3.27
346 347 0.611714 GTGGTGTATGTCTCGGGGTT 59.388 55.000 0.00 0.00 0.00 4.11
347 348 0.252103 AGTGGTGTATGTCTCGGGGT 60.252 55.000 0.00 0.00 0.00 4.95
348 349 0.175760 CAGTGGTGTATGTCTCGGGG 59.824 60.000 0.00 0.00 0.00 5.73
349 350 1.182667 TCAGTGGTGTATGTCTCGGG 58.817 55.000 0.00 0.00 0.00 5.14
350 351 3.526931 AATCAGTGGTGTATGTCTCGG 57.473 47.619 0.00 0.00 0.00 4.63
351 352 5.223382 GGATAATCAGTGGTGTATGTCTCG 58.777 45.833 0.00 0.00 0.00 4.04
352 353 5.221263 ACGGATAATCAGTGGTGTATGTCTC 60.221 44.000 0.00 0.00 0.00 3.36
353 354 4.649674 ACGGATAATCAGTGGTGTATGTCT 59.350 41.667 0.00 0.00 0.00 3.41
354 355 4.745125 CACGGATAATCAGTGGTGTATGTC 59.255 45.833 0.00 0.00 38.60 3.06
355 356 4.693283 CACGGATAATCAGTGGTGTATGT 58.307 43.478 0.00 0.00 38.60 2.29
363 364 2.102420 TGCCTACCACGGATAATCAGTG 59.898 50.000 0.00 0.00 41.26 3.66
364 365 2.394632 TGCCTACCACGGATAATCAGT 58.605 47.619 0.00 0.00 0.00 3.41
365 366 3.329386 CATGCCTACCACGGATAATCAG 58.671 50.000 0.00 0.00 0.00 2.90
366 367 2.038426 CCATGCCTACCACGGATAATCA 59.962 50.000 0.00 0.00 0.00 2.57
367 368 2.038557 ACCATGCCTACCACGGATAATC 59.961 50.000 0.00 0.00 29.55 1.75
368 369 2.054799 ACCATGCCTACCACGGATAAT 58.945 47.619 0.00 0.00 29.55 1.28
369 370 1.502690 ACCATGCCTACCACGGATAA 58.497 50.000 0.00 0.00 29.55 1.75
370 371 1.140052 CAACCATGCCTACCACGGATA 59.860 52.381 0.00 0.00 29.55 2.59
371 372 0.107214 CAACCATGCCTACCACGGAT 60.107 55.000 0.00 0.00 29.55 4.18
372 373 1.298340 CAACCATGCCTACCACGGA 59.702 57.895 0.00 0.00 29.55 4.69
373 374 0.608035 AACAACCATGCCTACCACGG 60.608 55.000 0.00 0.00 31.67 4.94
374 375 1.243902 AAACAACCATGCCTACCACG 58.756 50.000 0.00 0.00 0.00 4.94
375 376 3.744238 AAAAACAACCATGCCTACCAC 57.256 42.857 0.00 0.00 0.00 4.16
395 396 5.122519 TGTGTCTGTACTGATGCTCAAAAA 58.877 37.500 5.69 0.00 0.00 1.94
396 397 4.702831 TGTGTCTGTACTGATGCTCAAAA 58.297 39.130 5.69 0.00 0.00 2.44
397 398 4.335400 TGTGTCTGTACTGATGCTCAAA 57.665 40.909 5.69 0.00 0.00 2.69
398 399 4.335400 TTGTGTCTGTACTGATGCTCAA 57.665 40.909 5.69 5.09 0.00 3.02
399 400 4.335400 TTTGTGTCTGTACTGATGCTCA 57.665 40.909 5.69 0.00 0.00 4.26
400 401 4.436584 GCATTTGTGTCTGTACTGATGCTC 60.437 45.833 13.42 0.48 37.00 4.26
401 402 3.438087 GCATTTGTGTCTGTACTGATGCT 59.562 43.478 13.42 0.00 37.00 3.79
402 403 3.438087 AGCATTTGTGTCTGTACTGATGC 59.562 43.478 13.01 13.01 38.56 3.91
403 404 4.692155 TGAGCATTTGTGTCTGTACTGATG 59.308 41.667 5.69 0.63 0.00 3.07
404 405 4.898320 TGAGCATTTGTGTCTGTACTGAT 58.102 39.130 5.69 0.00 0.00 2.90
405 406 4.335400 TGAGCATTTGTGTCTGTACTGA 57.665 40.909 0.00 0.00 0.00 3.41
406 407 6.915544 ATATGAGCATTTGTGTCTGTACTG 57.084 37.500 0.00 0.00 0.00 2.74
407 408 7.492669 GTGTATATGAGCATTTGTGTCTGTACT 59.507 37.037 0.00 0.00 0.00 2.73
408 409 7.515215 CGTGTATATGAGCATTTGTGTCTGTAC 60.515 40.741 0.00 0.00 0.00 2.90
409 410 6.475402 CGTGTATATGAGCATTTGTGTCTGTA 59.525 38.462 0.00 0.00 0.00 2.74
410 411 5.291858 CGTGTATATGAGCATTTGTGTCTGT 59.708 40.000 0.00 0.00 0.00 3.41
411 412 5.731278 CGTGTATATGAGCATTTGTGTCTG 58.269 41.667 0.00 0.00 0.00 3.51
412 413 4.271049 GCGTGTATATGAGCATTTGTGTCT 59.729 41.667 0.00 0.00 0.00 3.41
413 414 4.518217 GCGTGTATATGAGCATTTGTGTC 58.482 43.478 0.00 0.00 0.00 3.67
414 415 3.001228 CGCGTGTATATGAGCATTTGTGT 59.999 43.478 0.00 0.00 0.00 3.72
415 416 3.534889 CGCGTGTATATGAGCATTTGTG 58.465 45.455 0.00 0.00 0.00 3.33
416 417 2.032894 GCGCGTGTATATGAGCATTTGT 60.033 45.455 8.43 0.00 38.35 2.83
417 418 2.032979 TGCGCGTGTATATGAGCATTTG 60.033 45.455 8.43 0.00 42.50 2.32
418 419 2.209273 TGCGCGTGTATATGAGCATTT 58.791 42.857 8.43 0.00 42.50 2.32
419 420 1.864565 TGCGCGTGTATATGAGCATT 58.135 45.000 8.43 0.00 42.50 3.56
420 421 3.586430 TGCGCGTGTATATGAGCAT 57.414 47.368 8.43 0.00 42.50 3.79
422 423 2.090658 GTGTATGCGCGTGTATATGAGC 59.909 50.000 13.61 0.41 38.85 4.26
423 424 3.565516 AGTGTATGCGCGTGTATATGAG 58.434 45.455 13.61 0.00 0.00 2.90
424 425 3.003897 TGAGTGTATGCGCGTGTATATGA 59.996 43.478 13.61 0.00 0.00 2.15
425 426 3.119628 GTGAGTGTATGCGCGTGTATATG 59.880 47.826 13.61 0.00 0.00 1.78
426 427 3.305964 GTGAGTGTATGCGCGTGTATAT 58.694 45.455 13.61 0.00 0.00 0.86
427 428 2.542205 GGTGAGTGTATGCGCGTGTATA 60.542 50.000 13.61 2.40 0.00 1.47
428 429 1.556564 GTGAGTGTATGCGCGTGTAT 58.443 50.000 13.61 4.63 0.00 2.29
429 430 0.457166 GGTGAGTGTATGCGCGTGTA 60.457 55.000 13.61 0.00 0.00 2.90
430 431 1.736645 GGTGAGTGTATGCGCGTGT 60.737 57.895 13.61 0.00 0.00 4.49
431 432 2.452813 GGGTGAGTGTATGCGCGTG 61.453 63.158 13.61 0.00 0.00 5.34
432 433 2.125673 GGGTGAGTGTATGCGCGT 60.126 61.111 8.43 7.55 0.00 6.01
433 434 2.011741 TAGGGGTGAGTGTATGCGCG 62.012 60.000 0.00 0.00 0.00 6.86
434 435 0.393077 ATAGGGGTGAGTGTATGCGC 59.607 55.000 0.00 0.00 0.00 6.09
435 436 1.686587 TCATAGGGGTGAGTGTATGCG 59.313 52.381 0.00 0.00 0.00 4.73
436 437 3.467803 GTTCATAGGGGTGAGTGTATGC 58.532 50.000 0.00 0.00 0.00 3.14
437 438 3.717707 CGTTCATAGGGGTGAGTGTATG 58.282 50.000 0.00 0.00 0.00 2.39
438 439 2.102588 GCGTTCATAGGGGTGAGTGTAT 59.897 50.000 0.00 0.00 0.00 2.29
439 440 1.479323 GCGTTCATAGGGGTGAGTGTA 59.521 52.381 0.00 0.00 0.00 2.90
440 441 0.249398 GCGTTCATAGGGGTGAGTGT 59.751 55.000 0.00 0.00 0.00 3.55
441 442 0.249120 TGCGTTCATAGGGGTGAGTG 59.751 55.000 0.00 0.00 0.00 3.51
442 443 0.249398 GTGCGTTCATAGGGGTGAGT 59.751 55.000 0.00 0.00 0.00 3.41
443 444 0.249120 TGTGCGTTCATAGGGGTGAG 59.751 55.000 0.00 0.00 0.00 3.51
444 445 0.036765 GTGTGCGTTCATAGGGGTGA 60.037 55.000 0.00 0.00 0.00 4.02
445 446 0.321210 TGTGTGCGTTCATAGGGGTG 60.321 55.000 0.00 0.00 0.00 4.61
446 447 0.618458 ATGTGTGCGTTCATAGGGGT 59.382 50.000 0.00 0.00 0.00 4.95
447 448 1.016627 CATGTGTGCGTTCATAGGGG 58.983 55.000 0.00 0.00 0.00 4.79
448 449 0.378257 GCATGTGTGCGTTCATAGGG 59.622 55.000 0.00 0.00 42.28 3.53
449 450 3.903876 GCATGTGTGCGTTCATAGG 57.096 52.632 0.00 0.00 42.28 2.57
459 460 1.442769 GGGTAGAGTGTGCATGTGTG 58.557 55.000 0.00 0.00 0.00 3.82
460 461 0.324943 GGGGTAGAGTGTGCATGTGT 59.675 55.000 0.00 0.00 0.00 3.72
461 462 0.615331 AGGGGTAGAGTGTGCATGTG 59.385 55.000 0.00 0.00 0.00 3.21
462 463 2.247699 TAGGGGTAGAGTGTGCATGT 57.752 50.000 0.00 0.00 0.00 3.21
463 464 2.700371 TCATAGGGGTAGAGTGTGCATG 59.300 50.000 0.00 0.00 0.00 4.06
464 465 3.046283 TCATAGGGGTAGAGTGTGCAT 57.954 47.619 0.00 0.00 0.00 3.96
465 466 2.500098 GTTCATAGGGGTAGAGTGTGCA 59.500 50.000 0.00 0.00 0.00 4.57
466 467 2.500098 TGTTCATAGGGGTAGAGTGTGC 59.500 50.000 0.00 0.00 0.00 4.57
467 468 3.118738 GGTGTTCATAGGGGTAGAGTGTG 60.119 52.174 0.00 0.00 0.00 3.82
468 469 3.105283 GGTGTTCATAGGGGTAGAGTGT 58.895 50.000 0.00 0.00 0.00 3.55
469 470 3.375699 AGGTGTTCATAGGGGTAGAGTG 58.624 50.000 0.00 0.00 0.00 3.51
470 471 3.630311 GGAGGTGTTCATAGGGGTAGAGT 60.630 52.174 0.00 0.00 0.00 3.24
471 472 2.966516 GGAGGTGTTCATAGGGGTAGAG 59.033 54.545 0.00 0.00 0.00 2.43
472 473 2.688817 CGGAGGTGTTCATAGGGGTAGA 60.689 54.545 0.00 0.00 0.00 2.59
473 474 1.687123 CGGAGGTGTTCATAGGGGTAG 59.313 57.143 0.00 0.00 0.00 3.18
474 475 1.288633 TCGGAGGTGTTCATAGGGGTA 59.711 52.381 0.00 0.00 0.00 3.69
475 476 0.042131 TCGGAGGTGTTCATAGGGGT 59.958 55.000 0.00 0.00 0.00 4.95
476 477 1.200519 TTCGGAGGTGTTCATAGGGG 58.799 55.000 0.00 0.00 0.00 4.79
477 478 2.500098 TCTTTCGGAGGTGTTCATAGGG 59.500 50.000 0.00 0.00 0.00 3.53
478 479 3.195825 AGTCTTTCGGAGGTGTTCATAGG 59.804 47.826 0.00 0.00 0.00 2.57
479 480 4.082190 TCAGTCTTTCGGAGGTGTTCATAG 60.082 45.833 0.00 0.00 0.00 2.23
480 481 3.830178 TCAGTCTTTCGGAGGTGTTCATA 59.170 43.478 0.00 0.00 0.00 2.15
481 482 2.632996 TCAGTCTTTCGGAGGTGTTCAT 59.367 45.455 0.00 0.00 0.00 2.57
482 483 2.035961 CTCAGTCTTTCGGAGGTGTTCA 59.964 50.000 0.00 0.00 35.32 3.18
483 484 2.678324 CTCAGTCTTTCGGAGGTGTTC 58.322 52.381 0.00 0.00 35.32 3.18
484 485 1.270358 GCTCAGTCTTTCGGAGGTGTT 60.270 52.381 0.00 0.00 38.48 3.32
485 486 0.318762 GCTCAGTCTTTCGGAGGTGT 59.681 55.000 0.00 0.00 38.48 4.16
486 487 0.390472 GGCTCAGTCTTTCGGAGGTG 60.390 60.000 0.00 0.00 38.48 4.00
487 488 1.878656 CGGCTCAGTCTTTCGGAGGT 61.879 60.000 0.00 0.00 38.48 3.85
488 489 1.153745 CGGCTCAGTCTTTCGGAGG 60.154 63.158 0.00 0.00 38.48 4.30
489 490 1.153745 CCGGCTCAGTCTTTCGGAG 60.154 63.158 0.00 0.00 42.94 4.63
490 491 2.970639 CCGGCTCAGTCTTTCGGA 59.029 61.111 0.00 0.00 42.94 4.55
491 492 2.815647 GCCGGCTCAGTCTTTCGG 60.816 66.667 22.15 0.00 43.13 4.30
492 493 1.448540 ATGCCGGCTCAGTCTTTCG 60.449 57.895 29.70 0.00 0.00 3.46
493 494 1.986575 GCATGCCGGCTCAGTCTTTC 61.987 60.000 29.70 2.51 0.00 2.62
494 495 2.042831 GCATGCCGGCTCAGTCTTT 61.043 57.895 29.70 0.00 0.00 2.52
495 496 2.437359 GCATGCCGGCTCAGTCTT 60.437 61.111 29.70 0.26 0.00 3.01
496 497 3.709633 TGCATGCCGGCTCAGTCT 61.710 61.111 29.70 2.00 34.04 3.24
497 498 3.503363 GTGCATGCCGGCTCAGTC 61.503 66.667 29.70 12.50 34.04 3.51
501 502 2.947938 ATAGTGGTGCATGCCGGCTC 62.948 60.000 29.70 16.95 34.04 4.70
502 503 3.047807 ATAGTGGTGCATGCCGGCT 62.048 57.895 29.70 10.60 34.04 5.52
503 504 2.516930 ATAGTGGTGCATGCCGGC 60.517 61.111 22.73 22.73 0.00 6.13
504 505 0.179059 TACATAGTGGTGCATGCCGG 60.179 55.000 16.68 0.00 0.00 6.13
505 506 0.937304 GTACATAGTGGTGCATGCCG 59.063 55.000 16.68 0.00 0.00 5.69
506 507 1.942657 CTGTACATAGTGGTGCATGCC 59.057 52.381 16.68 6.42 32.92 4.40
507 508 2.868583 CTCTGTACATAGTGGTGCATGC 59.131 50.000 11.82 11.82 32.92 4.06
508 509 4.391405 TCTCTGTACATAGTGGTGCATG 57.609 45.455 8.01 0.00 32.92 4.06
509 510 5.363101 CATTCTCTGTACATAGTGGTGCAT 58.637 41.667 8.01 0.00 32.92 3.96
510 511 4.383010 CCATTCTCTGTACATAGTGGTGCA 60.383 45.833 8.01 0.00 32.39 4.57
511 512 4.122776 CCATTCTCTGTACATAGTGGTGC 58.877 47.826 8.01 0.00 0.00 5.01
512 513 5.598416 TCCATTCTCTGTACATAGTGGTG 57.402 43.478 14.06 9.16 0.00 4.17
513 514 5.958380 TCTTCCATTCTCTGTACATAGTGGT 59.042 40.000 14.06 0.00 0.00 4.16
514 515 6.471233 TCTTCCATTCTCTGTACATAGTGG 57.529 41.667 8.01 9.21 0.00 4.00
515 516 8.253810 TCTTTCTTCCATTCTCTGTACATAGTG 58.746 37.037 8.01 0.96 0.00 2.74
516 517 8.367660 TCTTTCTTCCATTCTCTGTACATAGT 57.632 34.615 8.01 0.00 0.00 2.12
517 518 9.474920 GATCTTTCTTCCATTCTCTGTACATAG 57.525 37.037 0.00 0.00 0.00 2.23
518 519 9.206690 AGATCTTTCTTCCATTCTCTGTACATA 57.793 33.333 0.00 0.00 0.00 2.29
519 520 8.088463 AGATCTTTCTTCCATTCTCTGTACAT 57.912 34.615 0.00 0.00 0.00 2.29
520 521 7.487822 AGATCTTTCTTCCATTCTCTGTACA 57.512 36.000 0.00 0.00 0.00 2.90
534 535 8.417106 GGGTTTCTTTTTCTGAAGATCTTTCTT 58.583 33.333 9.87 0.00 44.99 2.52
535 536 7.014711 GGGGTTTCTTTTTCTGAAGATCTTTCT 59.985 37.037 9.87 0.00 35.70 2.52
536 537 7.148641 GGGGTTTCTTTTTCTGAAGATCTTTC 58.851 38.462 9.87 3.85 35.70 2.62
537 538 6.239036 CGGGGTTTCTTTTTCTGAAGATCTTT 60.239 38.462 9.87 0.00 35.70 2.52
538 539 5.241728 CGGGGTTTCTTTTTCTGAAGATCTT 59.758 40.000 7.95 7.95 35.70 2.40
539 540 4.762251 CGGGGTTTCTTTTTCTGAAGATCT 59.238 41.667 0.00 0.00 35.70 2.75
540 541 4.760204 TCGGGGTTTCTTTTTCTGAAGATC 59.240 41.667 0.00 0.00 35.70 2.75
541 542 4.725490 TCGGGGTTTCTTTTTCTGAAGAT 58.275 39.130 0.00 0.00 35.70 2.40
542 543 4.134563 CTCGGGGTTTCTTTTTCTGAAGA 58.865 43.478 0.00 0.00 34.00 2.87
543 544 4.023963 GTCTCGGGGTTTCTTTTTCTGAAG 60.024 45.833 0.00 0.00 0.00 3.02
544 545 3.881089 GTCTCGGGGTTTCTTTTTCTGAA 59.119 43.478 0.00 0.00 0.00 3.02
545 546 3.118186 TGTCTCGGGGTTTCTTTTTCTGA 60.118 43.478 0.00 0.00 0.00 3.27
546 547 3.211045 TGTCTCGGGGTTTCTTTTTCTG 58.789 45.455 0.00 0.00 0.00 3.02
547 548 3.570912 TGTCTCGGGGTTTCTTTTTCT 57.429 42.857 0.00 0.00 0.00 2.52
548 549 3.611766 GCATGTCTCGGGGTTTCTTTTTC 60.612 47.826 0.00 0.00 0.00 2.29
549 550 2.296190 GCATGTCTCGGGGTTTCTTTTT 59.704 45.455 0.00 0.00 0.00 1.94
550 551 1.886542 GCATGTCTCGGGGTTTCTTTT 59.113 47.619 0.00 0.00 0.00 2.27
551 552 1.202879 TGCATGTCTCGGGGTTTCTTT 60.203 47.619 0.00 0.00 0.00 2.52
552 553 0.400213 TGCATGTCTCGGGGTTTCTT 59.600 50.000 0.00 0.00 0.00 2.52
553 554 0.321653 GTGCATGTCTCGGGGTTTCT 60.322 55.000 0.00 0.00 0.00 2.52
554 555 1.305930 GGTGCATGTCTCGGGGTTTC 61.306 60.000 0.00 0.00 0.00 2.78
555 556 1.303317 GGTGCATGTCTCGGGGTTT 60.303 57.895 0.00 0.00 0.00 3.27
556 557 2.351276 GGTGCATGTCTCGGGGTT 59.649 61.111 0.00 0.00 0.00 4.11
557 558 2.927856 TGGTGCATGTCTCGGGGT 60.928 61.111 0.00 0.00 0.00 4.95
558 559 2.436646 GTGGTGCATGTCTCGGGG 60.437 66.667 0.00 0.00 0.00 5.73
559 560 1.742880 CAGTGGTGCATGTCTCGGG 60.743 63.158 0.00 0.00 0.00 5.14
560 561 0.107993 ATCAGTGGTGCATGTCTCGG 60.108 55.000 0.00 0.00 0.00 4.63
561 562 1.730501 AATCAGTGGTGCATGTCTCG 58.269 50.000 0.00 0.00 0.00 4.04
562 563 3.812053 GGATAATCAGTGGTGCATGTCTC 59.188 47.826 0.00 0.00 0.00 3.36
563 564 3.742327 CGGATAATCAGTGGTGCATGTCT 60.742 47.826 0.00 0.00 0.00 3.41
564 565 2.545526 CGGATAATCAGTGGTGCATGTC 59.454 50.000 0.00 0.00 0.00 3.06
565 566 2.092968 ACGGATAATCAGTGGTGCATGT 60.093 45.455 0.00 0.00 0.00 3.21
566 567 2.288729 CACGGATAATCAGTGGTGCATG 59.711 50.000 0.00 0.00 38.60 4.06
567 568 2.564771 CACGGATAATCAGTGGTGCAT 58.435 47.619 0.00 0.00 38.60 3.96
568 569 2.022764 CACGGATAATCAGTGGTGCA 57.977 50.000 0.00 0.00 38.60 4.57
573 574 2.102420 TGCCTACCACGGATAATCAGTG 59.898 50.000 0.00 0.00 41.26 3.66
574 575 2.394632 TGCCTACCACGGATAATCAGT 58.605 47.619 0.00 0.00 0.00 3.41
575 576 3.329386 CATGCCTACCACGGATAATCAG 58.671 50.000 0.00 0.00 0.00 2.90
576 577 2.549992 GCATGCCTACCACGGATAATCA 60.550 50.000 6.36 0.00 0.00 2.57
577 578 2.076863 GCATGCCTACCACGGATAATC 58.923 52.381 6.36 0.00 0.00 1.75
578 579 1.699634 AGCATGCCTACCACGGATAAT 59.300 47.619 15.66 0.00 0.00 1.28
579 580 1.128200 AGCATGCCTACCACGGATAA 58.872 50.000 15.66 0.00 0.00 1.75
580 581 1.128200 AAGCATGCCTACCACGGATA 58.872 50.000 15.66 0.00 0.00 2.59
581 582 0.464373 CAAGCATGCCTACCACGGAT 60.464 55.000 15.66 0.00 0.00 4.18
582 583 1.078497 CAAGCATGCCTACCACGGA 60.078 57.895 15.66 0.00 0.00 4.69
583 584 0.960364 AACAAGCATGCCTACCACGG 60.960 55.000 15.66 0.00 0.00 4.94
584 585 0.881118 AAACAAGCATGCCTACCACG 59.119 50.000 15.66 0.00 0.00 4.94
585 586 3.385193 AAAAACAAGCATGCCTACCAC 57.615 42.857 15.66 0.00 0.00 4.16
605 606 5.122519 TGTGTCTGTACTGATGCTCAAAAA 58.877 37.500 5.69 0.00 0.00 1.94
606 607 4.702831 TGTGTCTGTACTGATGCTCAAAA 58.297 39.130 5.69 0.00 0.00 2.44
607 608 4.335400 TGTGTCTGTACTGATGCTCAAA 57.665 40.909 5.69 0.00 0.00 2.69
608 609 4.335400 TTGTGTCTGTACTGATGCTCAA 57.665 40.909 5.69 5.09 0.00 3.02
609 610 4.058124 GTTTGTGTCTGTACTGATGCTCA 58.942 43.478 5.69 0.00 0.00 4.26
610 611 3.121944 CGTTTGTGTCTGTACTGATGCTC 59.878 47.826 5.69 0.00 0.00 4.26
611 612 3.059884 CGTTTGTGTCTGTACTGATGCT 58.940 45.455 5.69 0.00 0.00 3.79
612 613 2.411547 GCGTTTGTGTCTGTACTGATGC 60.412 50.000 5.69 3.20 0.00 3.91
613 614 3.059884 AGCGTTTGTGTCTGTACTGATG 58.940 45.455 5.69 0.00 0.00 3.07
614 615 3.243737 TGAGCGTTTGTGTCTGTACTGAT 60.244 43.478 5.69 0.00 0.00 2.90
615 616 2.100087 TGAGCGTTTGTGTCTGTACTGA 59.900 45.455 0.00 0.00 0.00 3.41
616 617 2.469826 TGAGCGTTTGTGTCTGTACTG 58.530 47.619 0.00 0.00 0.00 2.74
617 618 2.882927 TGAGCGTTTGTGTCTGTACT 57.117 45.000 0.00 0.00 0.00 2.73
618 619 5.803461 TGTATATGAGCGTTTGTGTCTGTAC 59.197 40.000 0.00 0.00 0.00 2.90
619 620 5.803461 GTGTATATGAGCGTTTGTGTCTGTA 59.197 40.000 0.00 0.00 0.00 2.74
620 621 4.625742 GTGTATATGAGCGTTTGTGTCTGT 59.374 41.667 0.00 0.00 0.00 3.41
621 622 4.259411 CGTGTATATGAGCGTTTGTGTCTG 60.259 45.833 0.00 0.00 0.00 3.51
622 623 3.857665 CGTGTATATGAGCGTTTGTGTCT 59.142 43.478 0.00 0.00 0.00 3.41
623 624 3.541516 GCGTGTATATGAGCGTTTGTGTC 60.542 47.826 0.00 0.00 0.00 3.67
624 625 2.347452 GCGTGTATATGAGCGTTTGTGT 59.653 45.455 0.00 0.00 0.00 3.72
625 626 2.594269 CGCGTGTATATGAGCGTTTGTG 60.594 50.000 0.00 0.00 46.48 3.33
626 627 1.586578 CGCGTGTATATGAGCGTTTGT 59.413 47.619 0.00 0.00 46.48 2.83
627 628 2.264207 CGCGTGTATATGAGCGTTTG 57.736 50.000 0.00 0.00 46.48 2.93
632 633 2.090658 GTGTATGCGCGTGTATATGAGC 59.909 50.000 13.61 0.41 38.85 4.26
633 634 3.565516 AGTGTATGCGCGTGTATATGAG 58.434 45.455 13.61 0.00 0.00 2.90
634 635 3.003897 TGAGTGTATGCGCGTGTATATGA 59.996 43.478 13.61 0.00 0.00 2.15
635 636 3.119628 GTGAGTGTATGCGCGTGTATATG 59.880 47.826 13.61 0.00 0.00 1.78
636 637 3.305964 GTGAGTGTATGCGCGTGTATAT 58.694 45.455 13.61 0.00 0.00 0.86
637 638 2.542205 GGTGAGTGTATGCGCGTGTATA 60.542 50.000 13.61 2.40 0.00 1.47
638 639 1.556564 GTGAGTGTATGCGCGTGTAT 58.443 50.000 13.61 4.63 0.00 2.29
639 640 0.457166 GGTGAGTGTATGCGCGTGTA 60.457 55.000 13.61 0.00 0.00 2.90
640 641 1.736645 GGTGAGTGTATGCGCGTGT 60.737 57.895 13.61 0.00 0.00 4.49
641 642 2.452813 GGGTGAGTGTATGCGCGTG 61.453 63.158 13.61 0.00 0.00 5.34
642 643 2.125673 GGGTGAGTGTATGCGCGT 60.126 61.111 8.43 7.55 0.00 6.01
643 644 2.011741 TAGGGGTGAGTGTATGCGCG 62.012 60.000 0.00 0.00 0.00 6.86
644 645 0.393077 ATAGGGGTGAGTGTATGCGC 59.607 55.000 0.00 0.00 0.00 6.09
645 646 1.686587 TCATAGGGGTGAGTGTATGCG 59.313 52.381 0.00 0.00 0.00 4.73
646 647 3.467803 GTTCATAGGGGTGAGTGTATGC 58.532 50.000 0.00 0.00 0.00 3.14
647 648 3.717707 CGTTCATAGGGGTGAGTGTATG 58.282 50.000 0.00 0.00 0.00 2.39
648 649 2.102588 GCGTTCATAGGGGTGAGTGTAT 59.897 50.000 0.00 0.00 0.00 2.29
649 650 1.479323 GCGTTCATAGGGGTGAGTGTA 59.521 52.381 0.00 0.00 0.00 2.90
650 651 0.249398 GCGTTCATAGGGGTGAGTGT 59.751 55.000 0.00 0.00 0.00 3.55
651 652 0.249120 TGCGTTCATAGGGGTGAGTG 59.751 55.000 0.00 0.00 0.00 3.51
652 653 0.249398 GTGCGTTCATAGGGGTGAGT 59.751 55.000 0.00 0.00 0.00 3.41
653 654 0.249120 TGTGCGTTCATAGGGGTGAG 59.751 55.000 0.00 0.00 0.00 3.51
654 655 0.036765 GTGTGCGTTCATAGGGGTGA 60.037 55.000 0.00 0.00 0.00 4.02
655 656 0.321210 TGTGTGCGTTCATAGGGGTG 60.321 55.000 0.00 0.00 0.00 4.61
656 657 0.321298 GTGTGTGCGTTCATAGGGGT 60.321 55.000 0.00 0.00 0.00 4.95
657 658 1.358725 CGTGTGTGCGTTCATAGGGG 61.359 60.000 0.00 0.00 0.00 4.79
658 659 1.966493 GCGTGTGTGCGTTCATAGGG 61.966 60.000 0.00 0.00 0.00 3.53
659 660 1.288419 TGCGTGTGTGCGTTCATAGG 61.288 55.000 0.00 0.00 37.81 2.57
660 661 0.179250 GTGCGTGTGTGCGTTCATAG 60.179 55.000 0.00 0.00 37.81 2.23
661 662 0.876342 TGTGCGTGTGTGCGTTCATA 60.876 50.000 0.00 0.00 37.81 2.15
662 663 2.176926 TGTGCGTGTGTGCGTTCAT 61.177 52.632 0.00 0.00 37.81 2.57
663 664 2.815647 TGTGCGTGTGTGCGTTCA 60.816 55.556 0.00 0.00 37.81 3.18
664 665 2.350760 GTGTGCGTGTGTGCGTTC 60.351 61.111 0.00 0.00 37.81 3.95
665 666 3.871574 GGTGTGCGTGTGTGCGTT 61.872 61.111 0.00 0.00 37.81 4.84
668 669 2.280524 TAGGGTGTGCGTGTGTGC 60.281 61.111 0.00 0.00 0.00 4.57
669 670 1.959226 GGTAGGGTGTGCGTGTGTG 60.959 63.158 0.00 0.00 0.00 3.82
670 671 2.424302 GGTAGGGTGTGCGTGTGT 59.576 61.111 0.00 0.00 0.00 3.72
671 672 2.358247 GGGTAGGGTGTGCGTGTG 60.358 66.667 0.00 0.00 0.00 3.82
672 673 2.735151 TAGGGGTAGGGTGTGCGTGT 62.735 60.000 0.00 0.00 0.00 4.49
673 674 1.335132 ATAGGGGTAGGGTGTGCGTG 61.335 60.000 0.00 0.00 0.00 5.34
674 675 1.002533 ATAGGGGTAGGGTGTGCGT 59.997 57.895 0.00 0.00 0.00 5.24
675 676 1.046472 TCATAGGGGTAGGGTGTGCG 61.046 60.000 0.00 0.00 0.00 5.34
676 677 1.134189 GTTCATAGGGGTAGGGTGTGC 60.134 57.143 0.00 0.00 0.00 4.57
677 678 2.093128 GTGTTCATAGGGGTAGGGTGTG 60.093 54.545 0.00 0.00 0.00 3.82
678 679 2.193993 GTGTTCATAGGGGTAGGGTGT 58.806 52.381 0.00 0.00 0.00 4.16
679 680 1.489230 GGTGTTCATAGGGGTAGGGTG 59.511 57.143 0.00 0.00 0.00 4.61
680 681 1.368558 AGGTGTTCATAGGGGTAGGGT 59.631 52.381 0.00 0.00 0.00 4.34
681 682 2.191981 AGGTGTTCATAGGGGTAGGG 57.808 55.000 0.00 0.00 0.00 3.53
682 683 2.102588 CGAAGGTGTTCATAGGGGTAGG 59.897 54.545 0.00 0.00 32.36 3.18
683 684 3.028850 TCGAAGGTGTTCATAGGGGTAG 58.971 50.000 0.00 0.00 32.36 3.18
684 685 3.104519 TCGAAGGTGTTCATAGGGGTA 57.895 47.619 0.00 0.00 32.36 3.69
685 686 1.946984 TCGAAGGTGTTCATAGGGGT 58.053 50.000 0.00 0.00 32.36 4.95
686 687 3.055385 TCTTTCGAAGGTGTTCATAGGGG 60.055 47.826 7.20 0.00 32.36 4.79
687 688 3.933332 GTCTTTCGAAGGTGTTCATAGGG 59.067 47.826 7.20 0.00 32.36 3.53
688 689 4.627467 CAGTCTTTCGAAGGTGTTCATAGG 59.373 45.833 7.20 0.00 32.36 2.57
689 690 5.470368 TCAGTCTTTCGAAGGTGTTCATAG 58.530 41.667 7.20 0.00 32.36 2.23
690 691 5.462530 TCAGTCTTTCGAAGGTGTTCATA 57.537 39.130 7.20 0.00 32.36 2.15
691 692 4.310769 CTCAGTCTTTCGAAGGTGTTCAT 58.689 43.478 7.20 0.00 32.36 2.57
692 693 3.717707 CTCAGTCTTTCGAAGGTGTTCA 58.282 45.455 7.20 0.00 32.36 3.18
693 694 2.476997 GCTCAGTCTTTCGAAGGTGTTC 59.523 50.000 7.20 0.00 0.00 3.18
694 695 2.484889 GCTCAGTCTTTCGAAGGTGTT 58.515 47.619 7.20 0.00 0.00 3.32
695 696 1.270358 GGCTCAGTCTTTCGAAGGTGT 60.270 52.381 7.20 0.00 0.00 4.16
696 697 1.433534 GGCTCAGTCTTTCGAAGGTG 58.566 55.000 7.20 0.00 0.00 4.00
697 698 0.038159 CGGCTCAGTCTTTCGAAGGT 60.038 55.000 7.20 0.00 0.00 3.50
698 699 0.737715 CCGGCTCAGTCTTTCGAAGG 60.738 60.000 0.00 0.00 0.00 3.46
699 700 1.355066 GCCGGCTCAGTCTTTCGAAG 61.355 60.000 22.15 0.00 0.00 3.79
700 701 1.374252 GCCGGCTCAGTCTTTCGAA 60.374 57.895 22.15 0.00 0.00 3.71
701 702 1.888436 ATGCCGGCTCAGTCTTTCGA 61.888 55.000 29.70 1.81 0.00 3.71
702 703 0.179111 TATGCCGGCTCAGTCTTTCG 60.179 55.000 29.70 0.00 0.00 3.46
703 704 2.139118 GATATGCCGGCTCAGTCTTTC 58.861 52.381 29.70 9.22 0.00 2.62
704 705 1.486310 TGATATGCCGGCTCAGTCTTT 59.514 47.619 29.70 3.35 0.00 2.52
705 706 1.123077 TGATATGCCGGCTCAGTCTT 58.877 50.000 29.70 5.10 0.00 3.01
706 707 1.274728 GATGATATGCCGGCTCAGTCT 59.725 52.381 29.70 8.26 0.00 3.24
707 708 1.274728 AGATGATATGCCGGCTCAGTC 59.725 52.381 29.70 19.55 0.00 3.51
708 709 1.346062 AGATGATATGCCGGCTCAGT 58.654 50.000 29.70 13.44 0.00 3.41
709 710 2.074576 CAAGATGATATGCCGGCTCAG 58.925 52.381 29.70 7.35 0.00 3.35
710 711 1.693606 TCAAGATGATATGCCGGCTCA 59.306 47.619 29.70 23.34 0.00 4.26
711 712 2.028658 TCTCAAGATGATATGCCGGCTC 60.029 50.000 29.70 17.89 0.00 4.70
712 713 1.973515 TCTCAAGATGATATGCCGGCT 59.026 47.619 29.70 15.76 0.00 5.52
713 714 2.462456 TCTCAAGATGATATGCCGGC 57.538 50.000 22.73 22.73 0.00 6.13
714 715 5.062683 CGTAAATCTCAAGATGATATGCCGG 59.937 44.000 0.00 0.00 34.49 6.13
715 716 5.863935 TCGTAAATCTCAAGATGATATGCCG 59.136 40.000 0.00 0.00 34.49 5.69
716 717 7.623089 GCTTCGTAAATCTCAAGATGATATGCC 60.623 40.741 0.00 0.00 34.49 4.40
717 718 7.232994 GCTTCGTAAATCTCAAGATGATATGC 58.767 38.462 0.00 0.00 34.49 3.14
718 719 7.386025 TGGCTTCGTAAATCTCAAGATGATATG 59.614 37.037 0.00 0.00 34.49 1.78
719 720 7.386299 GTGGCTTCGTAAATCTCAAGATGATAT 59.614 37.037 0.00 0.00 34.49 1.63
720 721 6.701841 GTGGCTTCGTAAATCTCAAGATGATA 59.298 38.462 0.00 0.00 34.49 2.15
721 722 5.525378 GTGGCTTCGTAAATCTCAAGATGAT 59.475 40.000 0.00 0.00 34.49 2.45
722 723 4.870426 GTGGCTTCGTAAATCTCAAGATGA 59.130 41.667 0.00 0.00 34.49 2.92
723 724 4.034510 GGTGGCTTCGTAAATCTCAAGATG 59.965 45.833 0.00 0.00 34.49 2.90
724 725 4.192317 GGTGGCTTCGTAAATCTCAAGAT 58.808 43.478 0.00 0.00 36.07 2.40
725 726 3.596214 GGTGGCTTCGTAAATCTCAAGA 58.404 45.455 0.00 0.00 0.00 3.02
726 727 2.348666 CGGTGGCTTCGTAAATCTCAAG 59.651 50.000 0.00 0.00 0.00 3.02
727 728 2.289195 ACGGTGGCTTCGTAAATCTCAA 60.289 45.455 4.10 0.00 39.22 3.02
728 729 1.274167 ACGGTGGCTTCGTAAATCTCA 59.726 47.619 4.10 0.00 39.22 3.27
729 730 2.005971 ACGGTGGCTTCGTAAATCTC 57.994 50.000 4.10 0.00 39.22 2.75
730 731 2.159142 CCTACGGTGGCTTCGTAAATCT 60.159 50.000 12.25 0.00 41.62 2.40
731 732 2.199236 CCTACGGTGGCTTCGTAAATC 58.801 52.381 12.25 0.00 41.62 2.17
732 733 2.304751 CCTACGGTGGCTTCGTAAAT 57.695 50.000 12.25 0.00 41.62 1.40
733 734 3.818586 CCTACGGTGGCTTCGTAAA 57.181 52.632 12.25 0.00 41.62 2.01
745 746 2.431942 ACGACAAAGCGCCTACGG 60.432 61.111 2.29 0.00 40.57 4.02
746 747 2.774951 CGACGACAAAGCGCCTACG 61.775 63.158 2.29 6.14 44.07 3.51
747 748 1.443194 TCGACGACAAAGCGCCTAC 60.443 57.895 2.29 0.00 33.86 3.18
748 749 1.443194 GTCGACGACAAAGCGCCTA 60.443 57.895 22.66 0.00 32.09 3.93
749 750 2.733593 GTCGACGACAAAGCGCCT 60.734 61.111 22.66 0.00 32.09 5.52
750 751 4.117372 CGTCGACGACAAAGCGCC 62.117 66.667 33.35 0.00 43.02 6.53
751 752 3.044114 CTCGTCGACGACAAAGCGC 62.044 63.158 34.97 0.00 44.22 5.92
752 753 0.995234 TTCTCGTCGACGACAAAGCG 60.995 55.000 34.97 23.80 44.22 4.68
753 754 0.430110 GTTCTCGTCGACGACAAAGC 59.570 55.000 34.97 20.73 44.22 3.51
754 755 0.695943 CGTTCTCGTCGACGACAAAG 59.304 55.000 34.97 27.75 44.22 2.77
755 756 2.774587 CGTTCTCGTCGACGACAAA 58.225 52.632 34.97 26.96 44.22 2.83
756 757 4.502335 CGTTCTCGTCGACGACAA 57.498 55.556 34.97 28.29 44.22 3.18
766 767 0.961358 AGTGGGAGGAGACGTTCTCG 60.961 60.000 0.00 0.00 44.28 4.04
767 768 0.528470 CAGTGGGAGGAGACGTTCTC 59.472 60.000 0.00 0.00 42.66 2.87
768 769 0.112606 TCAGTGGGAGGAGACGTTCT 59.887 55.000 0.00 0.00 0.00 3.01
769 770 0.966920 TTCAGTGGGAGGAGACGTTC 59.033 55.000 0.00 0.00 0.00 3.95
770 771 1.344763 CTTTCAGTGGGAGGAGACGTT 59.655 52.381 0.00 0.00 0.00 3.99
771 772 0.969894 CTTTCAGTGGGAGGAGACGT 59.030 55.000 0.00 0.00 0.00 4.34
772 773 0.390472 GCTTTCAGTGGGAGGAGACG 60.390 60.000 0.00 0.00 0.00 4.18
773 774 0.687354 TGCTTTCAGTGGGAGGAGAC 59.313 55.000 0.00 0.00 0.00 3.36
774 775 0.687354 GTGCTTTCAGTGGGAGGAGA 59.313 55.000 0.00 0.00 0.00 3.71
775 776 0.397941 TGTGCTTTCAGTGGGAGGAG 59.602 55.000 0.00 0.00 0.00 3.69
776 777 1.003580 GATGTGCTTTCAGTGGGAGGA 59.996 52.381 0.00 0.00 0.00 3.71
777 778 1.457346 GATGTGCTTTCAGTGGGAGG 58.543 55.000 0.00 0.00 0.00 4.30
778 779 1.081892 CGATGTGCTTTCAGTGGGAG 58.918 55.000 0.00 0.00 0.00 4.30
779 780 0.955428 GCGATGTGCTTTCAGTGGGA 60.955 55.000 0.00 0.00 41.73 4.37
780 781 1.503542 GCGATGTGCTTTCAGTGGG 59.496 57.895 0.00 0.00 41.73 4.61
781 782 1.503542 GGCGATGTGCTTTCAGTGG 59.496 57.895 0.00 0.00 45.43 4.00
782 783 1.133253 CGGCGATGTGCTTTCAGTG 59.867 57.895 0.00 0.00 45.43 3.66
783 784 2.034879 CCGGCGATGTGCTTTCAGT 61.035 57.895 9.30 0.00 45.43 3.41
784 785 1.298157 TTCCGGCGATGTGCTTTCAG 61.298 55.000 9.30 0.00 45.43 3.02
785 786 0.886938 TTTCCGGCGATGTGCTTTCA 60.887 50.000 9.30 0.00 45.43 2.69
786 787 0.451783 ATTTCCGGCGATGTGCTTTC 59.548 50.000 9.30 0.00 45.43 2.62
787 788 0.451783 GATTTCCGGCGATGTGCTTT 59.548 50.000 9.30 0.00 45.43 3.51
788 789 1.376609 GGATTTCCGGCGATGTGCTT 61.377 55.000 9.30 0.00 45.43 3.91
789 790 1.819632 GGATTTCCGGCGATGTGCT 60.820 57.895 9.30 0.00 45.43 4.40
790 791 1.819632 AGGATTTCCGGCGATGTGC 60.820 57.895 9.30 0.00 42.08 4.57
791 792 0.461870 TCAGGATTTCCGGCGATGTG 60.462 55.000 9.30 0.00 42.08 3.21
792 793 0.251916 TTCAGGATTTCCGGCGATGT 59.748 50.000 9.30 0.00 42.08 3.06
793 794 1.378531 TTTCAGGATTTCCGGCGATG 58.621 50.000 9.30 0.00 42.08 3.84
794 795 2.348411 ATTTCAGGATTTCCGGCGAT 57.652 45.000 9.30 0.00 42.08 4.58
795 796 2.992124 TATTTCAGGATTTCCGGCGA 57.008 45.000 9.30 0.00 42.08 5.54
796 797 4.537015 GATTTATTTCAGGATTTCCGGCG 58.463 43.478 0.00 0.00 42.08 6.46
797 798 4.340950 TGGATTTATTTCAGGATTTCCGGC 59.659 41.667 0.00 0.00 42.08 6.13
798 799 5.827797 TCTGGATTTATTTCAGGATTTCCGG 59.172 40.000 0.00 0.00 42.08 5.14
799 800 6.942532 TCTGGATTTATTTCAGGATTTCCG 57.057 37.500 0.00 0.00 42.08 4.30
805 806 8.352201 CGCATTATTTCTGGATTTATTTCAGGA 58.648 33.333 0.00 0.00 0.00 3.86
806 807 8.352201 TCGCATTATTTCTGGATTTATTTCAGG 58.648 33.333 0.00 0.00 0.00 3.86
807 808 9.390795 CTCGCATTATTTCTGGATTTATTTCAG 57.609 33.333 0.00 0.00 0.00 3.02
808 809 7.862372 GCTCGCATTATTTCTGGATTTATTTCA 59.138 33.333 0.00 0.00 0.00 2.69
809 810 7.862372 TGCTCGCATTATTTCTGGATTTATTTC 59.138 33.333 0.00 0.00 0.00 2.17
810 811 7.649306 GTGCTCGCATTATTTCTGGATTTATTT 59.351 33.333 0.00 0.00 0.00 1.40
811 812 7.141363 GTGCTCGCATTATTTCTGGATTTATT 58.859 34.615 0.00 0.00 0.00 1.40
812 813 6.294176 GGTGCTCGCATTATTTCTGGATTTAT 60.294 38.462 0.00 0.00 0.00 1.40
813 814 5.008613 GGTGCTCGCATTATTTCTGGATTTA 59.991 40.000 0.00 0.00 0.00 1.40
814 815 4.202050 GGTGCTCGCATTATTTCTGGATTT 60.202 41.667 0.00 0.00 0.00 2.17
815 816 3.316308 GGTGCTCGCATTATTTCTGGATT 59.684 43.478 0.00 0.00 0.00 3.01
816 817 2.880890 GGTGCTCGCATTATTTCTGGAT 59.119 45.455 0.00 0.00 0.00 3.41
817 818 2.288666 GGTGCTCGCATTATTTCTGGA 58.711 47.619 0.00 0.00 0.00 3.86
818 819 2.016318 TGGTGCTCGCATTATTTCTGG 58.984 47.619 0.00 0.00 0.00 3.86
819 820 2.032550 CCTGGTGCTCGCATTATTTCTG 59.967 50.000 0.00 0.00 0.00 3.02
820 821 2.092968 TCCTGGTGCTCGCATTATTTCT 60.093 45.455 0.00 0.00 0.00 2.52
821 822 2.288666 TCCTGGTGCTCGCATTATTTC 58.711 47.619 0.00 0.00 0.00 2.17
822 823 2.418368 TCCTGGTGCTCGCATTATTT 57.582 45.000 0.00 0.00 0.00 1.40
823 824 2.645838 ATCCTGGTGCTCGCATTATT 57.354 45.000 0.00 0.00 0.00 1.40
824 825 2.620115 CAAATCCTGGTGCTCGCATTAT 59.380 45.455 0.00 0.00 0.00 1.28
825 826 2.016318 CAAATCCTGGTGCTCGCATTA 58.984 47.619 0.00 0.00 0.00 1.90
826 827 0.813184 CAAATCCTGGTGCTCGCATT 59.187 50.000 0.00 0.00 0.00 3.56
827 828 0.035152 TCAAATCCTGGTGCTCGCAT 60.035 50.000 0.00 0.00 0.00 4.73
828 829 0.250684 TTCAAATCCTGGTGCTCGCA 60.251 50.000 0.00 0.00 0.00 5.10
829 830 0.169009 GTTCAAATCCTGGTGCTCGC 59.831 55.000 0.00 0.00 0.00 5.03
830 831 0.804989 GGTTCAAATCCTGGTGCTCG 59.195 55.000 0.00 0.00 0.00 5.03
831 832 1.177401 GGGTTCAAATCCTGGTGCTC 58.823 55.000 0.00 0.00 0.00 4.26
832 833 0.779997 AGGGTTCAAATCCTGGTGCT 59.220 50.000 0.00 0.00 38.36 4.40
833 834 3.363787 AGGGTTCAAATCCTGGTGC 57.636 52.632 0.00 0.00 38.36 5.01
838 839 3.852578 AGTGGTATCAGGGTTCAAATCCT 59.147 43.478 0.00 0.00 41.23 3.24
839 840 3.947834 CAGTGGTATCAGGGTTCAAATCC 59.052 47.826 0.00 0.00 0.00 3.01
840 841 4.589908 ACAGTGGTATCAGGGTTCAAATC 58.410 43.478 0.00 0.00 0.00 2.17
841 842 4.567747 GGACAGTGGTATCAGGGTTCAAAT 60.568 45.833 0.00 0.00 0.00 2.32
842 843 3.244770 GGACAGTGGTATCAGGGTTCAAA 60.245 47.826 0.00 0.00 0.00 2.69
843 844 2.304761 GGACAGTGGTATCAGGGTTCAA 59.695 50.000 0.00 0.00 0.00 2.69
844 845 1.906574 GGACAGTGGTATCAGGGTTCA 59.093 52.381 0.00 0.00 0.00 3.18
845 846 1.906574 TGGACAGTGGTATCAGGGTTC 59.093 52.381 0.00 0.00 0.00 3.62
846 847 1.628846 GTGGACAGTGGTATCAGGGTT 59.371 52.381 0.00 0.00 0.00 4.11
847 848 1.276622 GTGGACAGTGGTATCAGGGT 58.723 55.000 0.00 0.00 0.00 4.34
848 849 0.541863 GGTGGACAGTGGTATCAGGG 59.458 60.000 0.00 0.00 0.00 4.45
849 850 1.573108 AGGTGGACAGTGGTATCAGG 58.427 55.000 0.00 0.00 0.00 3.86
850 851 3.118738 GGTTAGGTGGACAGTGGTATCAG 60.119 52.174 0.00 0.00 0.00 2.90
851 852 2.835764 GGTTAGGTGGACAGTGGTATCA 59.164 50.000 0.00 0.00 0.00 2.15
852 853 2.835764 TGGTTAGGTGGACAGTGGTATC 59.164 50.000 0.00 0.00 0.00 2.24
853 854 2.910544 TGGTTAGGTGGACAGTGGTAT 58.089 47.619 0.00 0.00 0.00 2.73
854 855 2.402182 TGGTTAGGTGGACAGTGGTA 57.598 50.000 0.00 0.00 0.00 3.25
855 856 1.628846 GATGGTTAGGTGGACAGTGGT 59.371 52.381 0.00 0.00 0.00 4.16
856 857 1.909302 AGATGGTTAGGTGGACAGTGG 59.091 52.381 0.00 0.00 0.00 4.00
857 858 2.567169 TGAGATGGTTAGGTGGACAGTG 59.433 50.000 0.00 0.00 0.00 3.66
858 859 2.902608 TGAGATGGTTAGGTGGACAGT 58.097 47.619 0.00 0.00 0.00 3.55
859 860 3.981071 TTGAGATGGTTAGGTGGACAG 57.019 47.619 0.00 0.00 0.00 3.51
860 861 3.843619 TGATTGAGATGGTTAGGTGGACA 59.156 43.478 0.00 0.00 0.00 4.02
861 862 4.192317 GTGATTGAGATGGTTAGGTGGAC 58.808 47.826 0.00 0.00 0.00 4.02
862 863 3.199946 GGTGATTGAGATGGTTAGGTGGA 59.800 47.826 0.00 0.00 0.00 4.02
863 864 3.545703 GGTGATTGAGATGGTTAGGTGG 58.454 50.000 0.00 0.00 0.00 4.61
864 865 3.198068 CGGTGATTGAGATGGTTAGGTG 58.802 50.000 0.00 0.00 0.00 4.00
865 866 2.170607 CCGGTGATTGAGATGGTTAGGT 59.829 50.000 0.00 0.00 0.00 3.08
866 867 2.170607 ACCGGTGATTGAGATGGTTAGG 59.829 50.000 6.12 0.00 0.00 2.69
867 868 3.543680 ACCGGTGATTGAGATGGTTAG 57.456 47.619 6.12 0.00 0.00 2.34
868 869 3.992943 AACCGGTGATTGAGATGGTTA 57.007 42.857 8.52 0.00 37.90 2.85
869 870 2.879103 AACCGGTGATTGAGATGGTT 57.121 45.000 8.52 0.00 35.00 3.67
870 871 3.992943 TTAACCGGTGATTGAGATGGT 57.007 42.857 8.52 0.00 0.00 3.55
871 872 4.512944 CAGATTAACCGGTGATTGAGATGG 59.487 45.833 8.52 0.00 0.00 3.51
872 873 4.024556 GCAGATTAACCGGTGATTGAGATG 60.025 45.833 8.52 1.14 0.00 2.90
873 874 4.130118 GCAGATTAACCGGTGATTGAGAT 58.870 43.478 8.52 0.00 0.00 2.75
874 875 3.531538 GCAGATTAACCGGTGATTGAGA 58.468 45.455 8.52 0.00 0.00 3.27
875 876 2.285220 CGCAGATTAACCGGTGATTGAG 59.715 50.000 8.52 0.79 0.00 3.02
876 877 2.276201 CGCAGATTAACCGGTGATTGA 58.724 47.619 8.52 0.00 0.00 2.57
877 878 1.330521 CCGCAGATTAACCGGTGATTG 59.669 52.381 8.52 4.05 37.36 2.67
878 879 1.663695 CCGCAGATTAACCGGTGATT 58.336 50.000 8.52 0.00 37.36 2.57
879 880 3.379650 CCGCAGATTAACCGGTGAT 57.620 52.632 8.52 5.47 37.36 3.06
880 881 4.924019 CCGCAGATTAACCGGTGA 57.076 55.556 8.52 0.00 37.36 4.02
883 884 0.878961 GCCTACCGCAGATTAACCGG 60.879 60.000 0.00 0.00 46.97 5.28
884 885 0.179094 TGCCTACCGCAGATTAACCG 60.179 55.000 0.00 0.00 44.64 4.44
885 886 3.772619 TGCCTACCGCAGATTAACC 57.227 52.632 0.00 0.00 44.64 2.85
895 896 1.656818 CCCAACAAGCATGCCTACCG 61.657 60.000 15.66 0.06 0.00 4.02
950 954 2.180131 CTGCTCTCTTGTTGGTGCGC 62.180 60.000 0.00 0.00 0.00 6.09
969 974 0.463204 TGCTCTGAGACTATGGCTGC 59.537 55.000 9.28 0.00 0.00 5.25
987 1004 1.202348 TGAGCCATATCGCCTCGTATG 59.798 52.381 0.00 0.00 0.00 2.39
990 1007 0.032678 CTTGAGCCATATCGCCTCGT 59.967 55.000 0.00 0.00 0.00 4.18
1014 1031 2.348472 TCTGGGGAAAAGATGGTGAGT 58.652 47.619 0.00 0.00 0.00 3.41
1015 1032 3.245052 ACTTCTGGGGAAAAGATGGTGAG 60.245 47.826 0.00 0.00 0.00 3.51
1016 1033 2.716424 ACTTCTGGGGAAAAGATGGTGA 59.284 45.455 0.00 0.00 0.00 4.02
1026 1043 1.625818 GAGAGCAGAACTTCTGGGGAA 59.374 52.381 18.53 0.00 44.43 3.97
1072 1095 1.078708 TTGCCAAGTAGTAGCGGCC 60.079 57.895 0.00 0.00 44.22 6.13
1308 1343 1.513373 GTGATCGTGCGTGCGTAGA 60.513 57.895 1.25 0.00 0.00 2.59
1407 1443 4.082523 GCCTGCCGCCAGTACTCA 62.083 66.667 0.00 0.00 37.38 3.41
1607 1643 0.955919 CACCCTGAAGAACTTCCCGC 60.956 60.000 11.30 0.00 38.77 6.13
1625 1661 2.217038 AGCTCGTTCCTGCCTTCCA 61.217 57.895 0.00 0.00 0.00 3.53
1893 1947 2.163412 CTCGTGTTGAAGAGAGAGGAGG 59.837 54.545 0.00 0.00 36.65 4.30
1976 2030 7.326063 CGGCTTAATTGGCAATACTATTTAAGC 59.674 37.037 28.64 28.64 46.79 3.09
1999 2059 3.216147 AGCACATGTTTTAATGTCGGC 57.784 42.857 0.00 0.00 38.75 5.54
2008 2068 9.255029 AGGGAGTAATTAATTAGCACATGTTTT 57.745 29.630 8.18 0.00 0.00 2.43
2010 2070 7.226720 CGAGGGAGTAATTAATTAGCACATGTT 59.773 37.037 8.18 0.00 0.00 2.71
2012 2072 6.147821 CCGAGGGAGTAATTAATTAGCACATG 59.852 42.308 8.18 0.00 0.00 3.21
2032 2092 3.074412 AGCTTATGTTTGTGAACCGAGG 58.926 45.455 0.00 0.00 34.80 4.63
2036 2096 5.897377 ATACCAGCTTATGTTTGTGAACC 57.103 39.130 0.00 0.00 34.80 3.62
2075 2135 9.403110 CACACTAAAATACGTCTATATACACCC 57.597 37.037 0.00 0.00 0.00 4.61
2076 2136 9.956720 ACACACTAAAATACGTCTATATACACC 57.043 33.333 0.00 0.00 0.00 4.16
2097 2157 4.034048 ACTGAAATGAGTGAACGAACACAC 59.966 41.667 15.83 11.41 42.45 3.82
2104 2164 2.404215 ACGGACTGAAATGAGTGAACG 58.596 47.619 0.00 0.00 0.00 3.95
2108 2168 5.651530 ACTACATACGGACTGAAATGAGTG 58.348 41.667 7.93 0.00 0.00 3.51
2112 2172 5.006153 TGGACTACATACGGACTGAAATG 57.994 43.478 0.00 0.00 0.00 2.32
2147 2207 7.680982 TCCGTTCACAAATATAAGATGTTTCG 58.319 34.615 0.00 0.00 0.00 3.46
2148 2208 8.665685 ACTCCGTTCACAAATATAAGATGTTTC 58.334 33.333 0.00 0.00 0.00 2.78
2271 2331 0.036388 GGCGAACTCCAGGACAATGA 60.036 55.000 0.00 0.00 0.00 2.57
2471 2531 2.124570 GCACTCCGCCATGGTGAT 60.125 61.111 27.12 8.81 39.52 3.06
2617 2681 4.648626 TCGGCAGCTGCTTTGGCT 62.649 61.111 35.82 0.00 41.70 4.75
2719 2783 1.078848 GTTGGCGAGCATGACCTCT 60.079 57.895 0.00 0.00 0.00 3.69
2822 2886 1.859302 ATGAGCTTCTCCTTCCGACT 58.141 50.000 0.00 0.00 0.00 4.18
2840 2904 5.826208 GGTATGGTATTTTCGGGACAAGAAT 59.174 40.000 0.00 0.00 0.00 2.40
2853 2917 6.191315 TGCATTTAGTGGTGGTATGGTATTT 58.809 36.000 0.00 0.00 0.00 1.40
2861 2925 5.242434 CAGTACTTGCATTTAGTGGTGGTA 58.758 41.667 0.00 0.00 0.00 3.25
2862 2926 4.072131 CAGTACTTGCATTTAGTGGTGGT 58.928 43.478 0.00 0.00 0.00 4.16
2863 2927 4.685169 CAGTACTTGCATTTAGTGGTGG 57.315 45.455 0.00 0.00 0.00 4.61
2875 2939 3.073535 TGCTGTGCATGCAGTACTTGC 62.074 52.381 23.41 17.99 46.82 4.01
2876 2940 0.876399 TGCTGTGCATGCAGTACTTG 59.124 50.000 23.41 8.72 38.65 3.16
2877 2941 0.877071 GTGCTGTGCATGCAGTACTT 59.123 50.000 23.41 0.00 44.79 2.24
2878 2942 2.548178 GTGCTGTGCATGCAGTACT 58.452 52.632 23.41 0.00 44.79 2.73
2880 2944 1.236616 GGTGTGCTGTGCATGCAGTA 61.237 55.000 23.41 12.61 41.91 2.74
2881 2945 2.558286 GGTGTGCTGTGCATGCAGT 61.558 57.895 23.41 0.00 41.91 4.40
2882 2946 2.257371 GGTGTGCTGTGCATGCAG 59.743 61.111 23.41 11.99 41.91 4.41
2883 2947 3.662153 CGGTGTGCTGTGCATGCA 61.662 61.111 18.46 18.46 41.91 3.96
2884 2948 2.244436 CTACGGTGTGCTGTGCATGC 62.244 60.000 11.82 11.82 41.91 4.06
2885 2949 0.950555 ACTACGGTGTGCTGTGCATG 60.951 55.000 0.00 0.00 41.91 4.06
2886 2950 0.606096 TACTACGGTGTGCTGTGCAT 59.394 50.000 0.00 0.00 41.91 3.96
2887 2951 0.606096 ATACTACGGTGTGCTGTGCA 59.394 50.000 0.00 0.00 35.51 4.57
2888 2952 2.460918 CTATACTACGGTGTGCTGTGC 58.539 52.381 0.00 0.00 35.51 4.57
2889 2953 2.099263 AGCTATACTACGGTGTGCTGTG 59.901 50.000 0.00 0.00 35.51 3.66
2890 2954 2.376109 AGCTATACTACGGTGTGCTGT 58.624 47.619 0.00 0.00 37.98 4.40
2891 2955 3.438297 AAGCTATACTACGGTGTGCTG 57.562 47.619 0.00 0.00 31.26 4.41
2892 2956 5.587388 TTTAAGCTATACTACGGTGTGCT 57.413 39.130 0.00 0.00 0.00 4.40
2893 2957 6.839820 AATTTAAGCTATACTACGGTGTGC 57.160 37.500 0.00 0.00 0.00 4.57
2916 2980 9.713713 TGGAAAATCATATCGGAATTCGTATAA 57.286 29.630 0.00 0.00 40.32 0.98
2917 2981 9.713713 TTGGAAAATCATATCGGAATTCGTATA 57.286 29.630 0.00 0.40 40.32 1.47
2918 2982 8.615878 TTGGAAAATCATATCGGAATTCGTAT 57.384 30.769 0.00 0.00 40.32 3.06
2919 2983 8.615878 ATTGGAAAATCATATCGGAATTCGTA 57.384 30.769 0.00 0.00 40.32 3.43
2920 2984 6.935741 TTGGAAAATCATATCGGAATTCGT 57.064 33.333 0.00 0.00 40.32 3.85
2921 2985 9.329913 GTTATTGGAAAATCATATCGGAATTCG 57.670 33.333 0.00 0.00 40.90 3.34
2922 2986 9.329913 CGTTATTGGAAAATCATATCGGAATTC 57.670 33.333 0.00 0.00 0.00 2.17
2923 2987 8.846211 ACGTTATTGGAAAATCATATCGGAATT 58.154 29.630 0.00 0.00 0.00 2.17
2924 2988 8.289618 CACGTTATTGGAAAATCATATCGGAAT 58.710 33.333 0.00 0.00 0.00 3.01
2925 2989 7.254966 CCACGTTATTGGAAAATCATATCGGAA 60.255 37.037 0.00 0.00 39.24 4.30
2926 2990 6.203915 CCACGTTATTGGAAAATCATATCGGA 59.796 38.462 0.00 0.00 39.24 4.55
2927 2991 6.370593 CCACGTTATTGGAAAATCATATCGG 58.629 40.000 0.00 0.00 39.24 4.18
2928 2992 6.203915 TCCCACGTTATTGGAAAATCATATCG 59.796 38.462 0.00 0.00 39.24 2.92
2929 2993 7.444183 TCTCCCACGTTATTGGAAAATCATATC 59.556 37.037 0.00 0.00 39.24 1.63
2930 2994 7.228706 GTCTCCCACGTTATTGGAAAATCATAT 59.771 37.037 0.00 0.00 39.24 1.78
2931 2995 6.540914 GTCTCCCACGTTATTGGAAAATCATA 59.459 38.462 0.00 0.00 39.24 2.15
2932 2996 5.357032 GTCTCCCACGTTATTGGAAAATCAT 59.643 40.000 0.00 0.00 39.24 2.45
2933 2997 4.698304 GTCTCCCACGTTATTGGAAAATCA 59.302 41.667 0.00 0.00 39.24 2.57
2934 2998 4.941873 AGTCTCCCACGTTATTGGAAAATC 59.058 41.667 0.00 0.00 39.24 2.17
2935 2999 4.918588 AGTCTCCCACGTTATTGGAAAAT 58.081 39.130 0.00 0.00 39.24 1.82
2936 3000 4.360951 AGTCTCCCACGTTATTGGAAAA 57.639 40.909 0.00 0.00 39.24 2.29
2937 3001 4.283978 TGTAGTCTCCCACGTTATTGGAAA 59.716 41.667 0.00 0.00 39.24 3.13
2938 3002 3.833650 TGTAGTCTCCCACGTTATTGGAA 59.166 43.478 0.00 0.00 39.24 3.53
2939 3003 3.433343 TGTAGTCTCCCACGTTATTGGA 58.567 45.455 0.00 0.00 39.24 3.53
2940 3004 3.880047 TGTAGTCTCCCACGTTATTGG 57.120 47.619 0.00 0.00 36.26 3.16
2941 3005 6.334989 TGTATTGTAGTCTCCCACGTTATTG 58.665 40.000 0.00 0.00 0.00 1.90
2942 3006 6.534475 TGTATTGTAGTCTCCCACGTTATT 57.466 37.500 0.00 0.00 0.00 1.40
2943 3007 6.534475 TTGTATTGTAGTCTCCCACGTTAT 57.466 37.500 0.00 0.00 0.00 1.89
2944 3008 5.622914 GCTTGTATTGTAGTCTCCCACGTTA 60.623 44.000 0.00 0.00 0.00 3.18
2945 3009 4.817517 CTTGTATTGTAGTCTCCCACGTT 58.182 43.478 0.00 0.00 0.00 3.99
2946 3010 3.368116 GCTTGTATTGTAGTCTCCCACGT 60.368 47.826 0.00 0.00 0.00 4.49
2947 3011 3.119101 AGCTTGTATTGTAGTCTCCCACG 60.119 47.826 0.00 0.00 0.00 4.94
2948 3012 4.473477 AGCTTGTATTGTAGTCTCCCAC 57.527 45.455 0.00 0.00 0.00 4.61
2949 3013 5.105064 GGTTAGCTTGTATTGTAGTCTCCCA 60.105 44.000 0.00 0.00 0.00 4.37
2950 3014 5.105064 TGGTTAGCTTGTATTGTAGTCTCCC 60.105 44.000 0.00 0.00 0.00 4.30
2951 3015 5.974108 TGGTTAGCTTGTATTGTAGTCTCC 58.026 41.667 0.00 0.00 0.00 3.71
2952 3016 7.868415 CCTATGGTTAGCTTGTATTGTAGTCTC 59.132 40.741 0.00 0.00 0.00 3.36
2953 3017 7.344871 ACCTATGGTTAGCTTGTATTGTAGTCT 59.655 37.037 0.00 0.00 27.29 3.24
2954 3018 7.498443 ACCTATGGTTAGCTTGTATTGTAGTC 58.502 38.462 0.00 0.00 27.29 2.59
2955 3019 7.433537 ACCTATGGTTAGCTTGTATTGTAGT 57.566 36.000 0.00 0.00 27.29 2.73
2956 3020 7.254795 GCAACCTATGGTTAGCTTGTATTGTAG 60.255 40.741 0.00 0.00 45.01 2.74
2957 3021 6.540914 GCAACCTATGGTTAGCTTGTATTGTA 59.459 38.462 0.00 0.00 45.01 2.41
2958 3022 5.357032 GCAACCTATGGTTAGCTTGTATTGT 59.643 40.000 0.00 0.00 45.01 2.71
2959 3023 5.221048 GGCAACCTATGGTTAGCTTGTATTG 60.221 44.000 16.84 0.00 45.01 1.90
2960 3024 4.887655 GGCAACCTATGGTTAGCTTGTATT 59.112 41.667 16.84 0.00 45.01 1.89
2961 3025 4.080015 TGGCAACCTATGGTTAGCTTGTAT 60.080 41.667 16.84 0.00 45.01 2.29
2962 3026 3.264706 TGGCAACCTATGGTTAGCTTGTA 59.735 43.478 16.84 5.82 45.01 2.41
2963 3027 2.041081 TGGCAACCTATGGTTAGCTTGT 59.959 45.455 16.84 0.00 45.01 3.16
2964 3028 2.722094 TGGCAACCTATGGTTAGCTTG 58.278 47.619 16.84 3.55 45.01 4.01
2965 3029 3.449746 TTGGCAACCTATGGTTAGCTT 57.550 42.857 16.84 0.00 45.01 3.74
2966 3030 3.449746 TTTGGCAACCTATGGTTAGCT 57.550 42.857 0.00 0.00 45.01 3.32
2967 3031 4.736126 ATTTTGGCAACCTATGGTTAGC 57.264 40.909 0.00 8.13 45.01 3.09
2968 3032 7.639113 TTCTATTTTGGCAACCTATGGTTAG 57.361 36.000 0.00 0.00 45.01 2.34
2969 3033 8.423906 TTTTCTATTTTGGCAACCTATGGTTA 57.576 30.769 0.00 0.00 45.01 2.85
2971 3035 6.926630 TTTTCTATTTTGGCAACCTATGGT 57.073 33.333 0.00 0.00 37.65 3.55
2972 3036 8.040132 TCAATTTTCTATTTTGGCAACCTATGG 58.960 33.333 0.00 0.00 0.00 2.74
2973 3037 9.434420 TTCAATTTTCTATTTTGGCAACCTATG 57.566 29.630 0.00 0.00 0.00 2.23
2975 3039 9.434420 CATTCAATTTTCTATTTTGGCAACCTA 57.566 29.630 0.00 0.00 0.00 3.08
2976 3040 7.938490 ACATTCAATTTTCTATTTTGGCAACCT 59.062 29.630 0.00 0.00 0.00 3.50
2977 3041 8.016801 CACATTCAATTTTCTATTTTGGCAACC 58.983 33.333 0.00 0.00 0.00 3.77
2978 3042 8.772705 TCACATTCAATTTTCTATTTTGGCAAC 58.227 29.630 0.00 0.00 0.00 4.17
2979 3043 8.899427 TCACATTCAATTTTCTATTTTGGCAA 57.101 26.923 0.00 0.00 0.00 4.52
2980 3044 8.772705 GTTCACATTCAATTTTCTATTTTGGCA 58.227 29.630 0.00 0.00 0.00 4.92
2981 3045 8.229811 GGTTCACATTCAATTTTCTATTTTGGC 58.770 33.333 0.00 0.00 0.00 4.52
2982 3046 8.434661 CGGTTCACATTCAATTTTCTATTTTGG 58.565 33.333 0.00 0.00 0.00 3.28
2983 3047 7.951565 GCGGTTCACATTCAATTTTCTATTTTG 59.048 33.333 0.00 0.00 0.00 2.44
2984 3048 7.117667 GGCGGTTCACATTCAATTTTCTATTTT 59.882 33.333 0.00 0.00 0.00 1.82
2985 3049 6.589907 GGCGGTTCACATTCAATTTTCTATTT 59.410 34.615 0.00 0.00 0.00 1.40
2986 3050 6.099341 GGCGGTTCACATTCAATTTTCTATT 58.901 36.000 0.00 0.00 0.00 1.73
2987 3051 5.650543 GGCGGTTCACATTCAATTTTCTAT 58.349 37.500 0.00 0.00 0.00 1.98
2988 3052 4.378978 CGGCGGTTCACATTCAATTTTCTA 60.379 41.667 0.00 0.00 0.00 2.10
2989 3053 3.611530 CGGCGGTTCACATTCAATTTTCT 60.612 43.478 0.00 0.00 0.00 2.52
2990 3054 2.661195 CGGCGGTTCACATTCAATTTTC 59.339 45.455 0.00 0.00 0.00 2.29
2991 3055 2.609244 CCGGCGGTTCACATTCAATTTT 60.609 45.455 19.97 0.00 0.00 1.82
2992 3056 1.067915 CCGGCGGTTCACATTCAATTT 60.068 47.619 19.97 0.00 0.00 1.82
2993 3057 0.525761 CCGGCGGTTCACATTCAATT 59.474 50.000 19.97 0.00 0.00 2.32
2994 3058 0.322098 TCCGGCGGTTCACATTCAAT 60.322 50.000 27.32 0.00 0.00 2.57
2995 3059 0.322098 ATCCGGCGGTTCACATTCAA 60.322 50.000 27.32 1.79 0.00 2.69
2996 3060 0.742990 GATCCGGCGGTTCACATTCA 60.743 55.000 27.42 6.38 0.00 2.57
2997 3061 0.462047 AGATCCGGCGGTTCACATTC 60.462 55.000 31.90 16.26 0.00 2.67
2998 3062 0.035439 AAGATCCGGCGGTTCACATT 60.035 50.000 31.90 18.58 0.00 2.71
2999 3063 0.744414 CAAGATCCGGCGGTTCACAT 60.744 55.000 31.90 17.18 0.00 3.21
3000 3064 1.375396 CAAGATCCGGCGGTTCACA 60.375 57.895 31.90 13.00 0.00 3.58
3001 3065 2.106683 CCAAGATCCGGCGGTTCAC 61.107 63.158 31.90 19.09 0.00 3.18
3002 3066 1.622607 ATCCAAGATCCGGCGGTTCA 61.623 55.000 31.90 16.36 0.00 3.18
3003 3067 1.146263 ATCCAAGATCCGGCGGTTC 59.854 57.895 27.32 26.38 0.00 3.62
3004 3068 1.153168 CATCCAAGATCCGGCGGTT 60.153 57.895 27.32 18.90 0.00 4.44
3005 3069 2.505982 CATCCAAGATCCGGCGGT 59.494 61.111 27.32 13.58 0.00 5.68
3006 3070 2.116983 ATCCATCCAAGATCCGGCGG 62.117 60.000 22.51 22.51 0.00 6.13
3007 3071 0.952497 CATCCATCCAAGATCCGGCG 60.952 60.000 0.00 0.00 0.00 6.46
3008 3072 1.239968 GCATCCATCCAAGATCCGGC 61.240 60.000 0.00 0.00 0.00 6.13
3009 3073 0.607489 GGCATCCATCCAAGATCCGG 60.607 60.000 0.00 0.00 0.00 5.14
3010 3074 0.607489 GGGCATCCATCCAAGATCCG 60.607 60.000 0.00 0.00 0.00 4.18
3011 3075 0.251519 GGGGCATCCATCCAAGATCC 60.252 60.000 0.00 0.00 35.00 3.36
3012 3076 0.479815 TGGGGCATCCATCCAAGATC 59.520 55.000 0.00 0.00 41.46 2.75
3013 3077 2.649472 TGGGGCATCCATCCAAGAT 58.351 52.632 0.00 0.00 41.46 2.40
3014 3078 4.185153 TGGGGCATCCATCCAAGA 57.815 55.556 0.00 0.00 41.46 3.02
3022 3086 4.080863 CCTACACTAGAATATGGGGCATCC 60.081 50.000 0.00 0.00 0.00 3.51
3023 3087 4.777896 TCCTACACTAGAATATGGGGCATC 59.222 45.833 0.00 0.00 0.00 3.91
3024 3088 4.763355 TCCTACACTAGAATATGGGGCAT 58.237 43.478 0.00 0.00 0.00 4.40
3025 3089 4.160329 CTCCTACACTAGAATATGGGGCA 58.840 47.826 0.00 0.00 0.00 5.36
3026 3090 3.055747 GCTCCTACACTAGAATATGGGGC 60.056 52.174 0.00 0.00 32.21 5.80
3027 3091 4.221703 CAGCTCCTACACTAGAATATGGGG 59.778 50.000 0.00 0.00 0.00 4.96
3028 3092 4.322349 GCAGCTCCTACACTAGAATATGGG 60.322 50.000 0.00 0.00 0.00 4.00
3029 3093 4.526262 AGCAGCTCCTACACTAGAATATGG 59.474 45.833 0.00 0.00 0.00 2.74
3030 3094 5.468592 CAGCAGCTCCTACACTAGAATATG 58.531 45.833 0.00 0.00 0.00 1.78
3031 3095 4.526262 CCAGCAGCTCCTACACTAGAATAT 59.474 45.833 0.00 0.00 0.00 1.28
3032 3096 3.891977 CCAGCAGCTCCTACACTAGAATA 59.108 47.826 0.00 0.00 0.00 1.75
3033 3097 2.697751 CCAGCAGCTCCTACACTAGAAT 59.302 50.000 0.00 0.00 0.00 2.40
3034 3098 2.103373 CCAGCAGCTCCTACACTAGAA 58.897 52.381 0.00 0.00 0.00 2.10
3035 3099 1.285078 TCCAGCAGCTCCTACACTAGA 59.715 52.381 0.00 0.00 0.00 2.43
3036 3100 1.680735 CTCCAGCAGCTCCTACACTAG 59.319 57.143 0.00 0.00 0.00 2.57
3037 3101 1.686428 CCTCCAGCAGCTCCTACACTA 60.686 57.143 0.00 0.00 0.00 2.74
3038 3102 0.975040 CCTCCAGCAGCTCCTACACT 60.975 60.000 0.00 0.00 0.00 3.55
3039 3103 1.519719 CCTCCAGCAGCTCCTACAC 59.480 63.158 0.00 0.00 0.00 2.90
3040 3104 1.687146 CCCTCCAGCAGCTCCTACA 60.687 63.158 0.00 0.00 0.00 2.74
3041 3105 3.100503 GCCCTCCAGCAGCTCCTAC 62.101 68.421 0.00 0.00 0.00 3.18
3042 3106 2.765807 GCCCTCCAGCAGCTCCTA 60.766 66.667 0.00 0.00 0.00 2.94
3043 3107 4.737476 AGCCCTCCAGCAGCTCCT 62.737 66.667 0.00 0.00 34.23 3.69
3044 3108 3.279504 AAAGCCCTCCAGCAGCTCC 62.280 63.158 0.00 0.00 35.30 4.70
3045 3109 2.045131 CAAAGCCCTCCAGCAGCTC 61.045 63.158 0.00 0.00 35.30 4.09
3046 3110 2.035312 CAAAGCCCTCCAGCAGCT 59.965 61.111 0.00 0.00 38.88 4.24
3047 3111 1.871126 GAACAAAGCCCTCCAGCAGC 61.871 60.000 0.00 0.00 34.23 5.25
3048 3112 0.538057 TGAACAAAGCCCTCCAGCAG 60.538 55.000 0.00 0.00 34.23 4.24
3049 3113 0.112995 ATGAACAAAGCCCTCCAGCA 59.887 50.000 0.00 0.00 34.23 4.41
3050 3114 1.260544 AATGAACAAAGCCCTCCAGC 58.739 50.000 0.00 0.00 0.00 4.85
3051 3115 2.892852 TGAAATGAACAAAGCCCTCCAG 59.107 45.455 0.00 0.00 0.00 3.86
3052 3116 2.627699 GTGAAATGAACAAAGCCCTCCA 59.372 45.455 0.00 0.00 0.00 3.86
3053 3117 2.351738 CGTGAAATGAACAAAGCCCTCC 60.352 50.000 0.00 0.00 0.00 4.30
3054 3118 2.552315 TCGTGAAATGAACAAAGCCCTC 59.448 45.455 0.00 0.00 0.00 4.30
3055 3119 2.554032 CTCGTGAAATGAACAAAGCCCT 59.446 45.455 0.00 0.00 0.00 5.19
3056 3120 2.922335 GCTCGTGAAATGAACAAAGCCC 60.922 50.000 0.00 0.00 0.00 5.19
3057 3121 2.319472 GCTCGTGAAATGAACAAAGCC 58.681 47.619 0.00 0.00 0.00 4.35
3058 3122 2.030805 AGGCTCGTGAAATGAACAAAGC 60.031 45.455 0.00 0.00 0.00 3.51
3059 3123 3.558505 CAGGCTCGTGAAATGAACAAAG 58.441 45.455 0.00 0.00 0.00 2.77
3060 3124 2.287547 GCAGGCTCGTGAAATGAACAAA 60.288 45.455 0.00 0.00 0.00 2.83
3061 3125 1.266718 GCAGGCTCGTGAAATGAACAA 59.733 47.619 0.00 0.00 0.00 2.83
3062 3126 0.874390 GCAGGCTCGTGAAATGAACA 59.126 50.000 0.00 0.00 0.00 3.18
3063 3127 1.129437 GAGCAGGCTCGTGAAATGAAC 59.871 52.381 5.41 0.00 33.06 3.18
3064 3128 1.002430 AGAGCAGGCTCGTGAAATGAA 59.998 47.619 15.02 0.00 46.90 2.57
3065 3129 0.610174 AGAGCAGGCTCGTGAAATGA 59.390 50.000 15.02 0.00 46.90 2.57
3066 3130 1.446907 AAGAGCAGGCTCGTGAAATG 58.553 50.000 15.02 0.00 46.90 2.32
3067 3131 2.898705 CTAAGAGCAGGCTCGTGAAAT 58.101 47.619 17.95 4.55 46.90 2.17
3068 3132 1.673033 GCTAAGAGCAGGCTCGTGAAA 60.673 52.381 17.95 0.00 46.90 2.69
3069 3133 0.108615 GCTAAGAGCAGGCTCGTGAA 60.109 55.000 17.95 0.47 46.90 3.18
3070 3134 1.513158 GCTAAGAGCAGGCTCGTGA 59.487 57.895 17.95 6.36 46.90 4.35
3071 3135 1.520342 GGCTAAGAGCAGGCTCGTG 60.520 63.158 17.95 11.86 44.75 4.35
3072 3136 1.544825 TTGGCTAAGAGCAGGCTCGT 61.545 55.000 15.02 14.43 44.75 4.18
3073 3137 0.179062 ATTGGCTAAGAGCAGGCTCG 60.179 55.000 15.02 3.27 44.75 5.03
3074 3138 1.140652 AGATTGGCTAAGAGCAGGCTC 59.859 52.381 13.27 13.27 44.75 4.70
3075 3139 1.211456 AGATTGGCTAAGAGCAGGCT 58.789 50.000 0.00 0.00 44.75 4.58
3076 3140 2.366916 TCTAGATTGGCTAAGAGCAGGC 59.633 50.000 0.21 0.00 44.75 4.85
3077 3141 3.554752 GCTCTAGATTGGCTAAGAGCAGG 60.555 52.174 14.55 0.00 44.75 4.85
3078 3142 3.069300 TGCTCTAGATTGGCTAAGAGCAG 59.931 47.826 17.30 0.00 45.15 4.24
3079 3143 3.033909 TGCTCTAGATTGGCTAAGAGCA 58.966 45.455 17.30 17.30 46.29 4.26
3080 3144 3.389221 GTGCTCTAGATTGGCTAAGAGC 58.611 50.000 13.02 13.02 43.29 4.09
3081 3145 3.244044 GGGTGCTCTAGATTGGCTAAGAG 60.244 52.174 0.00 0.00 32.31 2.85
3082 3146 2.700897 GGGTGCTCTAGATTGGCTAAGA 59.299 50.000 0.00 0.00 0.00 2.10
3083 3147 2.435805 TGGGTGCTCTAGATTGGCTAAG 59.564 50.000 0.00 0.00 0.00 2.18
3084 3148 2.477245 TGGGTGCTCTAGATTGGCTAA 58.523 47.619 0.00 0.00 0.00 3.09
3085 3149 2.174685 TGGGTGCTCTAGATTGGCTA 57.825 50.000 0.00 0.00 0.00 3.93
3086 3150 1.419387 GATGGGTGCTCTAGATTGGCT 59.581 52.381 0.00 0.00 0.00 4.75
3087 3151 1.875576 CGATGGGTGCTCTAGATTGGC 60.876 57.143 0.00 0.00 0.00 4.52
3088 3152 1.688735 TCGATGGGTGCTCTAGATTGG 59.311 52.381 0.00 0.00 0.00 3.16
3089 3153 3.583806 GATCGATGGGTGCTCTAGATTG 58.416 50.000 0.54 0.00 0.00 2.67
3090 3154 2.564947 GGATCGATGGGTGCTCTAGATT 59.435 50.000 0.54 0.00 0.00 2.40
3091 3155 2.175202 GGATCGATGGGTGCTCTAGAT 58.825 52.381 0.54 0.00 0.00 1.98
3092 3156 1.621992 GGATCGATGGGTGCTCTAGA 58.378 55.000 0.54 0.00 0.00 2.43
3093 3157 0.242286 CGGATCGATGGGTGCTCTAG 59.758 60.000 0.54 0.00 0.00 2.43
3094 3158 0.179001 TCGGATCGATGGGTGCTCTA 60.179 55.000 0.54 0.00 0.00 2.43
3095 3159 1.455773 TCGGATCGATGGGTGCTCT 60.456 57.895 0.54 0.00 0.00 4.09
3096 3160 1.006805 CTCGGATCGATGGGTGCTC 60.007 63.158 0.54 0.00 34.61 4.26
3097 3161 0.829602 ATCTCGGATCGATGGGTGCT 60.830 55.000 0.54 0.00 34.61 4.40
3098 3162 0.034059 AATCTCGGATCGATGGGTGC 59.966 55.000 0.54 0.00 34.61 5.01
3099 3163 2.138320 CAAATCTCGGATCGATGGGTG 58.862 52.381 0.54 0.00 34.61 4.61
3100 3164 2.039418 TCAAATCTCGGATCGATGGGT 58.961 47.619 0.54 0.00 34.61 4.51
3101 3165 2.820059 TCAAATCTCGGATCGATGGG 57.180 50.000 0.54 0.00 34.61 4.00
3102 3166 2.998670 CCATCAAATCTCGGATCGATGG 59.001 50.000 19.35 19.35 42.73 3.51
3103 3167 3.657634 ACCATCAAATCTCGGATCGATG 58.342 45.455 0.54 13.50 34.61 3.84
3104 3168 4.342862 AACCATCAAATCTCGGATCGAT 57.657 40.909 0.00 0.00 34.61 3.59
3105 3169 3.819564 AACCATCAAATCTCGGATCGA 57.180 42.857 0.00 0.00 0.00 3.59
3106 3170 3.741344 GGTAACCATCAAATCTCGGATCG 59.259 47.826 0.00 0.00 0.00 3.69
3107 3171 4.962155 AGGTAACCATCAAATCTCGGATC 58.038 43.478 0.00 0.00 37.17 3.36
3108 3172 5.373812 AAGGTAACCATCAAATCTCGGAT 57.626 39.130 0.00 0.00 37.17 4.18
3109 3173 4.837093 AAGGTAACCATCAAATCTCGGA 57.163 40.909 0.00 0.00 37.17 4.55
3110 3174