Multiple sequence alignment - TraesCS5B01G454000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G454000 chr5B 100.000 2975 0 0 1 2975 626786946 626783972 0.000000e+00 5494.0
1 TraesCS5B01G454000 chr5B 97.885 2979 38 9 1 2975 623118995 623116038 0.000000e+00 5129.0
2 TraesCS5B01G454000 chr5B 99.864 2211 3 0 765 2975 629854179 629851969 0.000000e+00 4067.0
3 TraesCS5B01G454000 chr5B 89.805 1285 99 14 1358 2613 633287057 633288338 0.000000e+00 1618.0
4 TraesCS5B01G454000 chr5B 88.994 1263 106 15 1358 2590 623114414 623113155 0.000000e+00 1531.0
5 TraesCS5B01G454000 chr5B 90.771 986 65 11 1651 2613 633270493 633271475 0.000000e+00 1293.0
6 TraesCS5B01G454000 chr5B 83.735 332 48 2 2003 2331 623102008 623101680 2.880000e-80 309.0
7 TraesCS5B01G454000 chr5B 95.495 111 5 0 2830 2940 511610849 511610739 8.470000e-41 178.0
8 TraesCS5B01G454000 chr5B 89.655 87 7 2 2289 2373 620582373 620582287 3.140000e-20 110.0
9 TraesCS5B01G454000 chr5B 90.323 62 5 1 2721 2782 704836877 704836817 2.460000e-11 80.5
10 TraesCS5B01G454000 chr5D 94.810 2447 95 14 289 2726 501825300 501822877 0.000000e+00 3786.0
11 TraesCS5B01G454000 chr5D 95.939 1847 63 1 892 2726 501864428 501862582 0.000000e+00 2985.0
12 TraesCS5B01G454000 chr5D 84.427 1509 152 33 916 2372 471632805 471634282 0.000000e+00 1408.0
13 TraesCS5B01G454000 chr5D 84.361 1509 153 33 916 2372 471545254 471546731 0.000000e+00 1402.0
14 TraesCS5B01G454000 chr5D 84.106 1510 155 33 916 2373 471706440 471707916 0.000000e+00 1380.0
15 TraesCS5B01G454000 chr5D 94.362 745 34 6 167 910 501791127 501790390 0.000000e+00 1136.0
16 TraesCS5B01G454000 chr5D 93.700 746 36 9 167 910 501828199 501827463 0.000000e+00 1107.0
17 TraesCS5B01G454000 chr5D 84.986 1039 107 21 928 1949 501397556 501396550 0.000000e+00 1009.0
18 TraesCS5B01G454000 chr5D 96.000 200 8 0 2776 2975 501822876 501822677 2.860000e-85 326.0
19 TraesCS5B01G454000 chr5D 96.000 200 8 0 2776 2975 501862581 501862382 2.860000e-85 326.0
20 TraesCS5B01G454000 chr5D 95.973 149 4 2 19 166 295008650 295008503 1.070000e-59 241.0
21 TraesCS5B01G454000 chr5D 72.651 713 136 32 1689 2366 296450622 296451310 6.550000e-42 182.0
22 TraesCS5B01G454000 chr5D 90.323 62 6 0 2725 2786 174010603 174010664 6.830000e-12 82.4
23 TraesCS5B01G454000 chr5D 94.000 50 2 1 2289 2337 498927956 498927907 1.140000e-09 75.0
24 TraesCS5B01G454000 chr5D 94.000 50 2 1 2289 2337 501709492 501709443 1.140000e-09 75.0
25 TraesCS5B01G454000 chr5D 72.444 225 45 13 471 688 218511153 218511367 4.140000e-04 56.5
26 TraesCS5B01G454000 chr5D 87.500 48 6 0 2928 2975 501438932 501438885 4.140000e-04 56.5
27 TraesCS5B01G454000 chr5A 90.090 555 27 12 920 1456 629275334 629274790 0.000000e+00 695.0
28 TraesCS5B01G454000 chr5A 87.393 468 42 8 2042 2492 629286203 629285736 3.400000e-144 521.0
29 TraesCS5B01G454000 chr5A 83.509 285 38 6 1669 1949 629251993 629251714 1.060000e-64 257.0
30 TraesCS5B01G454000 chr5A 94.040 151 7 2 17 166 26813088 26812939 8.300000e-56 228.0
31 TraesCS5B01G454000 chr5A 88.060 67 4 4 2736 2799 598891070 598891005 3.180000e-10 76.8
32 TraesCS5B01G454000 chr7D 95.333 150 7 0 17 166 282854609 282854460 3.830000e-59 239.0
33 TraesCS5B01G454000 chr7D 85.106 94 11 3 2741 2833 33051182 33051091 3.160000e-15 93.5
34 TraesCS5B01G454000 chr7D 92.424 66 3 2 2720 2785 568014434 568014371 3.160000e-15 93.5
35 TraesCS5B01G454000 chr7D 91.667 60 3 1 2724 2781 440985277 440985336 6.830000e-12 82.4
36 TraesCS5B01G454000 chr7D 75.401 187 34 9 440 623 168053800 168053977 2.460000e-11 80.5
37 TraesCS5B01G454000 chr7A 94.771 153 8 0 14 166 306652694 306652846 3.830000e-59 239.0
38 TraesCS5B01G454000 chr6D 95.333 150 7 0 17 166 145555393 145555244 3.830000e-59 239.0
39 TraesCS5B01G454000 chr2D 94.771 153 8 0 14 166 155950983 155951135 3.830000e-59 239.0
40 TraesCS5B01G454000 chr2D 93.043 115 7 1 2828 2941 599945171 599945285 1.830000e-37 167.0
41 TraesCS5B01G454000 chr1D 94.631 149 8 0 18 166 73303643 73303791 6.410000e-57 231.0
42 TraesCS5B01G454000 chr1D 89.552 67 6 1 2725 2791 206102136 206102201 1.900000e-12 84.2
43 TraesCS5B01G454000 chr3D 93.464 153 10 0 14 166 528205725 528205877 8.300000e-56 228.0
44 TraesCS5B01G454000 chr6A 94.495 109 6 0 2829 2937 17663800 17663908 5.100000e-38 169.0
45 TraesCS5B01G454000 chr1B 93.103 116 7 1 2829 2943 229263161 229263276 5.100000e-38 169.0
46 TraesCS5B01G454000 chr1B 91.379 58 5 0 2736 2793 200103189 200103132 2.460000e-11 80.5
47 TraesCS5B01G454000 chr7B 93.694 111 7 0 2827 2937 15305770 15305660 1.830000e-37 167.0
48 TraesCS5B01G454000 chr4A 94.340 53 3 0 2737 2789 665926596 665926544 6.830000e-12 82.4
49 TraesCS5B01G454000 chr4A 92.593 54 4 0 2780 2833 564893721 564893774 8.840000e-11 78.7
50 TraesCS5B01G454000 chr4A 83.784 74 7 4 465 536 626717401 626717331 6.880000e-07 65.8
51 TraesCS5B01G454000 chr4A 91.489 47 3 1 2643 2688 704800787 704800741 2.480000e-06 63.9
52 TraesCS5B01G454000 chr4A 94.737 38 1 1 2645 2681 11673186 11673149 1.150000e-04 58.4
53 TraesCS5B01G454000 chr2B 91.379 58 4 1 2736 2792 678068726 678068783 8.840000e-11 78.7
54 TraesCS5B01G454000 chr2B 84.848 66 10 0 472 537 436534598 436534663 1.910000e-07 67.6
55 TraesCS5B01G454000 chr2B 100.000 28 0 0 490 517 453333406 453333433 5.000000e-03 52.8
56 TraesCS5B01G454000 chr3A 93.023 43 2 1 2647 2688 451671100 451671142 8.900000e-06 62.1
57 TraesCS5B01G454000 chr3A 88.636 44 4 1 585 627 516891108 516891151 5.000000e-03 52.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G454000 chr5B 626783972 626786946 2974 True 5494.000000 5494 100.000000 1 2975 1 chr5B.!!$R4 2974
1 TraesCS5B01G454000 chr5B 629851969 629854179 2210 True 4067.000000 4067 99.864000 765 2975 1 chr5B.!!$R5 2210
2 TraesCS5B01G454000 chr5B 623113155 623118995 5840 True 3330.000000 5129 93.439500 1 2975 2 chr5B.!!$R7 2974
3 TraesCS5B01G454000 chr5B 633287057 633288338 1281 False 1618.000000 1618 89.805000 1358 2613 1 chr5B.!!$F2 1255
4 TraesCS5B01G454000 chr5B 633270493 633271475 982 False 1293.000000 1293 90.771000 1651 2613 1 chr5B.!!$F1 962
5 TraesCS5B01G454000 chr5D 501822677 501828199 5522 True 1739.666667 3786 94.836667 167 2975 3 chr5D.!!$R7 2808
6 TraesCS5B01G454000 chr5D 501862382 501864428 2046 True 1655.500000 2985 95.969500 892 2975 2 chr5D.!!$R8 2083
7 TraesCS5B01G454000 chr5D 471632805 471634282 1477 False 1408.000000 1408 84.427000 916 2372 1 chr5D.!!$F5 1456
8 TraesCS5B01G454000 chr5D 471545254 471546731 1477 False 1402.000000 1402 84.361000 916 2372 1 chr5D.!!$F4 1456
9 TraesCS5B01G454000 chr5D 471706440 471707916 1476 False 1380.000000 1380 84.106000 916 2373 1 chr5D.!!$F6 1457
10 TraesCS5B01G454000 chr5D 501790390 501791127 737 True 1136.000000 1136 94.362000 167 910 1 chr5D.!!$R6 743
11 TraesCS5B01G454000 chr5D 501396550 501397556 1006 True 1009.000000 1009 84.986000 928 1949 1 chr5D.!!$R3 1021
12 TraesCS5B01G454000 chr5A 629274790 629275334 544 True 695.000000 695 90.090000 920 1456 1 chr5A.!!$R4 536

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
210 211 0.108615 CTTCAGGCGGCCGATATAGG 60.109 60.0 33.48 11.4 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2565 5412 2.035312 AGGCTGGAGCAAAGCAGG 59.965 61.111 0.2 0.0 42.69 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 2.182030 CGTGGCTCCTCCGACTTC 59.818 66.667 0.00 0.0 37.80 3.01
210 211 0.108615 CTTCAGGCGGCCGATATAGG 60.109 60.000 33.48 11.4 0.00 2.57
421 422 6.094186 GGAACGCATTTCTTTCTTCTTATCCT 59.906 38.462 0.00 0.0 34.26 3.24
763 767 3.980646 TTTTGAATGGTCAACGGTGAG 57.019 42.857 1.63 0.0 43.52 3.51
2565 5412 4.199310 TGTTTGCCCTATGTTATGCTCTC 58.801 43.478 0.00 0.0 0.00 3.20
2626 5473 8.749026 ATTTTGCATCATGAATCTCTAGTCTT 57.251 30.769 0.00 0.0 0.00 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 2.304180 ACAACCAGGAGACTTGGAGATG 59.696 50.000 6.90 5.57 40.21 2.90
210 211 1.101049 TAGCCCGCTAGCAAAATGGC 61.101 55.000 16.45 16.70 39.17 4.40
751 755 2.753452 TCTGACTATCTCACCGTTGACC 59.247 50.000 0.00 0.00 0.00 4.02
763 767 2.580966 GGTTGACCGGTCTGACTATC 57.419 55.000 33.39 15.77 0.00 2.08
2565 5412 2.035312 AGGCTGGAGCAAAGCAGG 59.965 61.111 0.20 0.00 42.69 4.85
2924 5774 6.415206 TCAGTTAATTAATACTCCCTCCGG 57.585 41.667 0.31 0.00 0.00 5.14


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.