Multiple sequence alignment - TraesCS5B01G454700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G454700 chr5B 100.000 5783 0 0 1 5783 628693453 628699235 0.000000e+00 10680.0
1 TraesCS5B01G454700 chr5B 99.482 5788 24 5 1 5783 625113900 625119686 0.000000e+00 10517.0
2 TraesCS5B01G454700 chr5B 92.807 2822 133 24 1 2772 629894633 629897434 0.000000e+00 4023.0
3 TraesCS5B01G454700 chr5B 96.401 2334 70 3 228 2547 626837258 626839591 0.000000e+00 3832.0
4 TraesCS5B01G454700 chr5B 96.072 2342 70 4 228 2547 623166282 623168623 0.000000e+00 3795.0
5 TraesCS5B01G454700 chr5B 92.851 2182 133 11 2874 5040 633177217 633175044 0.000000e+00 3144.0
6 TraesCS5B01G454700 chr5B 96.376 1683 59 2 3360 5041 623171482 623173163 0.000000e+00 2769.0
7 TraesCS5B01G454700 chr5B 96.316 1683 59 3 3360 5041 629897439 629899119 0.000000e+00 2761.0
8 TraesCS5B01G454700 chr5B 96.261 1685 57 5 3360 5041 626842449 626844130 0.000000e+00 2758.0
9 TraesCS5B01G454700 chr5B 91.735 1464 57 18 893 2328 633179460 633178033 0.000000e+00 1975.0
10 TraesCS5B01G454700 chr5B 98.122 213 3 1 5241 5453 625120927 625120716 2.550000e-98 370.0
11 TraesCS5B01G454700 chr5B 90.476 231 21 1 1 230 626836993 626837223 2.620000e-78 303.0
12 TraesCS5B01G454700 chr5B 90.638 235 2 2 2538 2772 623171263 623171477 1.580000e-75 294.0
13 TraesCS5B01G454700 chr5B 90.638 235 2 2 2538 2772 626842230 626842444 1.580000e-75 294.0
14 TraesCS5B01G454700 chr5B 89.764 127 11 2 5036 5161 268959422 268959547 1.670000e-35 161.0
15 TraesCS5B01G454700 chr5B 94.253 87 4 1 5156 5242 629899118 629899203 1.310000e-26 132.0
16 TraesCS5B01G454700 chr5B 97.561 41 1 0 5156 5196 626844129 626844169 2.890000e-08 71.3
17 TraesCS5B01G454700 chr5B 95.122 41 2 0 5156 5196 623173162 623173202 1.350000e-06 65.8
18 TraesCS5B01G454700 chr5A 95.311 1578 70 3 3465 5041 625733832 625732258 0.000000e+00 2501.0
19 TraesCS5B01G454700 chr5A 94.195 1602 67 10 893 2478 625738874 625737283 0.000000e+00 2420.0
20 TraesCS5B01G454700 chr5A 94.825 715 25 5 2463 3167 625737251 625736539 0.000000e+00 1105.0
21 TraesCS5B01G454700 chr5A 93.727 271 16 1 3188 3457 625735063 625734793 6.980000e-109 405.0
22 TraesCS5B01G454700 chr5A 87.591 137 16 1 96 231 681936465 681936329 2.160000e-34 158.0
23 TraesCS5B01G454700 chr5A 86.131 137 18 1 96 231 683610882 683611018 4.670000e-31 147.0
24 TraesCS5B01G454700 chr5A 84.058 138 19 3 96 231 535155224 535155088 4.700000e-26 130.0
25 TraesCS5B01G454700 chr7A 98.711 543 7 0 5241 5783 487478893 487478351 0.000000e+00 965.0
26 TraesCS5B01G454700 chr7A 99.048 210 1 1 5241 5450 487477110 487477318 5.470000e-100 375.0
27 TraesCS5B01G454700 chr6A 83.431 1026 162 7 3755 4775 32898759 32897737 0.000000e+00 946.0
28 TraesCS5B01G454700 chr6A 76.582 1375 210 67 1000 2307 32900824 32899495 0.000000e+00 652.0
29 TraesCS5B01G454700 chr6A 82.162 185 26 4 659 836 599956078 599956262 1.000000e-32 152.0
30 TraesCS5B01G454700 chr6B 96.558 552 17 1 5232 5783 615607165 615607714 0.000000e+00 913.0
31 TraesCS5B01G454700 chr6B 90.909 561 41 7 5230 5783 507373847 507373290 0.000000e+00 745.0
32 TraesCS5B01G454700 chr6B 83.439 157 26 0 1093 1249 714336607 714336451 4.670000e-31 147.0
33 TraesCS5B01G454700 chr6B 87.288 118 14 1 3251 3367 204946656 204946773 3.640000e-27 134.0
34 TraesCS5B01G454700 chrUn 97.204 465 13 0 3360 3824 349939120 349939584 0.000000e+00 787.0
35 TraesCS5B01G454700 chrUn 97.204 465 13 0 3360 3824 349941413 349941877 0.000000e+00 787.0
36 TraesCS5B01G454700 chrUn 90.638 235 2 2 2538 2772 349938901 349939115 1.580000e-75 294.0
37 TraesCS5B01G454700 chrUn 90.638 235 2 2 2538 2772 349941194 349941408 1.580000e-75 294.0
38 TraesCS5B01G454700 chr2D 92.559 551 31 2 5241 5782 81514788 81515337 0.000000e+00 782.0
39 TraesCS5B01G454700 chr6D 77.639 1364 200 58 1000 2307 29768994 29770308 0.000000e+00 732.0
40 TraesCS5B01G454700 chr6D 80.579 932 181 0 3806 4737 468096600 468095669 0.000000e+00 719.0
41 TraesCS5B01G454700 chr6D 79.575 989 196 6 3790 4775 468057264 468056279 0.000000e+00 702.0
42 TraesCS5B01G454700 chr6D 74.613 323 65 12 530 836 453937666 453937987 6.080000e-25 126.0
43 TraesCS5B01G454700 chr7B 95.133 226 11 0 5237 5462 656195494 656195719 1.980000e-94 357.0
44 TraesCS5B01G454700 chr1B 94.017 234 12 2 5231 5462 570298558 570298791 2.560000e-93 353.0
45 TraesCS5B01G454700 chr1B 74.083 409 68 20 476 858 676897134 676896738 3.640000e-27 134.0
46 TraesCS5B01G454700 chr5D 86.228 334 34 6 4718 5041 297092971 297092640 9.220000e-93 351.0
47 TraesCS5B01G454700 chr5D 84.141 227 24 5 229 454 421546703 421546488 5.870000e-50 209.0
48 TraesCS5B01G454700 chr5D 90.580 138 11 2 96 231 421546875 421546738 1.280000e-41 182.0
49 TraesCS5B01G454700 chr3A 79.639 388 45 15 96 452 19187722 19187338 1.240000e-61 248.0
50 TraesCS5B01G454700 chr3A 91.057 123 11 0 5036 5158 720229499 720229621 3.580000e-37 167.0
51 TraesCS5B01G454700 chr4A 90.000 200 7 3 5594 5783 489436020 489436216 4.480000e-61 246.0
52 TraesCS5B01G454700 chr4A 92.661 109 8 0 5493 5601 489434392 489434500 2.160000e-34 158.0
53 TraesCS5B01G454700 chr4D 89.000 200 9 3 5594 5783 93068223 93068027 9.690000e-58 235.0
54 TraesCS5B01G454700 chr4D 91.667 120 8 2 5039 5157 367720660 367720542 1.290000e-36 165.0
55 TraesCS5B01G454700 chr4D 90.678 118 11 0 5040 5157 337412286 337412403 2.160000e-34 158.0
56 TraesCS5B01G454700 chr4D 94.845 97 5 0 5505 5601 93069753 93069657 1.000000e-32 152.0
57 TraesCS5B01G454700 chr4B 88.500 200 10 3 5594 5783 130623450 130623254 4.510000e-56 230.0
58 TraesCS5B01G454700 chr4B 94.340 106 6 0 5496 5601 130625061 130624956 4.640000e-36 163.0
59 TraesCS5B01G454700 chr4B 90.323 124 11 1 5035 5158 183611086 183611208 1.670000e-35 161.0
60 TraesCS5B01G454700 chr3B 84.507 213 15 8 96 290 596435323 596435111 1.640000e-45 195.0
61 TraesCS5B01G454700 chr7D 91.270 126 11 0 99 224 535577690 535577565 7.700000e-39 172.0
62 TraesCS5B01G454700 chr7D 75.250 400 76 15 470 858 60274117 60274504 9.970000e-38 169.0
63 TraesCS5B01G454700 chr7D 89.431 123 13 0 5036 5158 46717876 46717998 7.760000e-34 156.0
64 TraesCS5B01G454700 chr2B 90.244 123 10 2 5037 5158 239419438 239419559 6.000000e-35 159.0
65 TraesCS5B01G454700 chr2B 77.320 194 34 7 651 838 551040311 551040500 7.930000e-19 106.0
66 TraesCS5B01G454700 chr2B 87.838 74 7 2 730 802 210010366 210010294 1.030000e-12 86.1
67 TraesCS5B01G454700 chr1A 89.431 123 13 0 5036 5158 32469796 32469674 7.760000e-34 156.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G454700 chr5B 628693453 628699235 5782 False 10680.000000 10680 100.000000 1 5783 1 chr5B.!!$F3 5782
1 TraesCS5B01G454700 chr5B 625113900 625119686 5786 False 10517.000000 10517 99.482000 1 5783 1 chr5B.!!$F2 5782
2 TraesCS5B01G454700 chr5B 633175044 633179460 4416 True 2559.500000 3144 92.293000 893 5040 2 chr5B.!!$R2 4147
3 TraesCS5B01G454700 chr5B 629894633 629899203 4570 False 2305.333333 4023 94.458667 1 5242 3 chr5B.!!$F6 5241
4 TraesCS5B01G454700 chr5B 623166282 623173202 6920 False 1730.950000 3795 94.552000 228 5196 4 chr5B.!!$F4 4968
5 TraesCS5B01G454700 chr5B 626836993 626844169 7176 False 1451.660000 3832 94.267400 1 5196 5 chr5B.!!$F5 5195
6 TraesCS5B01G454700 chr5A 625732258 625738874 6616 True 1607.750000 2501 94.514500 893 5041 4 chr5A.!!$R3 4148
7 TraesCS5B01G454700 chr7A 487478351 487478893 542 True 965.000000 965 98.711000 5241 5783 1 chr7A.!!$R1 542
8 TraesCS5B01G454700 chr6A 32897737 32900824 3087 True 799.000000 946 80.006500 1000 4775 2 chr6A.!!$R1 3775
9 TraesCS5B01G454700 chr6B 615607165 615607714 549 False 913.000000 913 96.558000 5232 5783 1 chr6B.!!$F2 551
10 TraesCS5B01G454700 chr6B 507373290 507373847 557 True 745.000000 745 90.909000 5230 5783 1 chr6B.!!$R1 553
11 TraesCS5B01G454700 chrUn 349938901 349941877 2976 False 540.500000 787 93.921000 2538 3824 4 chrUn.!!$F1 1286
12 TraesCS5B01G454700 chr2D 81514788 81515337 549 False 782.000000 782 92.559000 5241 5782 1 chr2D.!!$F1 541
13 TraesCS5B01G454700 chr6D 29768994 29770308 1314 False 732.000000 732 77.639000 1000 2307 1 chr6D.!!$F1 1307
14 TraesCS5B01G454700 chr6D 468095669 468096600 931 True 719.000000 719 80.579000 3806 4737 1 chr6D.!!$R2 931
15 TraesCS5B01G454700 chr6D 468056279 468057264 985 True 702.000000 702 79.575000 3790 4775 1 chr6D.!!$R1 985
16 TraesCS5B01G454700 chr4A 489434392 489436216 1824 False 202.000000 246 91.330500 5493 5783 2 chr4A.!!$F1 290

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3203 10432 6.073440 CCTTGGTCAAAATTCATCAAAGCAAG 60.073 38.462 0.0 0.0 39.31 4.01 F
3582 11765 5.765182 CGCTTGGTATAGAAATCCAATTCCT 59.235 40.000 0.0 0.0 39.91 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
4367 12595 0.912486 AAAGTCCGAGATCTTGGGGG 59.088 55.0 26.13 11.96 34.78 5.40 R
5070 13302 7.154191 AGATACATCCATTTAAGGGACACAT 57.846 36.0 0.00 0.00 37.23 3.21 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
3203 10432 6.073440 CCTTGGTCAAAATTCATCAAAGCAAG 60.073 38.462 0.0 0.0 39.31 4.01
3582 11765 5.765182 CGCTTGGTATAGAAATCCAATTCCT 59.235 40.000 0.0 0.0 39.91 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
753 804 3.701205 ACATAGTCAGGATGCACACAA 57.299 42.857 0.00 0.00 34.76 3.33
3582 11765 7.339482 AGCCATATATATGTACTCTGTCTCGA 58.661 38.462 19.11 0.00 31.82 4.04
3930 12158 3.077359 CACGAGCTCCTCCTTTTTGAAT 58.923 45.455 8.47 0.00 0.00 2.57
4367 12595 0.912486 AAAGTCCGAGATCTTGGGGG 59.088 55.000 26.13 11.96 34.78 5.40
5070 13302 7.154191 AGATACATCCATTTAAGGGACACAT 57.846 36.000 0.00 0.00 37.23 3.21


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.