Multiple sequence alignment - TraesCS5B01G313100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G313100 chr5B 100.000 2449 0 0 1 2449 494655855 494658303 0 4523
1 TraesCS5B01G313100 chr5B 98.122 2450 45 1 1 2449 41406865 41404416 0 4268
2 TraesCS5B01G313100 chr5B 98.042 2451 45 3 1 2449 660354745 660352296 0 4257
3 TraesCS5B01G313100 chr5B 97.918 2450 48 3 1 2449 494664108 494661661 0 4239
4 TraesCS5B01G313100 chr2B 98.082 2450 46 1 1 2449 50469410 50471859 0 4263
5 TraesCS5B01G313100 chr4B 98.001 2451 47 2 1 2449 57126068 57123618 0 4253
6 TraesCS5B01G313100 chr4B 97.510 2450 58 3 1 2449 574590070 574592517 0 4183
7 TraesCS5B01G313100 chr6B 97.796 2450 53 1 1 2449 663151556 663149107 0 4224
8 TraesCS5B01G313100 chr1B 97.550 2449 57 2 1 2449 654687357 654684912 0 4187
9 TraesCS5B01G313100 chr4A 96.940 2451 60 8 1 2449 661072728 661070291 0 4096


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G313100 chr5B 494655855 494658303 2448 False 4523 4523 100.000 1 2449 1 chr5B.!!$F1 2448
1 TraesCS5B01G313100 chr5B 41404416 41406865 2449 True 4268 4268 98.122 1 2449 1 chr5B.!!$R1 2448
2 TraesCS5B01G313100 chr5B 660352296 660354745 2449 True 4257 4257 98.042 1 2449 1 chr5B.!!$R3 2448
3 TraesCS5B01G313100 chr5B 494661661 494664108 2447 True 4239 4239 97.918 1 2449 1 chr5B.!!$R2 2448
4 TraesCS5B01G313100 chr2B 50469410 50471859 2449 False 4263 4263 98.082 1 2449 1 chr2B.!!$F1 2448
5 TraesCS5B01G313100 chr4B 57123618 57126068 2450 True 4253 4253 98.001 1 2449 1 chr4B.!!$R1 2448
6 TraesCS5B01G313100 chr4B 574590070 574592517 2447 False 4183 4183 97.510 1 2449 1 chr4B.!!$F1 2448
7 TraesCS5B01G313100 chr6B 663149107 663151556 2449 True 4224 4224 97.796 1 2449 1 chr6B.!!$R1 2448
8 TraesCS5B01G313100 chr1B 654684912 654687357 2445 True 4187 4187 97.550 1 2449 1 chr1B.!!$R1 2448
9 TraesCS5B01G313100 chr4A 661070291 661072728 2437 True 4096 4096 96.940 1 2449 1 chr4A.!!$R1 2448

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
575 576 0.541998 TCCCCTCTCGTTTGCTCTCA 60.542 55.0 0.0 0.0 0.0 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2263 2275 9.615295 CTCACTAGAGAAGAACAAAAGTACTAC 57.385 37.037 0.0 0.0 44.98 2.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 4.438148 ACATTGAAAAACCAAAAGGACGG 58.562 39.130 0.00 0.00 0.00 4.79
140 141 2.115911 CGCTACTGAGACGGGCTCT 61.116 63.158 12.93 0.00 44.27 4.09
349 350 4.860881 CCCTCCCTGCGGGCTAGA 62.861 72.222 5.85 0.00 43.94 2.43
575 576 0.541998 TCCCCTCTCGTTTGCTCTCA 60.542 55.000 0.00 0.00 0.00 3.27
861 866 3.619767 ACACTCTCGCTGGCTGCA 61.620 61.111 16.76 3.10 43.06 4.41
929 935 4.772231 TCTTCTACCGGCCGCCCT 62.772 66.667 22.85 6.53 0.00 5.19
1154 1160 1.201429 ACAAGGAGCCGGAGTGGAAT 61.201 55.000 5.05 0.00 42.00 3.01
1341 1349 5.865013 GGGGTTTTATTGTTTGATAACGTGG 59.135 40.000 0.00 0.00 37.06 4.94
2263 2275 6.036300 TGCATTAGAAAAGAAATACGGTACCG 59.964 38.462 32.22 32.22 46.03 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
575 576 1.589803 GCCACGGCGAAATACCTAAT 58.410 50.000 16.62 0.0 0.00 1.73
721 722 1.692042 CATGGAGAGGGAGTGGCCT 60.692 63.158 3.32 0.0 36.66 5.19
861 866 4.479993 GCAGCAGATGGGGCGAGT 62.480 66.667 0.00 0.0 36.08 4.18
929 935 2.418910 GCAGTAGGCGAGGCTGAGA 61.419 63.158 9.55 0.0 32.39 3.27
1154 1160 4.705110 TCTTTCCAATTGTGACCTCTCA 57.295 40.909 4.43 0.0 0.00 3.27
2263 2275 9.615295 CTCACTAGAGAAGAACAAAAGTACTAC 57.385 37.037 0.00 0.0 44.98 2.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.