Multiple sequence alignment - TraesCS5B01G458700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G458700 chr5B 100.000 2714 0 0 1 2714 633802756 633805469 0.000000e+00 5012
1 TraesCS5B01G458700 chr5B 99.300 2714 18 1 1 2714 633812164 633814876 0.000000e+00 4905
2 TraesCS5B01G458700 chr2B 99.189 2714 21 1 1 2714 219309229 219306517 0.000000e+00 4889
3 TraesCS5B01G458700 chr2B 98.747 2714 33 1 1 2714 50599692 50596980 0.000000e+00 4822
4 TraesCS5B01G458700 chr2B 81.967 854 138 12 61 911 404574133 404573293 0.000000e+00 710
5 TraesCS5B01G458700 chr4A 98.526 2714 37 3 1 2714 605046406 605043696 0.000000e+00 4787
6 TraesCS5B01G458700 chr4A 98.379 2714 41 3 1 2714 605051948 605054658 0.000000e+00 4765
7 TraesCS5B01G458700 chrUn 99.379 966 6 0 1 966 446348987 446348022 0.000000e+00 1751
8 TraesCS5B01G458700 chrUn 77.679 1680 324 38 61 1719 86317164 86315515 0.000000e+00 977
9 TraesCS5B01G458700 chrUn 99.541 218 1 0 2497 2714 355819079 355818862 5.440000e-107 398


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G458700 chr5B 633802756 633805469 2713 False 5012 5012 100.000 1 2714 1 chr5B.!!$F1 2713
1 TraesCS5B01G458700 chr5B 633812164 633814876 2712 False 4905 4905 99.300 1 2714 1 chr5B.!!$F2 2713
2 TraesCS5B01G458700 chr2B 219306517 219309229 2712 True 4889 4889 99.189 1 2714 1 chr2B.!!$R2 2713
3 TraesCS5B01G458700 chr2B 50596980 50599692 2712 True 4822 4822 98.747 1 2714 1 chr2B.!!$R1 2713
4 TraesCS5B01G458700 chr2B 404573293 404574133 840 True 710 710 81.967 61 911 1 chr2B.!!$R3 850
5 TraesCS5B01G458700 chr4A 605043696 605046406 2710 True 4787 4787 98.526 1 2714 1 chr4A.!!$R1 2713
6 TraesCS5B01G458700 chr4A 605051948 605054658 2710 False 4765 4765 98.379 1 2714 1 chr4A.!!$F1 2713
7 TraesCS5B01G458700 chrUn 446348022 446348987 965 True 1751 1751 99.379 1 966 1 chrUn.!!$R3 965
8 TraesCS5B01G458700 chrUn 86315515 86317164 1649 True 977 977 77.679 61 1719 1 chrUn.!!$R1 1658

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
792 793 4.354686 TGGTGATCCATATGGGTGATGATT 59.645 41.667 21.78 0.0 39.03 2.57 F
1453 1455 3.647113 AGATGAGGAGATGGAAGATGGTG 59.353 47.826 0.00 0.0 0.00 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1609 1611 1.212935 CTGCATTGGCCTAGTAACCCT 59.787 52.381 3.32 0.0 40.13 4.34 R
2581 2583 3.041946 GGAGGAACTGATACCACATCCT 58.958 50.000 0.00 0.0 41.55 3.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
476 477 9.846248 CAGGAAGTATGAAAGTTTCTTTTATGG 57.154 33.333 16.33 0.0 0.00 2.74
521 522 4.619160 CGAAGAGTTCCACACATCTGATGA 60.619 45.833 23.59 0.0 0.00 2.92
792 793 4.354686 TGGTGATCCATATGGGTGATGATT 59.645 41.667 21.78 0.0 39.03 2.57
1453 1455 3.647113 AGATGAGGAGATGGAAGATGGTG 59.353 47.826 0.00 0.0 0.00 4.17
1548 1550 3.828451 CCAAGGGAGAAATTGCTTCAAGA 59.172 43.478 0.00 0.0 36.40 3.02
1609 1611 7.050377 CCAATTTGAAGATGGAAGTAGCTCTA 58.950 38.462 0.00 0.0 36.27 2.43
1710 1712 9.690434 CGCAATTCAAGTTATAAGAGAAAGTAC 57.310 33.333 0.00 0.0 0.00 2.73
2255 2257 0.542232 ACCGACTTGTACTCTGCCCT 60.542 55.000 0.00 0.0 0.00 5.19
2276 2278 7.451877 TGCCCTATGGTTTGTAGTGAATTAAAA 59.548 33.333 0.00 0.0 0.00 1.52
2581 2583 5.049954 GGCCTATTTATTATTCGTCGTTGCA 60.050 40.000 0.00 0.0 0.00 4.08
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
214 215 4.269183 TCTATTGTTTGCGGGTCATTCAT 58.731 39.130 0.00 0.00 0.00 2.57
476 477 2.815478 CGTCTTCCTCCTGTATTCTGC 58.185 52.381 0.00 0.00 0.00 4.26
521 522 9.900710 TGTCATTATGCGTAAACAAAATACTTT 57.099 25.926 1.76 0.00 0.00 2.66
792 793 1.220493 TCTTCTGCCCCAGCTATCCTA 59.780 52.381 0.00 0.00 40.80 2.94
1453 1455 6.421202 GGAGGAAGTATATCACATTCACGAAC 59.579 42.308 0.00 0.00 0.00 3.95
1548 1550 2.619074 GCATGCTCCTTTCTTACCCTGT 60.619 50.000 11.37 0.00 0.00 4.00
1609 1611 1.212935 CTGCATTGGCCTAGTAACCCT 59.787 52.381 3.32 0.00 40.13 4.34
1710 1712 2.332063 ACCAAACTGACCACACTCAG 57.668 50.000 0.00 0.00 43.06 3.35
2102 2104 7.041303 ACGGACATACTACATACTACATGTCAG 60.041 40.741 0.00 11.37 42.47 3.51
2276 2278 7.828717 CCTTACATGGGGCTTATTTCAATTTTT 59.171 33.333 0.00 0.00 0.00 1.94
2581 2583 3.041946 GGAGGAACTGATACCACATCCT 58.958 50.000 0.00 0.00 41.55 3.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.