Multiple sequence alignment - TraesCS5B01G341000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G341000 chr5B 100.000 2361 0 0 1 2361 525916753 525919113 0.000000e+00 4361.0
1 TraesCS5B01G341000 chr5B 99.323 2362 13 2 1 2361 525862508 525864867 0.000000e+00 4270.0
2 TraesCS5B01G341000 chr5B 99.111 2362 16 3 1 2361 526020129 526022486 0.000000e+00 4241.0
3 TraesCS5B01G341000 chr5B 98.857 2362 20 2 1 2361 525965437 525967792 0.000000e+00 4205.0
4 TraesCS5B01G341000 chr5B 98.730 2362 25 2 1 2361 525986922 525989279 0.000000e+00 4191.0
5 TraesCS5B01G341000 chr5B 97.925 2362 21 3 1 2361 526038303 526040637 0.000000e+00 4065.0
6 TraesCS5B01G341000 chr5B 99.026 2259 19 2 1 2258 526001607 526003863 0.000000e+00 4047.0
7 TraesCS5B01G341000 chr5B 98.640 2132 14 3 243 2361 386744214 386746343 0.000000e+00 3762.0
8 TraesCS5B01G341000 chr5B 99.276 1382 9 1 1 1381 526057112 526058493 0.000000e+00 2495.0
9 TraesCS5B01G341000 chr5B 98.701 231 2 1 1 230 526074670 526074900 2.180000e-110 409.0
10 TraesCS5B01G341000 chr5B 97.674 215 5 0 1588 1802 525988297 525988511 1.030000e-98 370.0
11 TraesCS5B01G341000 chrUn 99.366 1577 9 1 1 1576 215906936 215905360 0.000000e+00 2856.0
12 TraesCS5B01G341000 chrUn 98.735 1028 9 1 1334 2361 385214439 385215462 0.000000e+00 1823.0
13 TraesCS5B01G341000 chr1B 83.654 312 45 5 2047 2356 93953424 93953731 2.970000e-74 289.0
14 TraesCS5B01G341000 chr3D 94.737 57 3 0 1890 1946 43024766 43024822 3.230000e-14 89.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G341000 chr5B 525916753 525919113 2360 False 4361.0 4361 100.000 1 2361 1 chr5B.!!$F3 2360
1 TraesCS5B01G341000 chr5B 525862508 525864867 2359 False 4270.0 4270 99.323 1 2361 1 chr5B.!!$F2 2360
2 TraesCS5B01G341000 chr5B 526020129 526022486 2357 False 4241.0 4241 99.111 1 2361 1 chr5B.!!$F6 2360
3 TraesCS5B01G341000 chr5B 525965437 525967792 2355 False 4205.0 4205 98.857 1 2361 1 chr5B.!!$F4 2360
4 TraesCS5B01G341000 chr5B 526038303 526040637 2334 False 4065.0 4065 97.925 1 2361 1 chr5B.!!$F7 2360
5 TraesCS5B01G341000 chr5B 526001607 526003863 2256 False 4047.0 4047 99.026 1 2258 1 chr5B.!!$F5 2257
6 TraesCS5B01G341000 chr5B 386744214 386746343 2129 False 3762.0 3762 98.640 243 2361 1 chr5B.!!$F1 2118
7 TraesCS5B01G341000 chr5B 526057112 526058493 1381 False 2495.0 2495 99.276 1 1381 1 chr5B.!!$F8 1380
8 TraesCS5B01G341000 chr5B 525986922 525989279 2357 False 2280.5 4191 98.202 1 2361 2 chr5B.!!$F10 2360
9 TraesCS5B01G341000 chrUn 215905360 215906936 1576 True 2856.0 2856 99.366 1 1576 1 chrUn.!!$R1 1575
10 TraesCS5B01G341000 chrUn 385214439 385215462 1023 False 1823.0 1823 98.735 1334 2361 1 chrUn.!!$F1 1027

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
753 764 0.657312 CATGACGCTGTGTGTGTGTT 59.343 50.0 0.0 0.0 39.84 3.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1661 1680 1.140312 GGAGAGGAATACCCATGCCA 58.86 55.0 0.0 0.0 37.41 4.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
753 764 0.657312 CATGACGCTGTGTGTGTGTT 59.343 50.000 0.0 0.0 39.84 3.32
1421 1432 0.876399 TAGCACACTACGCTGTCGAA 59.124 50.000 0.0 0.0 40.73 3.71
1486 1497 2.158623 TCCTCTGCCATCTCTCTCTCTC 60.159 54.545 0.0 0.0 0.00 3.20
1487 1498 2.158564 CCTCTGCCATCTCTCTCTCTCT 60.159 54.545 0.0 0.0 0.00 3.10
1661 1680 2.685106 TCCTCCTCACAACTGACTCT 57.315 50.000 0.0 0.0 0.00 3.24
2217 2242 7.776107 AGTACCCTAAACCGAACTTACTATTC 58.224 38.462 0.0 0.0 0.00 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
136 138 3.899726 TCTCCCGTCAACTAGCTATCTT 58.100 45.455 0.0 0.0 0.00 2.40
753 764 5.541484 TGCAATAGAGGATAGCTTCAGATCA 59.459 40.000 0.0 0.0 0.00 2.92
1079 1090 1.075536 ACGGAGAAGGGAAAAGGCATT 59.924 47.619 0.0 0.0 0.00 3.56
1486 1497 2.630158 CCACTGGCATGAGAAAGAGAG 58.370 52.381 0.0 0.0 0.00 3.20
1487 1498 1.280133 CCCACTGGCATGAGAAAGAGA 59.720 52.381 0.0 0.0 0.00 3.10
1661 1680 1.140312 GGAGAGGAATACCCATGCCA 58.860 55.000 0.0 0.0 37.41 4.92
2086 2111 6.136541 ACTAAAAAGCAAAGAAGTGGAGTG 57.863 37.500 0.0 0.0 0.00 3.51
2217 2242 2.973224 GTGTACTCGCAAACTGCAAATG 59.027 45.455 0.0 0.0 45.36 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.