Multiple sequence alignment - TraesCS5B01G442900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G442900 chr5B 100.000 2507 0 0 1 2507 616027823 616025317 0.000000e+00 4630
1 TraesCS5B01G442900 chr5B 97.514 1730 37 3 778 2505 616160034 616161759 0.000000e+00 2952
2 TraesCS5B01G442900 chr5B 97.204 1359 32 3 1149 2505 616105895 616107249 0.000000e+00 2294
3 TraesCS5B01G442900 chr5B 91.163 1539 97 22 778 2309 616310373 616311879 0.000000e+00 2052
4 TraesCS5B01G442900 chr5B 91.098 1539 98 22 778 2309 616322009 616323515 0.000000e+00 2047
5 TraesCS5B01G442900 chr5B 90.974 1540 97 25 778 2309 616245760 616247265 0.000000e+00 2036
6 TraesCS5B01G442900 chr5B 90.909 1540 99 24 778 2309 616276445 616277951 0.000000e+00 2030
7 TraesCS5B01G442900 chr5B 98.333 1140 16 2 1371 2507 615964791 615963652 0.000000e+00 1997
8 TraesCS5B01G442900 chr5B 93.864 766 23 11 1 744 615965931 615965168 0.000000e+00 1133
9 TraesCS5B01G442900 chr5B 93.734 766 25 10 1 744 616103278 616104042 0.000000e+00 1127
10 TraesCS5B01G442900 chr5B 95.639 665 25 1 1 661 616158962 616159626 0.000000e+00 1064
11 TraesCS5B01G442900 chr5B 91.429 770 38 13 1 743 616331944 616332712 0.000000e+00 1031
12 TraesCS5B01G442900 chr5B 93.423 669 36 4 1 661 616264727 616265395 0.000000e+00 985
13 TraesCS5B01G442900 chr5B 93.124 669 38 4 1 661 616275648 616276316 0.000000e+00 974
14 TraesCS5B01G442900 chr5B 93.124 669 38 4 1 661 616309576 616310244 0.000000e+00 974
15 TraesCS5B01G442900 chr5B 93.124 669 38 4 1 661 616321212 616321880 0.000000e+00 974
16 TraesCS5B01G442900 chr5B 92.825 669 39 5 1 661 616244964 616245631 0.000000e+00 961
17 TraesCS5B01G442900 chr5B 90.174 631 49 9 1680 2309 616266412 616267030 0.000000e+00 809
18 TraesCS5B01G442900 chr5B 90.174 631 48 10 1680 2309 616300329 616300946 0.000000e+00 809
19 TraesCS5B01G442900 chr5B 89.793 627 47 10 1684 2309 616224079 616224689 0.000000e+00 787
20 TraesCS5B01G442900 chr5B 88.112 429 41 6 1680 2106 615951742 615952162 3.720000e-138 501
21 TraesCS5B01G442900 chr5B 95.455 88 3 1 657 744 616159944 616160030 3.360000e-29 139
22 TraesCS5B01G442900 chr5B 93.258 89 1 3 659 743 616223095 616223182 2.620000e-25 126
23 TraesCS5B01G442900 chr5B 92.135 89 2 3 659 743 616265432 616265519 1.220000e-23 121
24 TraesCS5B01G442900 chr5B 92.135 89 2 3 659 743 616310281 616310368 1.220000e-23 121
25 TraesCS5B01G442900 chrUn 91.920 1547 100 14 778 2312 68274280 68272747 0.000000e+00 2141
26 TraesCS5B01G442900 chrUn 91.839 1544 101 14 778 2309 302517340 302518870 0.000000e+00 2130
27 TraesCS5B01G442900 chrUn 88.917 1561 128 25 778 2312 335555964 335554423 0.000000e+00 1882
28 TraesCS5B01G442900 chrUn 88.412 1562 134 26 778 2309 345125484 345127028 0.000000e+00 1838
29 TraesCS5B01G442900 chrUn 97.436 78 2 0 667 744 68267942 68268019 1.560000e-27 134
30 TraesCS5B01G442900 chrUn 96.154 78 3 0 667 744 310278018 310277941 7.280000e-26 128
31 TraesCS5B01G442900 chrUn 96.154 78 3 0 667 744 327437717 327437794 7.280000e-26 128
32 TraesCS5B01G442900 chr5D 91.969 1544 99 14 778 2309 497103745 497105275 0.000000e+00 2141
33 TraesCS5B01G442900 chr2B 92.347 196 14 1 2313 2507 434221976 434221781 6.830000e-71 278
34 TraesCS5B01G442900 chr2B 92.308 195 14 1 2312 2505 420752466 420752272 2.460000e-70 276
35 TraesCS5B01G442900 chr4D 92.268 194 14 1 2313 2505 23585778 23585585 8.830000e-70 274
36 TraesCS5B01G442900 chr7B 90.732 205 17 2 2303 2505 136496583 136496379 3.180000e-69 272
37 TraesCS5B01G442900 chr6B 91.457 199 16 1 2310 2507 261417339 261417141 3.180000e-69 272
38 TraesCS5B01G442900 chr3B 89.904 208 19 2 2302 2507 610258997 610258790 1.480000e-67 267
39 TraesCS5B01G442900 chr5A 97.436 78 2 0 667 744 621443996 621444073 1.560000e-27 134
40 TraesCS5B01G442900 chr5A 97.436 78 2 0 667 744 621448399 621448476 1.560000e-27 134


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G442900 chr5B 616025317 616027823 2506 True 4630.000000 4630 100.000000 1 2507 1 chr5B.!!$R1 2506
1 TraesCS5B01G442900 chr5B 616103278 616107249 3971 False 1710.500000 2294 95.469000 1 2505 2 chr5B.!!$F4 2504
2 TraesCS5B01G442900 chr5B 615963652 615965931 2279 True 1565.000000 1997 96.098500 1 2507 2 chr5B.!!$R2 2506
3 TraesCS5B01G442900 chr5B 616321212 616323515 2303 False 1510.500000 2047 92.111000 1 2309 2 chr5B.!!$F11 2308
4 TraesCS5B01G442900 chr5B 616275648 616277951 2303 False 1502.000000 2030 92.016500 1 2309 2 chr5B.!!$F9 2308
5 TraesCS5B01G442900 chr5B 616244964 616247265 2301 False 1498.500000 2036 91.899500 1 2309 2 chr5B.!!$F7 2308
6 TraesCS5B01G442900 chr5B 616158962 616161759 2797 False 1385.000000 2952 96.202667 1 2505 3 chr5B.!!$F5 2504
7 TraesCS5B01G442900 chr5B 616309576 616311879 2303 False 1049.000000 2052 92.140667 1 2309 3 chr5B.!!$F10 2308
8 TraesCS5B01G442900 chr5B 616331944 616332712 768 False 1031.000000 1031 91.429000 1 743 1 chr5B.!!$F3 742
9 TraesCS5B01G442900 chr5B 616300329 616300946 617 False 809.000000 809 90.174000 1680 2309 1 chr5B.!!$F2 629
10 TraesCS5B01G442900 chr5B 616264727 616267030 2303 False 638.333333 985 91.910667 1 2309 3 chr5B.!!$F8 2308
11 TraesCS5B01G442900 chr5B 616223095 616224689 1594 False 456.500000 787 91.525500 659 2309 2 chr5B.!!$F6 1650
12 TraesCS5B01G442900 chrUn 68272747 68274280 1533 True 2141.000000 2141 91.920000 778 2312 1 chrUn.!!$R1 1534
13 TraesCS5B01G442900 chrUn 302517340 302518870 1530 False 2130.000000 2130 91.839000 778 2309 1 chrUn.!!$F2 1531
14 TraesCS5B01G442900 chrUn 335554423 335555964 1541 True 1882.000000 1882 88.917000 778 2312 1 chrUn.!!$R3 1534
15 TraesCS5B01G442900 chrUn 345125484 345127028 1544 False 1838.000000 1838 88.412000 778 2309 1 chrUn.!!$F4 1531
16 TraesCS5B01G442900 chr5D 497103745 497105275 1530 False 2141.000000 2141 91.969000 778 2309 1 chr5D.!!$F1 1531

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
687 1038 0.374758 CGTGCCACGAGATCAAATGG 59.625 55.0 12.85 0.0 46.05 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2140 4044 0.103208 ATTGCGTCGAGGTCAGATCC 59.897 55.0 7.01 0.0 0.0 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
25 26 4.749099 GCACTAGGACATCAAGATGATCAC 59.251 45.833 16.39 4.09 41.20 3.06
78 79 2.758423 AGAGCCAAAAACAACTTTCCGT 59.242 40.909 0.00 0.00 0.00 4.69
195 196 3.694566 GGCCAAGGTTAAATCAATCTCGT 59.305 43.478 0.00 0.00 0.00 4.18
288 293 6.869421 ACAAATTGACTTTTGTCTTGTTCG 57.131 33.333 0.00 0.00 44.39 3.95
661 671 1.537202 GTACGTGTGTCCCGACTAGTT 59.463 52.381 0.00 0.00 0.00 2.24
662 672 1.896220 ACGTGTGTCCCGACTAGTTA 58.104 50.000 0.00 0.00 0.00 2.24
664 674 1.808945 CGTGTGTCCCGACTAGTTAGT 59.191 52.381 0.00 0.00 39.71 2.24
665 675 3.002791 CGTGTGTCCCGACTAGTTAGTA 58.997 50.000 0.00 0.00 36.50 1.82
687 1038 0.374758 CGTGCCACGAGATCAAATGG 59.625 55.000 12.85 0.00 46.05 3.16
744 1099 1.282157 AGAAGAAATAACAGGCCGCCT 59.718 47.619 5.94 5.94 0.00 5.52
757 1112 4.297891 CGCCTGTGTGCACGTGTG 62.298 66.667 18.38 3.21 0.00 3.82
2140 4044 2.777972 CCCGCCCATGAATGCAGTG 61.778 63.158 0.00 0.00 0.00 3.66
2329 4241 0.035534 ACTGTCACGCCCAATATGCA 60.036 50.000 0.00 0.00 0.00 3.96
2381 4293 5.237815 CACCAAGGATAGAAGCGCATATTA 58.762 41.667 11.47 0.00 0.00 0.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
17 18 6.204301 AGCTATACTGCAACATTGTGATCATC 59.796 38.462 0.00 0.00 34.99 2.92
25 26 9.045223 TGTATTTCTAGCTATACTGCAACATTG 57.955 33.333 0.00 0.00 34.99 2.82
78 79 1.674359 ACGTGGCACAACTCAATCAA 58.326 45.000 19.09 0.00 44.16 2.57
164 165 0.178950 TAACCTTGGCCATGGTTGCA 60.179 50.000 44.11 32.02 45.11 4.08
195 196 9.134734 GTGTTAATTTTCTTGTTCAACTTCACA 57.865 29.630 0.00 0.00 0.00 3.58
288 293 1.338105 GCCAATTTGTGCTTCTTCCCC 60.338 52.381 0.00 0.00 0.00 4.81
609 619 2.434702 GCCAACTAGGTGCTAGTGGTAT 59.565 50.000 0.87 0.00 45.28 2.73
687 1038 1.084370 CCGATGTGGAGGAACTTCGC 61.084 60.000 7.00 0.00 46.55 4.70
761 1116 3.243535 TATCATCTGATCTCGTGGCACAC 60.244 47.826 19.09 3.86 44.99 3.82
762 1117 1.185315 TCATCTGATCTCGTGGCACA 58.815 50.000 19.09 4.04 0.00 4.57
763 1118 2.522836 ATCATCTGATCTCGTGGCAC 57.477 50.000 7.79 7.79 0.00 5.01
764 1119 4.085009 AGATATCATCTGATCTCGTGGCA 58.915 43.478 5.32 0.00 38.44 4.92
765 1120 4.717233 AGATATCATCTGATCTCGTGGC 57.283 45.455 5.32 0.00 38.44 5.01
776 1131 5.048364 GCGTTGAGGTAGTCAGATATCATCT 60.048 44.000 5.32 2.89 41.15 2.90
1788 3676 2.174639 TGGTTTCTATGTATGCTGGGGG 59.825 50.000 0.00 0.00 0.00 5.40
2129 4033 2.508716 AGGTCAGATCCACTGCATTCAT 59.491 45.455 0.00 0.00 45.38 2.57
2140 4044 0.103208 ATTGCGTCGAGGTCAGATCC 59.897 55.000 7.01 0.00 0.00 3.36
2329 4241 7.125963 ACCTTCGATTTCCTTTAGGATAGAGTT 59.874 37.037 0.00 0.00 44.98 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.