Multiple sequence alignment - TraesCS5B01G344800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G344800 chr5B 100.000 2378 0 0 1 2378 527606851 527609228 0.000000e+00 4392.0
1 TraesCS5B01G344800 chr5B 94.864 1655 68 5 1 1645 527785734 527787381 0.000000e+00 2569.0
2 TraesCS5B01G344800 chr5B 95.327 749 22 3 1640 2378 527787418 527788163 0.000000e+00 1177.0
3 TraesCS5B01G344800 chr5B 79.449 871 147 19 669 1519 527040340 527039482 2.630000e-164 588.0
4 TraesCS5B01G344800 chr5B 78.205 858 145 27 689 1519 527061063 527060221 5.860000e-141 510.0
5 TraesCS5B01G344800 chr5B 77.652 528 62 27 1864 2373 527774078 527774567 1.080000e-68 270.0
6 TraesCS5B01G344800 chr5B 89.655 58 4 2 377 433 527494977 527495033 3.280000e-09 73.1
7 TraesCS5B01G344800 chr5D 95.610 2392 87 11 1 2378 434568297 434570684 0.000000e+00 3819.0
8 TraesCS5B01G344800 chr5D 93.029 2410 90 14 1 2378 434656489 434654126 0.000000e+00 3448.0
9 TraesCS5B01G344800 chr5D 84.770 893 107 19 741 1618 434575688 434576566 0.000000e+00 869.0
10 TraesCS5B01G344800 chr5D 82.967 910 118 19 545 1443 434663328 434662445 0.000000e+00 787.0
11 TraesCS5B01G344800 chr5D 79.475 877 147 21 666 1519 434331046 434331912 2.040000e-165 592.0
12 TraesCS5B01G344800 chr5D 78.935 864 139 28 689 1521 435237369 435238220 4.470000e-152 547.0
13 TraesCS5B01G344800 chr5D 78.827 784 137 20 757 1519 434382263 434381488 3.530000e-138 501.0
14 TraesCS5B01G344800 chr5D 81.583 619 76 20 1641 2238 434662208 434661607 5.950000e-131 477.0
15 TraesCS5B01G344800 chr5D 88.219 365 25 7 1 348 434678640 434678277 1.020000e-113 420.0
16 TraesCS5B01G344800 chr5D 80.804 448 63 16 1727 2164 434712829 434712395 1.760000e-86 329.0
17 TraesCS5B01G344800 chr5D 75.427 468 93 19 1398 1855 434604053 434604508 8.610000e-50 207.0
18 TraesCS5B01G344800 chr5D 88.312 154 12 4 545 697 434575531 434575679 1.880000e-41 180.0
19 TraesCS5B01G344800 chr5D 93.137 102 6 1 1905 2006 434604642 434604742 5.300000e-32 148.0
20 TraesCS5B01G344800 chr5D 87.931 58 5 2 377 433 434674624 434674568 1.530000e-07 67.6
21 TraesCS5B01G344800 chr5D 97.143 35 1 0 198 232 434663743 434663709 2.550000e-05 60.2
22 TraesCS5B01G344800 chr5A 79.725 873 146 22 669 1519 548226986 548226123 9.400000e-169 603.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G344800 chr5B 527606851 527609228 2377 False 4392.0 4392 100.0000 1 2378 1 chr5B.!!$F2 2377
1 TraesCS5B01G344800 chr5B 527785734 527788163 2429 False 1873.0 2569 95.0955 1 2378 2 chr5B.!!$F4 2377
2 TraesCS5B01G344800 chr5B 527039482 527040340 858 True 588.0 588 79.4490 669 1519 1 chr5B.!!$R1 850
3 TraesCS5B01G344800 chr5B 527060221 527061063 842 True 510.0 510 78.2050 689 1519 1 chr5B.!!$R2 830
4 TraesCS5B01G344800 chr5D 434568297 434570684 2387 False 3819.0 3819 95.6100 1 2378 1 chr5D.!!$F2 2377
5 TraesCS5B01G344800 chr5D 434654126 434656489 2363 True 3448.0 3448 93.0290 1 2378 1 chr5D.!!$R2 2377
6 TraesCS5B01G344800 chr5D 434331046 434331912 866 False 592.0 592 79.4750 666 1519 1 chr5D.!!$F1 853
7 TraesCS5B01G344800 chr5D 435237369 435238220 851 False 547.0 547 78.9350 689 1521 1 chr5D.!!$F3 832
8 TraesCS5B01G344800 chr5D 434575531 434576566 1035 False 524.5 869 86.5410 545 1618 2 chr5D.!!$F4 1073
9 TraesCS5B01G344800 chr5D 434381488 434382263 775 True 501.0 501 78.8270 757 1519 1 chr5D.!!$R1 762
10 TraesCS5B01G344800 chr5D 434661607 434663743 2136 True 441.4 787 87.2310 198 2238 3 chr5D.!!$R4 2040
11 TraesCS5B01G344800 chr5D 434674568 434678640 4072 True 243.8 420 88.0750 1 433 2 chr5D.!!$R5 432
12 TraesCS5B01G344800 chr5A 548226123 548226986 863 True 603.0 603 79.7250 669 1519 1 chr5A.!!$R1 850

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
500 1335 0.179137 CAGGCAGACGAACGCATCTA 60.179 55.0 0.0 0.0 0.0 1.98 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1814 4401 3.181466 GCAAAGTTGTTTGGATTCAGGGT 60.181 43.478 0.38 0.0 42.99 4.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
58 59 9.104965 ACTAAAACTAATGTGCGCTGATATTTA 57.895 29.630 9.73 3.85 0.00 1.40
168 181 6.841601 AGGGTGTACATTCAAGTATGCATAT 58.158 36.000 10.16 0.00 0.00 1.78
179 192 7.719778 TCAAGTATGCATATCACATGAGTTC 57.280 36.000 10.16 0.00 0.00 3.01
238 266 9.346725 GAAAACTTCCATTAAACTGCTGAATAG 57.653 33.333 0.00 0.00 0.00 1.73
279 314 7.763528 CAGATTGAGCAACTGAGAACTAGTTAT 59.236 37.037 8.42 4.99 36.29 1.89
500 1335 0.179137 CAGGCAGACGAACGCATCTA 60.179 55.000 0.00 0.00 0.00 1.98
886 3042 2.778299 TCAGCTCATACACCACCAAAC 58.222 47.619 0.00 0.00 0.00 2.93
1003 3170 2.787994 CAAAGAAGTGGCAGAGGATGT 58.212 47.619 0.00 0.00 0.00 3.06
1158 3355 1.071019 GCACGACGATCTTCAGCGAA 61.071 55.000 0.00 0.00 0.00 4.70
1161 3358 0.910513 CGACGATCTTCAGCGAACTG 59.089 55.000 0.00 0.00 45.95 3.16
1366 3808 1.921982 TGGAGCCAGCAAGCAAATTA 58.078 45.000 0.55 0.00 34.23 1.40
1548 4000 6.037830 GCCAGTAGACACAGTTGTTTTTCTTA 59.962 38.462 0.00 0.00 35.47 2.10
1700 4287 6.069847 TCGGGACTTTGGGATAAGAAATAAGT 60.070 38.462 0.00 0.00 0.00 2.24
1814 4401 6.767524 AAACATTACTGAACAACTGGACAA 57.232 33.333 0.00 0.00 0.00 3.18
2273 4880 1.454201 AGACAGACTCGATCGCTGAA 58.546 50.000 22.67 1.47 33.94 3.02
2281 4888 2.094700 ACTCGATCGCTGAAAAGTAGCA 60.095 45.455 11.09 0.00 41.18 3.49
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
16 17 4.403015 TTTAGTTTTAAAGCGTACGCCC 57.597 40.909 34.88 10.85 43.17 6.13
24 25 7.114388 AGCGCACATTAGTTTTAGTTTTAAAGC 59.886 33.333 11.47 0.00 32.14 3.51
58 59 9.442047 CAGGACTCATCAGTTTTATAGTTTCTT 57.558 33.333 0.00 0.00 30.63 2.52
74 75 3.119708 GGAAAACATGTGCAGGACTCATC 60.120 47.826 0.00 0.00 30.09 2.92
168 181 6.545666 AGGTAACATTTGTTGAACTCATGTGA 59.454 34.615 11.84 4.27 38.90 3.58
179 192 5.957842 TTCTAGGCAGGTAACATTTGTTG 57.042 39.130 6.21 0.00 38.90 3.33
238 266 4.191544 TCAATCTGCAGGTGTACATTAGC 58.808 43.478 15.13 4.10 0.00 3.09
245 273 2.038952 AGTTGCTCAATCTGCAGGTGTA 59.961 45.455 15.13 0.00 41.71 2.90
500 1335 3.750371 TCAGATTGGTTGTTGATCGGTT 58.250 40.909 0.00 0.00 0.00 4.44
886 3042 3.409570 AGCTATGGATGCTGTAATGCTG 58.590 45.455 0.00 0.00 39.56 4.41
929 3092 3.441163 GTTGTTTCCGGGTCTTGTTTTC 58.559 45.455 0.00 0.00 0.00 2.29
980 3147 0.251077 CCTCTGCCACTTCTTTGCCT 60.251 55.000 0.00 0.00 0.00 4.75
1003 3170 3.521126 AGCCTCTTCCTCTTAAATGCTGA 59.479 43.478 0.00 0.00 0.00 4.26
1112 3309 3.788227 ACACCAATGCTACCTCAAAGA 57.212 42.857 0.00 0.00 0.00 2.52
1158 3355 1.270414 CCTGGGACATCCTCAGCAGT 61.270 60.000 9.66 0.00 38.20 4.40
1161 3358 1.694133 CCTCCTGGGACATCCTCAGC 61.694 65.000 9.66 0.00 38.20 4.26
1366 3808 4.689612 TCTTCAGGAGCTACAAACAACT 57.310 40.909 0.00 0.00 0.00 3.16
1814 4401 3.181466 GCAAAGTTGTTTGGATTCAGGGT 60.181 43.478 0.38 0.00 42.99 4.34
1850 4437 4.985538 TGTCCTTGAGTATTTTCAGGCTT 58.014 39.130 0.00 0.00 0.00 4.35
1900 4494 9.070149 GTTTCAAATGAAGCTGAAGATTATGAC 57.930 33.333 3.13 0.00 35.21 3.06
2241 4848 5.179742 TCGAGTCTGTCTTAACTCTTGAGTC 59.820 44.000 3.58 0.00 39.80 3.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.