Multiple sequence alignment - TraesCS5B01G443400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G443400 chr5B 100.000 2498 0 0 1 2498 616264748 616267245 0 4614
1 TraesCS5B01G443400 chr5B 99.600 2498 10 0 1 2498 616309597 616312094 0 4558
2 TraesCS5B01G443400 chr5B 99.600 2498 10 0 1 2498 616321233 616323730 0 4558
3 TraesCS5B01G443400 chr5B 99.159 2498 21 0 1 2498 616275669 616278166 0 4497
4 TraesCS5B01G443400 chr5B 98.639 2498 32 2 1 2498 616244985 616247480 0 4423
5 TraesCS5B01G443400 chr5B 98.319 2498 39 3 1 2498 616298667 616301161 0 4377
6 TraesCS5B01G443400 chr5B 98.932 1873 16 1 626 2498 616223036 616224904 0 3345
7 TraesCS5B01G443400 chr5B 92.197 2371 122 23 1 2338 616331965 616334305 0 3295
8 TraesCS5B01G443400 chr5B 97.448 627 15 1 1 627 616222287 616222912 0 1068
9 TraesCS5B01G443400 chr5D 91.683 2537 158 21 1 2498 497102971 497105493 0 3467
10 TraesCS5B01G443400 chrUn 90.387 2403 166 28 1 2354 335556743 335554357 0 3097
11 TraesCS5B01G443400 chrUn 91.972 1831 114 11 696 2498 68274357 68272532 0 2536
12 TraesCS5B01G443400 chrUn 91.972 1831 114 11 696 2498 302517263 302519088 0 2536
13 TraesCS5B01G443400 chrUn 92.572 1077 59 10 1 1064 417157934 417159002 0 1526


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G443400 chr5B 616264748 616267245 2497 False 4614.0 4614 100.000 1 2498 1 chr5B.!!$F2 2497
1 TraesCS5B01G443400 chr5B 616309597 616312094 2497 False 4558.0 4558 99.600 1 2498 1 chr5B.!!$F5 2497
2 TraesCS5B01G443400 chr5B 616321233 616323730 2497 False 4558.0 4558 99.600 1 2498 1 chr5B.!!$F6 2497
3 TraesCS5B01G443400 chr5B 616275669 616278166 2497 False 4497.0 4497 99.159 1 2498 1 chr5B.!!$F3 2497
4 TraesCS5B01G443400 chr5B 616244985 616247480 2495 False 4423.0 4423 98.639 1 2498 1 chr5B.!!$F1 2497
5 TraesCS5B01G443400 chr5B 616298667 616301161 2494 False 4377.0 4377 98.319 1 2498 1 chr5B.!!$F4 2497
6 TraesCS5B01G443400 chr5B 616331965 616334305 2340 False 3295.0 3295 92.197 1 2338 1 chr5B.!!$F7 2337
7 TraesCS5B01G443400 chr5B 616222287 616224904 2617 False 2206.5 3345 98.190 1 2498 2 chr5B.!!$F8 2497
8 TraesCS5B01G443400 chr5D 497102971 497105493 2522 False 3467.0 3467 91.683 1 2498 1 chr5D.!!$F1 2497
9 TraesCS5B01G443400 chrUn 335554357 335556743 2386 True 3097.0 3097 90.387 1 2354 1 chrUn.!!$R2 2353
10 TraesCS5B01G443400 chrUn 68272532 68274357 1825 True 2536.0 2536 91.972 696 2498 1 chrUn.!!$R1 1802
11 TraesCS5B01G443400 chrUn 302517263 302519088 1825 False 2536.0 2536 91.972 696 2498 1 chrUn.!!$F1 1802
12 TraesCS5B01G443400 chrUn 417157934 417159002 1068 False 1526.0 1526 92.572 1 1064 1 chrUn.!!$F2 1063

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1143 1283 0.552367 TTGGGGAGGTGACATGGGAT 60.552 55.0 0.0 0.0 0.0 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2109 2291 1.600013 CGTCGAGGTCAGATCTACTGG 59.4 57.143 0.0 0.0 45.76 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1143 1283 0.552367 TTGGGGAGGTGACATGGGAT 60.552 55.0 0.0 0.0 0.00 3.85
2141 2323 1.721664 CCTCGACGCCACGAATCCTA 61.722 60.0 0.0 0.0 41.67 2.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1290 1436 1.194781 ACTGCTTCTCCGACACCCAT 61.195 55.000 0.0 0.0 0.00 4.00
2109 2291 1.600013 CGTCGAGGTCAGATCTACTGG 59.400 57.143 0.0 0.0 45.76 4.00
2141 2323 2.060980 GGATGACTCTCCCTGCGGT 61.061 63.158 0.0 0.0 0.00 5.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.