Multiple sequence alignment - TraesCS5B01G454900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G454900 chr5B 100.000 1861 0 0 608 2468 629217653 629215793 0.000000e+00 3437
1 TraesCS5B01G454900 chr5B 100.000 374 0 0 1 374 629218260 629217887 0.000000e+00 691
2 TraesCS5B01G454900 chr7B 94.830 1857 77 5 629 2468 750371700 750369846 0.000000e+00 2880
3 TraesCS5B01G454900 chr7B 88.596 342 17 3 1 320 750372398 750372057 1.780000e-106 396
4 TraesCS5B01G454900 chr7A 94.373 1866 78 4 608 2468 104383437 104381594 0.000000e+00 2839
5 TraesCS5B01G454900 chr7A 92.706 1179 55 8 608 1786 358383167 358384314 0.000000e+00 1672
6 TraesCS5B01G454900 chr7A 92.217 1182 55 9 608 1789 676810393 676809249 0.000000e+00 1639
7 TraesCS5B01G454900 chr7A 91.794 1182 62 9 608 1789 676837212 676836066 0.000000e+00 1613
8 TraesCS5B01G454900 chr7A 91.695 1180 66 7 610 1789 676724387 676723240 0.000000e+00 1607
9 TraesCS5B01G454900 chr7A 92.529 348 23 3 1 346 676725216 676724870 1.700000e-136 496
10 TraesCS5B01G454900 chr7A 92.529 348 23 3 1 346 676837700 676837354 1.700000e-136 496
11 TraesCS5B01G454900 chr7A 96.000 225 8 1 1 224 104384127 104383903 5.020000e-97 364
12 TraesCS5B01G454900 chr2A 94.105 1866 82 5 608 2468 547863064 547864906 0.000000e+00 2811
13 TraesCS5B01G454900 chr2A 92.366 1179 58 5 608 1786 274139292 274140438 0.000000e+00 1650
14 TraesCS5B01G454900 chr2A 92.529 348 23 3 1 346 274138522 274138868 1.700000e-136 496
15 TraesCS5B01G454900 chr1D 94.413 1790 76 10 696 2468 24353535 24351753 0.000000e+00 2730
16 TraesCS5B01G454900 chr1D 97.279 882 19 2 1591 2467 262485265 262486146 0.000000e+00 1491
17 TraesCS5B01G454900 chr5A 92.132 1182 63 4 608 1789 75980217 75979066 0.000000e+00 1640
18 TraesCS5B01G454900 chr5A 96.413 920 28 1 1554 2468 543656530 543657449 0.000000e+00 1511
19 TraesCS5B01G454900 chr1A 92.132 1182 62 8 608 1789 579141399 579140249 0.000000e+00 1639
20 TraesCS5B01G454900 chr1A 87.458 295 27 8 1 288 19278596 19278305 5.090000e-87 331
21 TraesCS5B01G454900 chr1A 87.458 295 27 8 1 288 19392744 19392453 5.090000e-87 331
22 TraesCS5B01G454900 chr6A 92.112 1179 62 5 608 1786 82806813 82805666 0.000000e+00 1633
23 TraesCS5B01G454900 chr3A 91.878 1182 66 8 608 1789 644406837 644405686 0.000000e+00 1624
24 TraesCS5B01G454900 chr3D 97.622 883 15 2 1591 2468 558028411 558027530 0.000000e+00 1509
25 TraesCS5B01G454900 chr3D 96.829 883 22 2 1591 2468 114342367 114343248 0.000000e+00 1471
26 TraesCS5B01G454900 chr3D 91.892 74 5 1 709 782 605102790 605102718 4.340000e-18 102
27 TraesCS5B01G454900 chr5D 97.059 884 20 2 1591 2468 462629112 462629995 0.000000e+00 1483
28 TraesCS5B01G454900 chr4D 91.244 1005 84 3 977 1980 407023980 407022979 0.000000e+00 1365
29 TraesCS5B01G454900 chr3B 91.289 287 14 7 1 281 725604129 725604410 4.980000e-102 381
30 TraesCS5B01G454900 chr3B 89.583 288 18 9 1 281 413311623 413311905 3.020000e-94 355
31 TraesCS5B01G454900 chr4A 89.655 87 9 0 696 782 474674917 474674831 7.210000e-21 111


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G454900 chr5B 629215793 629218260 2467 True 2064.0 3437 100.0000 1 2468 2 chr5B.!!$R1 2467
1 TraesCS5B01G454900 chr7B 750369846 750372398 2552 True 1638.0 2880 91.7130 1 2468 2 chr7B.!!$R1 2467
2 TraesCS5B01G454900 chr7A 358383167 358384314 1147 False 1672.0 1672 92.7060 608 1786 1 chr7A.!!$F1 1178
3 TraesCS5B01G454900 chr7A 676809249 676810393 1144 True 1639.0 1639 92.2170 608 1789 1 chr7A.!!$R1 1181
4 TraesCS5B01G454900 chr7A 104381594 104384127 2533 True 1601.5 2839 95.1865 1 2468 2 chr7A.!!$R2 2467
5 TraesCS5B01G454900 chr7A 676836066 676837700 1634 True 1054.5 1613 92.1615 1 1789 2 chr7A.!!$R4 1788
6 TraesCS5B01G454900 chr7A 676723240 676725216 1976 True 1051.5 1607 92.1120 1 1789 2 chr7A.!!$R3 1788
7 TraesCS5B01G454900 chr2A 547863064 547864906 1842 False 2811.0 2811 94.1050 608 2468 1 chr2A.!!$F1 1860
8 TraesCS5B01G454900 chr2A 274138522 274140438 1916 False 1073.0 1650 92.4475 1 1786 2 chr2A.!!$F2 1785
9 TraesCS5B01G454900 chr1D 24351753 24353535 1782 True 2730.0 2730 94.4130 696 2468 1 chr1D.!!$R1 1772
10 TraesCS5B01G454900 chr1D 262485265 262486146 881 False 1491.0 1491 97.2790 1591 2467 1 chr1D.!!$F1 876
11 TraesCS5B01G454900 chr5A 75979066 75980217 1151 True 1640.0 1640 92.1320 608 1789 1 chr5A.!!$R1 1181
12 TraesCS5B01G454900 chr5A 543656530 543657449 919 False 1511.0 1511 96.4130 1554 2468 1 chr5A.!!$F1 914
13 TraesCS5B01G454900 chr1A 579140249 579141399 1150 True 1639.0 1639 92.1320 608 1789 1 chr1A.!!$R3 1181
14 TraesCS5B01G454900 chr6A 82805666 82806813 1147 True 1633.0 1633 92.1120 608 1786 1 chr6A.!!$R1 1178
15 TraesCS5B01G454900 chr3A 644405686 644406837 1151 True 1624.0 1624 91.8780 608 1789 1 chr3A.!!$R1 1181
16 TraesCS5B01G454900 chr3D 558027530 558028411 881 True 1509.0 1509 97.6220 1591 2468 1 chr3D.!!$R1 877
17 TraesCS5B01G454900 chr3D 114342367 114343248 881 False 1471.0 1471 96.8290 1591 2468 1 chr3D.!!$F1 877
18 TraesCS5B01G454900 chr5D 462629112 462629995 883 False 1483.0 1483 97.0590 1591 2468 1 chr5D.!!$F1 877
19 TraesCS5B01G454900 chr4D 407022979 407023980 1001 True 1365.0 1365 91.2440 977 1980 1 chr4D.!!$R1 1003

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
371 409 0.84687 CACCCCCTTCTCCTTCCCTT 60.847 60.0 0.0 0.0 0.0 3.95 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1918 2229 0.386858 GCTGTGTCGTCTTCGTGCTA 60.387 55.0 0.0 0.0 38.33 3.49 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
64 66 1.338674 CCACACTAGGCGAATCCAACA 60.339 52.381 0.00 0.0 37.29 3.33
72 74 1.202417 GGCGAATCCAACATCTCTCGA 60.202 52.381 0.00 0.0 34.01 4.04
81 83 3.131933 CCAACATCTCTCGATCACCTCTT 59.868 47.826 0.00 0.0 0.00 2.85
87 89 1.678627 TCTCGATCACCTCTTAGCAGC 59.321 52.381 0.00 0.0 0.00 5.25
237 261 3.453679 ACGCTCGCTCTTCCTCCC 61.454 66.667 0.00 0.0 0.00 4.30
302 327 2.041819 CGCCCTAACTCCCCTCCT 60.042 66.667 0.00 0.0 0.00 3.69
371 409 0.846870 CACCCCCTTCTCCTTCCCTT 60.847 60.000 0.00 0.0 0.00 3.95
373 411 1.274475 ACCCCCTTCTCCTTCCCTTAG 60.274 57.143 0.00 0.0 0.00 2.18
664 908 2.461300 TCAGGACCTCGATCTGGATT 57.539 50.000 8.37 0.0 0.00 3.01
1112 1418 2.026542 TCAGCAGCATCATGAAGAAGGT 60.027 45.455 0.00 0.0 0.00 3.50
1152 1458 2.044946 GCCAAGGACGCCAAGGAT 60.045 61.111 9.60 0.0 0.00 3.24
1189 1495 1.996292 TCTCGGAGTTCATTGCTTCG 58.004 50.000 4.69 0.0 36.37 3.79
1279 1585 1.281899 GTGCTGACCTATCGCTGTTC 58.718 55.000 0.00 0.0 0.00 3.18
1306 1612 0.323087 TCTGTACTGTAGGGCGAGCA 60.323 55.000 0.00 0.0 0.00 4.26
1358 1664 0.171455 AACATCGACGACCTGCTCTC 59.829 55.000 0.00 0.0 0.00 3.20
1361 1667 3.432588 CGACGACCTGCTCTCGGT 61.433 66.667 0.00 0.0 37.50 4.69
1764 2074 7.543172 TGAATGATTTGAAGCACTAAGAATTGC 59.457 33.333 0.00 0.0 39.16 3.56
2153 2469 7.466746 AAGTTGCTTCCAATTAAATCTGCTA 57.533 32.000 0.00 0.0 32.75 3.49
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
72 74 1.065126 GTTGGGCTGCTAAGAGGTGAT 60.065 52.381 0.00 0.00 0.00 3.06
81 83 1.228737 GGTTTGGGTTGGGCTGCTA 60.229 57.895 0.00 0.00 0.00 3.49
87 89 1.549265 GGAGTTAGGGTTTGGGTTGGG 60.549 57.143 0.00 0.00 0.00 4.12
282 307 4.817909 AGGGGAGTTAGGGCGGGG 62.818 72.222 0.00 0.00 0.00 5.73
354 392 1.512735 CTAAGGGAAGGAGAAGGGGG 58.487 60.000 0.00 0.00 0.00 5.40
664 908 2.650116 GGTGGAGAGCGCCTTCTCA 61.650 63.158 23.35 10.50 44.34 3.27
668 912 4.070552 GTCGGTGGAGAGCGCCTT 62.071 66.667 2.29 0.00 42.92 4.35
1055 1361 2.811542 GAACCTGTCCTGCTCCCTGC 62.812 65.000 0.00 0.00 43.25 4.85
1189 1495 1.373497 CCACTCACTCGCTGGTGAC 60.373 63.158 4.82 0.00 40.72 3.67
1229 1535 1.154035 GATTCGGGCAGGCAAAACG 60.154 57.895 0.00 0.00 0.00 3.60
1279 1585 3.367498 GCCCTACAGTACAGACAAGACAG 60.367 52.174 0.00 0.00 0.00 3.51
1306 1612 1.072965 CTTCTCCCTCTGGCACTTGTT 59.927 52.381 0.00 0.00 0.00 2.83
1358 1664 1.598962 CCTAGCATGGCCATCACCG 60.599 63.158 17.61 5.75 0.00 4.94
1855 2165 1.630126 AAGCCCCATCACGCTCTGAT 61.630 55.000 0.00 0.00 40.59 2.90
1918 2229 0.386858 GCTGTGTCGTCTTCGTGCTA 60.387 55.000 0.00 0.00 38.33 3.49
2314 2631 6.317642 TGCTAAGGTGCATACGATTGTATTTT 59.682 34.615 2.58 0.00 39.28 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.