Multiple sequence alignment - TraesCS5B01G458800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G458800 chr5B 100.000 2482 0 0 1 2482 634121833 634119352 0.000000e+00 4584.0
1 TraesCS5B01G458800 chr2D 96.729 2507 55 6 1 2482 52284031 52286535 0.000000e+00 4150.0
2 TraesCS5B01G458800 chr2A 94.809 2350 86 17 10 2329 315762262 315764605 0.000000e+00 3631.0
3 TraesCS5B01G458800 chr2A 86.149 296 18 9 452 746 755370074 755370347 5.190000e-77 298.0
4 TraesCS5B01G458800 chr2A 96.124 129 4 1 2354 2482 315764600 315764727 2.500000e-50 209.0
5 TraesCS5B01G458800 chr4A 95.646 2182 62 11 331 2482 420019636 420017458 0.000000e+00 3472.0
6 TraesCS5B01G458800 chr3D 91.543 2495 154 28 1 2482 412102847 412105297 0.000000e+00 3386.0
7 TraesCS5B01G458800 chr3D 95.909 2102 54 13 178 2253 477613649 477611554 0.000000e+00 3376.0
8 TraesCS5B01G458800 chr3D 97.335 1914 42 6 1 1907 30970121 30972032 0.000000e+00 3243.0
9 TraesCS5B01G458800 chr3D 95.221 565 21 4 1924 2482 30972890 30973454 0.000000e+00 889.0
10 TraesCS5B01G458800 chr3D 96.203 237 7 2 2248 2482 477571265 477571029 1.080000e-103 387.0
11 TraesCS5B01G458800 chr3D 97.765 179 3 1 4 181 477624386 477624208 8.620000e-80 307.0
12 TraesCS5B01G458800 chr3D 83.673 98 8 6 2296 2391 5040770 5040679 4.400000e-13 86.1
13 TraesCS5B01G458800 chr1A 95.132 1746 55 10 765 2482 558014400 558016143 0.000000e+00 2726.0
14 TraesCS5B01G458800 chr1A 97.712 437 7 2 329 763 558001241 558001676 0.000000e+00 749.0
15 TraesCS5B01G458800 chr7A 97.333 1500 33 4 380 1874 299430986 299429489 0.000000e+00 2542.0
16 TraesCS5B01G458800 chr7A 95.907 562 19 4 1924 2482 299415192 299414632 0.000000e+00 907.0
17 TraesCS5B01G458800 chr7A 87.309 457 49 8 56 505 447496118 447496572 4.730000e-142 514.0
18 TraesCS5B01G458800 chr6D 90.441 952 54 23 1422 2339 169715444 169716392 0.000000e+00 1219.0
19 TraesCS5B01G458800 chr6D 92.248 258 20 0 1001 1258 169714691 169714948 1.400000e-97 366.0
20 TraesCS5B01G458800 chr3B 86.396 838 52 27 1575 2384 726179274 726178471 0.000000e+00 859.0
21 TraesCS5B01G458800 chr7B 87.959 490 50 9 56 540 393857981 393858466 9.960000e-159 569.0
22 TraesCS5B01G458800 chr7D 88.428 458 43 8 56 505 394065714 394066169 6.040000e-151 544.0
23 TraesCS5B01G458800 chrUn 91.463 164 14 0 1258 1421 394864045 394864208 2.480000e-55 226.0
24 TraesCS5B01G458800 chr2B 92.453 106 7 1 79 183 140246808 140246703 1.540000e-32 150.0
25 TraesCS5B01G458800 chr2B 90.805 87 5 2 873 957 568669832 568669917 2.020000e-21 113.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G458800 chr5B 634119352 634121833 2481 True 4584.0 4584 100.0000 1 2482 1 chr5B.!!$R1 2481
1 TraesCS5B01G458800 chr2D 52284031 52286535 2504 False 4150.0 4150 96.7290 1 2482 1 chr2D.!!$F1 2481
2 TraesCS5B01G458800 chr2A 315762262 315764727 2465 False 1920.0 3631 95.4665 10 2482 2 chr2A.!!$F2 2472
3 TraesCS5B01G458800 chr4A 420017458 420019636 2178 True 3472.0 3472 95.6460 331 2482 1 chr4A.!!$R1 2151
4 TraesCS5B01G458800 chr3D 412102847 412105297 2450 False 3386.0 3386 91.5430 1 2482 1 chr3D.!!$F1 2481
5 TraesCS5B01G458800 chr3D 477611554 477613649 2095 True 3376.0 3376 95.9090 178 2253 1 chr3D.!!$R3 2075
6 TraesCS5B01G458800 chr3D 30970121 30973454 3333 False 2066.0 3243 96.2780 1 2482 2 chr3D.!!$F2 2481
7 TraesCS5B01G458800 chr1A 558014400 558016143 1743 False 2726.0 2726 95.1320 765 2482 1 chr1A.!!$F2 1717
8 TraesCS5B01G458800 chr7A 299429489 299430986 1497 True 2542.0 2542 97.3330 380 1874 1 chr7A.!!$R2 1494
9 TraesCS5B01G458800 chr7A 299414632 299415192 560 True 907.0 907 95.9070 1924 2482 1 chr7A.!!$R1 558
10 TraesCS5B01G458800 chr6D 169714691 169716392 1701 False 792.5 1219 91.3445 1001 2339 2 chr6D.!!$F1 1338
11 TraesCS5B01G458800 chr3B 726178471 726179274 803 True 859.0 859 86.3960 1575 2384 1 chr3B.!!$R1 809

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
679 684 1.419762 TGAGGTGGTGCTCTTGCTTTA 59.58 47.619 0.0 0.0 40.48 1.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1810 2165 1.600107 GTTCACACCTCCGGCCATA 59.4 57.895 2.24 0.0 0.0 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
679 684 1.419762 TGAGGTGGTGCTCTTGCTTTA 59.580 47.619 0.00 0.00 40.48 1.85
773 779 3.334691 CTGAAAGGACCGACATTAGCAA 58.665 45.455 0.00 0.00 0.00 3.91
1306 1317 4.503714 ACAGTTTGGGTTCAGAGAAGAA 57.496 40.909 0.00 0.00 0.00 2.52
1428 1776 6.577103 AGCAGAGATGAGTTCGATTCAATTA 58.423 36.000 4.49 0.00 0.00 1.40
1466 1814 0.033601 ACTTGAGTTTGCACCACCCA 60.034 50.000 0.00 0.00 0.00 4.51
1561 1910 9.807649 ATTCTTTTTATACTGATTTGATGCACC 57.192 29.630 0.00 0.00 0.00 5.01
1599 1948 5.858049 GCGAACAAATGTGATCTTCAATTGA 59.142 36.000 18.68 3.38 0.00 2.57
1810 2165 5.630121 TGGAGTGTATTTCAGTTGACCAAT 58.370 37.500 0.00 0.00 0.00 3.16
1981 3178 7.552687 GGACCTCATTACAAAGATACATGTCAA 59.447 37.037 0.00 0.00 0.00 3.18
2116 3319 0.379669 GGACGAGCTTGGCATCAATG 59.620 55.000 9.64 0.00 31.75 2.82
2305 3511 5.241064 CCGTGTAATGTAGCATAGTACTCCT 59.759 44.000 0.00 0.00 0.00 3.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
786 792 9.547753 GTGCAGAAAACTCTTCTAATGGATATA 57.452 33.333 0.00 0.0 0.00 0.86
861 869 3.538591 TGCATGAGAAGGTAAGCTGATG 58.461 45.455 0.00 0.0 0.00 3.07
1428 1776 8.051535 ACTCAAGTCTGAATCATTATCAATGGT 58.948 33.333 0.00 0.0 39.38 3.55
1561 1910 1.879380 TGTTCGCATTCCAAAGTCAGG 59.121 47.619 0.00 0.0 0.00 3.86
1599 1948 8.025445 GCAAACTAAAGTCTGAATCATCAATGT 58.975 33.333 0.00 0.0 34.49 2.71
1810 2165 1.600107 GTTCACACCTCCGGCCATA 59.400 57.895 2.24 0.0 0.00 2.74
1888 2243 5.889289 AGGACCAAGTTAGCTACAAACAAAA 59.111 36.000 0.00 0.0 0.00 2.44
2116 3319 8.908786 TCATGTAAAGGGATATCAGATTGTTC 57.091 34.615 4.83 0.0 0.00 3.18
2378 3616 3.264450 AGCTTTGTGCATAGTACTCCCTT 59.736 43.478 0.00 0.0 45.94 3.95


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.