Multiple sequence alignment - TraesCS5B01G388500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G388500 chr5B 100.000 2300 0 0 1 2300 567269428 567267129 0 4248
1 TraesCS5B01G388500 chr6A 98.349 2302 35 3 1 2300 608882069 608879769 0 4037
2 TraesCS5B01G388500 chr6A 97.534 2311 43 6 1 2300 84435311 84437618 0 3940
3 TraesCS5B01G388500 chrUn 98.267 2308 31 5 1 2300 86508845 86506539 0 4032
4 TraesCS5B01G388500 chr3B 98.092 2306 37 3 1 2300 92319004 92321308 0 4008
5 TraesCS5B01G388500 chr4D 98.089 2302 41 3 1 2300 123424881 123427181 0 4004
6 TraesCS5B01G388500 chr6B 98.008 2309 36 5 1 2300 596621490 596623797 0 4000
7 TraesCS5B01G388500 chr2B 97.875 2306 40 6 1 2300 30669446 30667144 0 3978
8 TraesCS5B01G388500 chr6D 97.614 2305 48 4 1 2300 168767955 168770257 0 3945
9 TraesCS5B01G388500 chr7A 97.482 2303 52 5 1 2300 563584351 563586650 0 3927


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G388500 chr5B 567267129 567269428 2299 True 4248 4248 100.000 1 2300 1 chr5B.!!$R1 2299
1 TraesCS5B01G388500 chr6A 608879769 608882069 2300 True 4037 4037 98.349 1 2300 1 chr6A.!!$R1 2299
2 TraesCS5B01G388500 chr6A 84435311 84437618 2307 False 3940 3940 97.534 1 2300 1 chr6A.!!$F1 2299
3 TraesCS5B01G388500 chrUn 86506539 86508845 2306 True 4032 4032 98.267 1 2300 1 chrUn.!!$R1 2299
4 TraesCS5B01G388500 chr3B 92319004 92321308 2304 False 4008 4008 98.092 1 2300 1 chr3B.!!$F1 2299
5 TraesCS5B01G388500 chr4D 123424881 123427181 2300 False 4004 4004 98.089 1 2300 1 chr4D.!!$F1 2299
6 TraesCS5B01G388500 chr6B 596621490 596623797 2307 False 4000 4000 98.008 1 2300 1 chr6B.!!$F1 2299
7 TraesCS5B01G388500 chr2B 30667144 30669446 2302 True 3978 3978 97.875 1 2300 1 chr2B.!!$R1 2299
8 TraesCS5B01G388500 chr6D 168767955 168770257 2302 False 3945 3945 97.614 1 2300 1 chr6D.!!$F1 2299
9 TraesCS5B01G388500 chr7A 563584351 563586650 2299 False 3927 3927 97.482 1 2300 1 chr7A.!!$F1 2299

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
990 1008 1.550976 GAACCTCTCCTTGTGATCGGT 59.449 52.381 0.0 0.0 0.0 4.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2147 2171 1.13379 GCTGCTCTTGTTGCTAATGGG 59.866 52.381 0.0 0.0 0.0 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
131 132 8.728596 ATTATAGCAGGTTGGTCTAGTAAGAT 57.271 34.615 0.00 0.0 33.30 2.40
164 165 3.120095 CGTTCGGTCGCCTATGATATACA 60.120 47.826 0.00 0.0 0.00 2.29
280 281 3.263170 TCTTTCATTCATCAAGGGGTCGA 59.737 43.478 0.00 0.0 0.00 4.20
432 448 2.872245 CGGCTCTTCTTCTTTGTCAACA 59.128 45.455 0.00 0.0 0.00 3.33
574 590 3.063588 GCCTCGCCTACTCATTTTTGTAC 59.936 47.826 0.00 0.0 0.00 2.90
616 632 3.961408 GGCTTAGGGATAAGAGAGTGTCA 59.039 47.826 0.00 0.0 0.00 3.58
811 827 4.328536 TCCATTTCAAAGGCGCTACTTTA 58.671 39.130 7.64 0.0 38.56 1.85
990 1008 1.550976 GAACCTCTCCTTGTGATCGGT 59.449 52.381 0.00 0.0 0.00 4.69
1152 1175 3.838271 GCGGACTGGGATCGCTCA 61.838 66.667 11.46 0.0 45.16 4.26
1233 1256 3.961414 GGGACAAGGGGCGGAACA 61.961 66.667 0.00 0.0 0.00 3.18
1513 1536 5.088026 AGTTTCTTACTCTCCCTTAGCAGT 58.912 41.667 0.00 0.0 28.23 4.40
1751 1775 2.028130 CCGGTCTAACTGCTGAGAGAT 58.972 52.381 0.00 0.0 0.00 2.75
2014 2038 1.820581 CCCGCGGGAAGTCTAATCA 59.179 57.895 41.82 0.0 37.50 2.57
2147 2171 8.669243 CATACTAAACTTCACTCCAATCTTTCC 58.331 37.037 0.00 0.0 0.00 3.13
2178 2202 5.738495 GCAACAAGAGCAGCTCTATCTATCA 60.738 44.000 25.66 0.0 40.28 2.15
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
140 141 1.105167 ATCATAGGCGACCGAACGGA 61.105 55.000 20.14 0.00 38.96 4.69
574 590 2.560151 CTTCGCTAACTCGCTCGCG 61.560 63.158 0.00 0.00 46.28 5.87
616 632 0.815734 ATGAAGGCTACGTACGCACT 59.184 50.000 16.72 5.47 0.00 4.40
811 827 3.243839 ACAATGACAAAGGCTTGCGAAAT 60.244 39.130 0.00 0.00 35.84 2.17
865 881 5.472478 GCATGCTCTCTGATTTATGGATTCA 59.528 40.000 11.37 0.00 0.00 2.57
913 931 3.119849 CGTTCCGGAAAGAATGAAATGCT 60.120 43.478 23.81 0.00 35.19 3.79
1152 1175 0.637195 TTCTAGAGGGCCTAGCTGGT 59.363 55.000 5.73 0.00 43.60 4.00
1233 1256 4.270834 TGCAGTAAGTAGATCGAGAGGTT 58.729 43.478 0.00 0.00 0.00 3.50
1513 1536 4.835615 GCAGATAGATAGACTCCTTTCCCA 59.164 45.833 0.00 0.00 0.00 4.37
1751 1775 7.778382 ACTCTTAGGGAAAGAAAAGCACTTTTA 59.222 33.333 8.29 0.00 43.66 1.52
2147 2171 1.133790 GCTGCTCTTGTTGCTAATGGG 59.866 52.381 0.00 0.00 0.00 4.00
2178 2202 3.432890 GCTAAGCTTACTCATCAAGGGCT 60.433 47.826 0.86 0.00 33.15 5.19


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.