Multiple sequence alignment - TraesCS5B01G279100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G279100 chr5B 100.000 2264 0 0 1 2264 464634106 464636369 0.000000e+00 4181.0
1 TraesCS5B01G279100 chr5B 94.773 2181 64 14 1 2162 530940831 530938682 0.000000e+00 3350.0
2 TraesCS5B01G279100 chr5B 90.320 1529 77 18 651 2162 297111159 297112633 0.000000e+00 1938.0
3 TraesCS5B01G279100 chr3B 97.922 2166 40 3 1 2162 16124436 16122272 0.000000e+00 3746.0
4 TraesCS5B01G279100 chr3B 90.015 1322 86 26 551 1859 16202941 16201653 0.000000e+00 1668.0
5 TraesCS5B01G279100 chr3B 88.132 514 32 6 1768 2262 803582994 803582491 3.240000e-163 584.0
6 TraesCS5B01G279100 chr3B 95.181 332 11 2 1936 2262 28618989 28619320 9.270000e-144 520.0
7 TraesCS5B01G279100 chr3B 94.012 334 15 2 1936 2264 16122385 16122052 3.360000e-138 501.0
8 TraesCS5B01G279100 chr3B 83.434 332 35 4 1936 2262 393331138 393331454 7.910000e-75 291.0
9 TraesCS5B01G279100 chr3B 83.908 261 25 9 2007 2262 179360773 179360525 1.350000e-57 233.0
10 TraesCS5B01G279100 chr2B 97.692 2166 41 3 1 2162 563917140 563914980 0.000000e+00 3714.0
11 TraesCS5B01G279100 chr2B 91.299 1632 81 20 551 2162 154584994 154583404 0.000000e+00 2170.0
12 TraesCS5B01G279100 chr2B 90.396 1364 61 15 621 1967 440604608 440605918 0.000000e+00 1729.0
13 TraesCS5B01G279100 chr2B 88.177 406 36 8 1768 2162 798602683 798603087 7.320000e-130 473.0
14 TraesCS5B01G279100 chr2B 85.106 94 11 2 1720 1812 29751620 29751529 2.390000e-15 93.5
15 TraesCS5B01G279100 chr2B 86.047 86 10 2 1720 1804 757693578 757693662 8.610000e-15 91.6
16 TraesCS5B01G279100 chr4B 98.221 1967 35 0 1 1967 402787203 402785237 0.000000e+00 3439.0
17 TraesCS5B01G279100 chr4B 96.798 1780 48 4 1 1780 576450752 576452522 0.000000e+00 2963.0
18 TraesCS5B01G279100 chr4A 94.888 2191 77 15 1 2162 712877478 712879662 0.000000e+00 3393.0
19 TraesCS5B01G279100 chr7B 94.672 2177 71 10 1 2160 235458094 235455946 0.000000e+00 3336.0
20 TraesCS5B01G279100 chr7B 97.153 1967 32 9 1 1967 687040622 687042564 0.000000e+00 3301.0
21 TraesCS5B01G279100 chr1B 96.900 1968 36 4 1 1967 38183391 38185334 0.000000e+00 3273.0
22 TraesCS5B01G279100 chr6B 96.131 1008 23 3 1271 2262 694764793 694765800 0.000000e+00 1631.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G279100 chr5B 464634106 464636369 2263 False 4181.0 4181 100.000 1 2264 1 chr5B.!!$F2 2263
1 TraesCS5B01G279100 chr5B 530938682 530940831 2149 True 3350.0 3350 94.773 1 2162 1 chr5B.!!$R1 2161
2 TraesCS5B01G279100 chr5B 297111159 297112633 1474 False 1938.0 1938 90.320 651 2162 1 chr5B.!!$F1 1511
3 TraesCS5B01G279100 chr3B 16122052 16124436 2384 True 2123.5 3746 95.967 1 2264 2 chr3B.!!$R4 2263
4 TraesCS5B01G279100 chr3B 16201653 16202941 1288 True 1668.0 1668 90.015 551 1859 1 chr3B.!!$R1 1308
5 TraesCS5B01G279100 chr3B 803582491 803582994 503 True 584.0 584 88.132 1768 2262 1 chr3B.!!$R3 494
6 TraesCS5B01G279100 chr2B 563914980 563917140 2160 True 3714.0 3714 97.692 1 2162 1 chr2B.!!$R3 2161
7 TraesCS5B01G279100 chr2B 154583404 154584994 1590 True 2170.0 2170 91.299 551 2162 1 chr2B.!!$R2 1611
8 TraesCS5B01G279100 chr2B 440604608 440605918 1310 False 1729.0 1729 90.396 621 1967 1 chr2B.!!$F1 1346
9 TraesCS5B01G279100 chr4B 402785237 402787203 1966 True 3439.0 3439 98.221 1 1967 1 chr4B.!!$R1 1966
10 TraesCS5B01G279100 chr4B 576450752 576452522 1770 False 2963.0 2963 96.798 1 1780 1 chr4B.!!$F1 1779
11 TraesCS5B01G279100 chr4A 712877478 712879662 2184 False 3393.0 3393 94.888 1 2162 1 chr4A.!!$F1 2161
12 TraesCS5B01G279100 chr7B 235455946 235458094 2148 True 3336.0 3336 94.672 1 2160 1 chr7B.!!$R1 2159
13 TraesCS5B01G279100 chr7B 687040622 687042564 1942 False 3301.0 3301 97.153 1 1967 1 chr7B.!!$F1 1966
14 TraesCS5B01G279100 chr1B 38183391 38185334 1943 False 3273.0 3273 96.900 1 1967 1 chr1B.!!$F1 1966
15 TraesCS5B01G279100 chr6B 694764793 694765800 1007 False 1631.0 1631 96.131 1271 2262 1 chr6B.!!$F1 991

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
637 638 1.072331 CAAGTGCTAGAGGTGGTGGTT 59.928 52.381 0.0 0.0 0.0 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1595 1632 0.535102 CCCTTCTTGTCACGTGCCTT 60.535 55.0 11.67 0.0 0.0 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
197 198 2.834113 AGCTACTAGGTTGACATGGGT 58.166 47.619 0.00 0.0 0.00 4.51
637 638 1.072331 CAAGTGCTAGAGGTGGTGGTT 59.928 52.381 0.00 0.0 0.00 3.67
791 828 1.192146 GCTAGAGGTGGTGGTGGTCA 61.192 60.000 0.00 0.0 0.00 4.02
1048 1085 4.717629 CGTGCGCGGACCAAGAGA 62.718 66.667 25.41 0.0 0.00 3.10
1175 1212 1.271325 TGACCGCAACAAGTCATGGAT 60.271 47.619 0.00 0.0 38.07 3.41
1539 1576 0.036952 CGCAAAGAGAAGGAGGCTCA 60.037 55.000 17.69 0.0 34.85 4.26
1595 1632 1.657751 CGATGCACGAGAGGAGGACA 61.658 60.000 0.00 0.0 45.77 4.02
1747 1784 7.491372 GGTCATGAACTACTTATGTCATTCGAA 59.509 37.037 2.64 0.0 0.00 3.71
1753 1790 8.771920 AACTACTTATGTCATTCGAAACATCA 57.228 30.769 16.66 7.5 37.33 3.07
2115 2240 2.936912 GCGCAGGAGACCAGACACT 61.937 63.158 0.30 0.0 0.00 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
197 198 0.887933 GAAAGGGCGAAATCTTGGCA 59.112 50.000 0.00 0.0 35.96 4.92
791 828 1.055040 AGCACTTGTGCTTCCTCTCT 58.945 50.000 20.95 0.0 43.52 3.10
1048 1085 0.036388 ATCCACGTCTTCGGCATGTT 60.036 50.000 0.00 0.0 41.85 2.71
1112 1149 3.954200 ACATCAGCACACCAACATGATA 58.046 40.909 0.00 0.0 0.00 2.15
1175 1212 5.987347 CACACGAAAAACCTTCTACCTTCTA 59.013 40.000 0.00 0.0 0.00 2.10
1539 1576 4.647564 TTTCTTGCCCTCTCTTCTTGAT 57.352 40.909 0.00 0.0 0.00 2.57
1595 1632 0.535102 CCCTTCTTGTCACGTGCCTT 60.535 55.000 11.67 0.0 0.00 4.35
1753 1790 9.035607 GTCTCGAATTACAAGTTCATCATACAT 57.964 33.333 0.00 0.0 0.00 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.