Multiple sequence alignment - TraesCS5B01G462900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G462900 chr5B 100.000 2801 0 0 1 2801 638346229 638343429 0.000000e+00 5173.0
1 TraesCS5B01G462900 chr5B 95.865 2225 45 14 598 2801 638353908 638351710 0.000000e+00 3555.0
2 TraesCS5B01G462900 chr5B 98.615 1805 25 0 1 1805 638337935 638336131 0.000000e+00 3195.0
3 TraesCS5B01G462900 chr5B 87.632 1423 142 21 907 2322 638364030 638362635 0.000000e+00 1622.0
4 TraesCS5B01G462900 chr5B 87.030 1303 130 24 616 1890 638398233 638396942 0.000000e+00 1434.0
5 TraesCS5B01G462900 chr5B 91.344 543 40 5 3 540 685617126 685617666 0.000000e+00 736.0
6 TraesCS5B01G462900 chr5B 78.325 609 81 32 1845 2422 638336120 638335532 2.070000e-91 346.0
7 TraesCS5B01G462900 chr5B 92.000 150 10 2 2332 2481 638355314 638355167 2.830000e-50 209.0
8 TraesCS5B01G462900 chr5B 94.643 112 6 0 2571 2682 622630495 622630606 1.030000e-39 174.0
9 TraesCS5B01G462900 chr5D 87.233 1966 187 44 616 2535 507772765 507770818 0.000000e+00 2182.0
10 TraesCS5B01G462900 chr5D 86.938 1401 137 27 666 2043 507776117 507774740 0.000000e+00 1531.0
11 TraesCS5B01G462900 chr5D 86.933 1301 126 22 616 1890 507836303 507835021 0.000000e+00 1421.0
12 TraesCS5B01G462900 chr5D 88.688 663 52 14 1932 2578 507774021 507773366 0.000000e+00 787.0
13 TraesCS5B01G462900 chr5D 91.786 487 34 4 58 540 3579724 3579240 0.000000e+00 673.0
14 TraesCS5B01G462900 chr5D 92.157 102 7 1 2680 2780 507773369 507773268 2.910000e-30 143.0
15 TraesCS5B01G462900 chr5D 85.965 114 14 2 1932 2043 507774742 507774629 1.360000e-23 121.0
16 TraesCS5B01G462900 chr5D 100.000 35 0 0 2767 2801 507773264 507773230 6.480000e-07 65.8
17 TraesCS5B01G462900 chr5A 90.286 1400 80 20 593 1967 635409203 635407835 0.000000e+00 1781.0
18 TraesCS5B01G462900 chr5A 87.372 1362 125 32 709 2043 635411791 635410450 0.000000e+00 1519.0
19 TraesCS5B01G462900 chr5A 91.313 518 40 5 1932 2447 635410452 635409938 0.000000e+00 702.0
20 TraesCS5B01G462900 chr5A 85.642 397 45 11 2019 2409 635407836 635407446 9.340000e-110 407.0
21 TraesCS5B01G462900 chr3B 90.128 547 41 9 3 540 732170944 732170402 0.000000e+00 699.0
22 TraesCS5B01G462900 chr3D 90.650 492 39 5 54 540 612825803 612826292 0.000000e+00 647.0
23 TraesCS5B01G462900 chr3D 93.750 112 7 0 2575 2686 41211720 41211609 4.800000e-38 169.0
24 TraesCS5B01G462900 chr6A 90.329 486 41 4 60 540 500096943 500097427 1.420000e-177 632.0
25 TraesCS5B01G462900 chr6A 89.349 507 43 7 54 554 556287270 556286769 6.590000e-176 627.0
26 TraesCS5B01G462900 chr6A 92.241 116 7 2 2574 2689 70934034 70933921 2.230000e-36 163.0
27 TraesCS5B01G462900 chr1D 90.184 489 40 5 59 540 201772791 201772304 5.090000e-177 630.0
28 TraesCS5B01G462900 chr1D 89.655 58 3 3 540 594 12410436 12410493 1.390000e-08 71.3
29 TraesCS5B01G462900 chr1A 89.431 492 43 7 56 540 564338348 564337859 1.840000e-171 612.0
30 TraesCS5B01G462900 chr1A 92.308 117 7 2 2571 2687 584968572 584968686 6.210000e-37 165.0
31 TraesCS5B01G462900 chr7A 93.860 114 6 1 2572 2684 600791731 600791844 1.330000e-38 171.0
32 TraesCS5B01G462900 chr2D 93.860 114 6 1 2572 2684 344879986 344879873 1.330000e-38 171.0
33 TraesCS5B01G462900 chr2D 90.476 42 2 2 555 594 20389902 20389861 1.000000e-03 54.7
34 TraesCS5B01G462900 chr2B 90.984 122 11 0 2568 2689 43851204 43851083 6.210000e-37 165.0
35 TraesCS5B01G462900 chrUn 90.476 126 8 4 2569 2692 92940909 92940786 2.230000e-36 163.0
36 TraesCS5B01G462900 chrUn 94.118 51 0 3 546 594 162261836 162261787 1.080000e-09 75.0
37 TraesCS5B01G462900 chr7D 94.872 39 0 2 558 594 550885853 550885815 3.010000e-05 60.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G462900 chr5B 638343429 638346229 2800 True 5173.000000 5173 100.00000 1 2801 1 chr5B.!!$R1 2800
1 TraesCS5B01G462900 chr5B 638351710 638355314 3604 True 1882.000000 3555 93.93250 598 2801 2 chr5B.!!$R5 2203
2 TraesCS5B01G462900 chr5B 638335532 638337935 2403 True 1770.500000 3195 88.47000 1 2422 2 chr5B.!!$R4 2421
3 TraesCS5B01G462900 chr5B 638362635 638364030 1395 True 1622.000000 1622 87.63200 907 2322 1 chr5B.!!$R2 1415
4 TraesCS5B01G462900 chr5B 638396942 638398233 1291 True 1434.000000 1434 87.03000 616 1890 1 chr5B.!!$R3 1274
5 TraesCS5B01G462900 chr5B 685617126 685617666 540 False 736.000000 736 91.34400 3 540 1 chr5B.!!$F2 537
6 TraesCS5B01G462900 chr5D 507835021 507836303 1282 True 1421.000000 1421 86.93300 616 1890 1 chr5D.!!$R2 1274
7 TraesCS5B01G462900 chr5D 507770818 507776117 5299 True 804.966667 2182 90.16350 616 2801 6 chr5D.!!$R3 2185
8 TraesCS5B01G462900 chr5A 635407446 635411791 4345 True 1102.250000 1781 88.65325 593 2447 4 chr5A.!!$R1 1854
9 TraesCS5B01G462900 chr3B 732170402 732170944 542 True 699.000000 699 90.12800 3 540 1 chr3B.!!$R1 537
10 TraesCS5B01G462900 chr6A 556286769 556287270 501 True 627.000000 627 89.34900 54 554 1 chr6A.!!$R2 500

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
219 224 1.679944 CCGAGGACCAAGCAATCACAT 60.680 52.381 0.0 0.0 0.0 3.21 F
599 608 3.618150 GCCGTAGCCGTCAAAAAGTAATA 59.382 43.478 0.0 0.0 0.0 0.98 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1173 3943 2.034066 CCAGAAAGCGGGCCAAGA 59.966 61.111 4.39 0.0 0.0 3.02 R
2686 5488 3.565482 TCAGAAACAAAGCAGACCATCAC 59.435 43.478 0.00 0.0 0.0 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
151 152 1.959226 CCACAACCTCCGGACAACG 60.959 63.158 0.00 0.0 43.80 4.10
219 224 1.679944 CCGAGGACCAAGCAATCACAT 60.680 52.381 0.00 0.0 0.00 3.21
599 608 3.618150 GCCGTAGCCGTCAAAAAGTAATA 59.382 43.478 0.00 0.0 0.00 0.98
600 609 4.093261 GCCGTAGCCGTCAAAAAGTAATAA 59.907 41.667 0.00 0.0 0.00 1.40
601 610 5.220719 GCCGTAGCCGTCAAAAAGTAATAAT 60.221 40.000 0.00 0.0 0.00 1.28
1173 3943 1.730487 CTCTGACCGCGTGCTCTAT 59.270 57.895 4.92 0.0 0.00 1.98
2609 5411 6.122850 TCGGAATTACTCGTCGAAGAAATA 57.877 37.500 1.95 0.0 39.69 1.40
2686 5488 2.538861 TCGAACAGAGCGAGTACTATCG 59.461 50.000 0.00 0.0 45.48 2.92
2753 5555 2.301583 GCCAGAGAGACCTCAACTCTTT 59.698 50.000 0.00 0.0 43.55 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
151 152 7.843490 TTTAACAAGTGGTATCATGAGCTAC 57.157 36.000 0.09 5.07 0.00 3.58
219 224 2.165641 ACAAATCTCGGTATCGTGCTCA 59.834 45.455 0.00 0.00 37.69 4.26
1173 3943 2.034066 CCAGAAAGCGGGCCAAGA 59.966 61.111 4.39 0.00 0.00 3.02
2686 5488 3.565482 TCAGAAACAAAGCAGACCATCAC 59.435 43.478 0.00 0.00 0.00 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.