Multiple sequence alignment - TraesCS5B01G443000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G443000 chr5B 100.000 4252 0 0 1 4252 616103209 616107460 0.000000e+00 7853.0
1 TraesCS5B01G443000 chr5B 98.086 1567 30 0 2686 4252 616160404 616161970 0.000000e+00 2728.0
2 TraesCS5B01G443000 chr5B 97.141 1399 34 3 2687 4081 616026675 616025279 0.000000e+00 2357.0
3 TraesCS5B01G443000 chr5B 99.413 1193 6 1 1 1193 615966000 615964809 0.000000e+00 2163.0
4 TraesCS5B01G443000 chr5B 96.356 1180 34 5 2909 4081 615964791 615963614 0.000000e+00 1932.0
5 TraesCS5B01G443000 chr5B 93.873 1224 64 8 1 1217 616331875 616333094 0.000000e+00 1834.0
6 TraesCS5B01G443000 chr5B 91.740 1247 70 8 1 1217 616309507 616310750 0.000000e+00 1701.0
7 TraesCS5B01G443000 chr5B 91.740 1247 70 8 1 1217 616321143 616322386 0.000000e+00 1701.0
8 TraesCS5B01G443000 chr5B 91.660 1247 71 8 1 1217 616264658 616265901 0.000000e+00 1696.0
9 TraesCS5B01G443000 chr5B 91.419 1247 74 10 1 1217 616275579 616276822 0.000000e+00 1679.0
10 TraesCS5B01G443000 chr5B 91.339 1247 74 11 1 1217 616244895 616246137 0.000000e+00 1674.0
11 TraesCS5B01G443000 chr5B 90.979 1164 75 17 2686 3844 616310741 616311879 0.000000e+00 1541.0
12 TraesCS5B01G443000 chr5B 90.893 1164 76 17 2686 3844 616322377 616323515 0.000000e+00 1535.0
13 TraesCS5B01G443000 chr5B 90.815 1165 75 19 2686 3844 616276813 616277951 0.000000e+00 1530.0
14 TraesCS5B01G443000 chr5B 90.815 1165 74 20 2686 3844 616246128 616247265 0.000000e+00 1528.0
15 TraesCS5B01G443000 chr5B 90.636 1164 79 17 2686 3844 616265892 616267030 0.000000e+00 1519.0
16 TraesCS5B01G443000 chr5B 97.379 763 20 0 1 763 616158893 616159655 0.000000e+00 1299.0
17 TraesCS5B01G443000 chr5B 94.238 833 25 10 3 834 616027890 616027080 0.000000e+00 1251.0
18 TraesCS5B01G443000 chr5B 90.333 962 72 16 2686 3641 615951216 615952162 0.000000e+00 1242.0
19 TraesCS5B01G443000 chr5B 90.690 623 45 8 3223 3844 616224079 616224689 0.000000e+00 817.0
20 TraesCS5B01G443000 chr5B 90.431 627 50 7 3219 3844 616300329 616300946 0.000000e+00 817.0
21 TraesCS5B01G443000 chr5B 98.465 456 6 1 763 1217 616159958 616160413 0.000000e+00 802.0
22 TraesCS5B01G443000 chrUn 90.708 1173 89 14 2686 3847 68273910 68272747 0.000000e+00 1544.0
23 TraesCS5B01G443000 chrUn 90.598 1170 90 14 2686 3844 302517710 302518870 0.000000e+00 1533.0
24 TraesCS5B01G443000 chrUn 86.605 1187 119 25 2686 3847 335555594 335554423 0.000000e+00 1275.0
25 TraesCS5B01G443000 chrUn 96.491 456 15 1 763 1217 68274356 68273901 0.000000e+00 752.0
26 TraesCS5B01G443000 chrUn 96.491 456 15 1 763 1217 302517264 302517719 0.000000e+00 752.0
27 TraesCS5B01G443000 chrUn 96.491 456 15 1 763 1217 310278013 310277558 0.000000e+00 752.0
28 TraesCS5B01G443000 chrUn 96.491 456 15 1 763 1217 327437722 327438177 0.000000e+00 752.0
29 TraesCS5B01G443000 chrUn 96.491 456 15 1 763 1217 345125408 345125863 0.000000e+00 752.0
30 TraesCS5B01G443000 chrUn 88.714 381 31 8 2281 2650 356843692 356843313 5.010000e-124 455.0
31 TraesCS5B01G443000 chrUn 88.714 381 31 8 2281 2650 356895281 356894902 5.010000e-124 455.0
32 TraesCS5B01G443000 chrUn 87.826 345 26 9 1214 1545 356896508 356896167 1.430000e-104 390.0
33 TraesCS5B01G443000 chrUn 77.612 469 82 15 1688 2142 356844149 356843690 3.260000e-66 263.0
34 TraesCS5B01G443000 chrUn 77.612 469 82 15 1688 2142 356895738 356895279 3.260000e-66 263.0
35 TraesCS5B01G443000 chrUn 77.612 469 82 15 1685 2139 391985700 391986159 3.260000e-66 263.0
36 TraesCS5B01G443000 chrUn 100.000 35 0 0 2652 2686 465907277 465907243 9.870000e-07 65.8
37 TraesCS5B01G443000 chr5D 90.769 1170 88 14 2686 3844 497104115 497105275 0.000000e+00 1544.0
38 TraesCS5B01G443000 chr5D 89.726 1168 98 17 2686 3844 497038645 497039799 0.000000e+00 1472.0
39 TraesCS5B01G443000 chr3A 98.808 839 10 0 1217 2055 15844633 15845471 0.000000e+00 1495.0
40 TraesCS5B01G443000 chr3A 93.728 845 44 4 1832 2670 15845332 15846173 0.000000e+00 1258.0
41 TraesCS5B01G443000 chr3A 84.481 973 119 21 1733 2685 40924021 40923061 0.000000e+00 931.0
42 TraesCS5B01G443000 chr3A 88.462 338 25 7 1220 1545 40924914 40924579 3.080000e-106 396.0
43 TraesCS5B01G443000 chr4A 95.823 838 18 4 1218 2055 66604992 66604172 0.000000e+00 1338.0
44 TraesCS5B01G443000 chr4A 92.907 860 52 4 1832 2685 66604311 66603455 0.000000e+00 1242.0
45 TraesCS5B01G443000 chr6A 85.813 1008 116 17 1691 2686 600398868 600399860 0.000000e+00 1044.0
46 TraesCS5B01G443000 chr6A 86.565 722 51 17 1318 2019 600398332 600399027 0.000000e+00 754.0
47 TraesCS5B01G443000 chr5A 96.711 456 13 2 763 1217 621448404 621448858 0.000000e+00 758.0
48 TraesCS5B01G443000 chr6B 93.086 405 27 1 3848 4252 349427370 349426967 3.660000e-165 592.0
49 TraesCS5B01G443000 chr2B 92.875 407 28 1 3846 4252 280380320 280380725 1.320000e-164 590.0
50 TraesCS5B01G443000 chr2B 92.593 405 29 1 3848 4252 365776591 365776188 7.930000e-162 580.0
51 TraesCS5B01G443000 chr2B 91.627 418 31 4 3836 4252 62952530 62952116 3.690000e-160 575.0
52 TraesCS5B01G443000 chr7B 92.402 408 31 0 3845 4252 312451758 312452165 2.200000e-162 582.0
53 TraesCS5B01G443000 chr4B 92.214 411 27 2 3845 4252 596404704 596405112 1.030000e-160 577.0
54 TraesCS5B01G443000 chr1B 89.688 417 31 9 2281 2686 35703591 35703176 4.870000e-144 521.0
55 TraesCS5B01G443000 chr1B 87.826 345 26 9 1214 1545 35704818 35704477 1.430000e-104 390.0
56 TraesCS5B01G443000 chr1A 89.688 417 31 8 2281 2686 109235778 109236193 4.870000e-144 521.0
57 TraesCS5B01G443000 chr1A 82.249 507 68 12 1543 2045 109234948 109235436 6.580000e-113 418.0
58 TraesCS5B01G443000 chr1A 87.791 344 26 8 1215 1545 109234551 109234891 5.160000e-104 388.0
59 TraesCS5B01G443000 chr1A 82.581 310 47 6 1832 2139 109235473 109235777 2.520000e-67 267.0
60 TraesCS5B01G443000 chr3B 89.423 416 32 8 2281 2685 782430652 782430238 8.150000e-142 514.0
61 TraesCS5B01G443000 chr3B 82.643 507 66 12 1543 2045 782431482 782430994 3.040000e-116 429.0
62 TraesCS5B01G443000 chr3B 86.919 344 28 9 1216 1545 782431879 782431539 1.870000e-98 370.0
63 TraesCS5B01G443000 chr3B 82.428 313 48 6 1832 2142 782430957 782430650 2.520000e-67 267.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G443000 chr5B 616103209 616107460 4251 False 7853.000000 7853 100.000000 1 4252 1 chr5B.!!$F2 4251
1 TraesCS5B01G443000 chr5B 615963614 615966000 2386 True 2047.500000 2163 97.884500 1 4081 2 chr5B.!!$R1 4080
2 TraesCS5B01G443000 chr5B 616331875 616333094 1219 False 1834.000000 1834 93.873000 1 1217 1 chr5B.!!$F5 1216
3 TraesCS5B01G443000 chr5B 616025279 616027890 2611 True 1804.000000 2357 95.689500 3 4081 2 chr5B.!!$R2 4078
4 TraesCS5B01G443000 chr5B 616309507 616311879 2372 False 1621.000000 1701 91.359500 1 3844 2 chr5B.!!$F10 3843
5 TraesCS5B01G443000 chr5B 616321143 616323515 2372 False 1618.000000 1701 91.316500 1 3844 2 chr5B.!!$F11 3843
6 TraesCS5B01G443000 chr5B 616158893 616161970 3077 False 1609.666667 2728 97.976667 1 4252 3 chr5B.!!$F6 4251
7 TraesCS5B01G443000 chr5B 616264658 616267030 2372 False 1607.500000 1696 91.148000 1 3844 2 chr5B.!!$F8 3843
8 TraesCS5B01G443000 chr5B 616275579 616277951 2372 False 1604.500000 1679 91.117000 1 3844 2 chr5B.!!$F9 3843
9 TraesCS5B01G443000 chr5B 616244895 616247265 2370 False 1601.000000 1674 91.077000 1 3844 2 chr5B.!!$F7 3843
10 TraesCS5B01G443000 chr5B 615951216 615952162 946 False 1242.000000 1242 90.333000 2686 3641 1 chr5B.!!$F1 955
11 TraesCS5B01G443000 chr5B 616224079 616224689 610 False 817.000000 817 90.690000 3223 3844 1 chr5B.!!$F3 621
12 TraesCS5B01G443000 chr5B 616300329 616300946 617 False 817.000000 817 90.431000 3219 3844 1 chr5B.!!$F4 625
13 TraesCS5B01G443000 chrUn 335554423 335555594 1171 True 1275.000000 1275 86.605000 2686 3847 1 chrUn.!!$R2 1161
14 TraesCS5B01G443000 chrUn 68272747 68274356 1609 True 1148.000000 1544 93.599500 763 3847 2 chrUn.!!$R4 3084
15 TraesCS5B01G443000 chrUn 302517264 302518870 1606 False 1142.500000 1533 93.544500 763 3844 2 chrUn.!!$F4 3081
16 TraesCS5B01G443000 chrUn 356894902 356896508 1606 True 369.333333 455 84.717333 1214 2650 3 chrUn.!!$R6 1436
17 TraesCS5B01G443000 chrUn 356843313 356844149 836 True 359.000000 455 83.163000 1688 2650 2 chrUn.!!$R5 962
18 TraesCS5B01G443000 chr5D 497104115 497105275 1160 False 1544.000000 1544 90.769000 2686 3844 1 chr5D.!!$F2 1158
19 TraesCS5B01G443000 chr5D 497038645 497039799 1154 False 1472.000000 1472 89.726000 2686 3844 1 chr5D.!!$F1 1158
20 TraesCS5B01G443000 chr3A 15844633 15846173 1540 False 1376.500000 1495 96.268000 1217 2670 2 chr3A.!!$F1 1453
21 TraesCS5B01G443000 chr3A 40923061 40924914 1853 True 663.500000 931 86.471500 1220 2685 2 chr3A.!!$R1 1465
22 TraesCS5B01G443000 chr4A 66603455 66604992 1537 True 1290.000000 1338 94.365000 1218 2685 2 chr4A.!!$R1 1467
23 TraesCS5B01G443000 chr6A 600398332 600399860 1528 False 899.000000 1044 86.189000 1318 2686 2 chr6A.!!$F1 1368
24 TraesCS5B01G443000 chr1B 35703176 35704818 1642 True 455.500000 521 88.757000 1214 2686 2 chr1B.!!$R1 1472
25 TraesCS5B01G443000 chr1A 109234551 109236193 1642 False 398.500000 521 85.577250 1215 2686 4 chr1A.!!$F1 1471
26 TraesCS5B01G443000 chr3B 782430238 782431879 1641 True 395.000000 514 85.353250 1216 2685 4 chr3B.!!$R1 1469

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
177 178 1.948145 TGTGCCACGTTACCGAAAAAT 59.052 42.857 0.00 0.0 37.88 1.82 F
1212 1557 1.153429 GGTGACATGGGACGCTACC 60.153 63.158 0.00 0.0 0.00 3.18 F
1735 2168 0.447801 GTATCCGTGACGTACCGTGT 59.552 55.000 3.64 0.0 41.37 4.49 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1241 1586 1.412453 AAGATAATGCGGCCCGGGTA 61.412 55.000 24.63 5.38 0.00 3.69 R
2266 3099 1.244816 GTTTGGTAAGCCCAGACACC 58.755 55.000 0.00 0.00 45.53 4.16 R
3441 4331 2.160205 CGCCCTCTCGATATTACTCCA 58.840 52.381 0.00 0.00 0.00 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
177 178 1.948145 TGTGCCACGTTACCGAAAAAT 59.052 42.857 0.00 0.00 37.88 1.82
178 179 3.136763 TGTGCCACGTTACCGAAAAATA 58.863 40.909 0.00 0.00 37.88 1.40
1136 1481 2.430367 GGTCACGGCCCAGAACTT 59.570 61.111 0.00 0.00 0.00 2.66
1212 1557 1.153429 GGTGACATGGGACGCTACC 60.153 63.158 0.00 0.00 0.00 3.18
1735 2168 0.447801 GTATCCGTGACGTACCGTGT 59.552 55.000 3.64 0.00 41.37 4.49
1789 2222 3.567478 ATGTCCGCGTCGACTTGCA 62.567 57.895 14.70 5.87 33.70 4.08
2032 2783 3.678072 CGTCCATGTTGACTCGTGTATTT 59.322 43.478 0.00 0.00 32.97 1.40
2035 2786 6.453791 CGTCCATGTTGACTCGTGTATTTTAG 60.454 42.308 0.00 0.00 32.97 1.85
2038 2789 3.676172 TGTTGACTCGTGTATTTTAGCCG 59.324 43.478 0.00 0.00 0.00 5.52
2266 3099 1.898079 CGTGCATCGTTCATGTTTTCG 59.102 47.619 0.00 0.00 34.56 3.46
2375 3216 8.307483 GCATAGTACTACATGAGTTATGGTCAT 58.693 37.037 4.31 0.00 41.25 3.06
3255 4142 9.578439 GGTAATAAGTTGAGTTATCGTACAAGT 57.422 33.333 0.00 0.00 0.00 3.16
3435 4325 5.486735 TTTTAGGATCCCAACTCGTACAA 57.513 39.130 8.55 0.00 0.00 2.41
3441 4331 4.457949 GGATCCCAACTCGTACAAACAAAT 59.542 41.667 0.00 0.00 0.00 2.32
3450 4341 8.714179 CAACTCGTACAAACAAATGGAGTAATA 58.286 33.333 0.00 0.00 33.31 0.98
3537 4432 1.374947 CCGTGATGGTCACCCACTT 59.625 57.895 4.65 0.00 45.65 3.16
3738 4640 1.665264 CCAACGCCATGCATGCCTAA 61.665 55.000 21.69 0.00 0.00 2.69
3832 4742 0.391263 ACATTTCCTCTTCGGGCGAC 60.391 55.000 0.00 0.00 0.00 5.19
3879 4789 5.280011 CCAATATGCGACCCTATCCTAAAGT 60.280 44.000 0.00 0.00 0.00 2.66
3989 4899 6.201591 AGATGGGGATAAATACAAAAGGCAA 58.798 36.000 0.00 0.00 0.00 4.52
4066 4976 5.973565 GGATGAAACACAAACAGAAACTCAG 59.026 40.000 0.00 0.00 0.00 3.35
4100 5010 3.075005 TAGCCCAGTCTGCCGACC 61.075 66.667 4.47 0.00 41.16 4.79
4135 5045 4.395542 CCCTGATCAAAGAAGAAGCAGAAG 59.604 45.833 0.00 0.00 0.00 2.85
4185 5095 3.059884 ACGTCATGATCATCGCATTACC 58.940 45.455 14.72 0.00 0.00 2.85
4194 5104 3.194861 TCATCGCATTACCTGTACTTGC 58.805 45.455 0.00 2.74 0.00 4.01
4232 5142 1.527433 CTGTGAGCCACGAGGACTCA 61.527 60.000 17.30 17.30 42.12 3.41
4246 5156 4.723309 GAGGACTCAGCAATCCCATTATT 58.277 43.478 0.00 0.00 35.38 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
177 178 9.953565 GCTTTATATATAAAGTGGGGTGTGATA 57.046 33.333 31.63 5.66 46.78 2.15
178 179 8.444783 TGCTTTATATATAAAGTGGGGTGTGAT 58.555 33.333 31.63 0.00 46.78 3.06
1136 1481 1.533033 TCCACGAAGTCCTGCTCCA 60.533 57.895 0.00 0.00 41.61 3.86
1241 1586 1.412453 AAGATAATGCGGCCCGGGTA 61.412 55.000 24.63 5.38 0.00 3.69
1579 2011 2.684881 AGCTCCAACGCTCATATTTTGG 59.315 45.455 0.00 0.00 40.01 3.28
1735 2168 1.513373 CGATGGACGCGAAGACGAA 60.513 57.895 15.93 0.00 42.66 3.85
1789 2222 5.617252 CCATGAATACAACGGTTAGGGTAT 58.383 41.667 0.00 0.00 0.00 2.73
2266 3099 1.244816 GTTTGGTAAGCCCAGACACC 58.755 55.000 0.00 0.00 45.53 4.16
3435 4325 6.525629 CCCTCTCGATATTACTCCATTTGTT 58.474 40.000 0.00 0.00 0.00 2.83
3441 4331 2.160205 CGCCCTCTCGATATTACTCCA 58.840 52.381 0.00 0.00 0.00 3.86
3450 4341 3.665226 CTAGCGCGCCCTCTCGAT 61.665 66.667 30.33 9.26 0.00 3.59
3537 4432 3.953612 GGATGGGTGAGCAATAATGACAA 59.046 43.478 0.00 0.00 0.00 3.18
3661 4563 3.023832 TCAGATCTACTGCATTCACGGA 58.976 45.455 0.00 0.00 45.38 4.69
3832 4742 0.247460 TGACAGTGCATCCTTCCTCG 59.753 55.000 0.00 0.00 0.00 4.63
3879 4789 1.621814 CTTGGTGGGACCTTCGAGTTA 59.378 52.381 0.00 0.00 39.58 2.24
3989 4899 5.512753 TGTTATATTCATGCGGCATTGTT 57.487 34.783 13.81 3.22 0.00 2.83
4066 4976 0.103208 CTAGCAGGGTGGATGTCGTC 59.897 60.000 0.00 0.00 0.00 4.20
4100 5010 2.694397 TGATCAGGGGATAGGTTCCTG 58.306 52.381 1.12 0.00 46.91 3.86
4135 5045 1.123655 GCTTGCTTGTTTTCGAGTGC 58.876 50.000 0.00 0.00 33.98 4.40
4185 5095 4.355543 ACAACAACAGTTGCAAGTACAG 57.644 40.909 13.56 2.16 45.01 2.74
4194 5104 7.067532 TCACAGTTTACTACAACAACAGTTG 57.932 36.000 12.03 12.03 46.22 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.