Multiple sequence alignment - TraesCS5B01G452200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G452200 chr5B 100.000 2795 0 0 1 2795 625047902 625050696 0.000000e+00 5162
1 TraesCS5B01G452200 chr5B 99.059 1913 18 0 6 1918 628619104 628621016 0.000000e+00 3434
2 TraesCS5B01G452200 chr5B 99.203 878 6 1 1919 2795 628629598 628630475 0.000000e+00 1581
3 TraesCS5B01G452200 chr5B 94.773 880 43 2 1919 2795 51772456 51773335 0.000000e+00 1367
4 TraesCS5B01G452200 chr7B 95.351 1936 64 14 1 1928 618148202 618146285 0.000000e+00 3053
5 TraesCS5B01G452200 chr2A 95.330 1927 67 10 1 1923 679341704 679343611 0.000000e+00 3038
6 TraesCS5B01G452200 chr2A 94.990 1936 70 13 1 1928 369591077 369589161 0.000000e+00 3013
7 TraesCS5B01G452200 chr2A 94.726 1934 77 11 1 1928 110844698 110842784 0.000000e+00 2983
8 TraesCS5B01G452200 chr2A 94.370 1936 83 12 1 1928 254870902 254868985 0.000000e+00 2948
9 TraesCS5B01G452200 chr7A 94.964 1926 76 9 1 1923 213652316 213654223 0.000000e+00 3000
10 TraesCS5B01G452200 chr7A 93.289 149 9 1 1 149 137569516 137569369 4.690000e-53 219
11 TraesCS5B01G452200 chr6A 94.878 1933 76 12 1 1928 275484436 275482522 0.000000e+00 3000
12 TraesCS5B01G452200 chr2B 94.805 1925 76 12 3 1923 79799128 79801032 0.000000e+00 2979
13 TraesCS5B01G452200 chr2B 94.104 882 46 4 1919 2795 717426800 717425920 0.000000e+00 1336
14 TraesCS5B01G452200 chr2B 94.104 882 45 6 1919 2795 650202995 650203874 0.000000e+00 1334
15 TraesCS5B01G452200 chr2B 93.984 881 47 5 1919 2795 552752963 552752085 0.000000e+00 1328
16 TraesCS5B01G452200 chr4B 95.563 879 37 2 1919 2795 632100076 632100954 0.000000e+00 1406
17 TraesCS5B01G452200 chr4B 94.224 883 43 6 1919 2795 549251950 549252830 0.000000e+00 1341
18 TraesCS5B01G452200 chr4B 90.260 154 9 4 1 150 607714906 607715057 2.200000e-46 196
19 TraesCS5B01G452200 chr4B 90.132 152 9 4 1 151 282378908 282379054 2.840000e-45 193
20 TraesCS5B01G452200 chr4B 89.610 154 10 4 1 150 607709257 607709408 1.020000e-44 191
21 TraesCS5B01G452200 chr1B 94.892 881 38 4 1919 2795 84555244 84554367 0.000000e+00 1371
22 TraesCS5B01G452200 chr1B 94.191 878 46 3 1921 2795 376639504 376638629 0.000000e+00 1334
23 TraesCS5B01G452200 chr5A 97.340 188 4 1 1 188 117197241 117197055 4.490000e-83 318
24 TraesCS5B01G452200 chr2D 88.820 161 5 4 1 149 315465176 315465335 4.750000e-43 185
25 TraesCS5B01G452200 chr6D 88.535 157 9 7 1 149 359738995 359738840 6.150000e-42 182
26 TraesCS5B01G452200 chr6D 92.308 117 7 2 34 149 87916230 87916345 6.190000e-37 165
27 TraesCS5B01G452200 chr6D 92.308 117 7 2 34 149 87916408 87916523 6.190000e-37 165
28 TraesCS5B01G452200 chr6D 92.308 117 7 2 34 149 87922221 87922336 6.190000e-37 165
29 TraesCS5B01G452200 chr6D 90.476 126 8 4 35 157 39894683 39894559 2.230000e-36 163
30 TraesCS5B01G452200 chr6D 91.129 124 6 4 36 155 71092802 71092680 2.230000e-36 163
31 TraesCS5B01G452200 chr6D 90.476 126 8 4 35 157 122215817 122215941 2.230000e-36 163
32 TraesCS5B01G452200 chr6D 90.476 126 8 4 35 157 122216367 122216491 2.230000e-36 163
33 TraesCS5B01G452200 chr3B 86.076 158 18 2 1 156 382612941 382612786 6.150000e-42 182
34 TraesCS5B01G452200 chr5D 87.349 166 9 4 1 155 52845064 52844900 2.210000e-41 180
35 TraesCS5B01G452200 chr5D 88.971 136 10 4 25 156 156949964 156950098 2.230000e-36 163
36 TraesCS5B01G452200 chr4D 87.730 163 5 6 1 149 271445379 271445540 2.860000e-40 176
37 TraesCS5B01G452200 chr4D 93.162 117 6 2 34 149 86261770 86261655 1.330000e-38 171
38 TraesCS5B01G452200 chr4D 93.103 116 6 2 34 149 72940791 72940678 4.790000e-38 169
39 TraesCS5B01G452200 chr4D 92.437 119 7 2 32 149 271451023 271451140 4.790000e-38 169
40 TraesCS5B01G452200 chr4D 93.103 116 6 2 34 149 330699655 330699542 4.790000e-38 169
41 TraesCS5B01G452200 chr4D 92.373 118 7 2 33 149 88372925 88373041 1.720000e-37 167
42 TraesCS5B01G452200 chr4D 91.200 125 7 3 33 154 330698980 330698857 1.720000e-37 167
43 TraesCS5B01G452200 chr4D 91.270 126 6 4 35 156 397396915 397397039 1.720000e-37 167
44 TraesCS5B01G452200 chr3D 93.333 120 6 2 34 152 33451960 33452078 2.860000e-40 176
45 TraesCS5B01G452200 chrUn 94.545 110 4 2 33 141 64005168 64005060 4.790000e-38 169
46 TraesCS5B01G452200 chrUn 92.373 118 7 2 34 151 208591363 208591478 1.720000e-37 167
47 TraesCS5B01G452200 chrUn 92.373 118 7 2 34 151 211744861 211744746 1.720000e-37 167
48 TraesCS5B01G452200 chrUn 86.061 165 10 4 1 154 19677031 19676869 6.190000e-37 165
49 TraesCS5B01G452200 chrUn 96.000 100 4 0 1 100 55242219 55242120 2.230000e-36 163
50 TraesCS5B01G452200 chrUn 91.597 119 8 2 32 149 64926385 64926502 2.230000e-36 163
51 TraesCS5B01G452200 chrUn 90.476 126 8 4 35 157 91625772 91625896 2.230000e-36 163
52 TraesCS5B01G452200 chrUn 96.000 100 4 0 1 100 289798966 289798867 2.230000e-36 163
53 TraesCS5B01G452200 chrUn 92.857 112 6 2 32 142 220406435 220406325 8.010000e-36 161
54 TraesCS5B01G452200 chrUn 92.857 112 5 3 32 142 145485173 145485282 2.880000e-35 159
55 TraesCS5B01G452200 chrUn 89.683 126 9 4 35 157 91633881 91634005 1.040000e-34 158
56 TraesCS5B01G452200 chr1D 91.200 125 8 3 33 155 340009287 340009164 1.720000e-37 167


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G452200 chr5B 625047902 625050696 2794 False 5162 5162 100.000 1 2795 1 chr5B.!!$F2 2794
1 TraesCS5B01G452200 chr5B 628619104 628621016 1912 False 3434 3434 99.059 6 1918 1 chr5B.!!$F3 1912
2 TraesCS5B01G452200 chr5B 628629598 628630475 877 False 1581 1581 99.203 1919 2795 1 chr5B.!!$F4 876
3 TraesCS5B01G452200 chr5B 51772456 51773335 879 False 1367 1367 94.773 1919 2795 1 chr5B.!!$F1 876
4 TraesCS5B01G452200 chr7B 618146285 618148202 1917 True 3053 3053 95.351 1 1928 1 chr7B.!!$R1 1927
5 TraesCS5B01G452200 chr2A 679341704 679343611 1907 False 3038 3038 95.330 1 1923 1 chr2A.!!$F1 1922
6 TraesCS5B01G452200 chr2A 369589161 369591077 1916 True 3013 3013 94.990 1 1928 1 chr2A.!!$R3 1927
7 TraesCS5B01G452200 chr2A 110842784 110844698 1914 True 2983 2983 94.726 1 1928 1 chr2A.!!$R1 1927
8 TraesCS5B01G452200 chr2A 254868985 254870902 1917 True 2948 2948 94.370 1 1928 1 chr2A.!!$R2 1927
9 TraesCS5B01G452200 chr7A 213652316 213654223 1907 False 3000 3000 94.964 1 1923 1 chr7A.!!$F1 1922
10 TraesCS5B01G452200 chr6A 275482522 275484436 1914 True 3000 3000 94.878 1 1928 1 chr6A.!!$R1 1927
11 TraesCS5B01G452200 chr2B 79799128 79801032 1904 False 2979 2979 94.805 3 1923 1 chr2B.!!$F1 1920
12 TraesCS5B01G452200 chr2B 717425920 717426800 880 True 1336 1336 94.104 1919 2795 1 chr2B.!!$R2 876
13 TraesCS5B01G452200 chr2B 650202995 650203874 879 False 1334 1334 94.104 1919 2795 1 chr2B.!!$F2 876
14 TraesCS5B01G452200 chr2B 552752085 552752963 878 True 1328 1328 93.984 1919 2795 1 chr2B.!!$R1 876
15 TraesCS5B01G452200 chr4B 632100076 632100954 878 False 1406 1406 95.563 1919 2795 1 chr4B.!!$F5 876
16 TraesCS5B01G452200 chr4B 549251950 549252830 880 False 1341 1341 94.224 1919 2795 1 chr4B.!!$F2 876
17 TraesCS5B01G452200 chr1B 84554367 84555244 877 True 1371 1371 94.892 1919 2795 1 chr1B.!!$R1 876
18 TraesCS5B01G452200 chr1B 376638629 376639504 875 True 1334 1334 94.191 1921 2795 1 chr1B.!!$R2 874

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
979 986 1.412343 TCAACTCAGCACAGCACAGTA 59.588 47.619 0.0 0.0 0.0 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2125 2133 2.890311 TGGAAACACTAGCACCCAAATG 59.11 45.455 0.0 0.0 33.4 2.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
251 252 7.013274 TGTGACTGACGATGTGATCATAGAATA 59.987 37.037 0.00 0.00 34.06 1.75
399 404 1.919240 TGACAGCCTCGAGTCCTAAA 58.081 50.000 12.31 0.00 33.89 1.85
933 940 2.544069 GCGAAGGAAGACTCTATTCCCG 60.544 54.545 1.18 0.96 46.24 5.14
979 986 1.412343 TCAACTCAGCACAGCACAGTA 59.588 47.619 0.00 0.00 0.00 2.74
1490 1498 0.603569 GGAGAGCTGGTTCGTCAAGA 59.396 55.000 0.00 0.00 0.00 3.02
1493 1501 0.318762 GAGCTGGTTCGTCAAGACCT 59.681 55.000 0.00 0.00 0.00 3.85
1556 1564 0.796312 CTGTTTGGACAACCGATCGG 59.204 55.000 32.20 32.20 39.42 4.18
1603 1611 1.745141 GCCGAGATGCTTTGATGACCT 60.745 52.381 0.00 0.00 0.00 3.85
1656 1664 2.042843 AACGGGGTTGTGGCCAAA 60.043 55.556 7.24 0.00 30.94 3.28
1665 1673 0.760945 TTGTGGCCAAAAATCCCCGT 60.761 50.000 7.24 0.00 0.00 5.28
2125 2133 4.671377 TCATGAGTGTTTTGCTTTGTGTC 58.329 39.130 0.00 0.00 0.00 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
399 404 0.108138 GAGGCTGCTATCACCGTTGT 60.108 55.000 0.00 0.0 0.00 3.32
933 940 4.696899 AGCGTGCCCTTTTTATAGAAAC 57.303 40.909 0.00 0.0 0.00 2.78
979 986 0.919710 GTGGCTAGGTTGGGGAAGAT 59.080 55.000 0.00 0.0 0.00 2.40
1490 1498 1.605712 CGTTTTCTTCTCTCGCCAGGT 60.606 52.381 0.00 0.0 0.00 4.00
1493 1501 1.935300 GCTCGTTTTCTTCTCTCGCCA 60.935 52.381 0.00 0.0 0.00 5.69
1556 1564 2.503382 GGAGCTGATCTCGGGGTCC 61.503 68.421 0.00 3.0 42.82 4.46
1603 1611 1.372997 GGCGACGAAGCACTTCTGA 60.373 57.895 0.00 0.0 39.27 3.27
1656 1664 1.563879 TGATGACCATCACGGGGATTT 59.436 47.619 8.49 0.0 42.42 2.17
2125 2133 2.890311 TGGAAACACTAGCACCCAAATG 59.110 45.455 0.00 0.0 33.40 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.