Multiple sequence alignment - TraesCS5B01G473900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G473900 chr5B 100.000 2457 0 0 1 2457 647781428 647778972 0.000000e+00 4538
1 TraesCS5B01G473900 chr5B 97.887 2461 47 3 1 2457 647699050 647696591 0.000000e+00 4252
2 TraesCS5B01G473900 chr5B 90.515 1982 162 13 1 1961 647405782 647403806 0.000000e+00 2595
3 TraesCS5B01G473900 chr5B 89.746 1024 84 9 1 1008 647733134 647732116 0.000000e+00 1290
4 TraesCS5B01G473900 chr5B 86.640 494 52 9 1 483 647659937 647659447 3.600000e-148 534
5 TraesCS5B01G473900 chr5D 90.343 2475 205 18 1 2452 515026032 515023569 0.000000e+00 3216
6 TraesCS5B01G473900 chr5D 90.113 2478 208 22 1 2455 514996675 514994212 0.000000e+00 3184
7 TraesCS5B01G473900 chr5D 89.665 2477 217 20 1 2452 514948830 514946368 0.000000e+00 3120
8 TraesCS5B01G473900 chr5D 89.535 2475 216 26 1 2452 514975238 514972784 0.000000e+00 3096
9 TraesCS5B01G473900 chr5D 89.489 1684 149 18 1 1669 514967506 514965836 0.000000e+00 2104
10 TraesCS5B01G473900 chr5A 87.550 2241 224 37 247 2457 643034536 643032321 0.000000e+00 2542
11 TraesCS5B01G473900 chr5A 86.626 2318 258 36 171 2457 643042713 643040417 0.000000e+00 2516
12 TraesCS5B01G473900 chr5A 87.745 2146 224 21 171 2288 643029622 643027488 0.000000e+00 2470
13 TraesCS5B01G473900 chr5A 88.363 1942 196 22 530 2457 643047361 643045436 0.000000e+00 2307
14 TraesCS5B01G473900 chr5A 88.008 1943 198 26 530 2457 643039746 643037824 0.000000e+00 2265


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G473900 chr5B 647778972 647781428 2456 True 4538 4538 100.0000 1 2457 1 chr5B.!!$R5 2456
1 TraesCS5B01G473900 chr5B 647696591 647699050 2459 True 4252 4252 97.8870 1 2457 1 chr5B.!!$R3 2456
2 TraesCS5B01G473900 chr5B 647403806 647405782 1976 True 2595 2595 90.5150 1 1961 1 chr5B.!!$R1 1960
3 TraesCS5B01G473900 chr5B 647732116 647733134 1018 True 1290 1290 89.7460 1 1008 1 chr5B.!!$R4 1007
4 TraesCS5B01G473900 chr5D 515023569 515026032 2463 True 3216 3216 90.3430 1 2452 1 chr5D.!!$R5 2451
5 TraesCS5B01G473900 chr5D 514994212 514996675 2463 True 3184 3184 90.1130 1 2455 1 chr5D.!!$R4 2454
6 TraesCS5B01G473900 chr5D 514946368 514948830 2462 True 3120 3120 89.6650 1 2452 1 chr5D.!!$R1 2451
7 TraesCS5B01G473900 chr5D 514972784 514975238 2454 True 3096 3096 89.5350 1 2452 1 chr5D.!!$R3 2451
8 TraesCS5B01G473900 chr5D 514965836 514967506 1670 True 2104 2104 89.4890 1 1669 1 chr5D.!!$R2 1668
9 TraesCS5B01G473900 chr5A 643027488 643047361 19873 True 2420 2542 87.6584 171 2457 5 chr5A.!!$R1 2286

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
156 158 1.692519 ACCGTGATCCCCTATACTTGC 59.307 52.381 0.0 0.0 0.0 4.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2146 14763 0.524862 GAGCAGGTGAAGCAACCATG 59.475 55.0 6.09 0.0 43.2 3.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
156 158 1.692519 ACCGTGATCCCCTATACTTGC 59.307 52.381 0.00 0.0 0.00 4.01
232 4711 2.708051 TCGTCGATCAGGAGTAGTTGT 58.292 47.619 0.00 0.0 0.00 3.32
340 4826 8.567198 TCCTCTCAATTAGATCCTTCCAAATA 57.433 34.615 0.00 0.0 32.41 1.40
548 5047 3.873952 CCTCCAATCACTTTAGCAGCTAC 59.126 47.826 0.00 0.0 0.00 3.58
1272 13876 4.660789 ACGTAGTGTTCAAGTACAACCT 57.339 40.909 0.00 0.0 42.51 3.50
1286 13890 3.207265 ACAACCTGAGTATGCACAACA 57.793 42.857 0.00 0.0 0.00 3.33
1339 13943 1.215382 CATTGTCTCGAGCCCGTCA 59.785 57.895 7.81 0.0 37.05 4.35
1773 14382 4.469657 TCACCAAAAGTACAAAGCATCCT 58.530 39.130 0.00 0.0 0.00 3.24
1903 14512 2.926200 CAGCCGACAAGACTTCATACAG 59.074 50.000 0.00 0.0 0.00 2.74
1912 14522 3.669949 AGACTTCATACAGGCCCCTTAT 58.330 45.455 0.00 0.0 0.00 1.73
2117 14734 1.555075 TGTGGATTGGAGCTGGAGTAC 59.445 52.381 0.00 0.0 0.00 2.73
2136 14753 9.483489 TGGAGTACCATCTAGTTCATTTTACTA 57.517 33.333 0.00 0.0 41.77 1.82
2146 14763 9.640963 TCTAGTTCATTTTACTAGAGCAAAGAC 57.359 33.333 8.28 0.0 45.54 3.01
2393 15012 8.621286 GGGTAAATCATTGATTAGTGGTAAGTG 58.379 37.037 12.15 0.0 31.46 3.16
2426 15045 5.938125 AGGCTAGAAAAATAAGAGAAACGCA 59.062 36.000 0.00 0.0 0.00 5.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
77 78 0.779997 ACACAAGGGGAGCCAAAGAT 59.220 50.000 0.00 0.0 0.00 2.40
156 158 3.386726 TGGAATGACCTACTGATAACCCG 59.613 47.826 0.00 0.0 39.86 5.28
298 4784 6.356556 TGAGAGGAAAATTTGTGAGACTTGA 58.643 36.000 0.00 0.0 0.00 3.02
340 4826 6.094464 GGTTAACAAGCAGTAAACCCGATTAT 59.906 38.462 8.10 0.0 34.75 1.28
342 4828 4.216902 GGTTAACAAGCAGTAAACCCGATT 59.783 41.667 8.10 0.0 34.75 3.34
548 5047 6.204882 AGTTCCTAATCTTGACTTTTCAACCG 59.795 38.462 0.00 0.0 36.79 4.44
1286 13890 0.842030 TCTTCTCCCACCTGCACCAT 60.842 55.000 0.00 0.0 0.00 3.55
1445 14049 4.480541 CGCGAGATCTATTAAGCAGTGAT 58.519 43.478 0.00 0.0 0.00 3.06
1903 14512 1.420514 GGAACTAGTCCATAAGGGGCC 59.579 57.143 0.00 0.0 44.85 5.80
2146 14763 0.524862 GAGCAGGTGAAGCAACCATG 59.475 55.000 6.09 0.0 43.20 3.66
2424 15043 3.460857 AAGTATCTCTCCGGATTGTGC 57.539 47.619 3.57 0.0 0.00 4.57
2426 15045 4.030913 TGGAAAGTATCTCTCCGGATTGT 58.969 43.478 3.57 0.0 31.37 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.