Multiple sequence alignment - TraesCS5B01G443600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G443600 chr5B 100.000 2567 0 0 1 2567 616298596 616301162 0 4741
1 TraesCS5B01G443600 chr5B 99.299 2568 17 1 1 2567 616244914 616247481 0 4641
2 TraesCS5B01G443600 chr5B 98.716 2570 30 3 1 2567 616275598 616278167 0 4560
3 TraesCS5B01G443600 chr5B 98.599 2570 33 3 1 2567 616309526 616312095 0 4543
4 TraesCS5B01G443600 chr5B 98.599 2570 33 3 1 2567 616321162 616323731 0 4543
5 TraesCS5B01G443600 chr5B 98.366 2570 39 3 1 2567 616264677 616267246 0 4510
6 TraesCS5B01G443600 chr5B 92.232 2433 123 28 1 2397 616331894 616334296 0 3386
7 TraesCS5B01G443600 chr5B 98.613 1874 21 2 695 2567 616223036 616224905 0 3312
8 TraesCS5B01G443600 chr5B 93.045 762 47 5 1 760 616158912 616159669 0 1109
9 TraesCS5B01G443600 chr5D 91.533 2610 163 27 1 2567 497102900 497105494 0 3542
10 TraesCS5B01G443600 chrUn 90.340 2474 171 31 1 2422 335556814 335554357 0 3182
11 TraesCS5B01G443600 chrUn 91.980 1833 111 15 765 2567 68274357 68272531 0 2538
12 TraesCS5B01G443600 chrUn 91.980 1833 111 15 765 2567 302517263 302519089 0 2538
13 TraesCS5B01G443600 chrUn 92.247 1148 66 12 1 1133 417157863 417159002 0 1605


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G443600 chr5B 616298596 616301162 2566 False 4741 4741 100.000 1 2567 1 chr5B.!!$F6 2566
1 TraesCS5B01G443600 chr5B 616244914 616247481 2567 False 4641 4641 99.299 1 2567 1 chr5B.!!$F3 2566
2 TraesCS5B01G443600 chr5B 616275598 616278167 2569 False 4560 4560 98.716 1 2567 1 chr5B.!!$F5 2566
3 TraesCS5B01G443600 chr5B 616309526 616312095 2569 False 4543 4543 98.599 1 2567 1 chr5B.!!$F7 2566
4 TraesCS5B01G443600 chr5B 616321162 616323731 2569 False 4543 4543 98.599 1 2567 1 chr5B.!!$F8 2566
5 TraesCS5B01G443600 chr5B 616264677 616267246 2569 False 4510 4510 98.366 1 2567 1 chr5B.!!$F4 2566
6 TraesCS5B01G443600 chr5B 616331894 616334296 2402 False 3386 3386 92.232 1 2397 1 chr5B.!!$F9 2396
7 TraesCS5B01G443600 chr5B 616223036 616224905 1869 False 3312 3312 98.613 695 2567 1 chr5B.!!$F2 1872
8 TraesCS5B01G443600 chr5B 616158912 616159669 757 False 1109 1109 93.045 1 760 1 chr5B.!!$F1 759
9 TraesCS5B01G443600 chr5D 497102900 497105494 2594 False 3542 3542 91.533 1 2567 1 chr5D.!!$F1 2566
10 TraesCS5B01G443600 chrUn 335554357 335556814 2457 True 3182 3182 90.340 1 2422 1 chrUn.!!$R2 2421
11 TraesCS5B01G443600 chrUn 68272531 68274357 1826 True 2538 2538 91.980 765 2567 1 chrUn.!!$R1 1802
12 TraesCS5B01G443600 chrUn 302517263 302519089 1826 False 2538 2538 91.980 765 2567 1 chrUn.!!$F1 1802
13 TraesCS5B01G443600 chrUn 417157863 417159002 1139 False 1605 1605 92.247 1 1133 1 chrUn.!!$F2 1132

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
871 886 1.805945 CTGACTACCTCAACGCGCC 60.806 63.158 5.73 0.0 0.0 6.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2488 2558 1.049289 ACCCAGAGTATCCGGCCTTC 61.049 60.0 0.0 0.0 33.66 3.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
298 300 2.293399 GGCTAACAACAAGGACCACAAG 59.707 50.000 0.00 0.00 0.0 3.16
433 437 4.321675 GGGGATGTTACGAAAGTTGCAATT 60.322 41.667 0.59 0.00 46.4 2.32
871 886 1.805945 CTGACTACCTCAACGCGCC 60.806 63.158 5.73 0.00 0.0 6.53
1145 1163 2.593436 CACGGCCCAAAACTCGGT 60.593 61.111 0.00 0.00 0.0 4.69
2488 2558 0.729690 GGCCTTCTTAAGCTGCTTCG 59.270 55.000 19.62 11.41 0.0 3.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
298 300 8.611757 AGTTTGTTCTTTAAATTGGAATGTTGC 58.388 29.630 0.00 0.00 0.00 4.17
433 437 3.753815 TGCCTCTGTCATTTTCATGTGA 58.246 40.909 0.00 0.00 0.00 3.58
871 886 3.236816 GTCAAATTCGAAGCACATGTGG 58.763 45.455 26.55 10.51 0.00 4.17
1145 1163 2.338620 CGTCCACGAAGTCCTGCA 59.661 61.111 0.00 0.00 41.61 4.41
2488 2558 1.049289 ACCCAGAGTATCCGGCCTTC 61.049 60.000 0.00 0.00 33.66 3.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.