Multiple sequence alignment - TraesCS5B01G312400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G312400 chr5B 100.000 2339 0 0 1 2339 493987751 493985413 0 4320
1 TraesCS5B01G312400 chr5B 95.756 754 25 3 1 754 68770857 68771603 0 1208
2 TraesCS5B01G312400 chr5B 97.264 658 18 0 1682 2339 305724718 305725375 0 1116
3 TraesCS5B01G312400 chr5D 99.143 934 6 2 752 1683 560879647 560878714 0 1679
4 TraesCS5B01G312400 chr5D 97.970 936 9 5 752 1683 503213081 503212152 0 1615
5 TraesCS5B01G312400 chrUn 98.929 934 8 2 752 1683 93417169 93418102 0 1668
6 TraesCS5B01G312400 chrUn 98.608 934 8 5 752 1682 327660701 327661632 0 1648
7 TraesCS5B01G312400 chr1D 98.825 936 7 2 752 1683 144237885 144236950 0 1664
8 TraesCS5B01G312400 chr2D 98.608 934 8 5 752 1682 272799055 272799986 0 1648
9 TraesCS5B01G312400 chr3B 98.075 935 12 5 752 1683 201521853 201520922 0 1622
10 TraesCS5B01G312400 chr3B 96.419 754 22 2 1 754 427280274 427279526 0 1238
11 TraesCS5B01G312400 chr3B 95.623 754 27 3 1 754 253548556 253547809 0 1205
12 TraesCS5B01G312400 chr3B 97.416 658 17 0 1682 2339 7731422 7732079 0 1122
13 TraesCS5B01G312400 chr3B 97.416 658 17 0 1682 2339 380490131 380490788 0 1122
14 TraesCS5B01G312400 chr3B 97.416 658 16 1 1682 2339 423016400 423017056 0 1120
15 TraesCS5B01G312400 chr6A 97.749 933 17 4 752 1683 271184625 271183696 0 1604
16 TraesCS5B01G312400 chr4A 97.650 936 13 6 752 1683 722779713 722780643 0 1598
17 TraesCS5B01G312400 chr6B 96.684 754 21 2 1 754 172537185 172537934 0 1251
18 TraesCS5B01G312400 chr6B 96.154 754 20 4 1 754 562767488 562766744 0 1223
19 TraesCS5B01G312400 chr6B 97.416 658 17 0 1682 2339 96618065 96618722 0 1122
20 TraesCS5B01G312400 chr6B 97.416 658 17 0 1682 2339 437248767 437248110 0 1122
21 TraesCS5B01G312400 chr6B 97.416 658 17 0 1682 2339 456155589 456156246 0 1122
22 TraesCS5B01G312400 chr6B 97.416 658 17 0 1682 2339 584663662 584664319 0 1122
23 TraesCS5B01G312400 chr7B 95.750 753 26 5 2 754 200865305 200864559 0 1208
24 TraesCS5B01G312400 chr7B 95.491 754 32 2 1 754 634675965 634675214 0 1203
25 TraesCS5B01G312400 chr4B 95.491 754 30 2 1 754 171492993 171493742 0 1201
26 TraesCS5B01G312400 chr4B 97.264 658 18 0 1682 2339 76572583 76573240 0 1116
27 TraesCS5B01G312400 chr1B 95.491 754 30 3 1 754 230649431 230648682 0 1201


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G312400 chr5B 493985413 493987751 2338 True 4320 4320 100.000 1 2339 1 chr5B.!!$R1 2338
1 TraesCS5B01G312400 chr5B 68770857 68771603 746 False 1208 1208 95.756 1 754 1 chr5B.!!$F1 753
2 TraesCS5B01G312400 chr5B 305724718 305725375 657 False 1116 1116 97.264 1682 2339 1 chr5B.!!$F2 657
3 TraesCS5B01G312400 chr5D 560878714 560879647 933 True 1679 1679 99.143 752 1683 1 chr5D.!!$R2 931
4 TraesCS5B01G312400 chr5D 503212152 503213081 929 True 1615 1615 97.970 752 1683 1 chr5D.!!$R1 931
5 TraesCS5B01G312400 chrUn 93417169 93418102 933 False 1668 1668 98.929 752 1683 1 chrUn.!!$F1 931
6 TraesCS5B01G312400 chrUn 327660701 327661632 931 False 1648 1648 98.608 752 1682 1 chrUn.!!$F2 930
7 TraesCS5B01G312400 chr1D 144236950 144237885 935 True 1664 1664 98.825 752 1683 1 chr1D.!!$R1 931
8 TraesCS5B01G312400 chr2D 272799055 272799986 931 False 1648 1648 98.608 752 1682 1 chr2D.!!$F1 930
9 TraesCS5B01G312400 chr3B 201520922 201521853 931 True 1622 1622 98.075 752 1683 1 chr3B.!!$R1 931
10 TraesCS5B01G312400 chr3B 427279526 427280274 748 True 1238 1238 96.419 1 754 1 chr3B.!!$R3 753
11 TraesCS5B01G312400 chr3B 253547809 253548556 747 True 1205 1205 95.623 1 754 1 chr3B.!!$R2 753
12 TraesCS5B01G312400 chr3B 7731422 7732079 657 False 1122 1122 97.416 1682 2339 1 chr3B.!!$F1 657
13 TraesCS5B01G312400 chr3B 380490131 380490788 657 False 1122 1122 97.416 1682 2339 1 chr3B.!!$F2 657
14 TraesCS5B01G312400 chr3B 423016400 423017056 656 False 1120 1120 97.416 1682 2339 1 chr3B.!!$F3 657
15 TraesCS5B01G312400 chr6A 271183696 271184625 929 True 1604 1604 97.749 752 1683 1 chr6A.!!$R1 931
16 TraesCS5B01G312400 chr4A 722779713 722780643 930 False 1598 1598 97.650 752 1683 1 chr4A.!!$F1 931
17 TraesCS5B01G312400 chr6B 172537185 172537934 749 False 1251 1251 96.684 1 754 1 chr6B.!!$F2 753
18 TraesCS5B01G312400 chr6B 562766744 562767488 744 True 1223 1223 96.154 1 754 1 chr6B.!!$R2 753
19 TraesCS5B01G312400 chr6B 96618065 96618722 657 False 1122 1122 97.416 1682 2339 1 chr6B.!!$F1 657
20 TraesCS5B01G312400 chr6B 437248110 437248767 657 True 1122 1122 97.416 1682 2339 1 chr6B.!!$R1 657
21 TraesCS5B01G312400 chr6B 456155589 456156246 657 False 1122 1122 97.416 1682 2339 1 chr6B.!!$F3 657
22 TraesCS5B01G312400 chr6B 584663662 584664319 657 False 1122 1122 97.416 1682 2339 1 chr6B.!!$F4 657
23 TraesCS5B01G312400 chr7B 200864559 200865305 746 True 1208 1208 95.750 2 754 1 chr7B.!!$R1 752
24 TraesCS5B01G312400 chr7B 634675214 634675965 751 True 1203 1203 95.491 1 754 1 chr7B.!!$R2 753
25 TraesCS5B01G312400 chr4B 171492993 171493742 749 False 1201 1201 95.491 1 754 1 chr4B.!!$F2 753
26 TraesCS5B01G312400 chr4B 76572583 76573240 657 False 1116 1116 97.264 1682 2339 1 chr4B.!!$F1 657
27 TraesCS5B01G312400 chr1B 230648682 230649431 749 True 1201 1201 95.491 1 754 1 chr1B.!!$R1 753

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
599 606 1.587054 CTCCGACGGAGCTGTTCTT 59.413 57.895 29.77 0.0 43.29 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2065 2080 2.791179 TGGATCCAAATCAGCCCCTTAT 59.209 45.455 13.46 0.0 33.21 1.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
25 26 7.759465 GTTATAAGAATGATCATGATGCCCTG 58.241 38.462 14.30 0.00 0.00 4.45
508 512 3.917300 TGAAGGCTTTTACCCTGGAAAA 58.083 40.909 0.00 0.00 31.73 2.29
509 513 4.290942 TGAAGGCTTTTACCCTGGAAAAA 58.709 39.130 0.00 1.06 31.73 1.94
552 559 4.612412 AAACTCCGCCGCCACGAA 62.612 61.111 0.00 0.00 34.06 3.85
599 606 1.587054 CTCCGACGGAGCTGTTCTT 59.413 57.895 29.77 0.00 43.29 2.52
1177 1186 7.964011 GGTCTAGTTCTATACGAATACTGATGC 59.036 40.741 0.00 0.00 33.45 3.91
1468 1480 8.506168 AATATGAAAATAAGAGCTTCCGTTCA 57.494 30.769 0.00 0.00 0.00 3.18
1711 1726 2.335933 ACCTGTGGGTTGCTAGTAGTT 58.664 47.619 0.00 0.00 44.73 2.24
1775 1790 5.936956 GTGGAAGATCATATGTTCAGATCCC 59.063 44.000 19.82 12.50 39.10 3.85
2065 2080 3.006940 CCCTAGTTTATGCGTTGCTTCA 58.993 45.455 0.00 0.00 0.00 3.02
2145 2160 2.010145 TCTGTAGTTGCGGATGCTTC 57.990 50.000 0.00 0.00 43.34 3.86
2235 2250 9.920946 ACCCACATATCAAATTATCAAAGTACT 57.079 29.630 0.00 0.00 0.00 2.73
2255 2270 3.055591 CTGAACGCGAATCATATGAGCT 58.944 45.455 15.93 0.49 0.00 4.09
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
368 369 7.389330 TCTGGTGTTTTCTTCGCTCAATAATTA 59.611 33.333 0.00 0.00 0.00 1.40
508 512 5.417580 TCCCGTAAGCTTGCTTATGATTTTT 59.582 36.000 26.81 0.57 0.00 1.94
509 513 4.947388 TCCCGTAAGCTTGCTTATGATTTT 59.053 37.500 26.81 1.20 0.00 1.82
510 514 4.335594 GTCCCGTAAGCTTGCTTATGATTT 59.664 41.667 26.81 1.85 0.00 2.17
552 559 1.228154 GTTCCACCAAGGTTCCGCT 60.228 57.895 0.00 0.00 39.02 5.52
1177 1186 4.270008 ACTTCAATTTTGACCCTATCCCG 58.730 43.478 0.00 0.00 36.83 5.14
1711 1726 7.168219 AGCATCAACTACAAGGAGTAATCAAA 58.832 34.615 0.00 0.00 30.92 2.69
2065 2080 2.791179 TGGATCCAAATCAGCCCCTTAT 59.209 45.455 13.46 0.00 33.21 1.73
2145 2160 6.010219 CCCACTTATGATTAACCCCTATTGG 58.990 44.000 0.00 0.00 0.00 3.16
2235 2250 3.097877 AGCTCATATGATTCGCGTTCA 57.902 42.857 14.88 14.88 0.00 3.18
2255 2270 7.899178 TTATCGTCAAGCTAGTTTTCATCAA 57.101 32.000 0.00 0.00 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.