Multiple sequence alignment - TraesCS5B01G388600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G388600 chr5B 100.000 2744 0 0 1 2744 567278985 567281728 0 5068
1 TraesCS5B01G388600 chr6B 98.724 2744 33 2 1 2744 596602868 596600127 0 4872
2 TraesCS5B01G388600 chr6B 98.293 2167 36 1 578 2744 715991505 715989340 0 3795
3 TraesCS5B01G388600 chrUn 98.652 2745 32 5 1 2744 171007276 171010016 0 4859
4 TraesCS5B01G388600 chr7A 98.615 2744 36 2 1 2744 638508675 638505934 0 4855
5 TraesCS5B01G388600 chr7A 98.469 2744 37 4 1 2744 708244617 708247355 0 4830
6 TraesCS5B01G388600 chr1B 97.996 2745 50 4 1 2744 672540214 672542954 0 4759
7 TraesCS5B01G388600 chr2B 97.960 2745 52 4 1 2744 391226253 391223512 0 4756
8 TraesCS5B01G388600 chr2B 97.813 2744 56 2 1 2744 391143795 391146534 0 4732
9 TraesCS5B01G388600 chr4B 97.631 2744 57 5 1 2744 495566956 495569691 0 4700


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G388600 chr5B 567278985 567281728 2743 False 5068 5068 100.000 1 2744 1 chr5B.!!$F1 2743
1 TraesCS5B01G388600 chr6B 596600127 596602868 2741 True 4872 4872 98.724 1 2744 1 chr6B.!!$R1 2743
2 TraesCS5B01G388600 chr6B 715989340 715991505 2165 True 3795 3795 98.293 578 2744 1 chr6B.!!$R2 2166
3 TraesCS5B01G388600 chrUn 171007276 171010016 2740 False 4859 4859 98.652 1 2744 1 chrUn.!!$F1 2743
4 TraesCS5B01G388600 chr7A 638505934 638508675 2741 True 4855 4855 98.615 1 2744 1 chr7A.!!$R1 2743
5 TraesCS5B01G388600 chr7A 708244617 708247355 2738 False 4830 4830 98.469 1 2744 1 chr7A.!!$F1 2743
6 TraesCS5B01G388600 chr1B 672540214 672542954 2740 False 4759 4759 97.996 1 2744 1 chr1B.!!$F1 2743
7 TraesCS5B01G388600 chr2B 391223512 391226253 2741 True 4756 4756 97.960 1 2744 1 chr2B.!!$R1 2743
8 TraesCS5B01G388600 chr2B 391143795 391146534 2739 False 4732 4732 97.813 1 2744 1 chr2B.!!$F1 2743
9 TraesCS5B01G388600 chr4B 495566956 495569691 2735 False 4700 4700 97.631 1 2744 1 chr4B.!!$F1 2743

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
898 903 2.71076 CCGAGAGAAAGACGAGATTCG 58.289 52.381 0.0 0.0 46.93 3.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2293 2301 0.035343 CCTTCCTCCTTCCGAAACCC 60.035 60.0 0.0 0.0 0.0 4.11 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
898 903 2.710760 CCGAGAGAAAGACGAGATTCG 58.289 52.381 0.00 0.00 46.93 3.34
1166 1171 4.067972 TCCTAGTCTTTTGCGACACTTT 57.932 40.909 0.00 0.00 36.38 2.66
1273 1279 9.288576 TCCTATTCATGGTTATGATGTTCAATC 57.711 33.333 0.00 0.00 42.60 2.67
1405 1411 4.108570 TCCATTACTACCAACCCACAGAT 58.891 43.478 0.00 0.00 0.00 2.90
1474 1480 7.360113 AGTTGGACTAATTTGGAAACATTGT 57.640 32.000 0.00 0.00 42.32 2.71
1690 1696 3.708631 CCATAGAAGAAGCTTCTCCTCCA 59.291 47.826 28.58 13.45 36.28 3.86
1881 1887 2.630580 GCTCGAGATCTTAGAACCCCAT 59.369 50.000 18.75 0.00 0.00 4.00
1917 1923 1.523484 TGCTCACTCGCACAAGCAA 60.523 52.632 0.00 0.00 41.50 3.91
1994 2001 5.477607 TTCTCGAATTGGTAGGTTTCTCA 57.522 39.130 0.00 0.00 0.00 3.27
2000 2007 7.218614 TCGAATTGGTAGGTTTCTCAAAGTAA 58.781 34.615 0.00 0.00 0.00 2.24
2070 2077 1.336347 ATGGGTAGGTAGGGGGAAGA 58.664 55.000 0.00 0.00 0.00 2.87
2111 2118 2.234661 TCCTTCACAGTGCATACCTCTG 59.765 50.000 0.00 0.00 40.13 3.35
2159 2167 2.291217 GCAAGATCTTTGGTCTTCCCCT 60.291 50.000 4.86 0.00 33.82 4.79
2378 2386 5.552178 CCTTTTGCTAGGAGAGTGTAGTTT 58.448 41.667 0.00 0.00 37.50 2.66
2507 2515 2.826128 ACTCTTATCTGGTTGCACTCGA 59.174 45.455 0.00 0.00 0.00 4.04
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
62 63 1.118356 TTGCACAAAAAGGCCGGGAT 61.118 50.000 2.18 0.00 0.00 3.85
898 903 6.651225 AGAAAGCACTCACTGAATTACTTACC 59.349 38.462 0.00 0.00 0.00 2.85
1166 1171 8.776470 CGAGACCTAACAAAATAAGTAAACCAA 58.224 33.333 0.00 0.00 0.00 3.67
1273 1279 4.112634 TCGTGAATCTCCGCTATTTGAAG 58.887 43.478 0.00 0.00 0.00 3.02
1405 1411 6.154192 ACCGTATATCTCAGAGAGGTCGTATA 59.846 42.308 6.24 0.44 0.00 1.47
1503 1509 7.839680 AATCAGACTAGAAACCAAAAACCAT 57.160 32.000 0.00 0.00 0.00 3.55
1768 1774 7.108847 AGTCTGTCTATCTTGCATTTTAAGCT 58.891 34.615 0.00 0.00 0.00 3.74
1798 1804 0.846427 TCCCCAGGCTCAAGGAATGT 60.846 55.000 0.00 0.00 0.00 2.71
1917 1923 1.351076 CCTTTTTGGGTGGCTTCCAT 58.649 50.000 0.60 0.00 35.28 3.41
2070 2077 0.474660 AGCCCTCTGACCCACTCTTT 60.475 55.000 0.00 0.00 0.00 2.52
2111 2118 6.469275 CGACCAGAAAAACTCAAAAGAGAAAC 59.531 38.462 0.00 0.00 0.00 2.78
2159 2167 0.878416 CCGCTTTTTCATCGGTTCCA 59.122 50.000 0.00 0.00 38.47 3.53
2293 2301 0.035343 CCTTCCTCCTTCCGAAACCC 60.035 60.000 0.00 0.00 0.00 4.11
2507 2515 3.821421 AAACAAGTCGACAGGAGAACT 57.179 42.857 19.50 0.00 0.00 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.