Multiple sequence alignment - TraesCS5B01G454200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G454200 chr5B 100.000 6439 0 0 1 6439 626858796 626865234 0.000000e+00 11891.0
1 TraesCS5B01G454200 chr5B 99.289 6473 9 6 1 6439 623196480 623202949 0.000000e+00 11664.0
2 TraesCS5B01G454200 chr5B 95.656 3292 110 19 424 3696 628825003 628828280 0.000000e+00 5256.0
3 TraesCS5B01G454200 chr5B 95.956 3165 101 14 551 3696 625225577 625228733 0.000000e+00 5110.0
4 TraesCS5B01G454200 chr5B 91.787 2216 130 29 3229 5410 622742672 622740475 0.000000e+00 3037.0
5 TraesCS5B01G454200 chr5B 93.747 2047 84 19 755 2776 629975637 629977664 0.000000e+00 3031.0
6 TraesCS5B01G454200 chr5B 89.817 2131 121 33 633 2706 622745187 622743096 0.000000e+00 2645.0
7 TraesCS5B01G454200 chr5B 90.241 1742 122 26 3698 5410 628828364 628830086 0.000000e+00 2231.0
8 TraesCS5B01G454200 chr5B 90.247 1743 121 27 3698 5410 633119442 633117719 0.000000e+00 2231.0
9 TraesCS5B01G454200 chr5B 90.184 1742 123 26 3698 5410 625228817 625230539 0.000000e+00 2226.0
10 TraesCS5B01G454200 chr5B 87.842 913 60 25 5442 6313 622740004 622739102 0.000000e+00 1024.0
11 TraesCS5B01G454200 chr5B 94.748 457 24 0 1 457 231198302 231197846 0.000000e+00 712.0
12 TraesCS5B01G454200 chr5B 94.748 457 24 0 1 457 254302139 254302595 0.000000e+00 712.0
13 TraesCS5B01G454200 chr5B 94.530 457 25 0 1 457 254371494 254371950 0.000000e+00 706.0
14 TraesCS5B01G454200 chr5B 84.110 365 18 15 424 757 629975318 629975673 3.750000e-82 316.0
15 TraesCS5B01G454200 chr5B 85.806 310 16 14 5489 5791 629980991 629981279 2.920000e-78 303.0
16 TraesCS5B01G454200 chr5B 85.811 148 20 1 5924 6070 629981490 629981637 8.640000e-34 156.0
17 TraesCS5B01G454200 chr5B 100.000 30 0 0 728 757 623197264 623197293 1.000000e-03 56.5
18 TraesCS5B01G454200 chr5A 91.232 4254 271 49 1220 5410 626061694 626065908 0.000000e+00 5696.0
19 TraesCS5B01G454200 chr5A 91.690 3225 191 32 1773 4942 599541962 599545164 0.000000e+00 4399.0
20 TraesCS5B01G454200 chr5A 93.615 2866 130 23 1228 4066 625690193 625687354 0.000000e+00 4229.0
21 TraesCS5B01G454200 chr5A 86.652 884 84 18 4541 5403 625687170 625686300 0.000000e+00 948.0
22 TraesCS5B01G454200 chr5A 87.239 862 49 25 5442 6263 625682823 625681983 0.000000e+00 926.0
23 TraesCS5B01G454200 chr5A 90.205 633 26 11 5460 6068 626066382 626067002 0.000000e+00 793.0
24 TraesCS5B01G454200 chr5A 89.728 331 15 7 5988 6312 626067003 626067320 7.770000e-109 405.0
25 TraesCS5B01G454200 chr5A 79.457 589 50 35 551 1114 599540831 599541373 1.030000e-92 351.0
26 TraesCS5B01G454200 chr5A 79.514 576 47 35 568 1114 625690815 625690282 1.720000e-90 344.0
27 TraesCS5B01G454200 chr5A 79.181 586 49 36 560 1114 626061072 626061615 8.000000e-89 339.0
28 TraesCS5B01G454200 chr5A 80.818 318 32 12 5953 6244 599546327 599546641 8.400000e-54 222.0
29 TraesCS5B01G454200 chr5A 79.769 173 26 7 5454 5623 599546019 599546185 4.080000e-22 117.0
30 TraesCS5B01G454200 chr5D 92.064 2999 158 41 755 3699 296877611 296874639 0.000000e+00 4146.0
31 TraesCS5B01G454200 chr5D 90.481 3141 175 51 610 3696 501512943 501516013 0.000000e+00 4030.0
32 TraesCS5B01G454200 chr5D 91.326 3009 152 48 746 3699 501214614 501211660 0.000000e+00 4010.0
33 TraesCS5B01G454200 chr5D 90.143 1745 121 30 3698 5410 501516097 501517822 0.000000e+00 2222.0
34 TraesCS5B01G454200 chr5D 89.628 1745 128 31 3698 5410 501211579 501209856 0.000000e+00 2170.0
35 TraesCS5B01G454200 chr5D 86.780 885 83 16 4541 5403 296874453 296873581 0.000000e+00 955.0
36 TraesCS5B01G454200 chr5D 85.987 892 62 27 5460 6313 296868710 296867844 0.000000e+00 896.0
37 TraesCS5B01G454200 chr5D 87.199 789 65 17 4646 5410 296869959 296869183 0.000000e+00 865.0
38 TraesCS5B01G454200 chr5D 87.928 555 40 13 5785 6313 501209098 501208545 4.240000e-176 628.0
39 TraesCS5B01G454200 chr5D 89.935 308 20 6 5442 5746 501209390 501209091 2.820000e-103 387.0
40 TraesCS5B01G454200 chrUn 93.326 1768 92 15 1948 3696 356907796 356909556 0.000000e+00 2588.0
41 TraesCS5B01G454200 chrUn 89.615 1531 120 18 3905 5410 374360000 374361516 0.000000e+00 1910.0
42 TraesCS5B01G454200 chrUn 98.415 694 5 5 424 1117 378267029 378266342 0.000000e+00 1216.0
43 TraesCS5B01G454200 chrUn 95.258 717 6 6 424 1117 376626233 376625522 0.000000e+00 1110.0
44 TraesCS5B01G454200 chrUn 100.000 30 0 0 728 757 376625877 376625848 1.000000e-03 56.5
45 TraesCS5B01G454200 chrUn 100.000 30 0 0 728 757 378266697 378266668 1.000000e-03 56.5
46 TraesCS5B01G454200 chr3B 95.405 457 21 0 1 457 470199633 470200089 0.000000e+00 728.0
47 TraesCS5B01G454200 chr3B 94.530 457 25 0 1 457 672068702 672068246 0.000000e+00 706.0
48 TraesCS5B01G454200 chr3B 85.973 442 33 10 5472 5909 11695936 11696352 4.580000e-121 446.0
49 TraesCS5B01G454200 chr3B 79.648 511 64 17 5923 6407 461305137 461305633 1.340000e-86 331.0
50 TraesCS5B01G454200 chr3B 85.652 230 25 4 5453 5680 461304808 461305031 1.080000e-57 235.0
51 TraesCS5B01G454200 chr7B 94.748 457 24 0 1 457 19170574 19170118 0.000000e+00 712.0
52 TraesCS5B01G454200 chr6B 94.397 464 23 3 1 464 308396777 308397237 0.000000e+00 710.0
53 TraesCS5B01G454200 chr6B 87.500 472 45 10 948 1416 693676700 693677160 3.420000e-147 532.0
54 TraesCS5B01G454200 chr2D 94.530 457 25 0 1 457 465997488 465997032 0.000000e+00 706.0
55 TraesCS5B01G454200 chr2B 86.892 473 47 11 948 1416 559331985 559331524 3.440000e-142 516.0
56 TraesCS5B01G454200 chr2B 86.653 472 49 9 948 1416 152884179 152883719 1.600000e-140 510.0
57 TraesCS5B01G454200 chr4B 85.246 427 36 9 5489 5912 477967059 477966657 1.290000e-111 414.0
58 TraesCS5B01G454200 chr1B 84.034 238 22 9 5740 5972 491633339 491633113 1.410000e-51 215.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G454200 chr5B 626858796 626865234 6438 False 11891.000000 11891 100.000000 1 6439 1 chr5B.!!$F5 6438
1 TraesCS5B01G454200 chr5B 623196480 623202949 6469 False 11664.000000 11664 99.289000 1 6439 1 chr5B.!!$F3 6438
2 TraesCS5B01G454200 chr5B 628825003 628830086 5083 False 3743.500000 5256 92.948500 424 5410 2 chr5B.!!$F7 4986
3 TraesCS5B01G454200 chr5B 625225577 625230539 4962 False 3668.000000 5110 93.070000 551 5410 2 chr5B.!!$F6 4859
4 TraesCS5B01G454200 chr5B 622739102 622745187 6085 True 2235.333333 3037 89.815333 633 6313 3 chr5B.!!$R3 5680
5 TraesCS5B01G454200 chr5B 633117719 633119442 1723 True 2231.000000 2231 90.247000 3698 5410 1 chr5B.!!$R2 1712
6 TraesCS5B01G454200 chr5B 629975318 629981637 6319 False 951.500000 3031 87.368500 424 6070 4 chr5B.!!$F8 5646
7 TraesCS5B01G454200 chr5A 626061072 626067320 6248 False 1808.250000 5696 87.586500 560 6312 4 chr5A.!!$F2 5752
8 TraesCS5B01G454200 chr5A 625681983 625690815 8832 True 1611.750000 4229 86.755000 568 6263 4 chr5A.!!$R1 5695
9 TraesCS5B01G454200 chr5A 599540831 599546641 5810 False 1272.250000 4399 82.933500 551 6244 4 chr5A.!!$F1 5693
10 TraesCS5B01G454200 chr5D 501512943 501517822 4879 False 3126.000000 4030 90.312000 610 5410 2 chr5D.!!$F1 4800
11 TraesCS5B01G454200 chr5D 501208545 501214614 6069 True 1798.750000 4010 89.704250 746 6313 4 chr5D.!!$R2 5567
12 TraesCS5B01G454200 chr5D 296867844 296877611 9767 True 1715.500000 4146 88.007500 755 6313 4 chr5D.!!$R1 5558
13 TraesCS5B01G454200 chrUn 356907796 356909556 1760 False 2588.000000 2588 93.326000 1948 3696 1 chrUn.!!$F1 1748
14 TraesCS5B01G454200 chrUn 374360000 374361516 1516 False 1910.000000 1910 89.615000 3905 5410 1 chrUn.!!$F2 1505
15 TraesCS5B01G454200 chrUn 378266342 378267029 687 True 636.250000 1216 99.207500 424 1117 2 chrUn.!!$R2 693
16 TraesCS5B01G454200 chrUn 376625522 376626233 711 True 583.250000 1110 97.629000 424 1117 2 chrUn.!!$R1 693
17 TraesCS5B01G454200 chr3B 461304808 461305633 825 False 283.000000 331 82.650000 5453 6407 2 chr3B.!!$F3 954

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
364 365 2.783135 CTCAACAAGGCACTGTATGGT 58.217 47.619 0.0 0.0 40.86 3.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
5438 11988 5.073417 AGAGAGGGAGGATTACGTATAGTGT 59.927 44.0 0.0 0.0 0.0 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
45 46 3.065786 CCTCGCAAGCACAATATCATTGT 59.934 43.478 0.0 0.0 37.18 2.71
326 327 5.511888 CCTGGCTTTGAAGATCCAAAACATT 60.512 40.000 0.0 0.0 35.83 2.71
364 365 2.783135 CTCAACAAGGCACTGTATGGT 58.217 47.619 0.0 0.0 40.86 3.55
2535 2727 5.869753 ATCAGAAAGATGTGTAGTTGTGC 57.130 39.130 0.0 0.0 35.06 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
45 46 3.836365 TGCGATAGATCCATTTGGTGA 57.164 42.857 0.0 0.0 39.76 4.02
326 327 7.360113 TGTTGAGCTTGTATACCATATCAGA 57.640 36.000 0.0 0.0 0.00 3.27
364 365 2.037251 AGCACGAGGAGCTTGTTTAAGA 59.963 45.455 0.0 0.0 39.87 2.10
5438 11988 5.073417 AGAGAGGGAGGATTACGTATAGTGT 59.927 44.000 0.0 0.0 0.00 3.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.