Multiple sequence alignment - TraesCS5B01G322100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G322100 chr5B 100.000 2264 0 0 1 2264 506965542 506967805 0.000000e+00 4181
1 TraesCS5B01G322100 chr5B 94.932 2289 90 8 1 2264 234885620 234883333 0.000000e+00 3561
2 TraesCS5B01G322100 chr5B 93.182 484 23 1 1791 2264 709185000 709184517 0.000000e+00 702
3 TraesCS5B01G322100 chr5B 95.968 124 5 0 2141 2264 535136343 535136466 3.810000e-48 202
4 TraesCS5B01G322100 chr3B 96.009 2280 73 8 1 2264 604266044 604263767 0.000000e+00 3690
5 TraesCS5B01G322100 chr3B 95.161 124 6 0 2141 2264 760825777 760825900 1.770000e-46 196
6 TraesCS5B01G322100 chr3B 94.355 124 7 0 2141 2264 420918915 420918792 8.250000e-45 191
7 TraesCS5B01G322100 chr4B 96.767 2196 50 12 1 2191 551060036 551062215 0.000000e+00 3642
8 TraesCS5B01G322100 chr4B 92.253 839 54 6 1435 2264 310257593 310258429 0.000000e+00 1179
9 TraesCS5B01G322100 chr4B 95.161 124 6 0 2141 2264 551062246 551062369 1.770000e-46 196
10 TraesCS5B01G322100 chr6B 96.780 2143 66 2 1 2141 181111565 181109424 0.000000e+00 3572
11 TraesCS5B01G322100 chr2B 96.636 2140 70 1 2 2139 549352845 549354984 0.000000e+00 3552
12 TraesCS5B01G322100 chr2B 96.863 2072 58 6 1 2068 454449224 454451292 0.000000e+00 3459
13 TraesCS5B01G322100 chr2B 96.815 2072 59 6 1 2068 454473357 454475425 0.000000e+00 3454
14 TraesCS5B01G322100 chr1B 97.474 2019 49 1 1 2017 571422405 571420387 0.000000e+00 3445
15 TraesCS5B01G322100 chr1B 95.161 124 6 0 2141 2264 571420333 571420210 1.770000e-46 196
16 TraesCS5B01G322100 chr4D 93.119 2151 133 14 1 2141 470196639 470194494 0.000000e+00 3138
17 TraesCS5B01G322100 chr2D 92.687 2147 147 9 1 2141 619853630 619855772 0.000000e+00 3086


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G322100 chr5B 506965542 506967805 2263 False 4181.0 4181 100.0000 1 2264 1 chr5B.!!$F1 2263
1 TraesCS5B01G322100 chr5B 234883333 234885620 2287 True 3561.0 3561 94.9320 1 2264 1 chr5B.!!$R1 2263
2 TraesCS5B01G322100 chr3B 604263767 604266044 2277 True 3690.0 3690 96.0090 1 2264 1 chr3B.!!$R2 2263
3 TraesCS5B01G322100 chr4B 551060036 551062369 2333 False 1919.0 3642 95.9640 1 2264 2 chr4B.!!$F2 2263
4 TraesCS5B01G322100 chr4B 310257593 310258429 836 False 1179.0 1179 92.2530 1435 2264 1 chr4B.!!$F1 829
5 TraesCS5B01G322100 chr6B 181109424 181111565 2141 True 3572.0 3572 96.7800 1 2141 1 chr6B.!!$R1 2140
6 TraesCS5B01G322100 chr2B 549352845 549354984 2139 False 3552.0 3552 96.6360 2 2139 1 chr2B.!!$F3 2137
7 TraesCS5B01G322100 chr2B 454449224 454451292 2068 False 3459.0 3459 96.8630 1 2068 1 chr2B.!!$F1 2067
8 TraesCS5B01G322100 chr2B 454473357 454475425 2068 False 3454.0 3454 96.8150 1 2068 1 chr2B.!!$F2 2067
9 TraesCS5B01G322100 chr1B 571420210 571422405 2195 True 1820.5 3445 96.3175 1 2264 2 chr1B.!!$R1 2263
10 TraesCS5B01G322100 chr4D 470194494 470196639 2145 True 3138.0 3138 93.1190 1 2141 1 chr4D.!!$R1 2140
11 TraesCS5B01G322100 chr2D 619853630 619855772 2142 False 3086.0 3086 92.6870 1 2141 1 chr2D.!!$F1 2140

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
654 657 0.178533 AACGAAGAACCAACACGGGA 59.821 50.0 0.0 0.0 40.22 5.14 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1661 1678 0.611618 TTTGGCATGGCTTCATCCGT 60.612 50.0 21.08 0.0 0.0 4.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 2.180017 GCATTCTGCAAGCACGGG 59.820 61.111 0.00 0.00 44.26 5.28
224 225 1.547372 GGTGGAGTTGCTTACGAGGTA 59.453 52.381 0.00 0.00 0.00 3.08
296 297 1.741706 CCTTGCTCGCATTTGATGACT 59.258 47.619 0.00 0.00 0.00 3.41
623 626 3.462483 TGACACAGGACACAACGTTAT 57.538 42.857 0.00 0.00 0.00 1.89
654 657 0.178533 AACGAAGAACCAACACGGGA 59.821 50.000 0.00 0.00 40.22 5.14
877 893 2.930040 CCTATCGACGTGTTGCTCAATT 59.070 45.455 0.00 0.00 0.00 2.32
1214 1231 3.331478 TGTTTGCCCCAATTATGCTTG 57.669 42.857 0.00 0.00 0.00 4.01
1309 1326 2.930040 GTGTGTCATCACTAACATCCGG 59.070 50.000 0.00 0.00 44.14 5.14
1389 1406 5.779771 AGTGCCAAAAGATATCCAAAAGGAA 59.220 36.000 0.00 0.00 0.00 3.36
1417 1434 3.763897 AGAAGATTGTTTTAGGCGCCAAT 59.236 39.130 31.54 18.41 0.00 3.16
1446 1463 4.777463 TCGAAGAAAGGTTTCAAAGAGGT 58.223 39.130 5.30 0.00 39.61 3.85
1661 1678 1.887854 TCGGTGGACTCGTCATGTAAA 59.112 47.619 0.00 0.00 0.00 2.01
1843 1860 7.286087 TCTGGGATTTGTCATGATTCTTATTGG 59.714 37.037 0.00 0.00 0.00 3.16
1859 1876 5.695816 TCTTATTGGAAAATTGTTGTGCTGC 59.304 36.000 0.00 0.00 0.00 5.25
2036 2252 0.033699 GTAGGACCAGACCCTACCGT 60.034 60.000 7.86 0.00 46.52 4.83
2173 2465 3.712907 GGCGGTAGGGTCCAGCAA 61.713 66.667 0.00 0.00 0.00 3.91
2248 2540 2.687935 GCCCCATATGTGTCGAATGTTT 59.312 45.455 1.24 0.00 0.00 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 2.247358 TCTTTTCCCCAATCCACTTGC 58.753 47.619 0.00 0.00 33.20 4.01
189 190 0.890683 CCACCGTAAGACCTACCGTT 59.109 55.000 0.00 0.00 43.02 4.44
224 225 1.065851 CACCAACGGTTTTTAAGGCGT 59.934 47.619 0.00 0.00 31.02 5.68
296 297 1.891919 GTTTCTCACCCGTGCTGCA 60.892 57.895 0.00 0.00 0.00 4.41
623 626 3.003275 GGTTCTTCGTTTCTTGCATGTCA 59.997 43.478 0.00 0.00 0.00 3.58
654 657 2.466846 CGTCCACGTGTTTGACTAGTT 58.533 47.619 15.65 0.00 34.11 2.24
877 893 6.831353 ACCATTCACATTATTTAACCATCCGA 59.169 34.615 0.00 0.00 0.00 4.55
1309 1326 2.544267 GAGGCGGTGACTGCATATAAAC 59.456 50.000 19.20 0.00 0.00 2.01
1417 1434 2.341846 AACCTTTCTTCGAACAGCCA 57.658 45.000 0.00 0.00 0.00 4.75
1446 1463 0.038526 GACGACGCTCTTCCTCCAAA 60.039 55.000 0.00 0.00 0.00 3.28
1661 1678 0.611618 TTTGGCATGGCTTCATCCGT 60.612 50.000 21.08 0.00 0.00 4.69
1843 1860 3.371168 TCTTCGCAGCACAACAATTTTC 58.629 40.909 0.00 0.00 0.00 2.29
1859 1876 6.392625 TCTGTTATATCCCACTTCTCTTCG 57.607 41.667 0.00 0.00 0.00 3.79
2036 2252 3.006133 TACCGCCATGGCCTGTGA 61.006 61.111 30.79 13.40 43.94 3.58
2151 2443 2.063979 TGGACCCTACCGCCAGATG 61.064 63.158 0.00 0.00 0.00 2.90
2173 2465 3.797353 CAGGCCATGGCGGTAGGT 61.797 66.667 29.90 7.53 43.06 3.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.