Multiple sequence alignment - TraesCS5B01G473800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G473800 chr5B 100.000 2457 0 0 1 2457 647699047 647696591 0.000000e+00 4538
1 TraesCS5B01G473800 chr5B 97.884 2458 47 3 1 2457 647781425 647778972 0.000000e+00 4246
2 TraesCS5B01G473800 chr5B 90.666 1982 155 14 1 1960 647405779 647403806 0.000000e+00 2608
3 TraesCS5B01G473800 chr5B 90.623 1941 146 17 159 2078 647464822 647462897 0.000000e+00 2543
4 TraesCS5B01G473800 chr5B 89.551 1024 83 9 1 1008 647733131 647732116 0.000000e+00 1277
5 TraesCS5B01G473800 chr5B 86.842 494 48 9 1 483 647659934 647659447 1.000000e-148 536
6 TraesCS5B01G473800 chr5B 82.143 168 21 8 2266 2431 577090430 577090590 4.260000e-28 135
7 TraesCS5B01G473800 chr5D 90.303 2475 203 18 1 2452 515026029 515023569 0.000000e+00 3206
8 TraesCS5B01G473800 chr5D 89.988 2477 208 21 2 2455 514996671 514994212 0.000000e+00 3164
9 TraesCS5B01G473800 chr5D 89.588 2478 214 22 1 2452 514948827 514946368 0.000000e+00 3107
10 TraesCS5B01G473800 chr5D 89.418 2476 214 28 1 2452 514975235 514972784 0.000000e+00 3077
11 TraesCS5B01G473800 chr5D 89.371 1684 148 18 1 1669 514967503 514965836 0.000000e+00 2089
12 TraesCS5B01G473800 chr5A 87.556 2242 222 39 247 2457 643034536 643032321 0.000000e+00 2542
13 TraesCS5B01G473800 chr5A 86.520 2322 256 36 168 2457 643042713 643040417 0.000000e+00 2501
14 TraesCS5B01G473800 chr5A 87.483 2149 226 22 168 2287 643029622 643027488 0.000000e+00 2438
15 TraesCS5B01G473800 chr5A 88.317 1943 195 24 530 2457 643047361 643045436 0.000000e+00 2302
16 TraesCS5B01G473800 chr5A 88.066 1944 195 28 530 2457 643039746 643037824 0.000000e+00 2270
17 TraesCS5B01G473800 chr1D 92.683 164 11 1 1 163 8737574 8737411 4.080000e-58 235


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G473800 chr5B 647696591 647699047 2456 True 4538.0 4538 100.0000 1 2457 1 chr5B.!!$R4 2456
1 TraesCS5B01G473800 chr5B 647778972 647781425 2453 True 4246.0 4246 97.8840 1 2457 1 chr5B.!!$R6 2456
2 TraesCS5B01G473800 chr5B 647403806 647405779 1973 True 2608.0 2608 90.6660 1 1960 1 chr5B.!!$R1 1959
3 TraesCS5B01G473800 chr5B 647462897 647464822 1925 True 2543.0 2543 90.6230 159 2078 1 chr5B.!!$R2 1919
4 TraesCS5B01G473800 chr5B 647732116 647733131 1015 True 1277.0 1277 89.5510 1 1008 1 chr5B.!!$R5 1007
5 TraesCS5B01G473800 chr5D 515023569 515026029 2460 True 3206.0 3206 90.3030 1 2452 1 chr5D.!!$R5 2451
6 TraesCS5B01G473800 chr5D 514994212 514996671 2459 True 3164.0 3164 89.9880 2 2455 1 chr5D.!!$R4 2453
7 TraesCS5B01G473800 chr5D 514946368 514948827 2459 True 3107.0 3107 89.5880 1 2452 1 chr5D.!!$R1 2451
8 TraesCS5B01G473800 chr5D 514972784 514975235 2451 True 3077.0 3077 89.4180 1 2452 1 chr5D.!!$R3 2451
9 TraesCS5B01G473800 chr5D 514965836 514967503 1667 True 2089.0 2089 89.3710 1 1669 1 chr5D.!!$R2 1668
10 TraesCS5B01G473800 chr5A 643027488 643047361 19873 True 2410.6 2542 87.5884 168 2457 5 chr5A.!!$R1 2289

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
547 7647 2.681848 CCTCCAATCACTTTAGCAGCTG 59.318 50.0 10.11 10.11 0.00 4.24 F
558 7658 4.342092 ACTTTAGCAGCTGTGGTTGAAAAT 59.658 37.5 16.64 0.00 35.51 1.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1355 13979 0.330604 AGCTGGATGTGGTCATTGCT 59.669 50.000 0.0 0.0 34.06 3.91 R
2094 14731 1.637553 ACTCCAGCTCCAATCCACAAT 59.362 47.619 0.0 0.0 0.00 2.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
214 4696 3.983044 AGTTGAGGGCTAATTTCGTCT 57.017 42.857 0.00 0.00 0.00 4.18
547 7647 2.681848 CCTCCAATCACTTTAGCAGCTG 59.318 50.000 10.11 10.11 0.00 4.24
558 7658 4.342092 ACTTTAGCAGCTGTGGTTGAAAAT 59.658 37.500 16.64 0.00 35.51 1.82
1220 13844 7.222031 TCGTTGTTCTTGATGTATATACTGTGC 59.778 37.037 13.89 2.08 0.00 4.57
1714 14342 4.451629 AAACGGTGATGAACGTCTATCT 57.548 40.909 0.00 0.00 43.31 1.98
2094 14731 6.522625 TCAAACACCTCAACTTCAATTTCA 57.477 33.333 0.00 0.00 0.00 2.69
2117 14754 2.642311 TGTGGATTGGAGCTGGAGTAAA 59.358 45.455 0.00 0.00 0.00 2.01
2123 14760 6.069673 TGGATTGGAGCTGGAGTAAAATCTAA 60.070 38.462 0.00 0.00 0.00 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
214 4696 3.014304 ACTCCGCAACTACTCCTGATA 57.986 47.619 0.00 0.0 0.00 2.15
547 7647 8.360390 AGTTCCTAATCTTGAATTTTCAACCAC 58.640 33.333 1.66 0.0 41.88 4.16
952 13576 3.849911 TGCTACCGAAGATCACAAGAAG 58.150 45.455 0.00 0.0 0.00 2.85
1220 13844 7.036220 AGTTAACACAAGAATACGGATCAGAG 58.964 38.462 8.61 0.0 0.00 3.35
1355 13979 0.330604 AGCTGGATGTGGTCATTGCT 59.669 50.000 0.00 0.0 34.06 3.91
2094 14731 1.637553 ACTCCAGCTCCAATCCACAAT 59.362 47.619 0.00 0.0 0.00 2.71
2123 14760 7.820872 CCATTTCTTTGCTCCAGTAAAATGAAT 59.179 33.333 0.00 0.0 0.00 2.57
2356 14994 7.487822 TCAATGATTTGCCCAAGGTTAATTA 57.512 32.000 0.00 0.0 32.61 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.