Multiple sequence alignment - TraesCS5B01G342700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G342700 chr5B 100.000 2646 0 0 1 2646 527014123 527011478 0.000000e+00 4887.0
1 TraesCS5B01G342700 chr5B 98.538 2668 15 2 1 2646 526990745 526988080 0.000000e+00 4689.0
2 TraesCS5B01G342700 chr5B 99.298 855 6 0 1792 2646 526955184 526954330 0.000000e+00 1546.0
3 TraesCS5B01G342700 chr5B 90.741 54 5 0 137 190 654908473 654908420 3.650000e-09 73.1
4 TraesCS5B01G342700 chr2A 89.534 1051 67 17 753 1796 776394476 776395490 0.000000e+00 1291.0
5 TraesCS5B01G342700 chr2A 87.619 105 13 0 1773 1877 776398951 776399055 3.580000e-24 122.0
6 TraesCS5B01G342700 chrUn 99.531 640 3 0 1792 2431 344136951 344136312 0.000000e+00 1166.0
7 TraesCS5B01G342700 chr5D 92.066 542 35 6 8 544 434358686 434358148 0.000000e+00 756.0
8 TraesCS5B01G342700 chr5D 86.979 192 18 1 540 724 434354696 434354505 2.670000e-50 209.0
9 TraesCS5B01G342700 chr3D 79.042 501 101 4 2130 2627 103866564 103867063 9.070000e-90 340.0
10 TraesCS5B01G342700 chr3D 79.042 501 101 4 2130 2627 528145248 528144749 9.070000e-90 340.0
11 TraesCS5B01G342700 chr3D 78.486 502 104 4 2129 2627 528139528 528139028 2.540000e-85 326.0
12 TraesCS5B01G342700 chr3D 78.044 501 106 3 2129 2627 26846146 26846644 1.980000e-81 313.0
13 TraesCS5B01G342700 chr3D 79.012 162 22 9 95 249 602800401 602800557 1.680000e-17 100.0
14 TraesCS5B01G342700 chr7D 77.668 506 107 6 2129 2630 53193806 53193303 1.190000e-78 303.0
15 TraesCS5B01G342700 chr1D 79.176 437 87 4 2130 2563 455782193 455781758 1.540000e-77 300.0
16 TraesCS5B01G342700 chr1D 100.000 32 0 0 1767 1798 135645750 135645781 2.840000e-05 60.2
17 TraesCS5B01G342700 chr3A 81.667 120 16 4 140 258 733042529 733042415 7.800000e-16 95.3
18 TraesCS5B01G342700 chr5A 88.000 75 7 2 118 190 646811823 646811749 1.300000e-13 87.9
19 TraesCS5B01G342700 chr5A 89.362 47 5 0 1768 1814 613596563 613596517 2.840000e-05 60.2
20 TraesCS5B01G342700 chr3B 95.122 41 2 0 1767 1807 123421942 123421982 6.110000e-07 65.8
21 TraesCS5B01G342700 chr7B 90.909 44 4 0 1769 1812 244276337 244276380 2.840000e-05 60.2
22 TraesCS5B01G342700 chr4D 92.683 41 3 0 1767 1807 86644055 86644015 2.840000e-05 60.2
23 TraesCS5B01G342700 chr6A 88.235 51 2 3 1768 1816 25634540 25634492 1.020000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G342700 chr5B 527011478 527014123 2645 True 4887.0 4887 100.0000 1 2646 1 chr5B.!!$R3 2645
1 TraesCS5B01G342700 chr5B 526988080 526990745 2665 True 4689.0 4689 98.5380 1 2646 1 chr5B.!!$R2 2645
2 TraesCS5B01G342700 chr5B 526954330 526955184 854 True 1546.0 1546 99.2980 1792 2646 1 chr5B.!!$R1 854
3 TraesCS5B01G342700 chr2A 776394476 776399055 4579 False 706.5 1291 88.5765 753 1877 2 chr2A.!!$F1 1124
4 TraesCS5B01G342700 chrUn 344136312 344136951 639 True 1166.0 1166 99.5310 1792 2431 1 chrUn.!!$R1 639
5 TraesCS5B01G342700 chr5D 434354505 434358686 4181 True 482.5 756 89.5225 8 724 2 chr5D.!!$R1 716
6 TraesCS5B01G342700 chr3D 528139028 528139528 500 True 326.0 326 78.4860 2129 2627 1 chr3D.!!$R1 498
7 TraesCS5B01G342700 chr7D 53193303 53193806 503 True 303.0 303 77.6680 2129 2630 1 chr7D.!!$R1 501

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
609 4071 1.82299 CGGCTAGGGTAAACTCTCACA 59.177 52.381 0.0 0.0 0.0 3.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2601 9584 0.727398 GAGCATTGTGTCGCTTACCC 59.273 55.0 0.0 0.0 38.99 3.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
609 4071 1.822990 CGGCTAGGGTAAACTCTCACA 59.177 52.381 0.0 0.0 0.00 3.58
1922 8903 1.189446 GTCACGTAGTTGTTGTCAGCG 59.811 52.381 0.0 0.0 41.61 5.18
2601 9584 0.398318 GGGGATCGAGATGGGAAAGG 59.602 60.000 0.0 0.0 0.00 3.11
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
609 4071 0.243907 CTCGTCGGTGAAGTGTGGAT 59.756 55.000 0.0 0.0 0.00 3.41
1150 4619 8.084985 AGAAAATAAAACAAGGGAAGAACCAA 57.915 30.769 0.0 0.0 41.20 3.67
1922 8903 3.636153 AGGGTCTTTACTTCATCTGGC 57.364 47.619 0.0 0.0 0.00 4.85
1966 8947 3.073062 AGACATTTGGTGGAGTTGCTAGT 59.927 43.478 0.0 0.0 0.00 2.57
2601 9584 0.727398 GAGCATTGTGTCGCTTACCC 59.273 55.000 0.0 0.0 38.99 3.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.