Multiple sequence alignment - TraesCS5B01G461100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G461100 chr5B 100.000 2828 0 0 1 2828 636916752 636913925 0.000000e+00 5223.0
1 TraesCS5B01G461100 chr5B 95.594 1044 26 2 1347 2371 234045228 234046270 0.000000e+00 1655.0
2 TraesCS5B01G461100 chr5B 95.934 787 28 4 1 785 234043861 234044645 0.000000e+00 1273.0
3 TraesCS5B01G461100 chr3B 96.144 2023 53 5 828 2828 271101919 271099900 0.000000e+00 3280.0
4 TraesCS5B01G461100 chr3B 95.355 818 34 4 1 815 271102981 271102165 0.000000e+00 1297.0
5 TraesCS5B01G461100 chr3B 87.097 310 13 4 2521 2828 796735390 796735674 2.720000e-85 326.0
6 TraesCS5B01G461100 chr4A 94.903 2119 66 12 1 2081 741610023 741612137 0.000000e+00 3277.0
7 TraesCS5B01G461100 chr4A 95.323 1240 48 7 2 1238 687006928 687008160 0.000000e+00 1960.0
8 TraesCS5B01G461100 chr4A 98.053 719 7 5 2112 2828 741617654 741618367 0.000000e+00 1243.0
9 TraesCS5B01G461100 chr4A 98.188 607 8 3 2224 2828 687009268 687009873 0.000000e+00 1057.0
10 TraesCS5B01G461100 chr1D 96.045 1239 43 5 2 1238 66928021 66929255 0.000000e+00 2012.0
11 TraesCS5B01G461100 chr1D 97.967 787 13 3 2042 2826 66930475 66931260 0.000000e+00 1362.0
12 TraesCS5B01G461100 chr1D 97.840 787 13 4 2045 2828 424019968 424019183 0.000000e+00 1356.0
13 TraesCS5B01G461100 chr1D 98.148 216 3 1 1826 2041 424020709 424020495 2.660000e-100 375.0
14 TraesCS5B01G461100 chr1D 97.696 217 3 2 1826 2041 66929739 66929954 3.440000e-99 372.0
15 TraesCS5B01G461100 chr2D 95.803 1239 44 7 2 1238 472764960 472763728 0.000000e+00 1993.0
16 TraesCS5B01G461100 chr2D 97.713 787 13 4 2045 2828 472762503 472761719 0.000000e+00 1349.0
17 TraesCS5B01G461100 chr5D 95.353 1248 41 9 2 1238 24443599 24442358 0.000000e+00 1967.0
18 TraesCS5B01G461100 chr5D 97.837 786 13 4 2045 2828 24441133 24440350 0.000000e+00 1354.0
19 TraesCS5B01G461100 chr7D 95.128 1252 43 10 2 1242 276090309 276089065 0.000000e+00 1958.0
20 TraesCS5B01G461100 chr7D 97.586 787 16 3 2045 2828 276087841 276087055 0.000000e+00 1345.0
21 TraesCS5B01G461100 chr7D 93.674 743 23 7 2109 2828 597627418 597626677 0.000000e+00 1090.0
22 TraesCS5B01G461100 chr7D 98.611 216 2 1 1826 2041 276088583 276088369 5.720000e-102 381.0
23 TraesCS5B01G461100 chr4B 95.911 1174 41 6 1 1170 355188304 355187134 0.000000e+00 1895.0
24 TraesCS5B01G461100 chr4B 95.656 1036 32 9 1347 2371 355187139 355186106 0.000000e+00 1652.0
25 TraesCS5B01G461100 chr4B 92.121 495 17 1 1323 1817 1768681 1769153 0.000000e+00 678.0
26 TraesCS5B01G461100 chr2B 95.559 1171 42 7 1 1167 90147049 90148213 0.000000e+00 1866.0
27 TraesCS5B01G461100 chr2B 95.115 1044 31 2 1347 2371 90148211 90149253 0.000000e+00 1628.0
28 TraesCS5B01G461100 chr7B 94.358 1028 45 12 1347 2371 668435026 668436043 0.000000e+00 1565.0
29 TraesCS5B01G461100 chr7B 96.099 282 11 0 1347 1628 668431216 668431497 7.140000e-126 460.0
30 TraesCS5B01G461100 chr1A 87.379 1236 104 28 1 1197 34429417 34428195 0.000000e+00 1371.0
31 TraesCS5B01G461100 chr4D 92.473 372 28 0 1323 1694 1326260 1326631 1.490000e-147 532.0
32 TraesCS5B01G461100 chr5A 97.222 36 1 0 1769 1804 699469999 699469964 8.460000e-06 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G461100 chr5B 636913925 636916752 2827 True 5223.000000 5223 100.000000 1 2828 1 chr5B.!!$R1 2827
1 TraesCS5B01G461100 chr5B 234043861 234046270 2409 False 1464.000000 1655 95.764000 1 2371 2 chr5B.!!$F1 2370
2 TraesCS5B01G461100 chr3B 271099900 271102981 3081 True 2288.500000 3280 95.749500 1 2828 2 chr3B.!!$R1 2827
3 TraesCS5B01G461100 chr4A 741610023 741612137 2114 False 3277.000000 3277 94.903000 1 2081 1 chr4A.!!$F1 2080
4 TraesCS5B01G461100 chr4A 687006928 687009873 2945 False 1508.500000 1960 96.755500 2 2828 2 chr4A.!!$F3 2826
5 TraesCS5B01G461100 chr4A 741617654 741618367 713 False 1243.000000 1243 98.053000 2112 2828 1 chr4A.!!$F2 716
6 TraesCS5B01G461100 chr1D 66928021 66931260 3239 False 1248.666667 2012 97.236000 2 2826 3 chr1D.!!$F1 2824
7 TraesCS5B01G461100 chr1D 424019183 424020709 1526 True 865.500000 1356 97.994000 1826 2828 2 chr1D.!!$R1 1002
8 TraesCS5B01G461100 chr2D 472761719 472764960 3241 True 1671.000000 1993 96.758000 2 2828 2 chr2D.!!$R1 2826
9 TraesCS5B01G461100 chr5D 24440350 24443599 3249 True 1660.500000 1967 96.595000 2 2828 2 chr5D.!!$R1 2826
10 TraesCS5B01G461100 chr7D 276087055 276090309 3254 True 1228.000000 1958 97.108333 2 2828 3 chr7D.!!$R2 2826
11 TraesCS5B01G461100 chr7D 597626677 597627418 741 True 1090.000000 1090 93.674000 2109 2828 1 chr7D.!!$R1 719
12 TraesCS5B01G461100 chr4B 355186106 355188304 2198 True 1773.500000 1895 95.783500 1 2371 2 chr4B.!!$R1 2370
13 TraesCS5B01G461100 chr2B 90147049 90149253 2204 False 1747.000000 1866 95.337000 1 2371 2 chr2B.!!$F1 2370
14 TraesCS5B01G461100 chr7B 668431216 668436043 4827 False 1012.500000 1565 95.228500 1347 2371 2 chr7B.!!$F1 1024
15 TraesCS5B01G461100 chr1A 34428195 34429417 1222 True 1371.000000 1371 87.379000 1 1197 1 chr1A.!!$R1 1196

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
637 645 1.989706 TCCCACGGATCGATGACATA 58.01 50.0 0.54 0.0 0.0 2.29 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2005 4895 4.571176 GTGGCTGGCTACTTTAACAGTATC 59.429 45.833 2.0 0.0 37.36 2.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
28 29 5.528320 TCACATATGATGACACAATGCGAAT 59.472 36.000 10.38 0.00 0.00 3.34
192 198 7.930865 TGTACCTGGAAATGATTTTTGGAAAAG 59.069 33.333 0.00 0.00 0.00 2.27
478 486 5.769367 CATAGAAAATGGTGCTCATCCATG 58.231 41.667 0.00 0.00 43.85 3.66
637 645 1.989706 TCCCACGGATCGATGACATA 58.010 50.000 0.54 0.00 0.00 2.29
785 831 2.124570 CCTGCTCCCAATGTCCCG 60.125 66.667 0.00 0.00 0.00 5.14
1185 1466 2.984562 TGTCTCAAACAGTGCACTTCA 58.015 42.857 18.94 3.91 32.81 3.02
1245 1526 1.153369 CCCGATGCGAACAGTGGAT 60.153 57.895 0.00 0.00 0.00 3.41
1278 1559 1.261938 TGGAATTCTTCTCCGCCGGA 61.262 55.000 5.05 5.37 35.55 5.14
1347 1628 7.008021 AGAAGAGAAGAGAAGAAAAGATGCT 57.992 36.000 0.00 0.00 0.00 3.79
1350 1631 4.009002 AGAAGAGAAGAAAAGATGCTGCC 58.991 43.478 0.00 0.00 0.00 4.85
1556 4021 4.742201 CCACCGCAGAGGACGTGG 62.742 72.222 0.00 0.00 45.00 4.94
2081 5497 1.218047 GCTGGGATGTGTAGCGTGA 59.782 57.895 0.00 0.00 0.00 4.35
2156 5576 7.431084 GTCAGTACAACAAACGTGATGATTTTT 59.569 33.333 8.46 0.00 32.15 1.94
2769 6209 5.343249 CCATTTAGAGTACATTTGCTTGCC 58.657 41.667 0.00 0.00 0.00 4.52
2778 6218 5.949354 AGTACATTTGCTTGCCCTGTTAATA 59.051 36.000 0.00 0.00 0.00 0.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
192 198 5.459434 GCTACCTCGTAGTTTGCTCTTTATC 59.541 44.000 1.11 0.0 38.30 1.75
1347 1628 1.078214 CGGCTGAAGATCCAAGGCA 60.078 57.895 12.15 0.0 0.00 4.75
1350 1631 3.861341 TTCCGGCTGAAGATCCAAG 57.139 52.632 0.00 0.0 0.00 3.61
2005 4895 4.571176 GTGGCTGGCTACTTTAACAGTATC 59.429 45.833 2.00 0.0 37.36 2.24
2081 5497 5.359576 TCAAAACCAATCAACACAAGCTAGT 59.640 36.000 0.00 0.0 0.00 2.57
2769 6209 8.356000 TGGAGTAACCCAAAAATATTAACAGG 57.644 34.615 0.00 0.0 38.00 4.00
2778 6218 5.086621 AGCAAGATGGAGTAACCCAAAAAT 58.913 37.500 0.00 0.0 40.04 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.