Multiple sequence alignment - TraesCS5B01G268500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G268500 chr5B 100.000 2640 0 0 1 2640 454660906 454663545 0.000000e+00 4876
1 TraesCS5B01G268500 chr5B 93.732 1755 100 6 1 1747 428831267 428833019 0.000000e+00 2623
2 TraesCS5B01G268500 chr5B 92.676 355 25 1 1795 2149 297112318 297112671 6.520000e-141 510
3 TraesCS5B01G268500 chr5B 89.356 404 9 9 2264 2640 436478906 436479302 6.610000e-131 477
4 TraesCS5B01G268500 chr5B 88.480 408 15 6 2264 2640 530938589 530938183 5.150000e-127 464
5 TraesCS5B01G268500 chr6B 95.238 2331 57 6 1 2299 661051615 661053923 0.000000e+00 3640
6 TraesCS5B01G268500 chr6B 96.309 1815 56 4 1 1815 114144823 114143020 0.000000e+00 2970
7 TraesCS5B01G268500 chr6B 97.086 1750 51 0 1 1750 687514429 687512680 0.000000e+00 2950
8 TraesCS5B01G268500 chr6B 96.884 1733 50 3 1 1732 650646695 650644966 0.000000e+00 2898
9 TraesCS5B01G268500 chr6B 88.725 408 16 6 2262 2640 661053956 661054362 3.080000e-129 472
10 TraesCS5B01G268500 chr6B 84.026 313 26 2 1996 2308 114142917 114142629 2.000000e-71 279
11 TraesCS5B01G268500 chr6B 94.872 78 2 1 1738 1815 687512662 687512587 1.280000e-23 121
12 TraesCS5B01G268500 chr1B 92.780 2313 114 30 1 2308 357902161 357899897 0.000000e+00 3297
13 TraesCS5B01G268500 chr1B 93.484 399 25 1 1795 2193 649299494 649299097 2.260000e-165 592
14 TraesCS5B01G268500 chr1B 90.909 363 5 3 2305 2640 357899814 357899453 1.850000e-126 462
15 TraesCS5B01G268500 chr1B 82.292 192 10 8 2117 2308 357900300 357900133 7.620000e-31 145
16 TraesCS5B01G268500 chr1B 80.000 220 20 16 1702 1910 38185128 38185334 9.850000e-30 141
17 TraesCS5B01G268500 chr6A 96.859 1751 52 3 1 1750 74992223 74990475 0.000000e+00 2926
18 TraesCS5B01G268500 chr6A 93.898 1852 61 31 1 1815 592020692 592018856 0.000000e+00 2747
19 TraesCS5B01G268500 chr6A 91.980 399 31 1 1795 2193 466680739 466681136 2.300000e-155 558
20 TraesCS5B01G268500 chr7B 93.786 1754 99 6 1 1746 27326584 27328335 0.000000e+00 2627
21 TraesCS5B01G268500 chr7B 86.372 521 56 6 1788 2308 707618424 707618929 2.970000e-154 555
22 TraesCS5B01G268500 chr7B 88.136 413 15 6 2262 2640 235455853 235455441 6.660000e-126 460
23 TraesCS5B01G268500 chr7B 96.552 87 2 1 2555 2640 335929681 335929767 2.740000e-30 143
24 TraesCS5B01G268500 chr2B 93.743 1758 99 7 1 1750 29754559 29752805 0.000000e+00 2627
25 TraesCS5B01G268500 chr2B 94.358 514 24 3 1795 2308 154583715 154583207 0.000000e+00 784
26 TraesCS5B01G268500 chr2B 90.856 514 34 6 1795 2308 798602772 798603272 0.000000e+00 676
27 TraesCS5B01G268500 chr2B 92.268 388 19 7 2262 2640 45598338 45598723 8.310000e-150 540
28 TraesCS5B01G268500 chr2B 80.702 228 31 9 2082 2302 42195463 42195684 5.850000e-37 165
29 TraesCS5B01G268500 chr2B 98.780 82 1 0 2559 2640 178345171 178345090 2.120000e-31 147
30 TraesCS5B01G268500 chr2B 89.899 99 9 1 2210 2308 138733814 138733911 2.760000e-25 126
31 TraesCS5B01G268500 chr2B 86.842 114 9 5 1702 1815 42195132 42195239 3.570000e-24 122
32 TraesCS5B01G268500 chr5A 93.734 399 24 1 1795 2193 591475552 591475949 4.860000e-167 597
33 TraesCS5B01G268500 chrUn 87.743 514 38 10 1795 2308 361056043 361055555 6.340000e-161 577
34 TraesCS5B01G268500 chrUn 86.788 439 33 9 1870 2308 17580370 17580783 1.430000e-127 466
35 TraesCS5B01G268500 chrUn 97.561 82 2 0 2559 2640 361055202 361055121 9.850000e-30 141
36 TraesCS5B01G268500 chrUn 97.561 82 2 0 2559 2640 416566546 416566465 9.850000e-30 141
37 TraesCS5B01G268500 chr7A 87.743 514 38 10 1795 2308 497717704 497717216 6.340000e-161 577
38 TraesCS5B01G268500 chr4B 93.247 385 18 5 2262 2640 49107905 49108287 6.380000e-156 560
39 TraesCS5B01G268500 chr4B 89.899 99 9 1 2210 2308 49107654 49107751 2.760000e-25 126
40 TraesCS5B01G268500 chr4B 86.842 114 7 6 1702 1815 402785466 402785361 1.280000e-23 121
41 TraesCS5B01G268500 chr3B 96.154 338 6 3 2305 2640 803582571 803582239 1.790000e-151 545
42 TraesCS5B01G268500 chr4A 89.461 408 13 4 2262 2640 698021279 698020873 3.050000e-134 488


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G268500 chr5B 454660906 454663545 2639 False 4876.000000 4876 100.000000 1 2640 1 chr5B.!!$F4 2639
1 TraesCS5B01G268500 chr5B 428831267 428833019 1752 False 2623.000000 2623 93.732000 1 1747 1 chr5B.!!$F2 1746
2 TraesCS5B01G268500 chr6B 650644966 650646695 1729 True 2898.000000 2898 96.884000 1 1732 1 chr6B.!!$R1 1731
3 TraesCS5B01G268500 chr6B 661051615 661054362 2747 False 2056.000000 3640 91.981500 1 2640 2 chr6B.!!$F1 2639
4 TraesCS5B01G268500 chr6B 114142629 114144823 2194 True 1624.500000 2970 90.167500 1 2308 2 chr6B.!!$R2 2307
5 TraesCS5B01G268500 chr6B 687512587 687514429 1842 True 1535.500000 2950 95.979000 1 1815 2 chr6B.!!$R3 1814
6 TraesCS5B01G268500 chr1B 357899453 357902161 2708 True 1301.333333 3297 88.660333 1 2640 3 chr1B.!!$R2 2639
7 TraesCS5B01G268500 chr6A 74990475 74992223 1748 True 2926.000000 2926 96.859000 1 1750 1 chr6A.!!$R1 1749
8 TraesCS5B01G268500 chr6A 592018856 592020692 1836 True 2747.000000 2747 93.898000 1 1815 1 chr6A.!!$R2 1814
9 TraesCS5B01G268500 chr7B 27326584 27328335 1751 False 2627.000000 2627 93.786000 1 1746 1 chr7B.!!$F1 1745
10 TraesCS5B01G268500 chr7B 707618424 707618929 505 False 555.000000 555 86.372000 1788 2308 1 chr7B.!!$F3 520
11 TraesCS5B01G268500 chr2B 29752805 29754559 1754 True 2627.000000 2627 93.743000 1 1750 1 chr2B.!!$R1 1749
12 TraesCS5B01G268500 chr2B 154583207 154583715 508 True 784.000000 784 94.358000 1795 2308 1 chr2B.!!$R2 513
13 TraesCS5B01G268500 chr2B 798602772 798603272 500 False 676.000000 676 90.856000 1795 2308 1 chr2B.!!$F3 513
14 TraesCS5B01G268500 chrUn 361055121 361056043 922 True 359.000000 577 92.652000 1795 2640 2 chrUn.!!$R2 845
15 TraesCS5B01G268500 chr4B 49107654 49108287 633 False 343.000000 560 91.573000 2210 2640 2 chr4B.!!$F1 430

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
701 703 0.96637 GCTAGAGGTGGTGGTCGAGT 60.966 60.0 0.0 0.0 0.0 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2217 2327 0.107703 TTGGCGTCTGGATGTCCATC 60.108 55.0 1.54 0.0 46.46 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
163 164 3.120792 GCGAAGGCGAGAAACATACATA 58.879 45.455 0.00 0.00 40.82 2.29
204 206 2.483714 GCGGATGCAAGAGTTCCATCTA 60.484 50.000 4.26 0.00 42.15 1.98
318 320 2.163509 CCTCTTCTGAAGGTCGAGACA 58.836 52.381 16.83 0.00 0.00 3.41
370 372 2.906389 GGTGATATGGATGACCTGGCTA 59.094 50.000 0.00 0.00 36.47 3.93
549 551 1.000955 GAACGAGCTGGAAGAGGTGAA 59.999 52.381 1.44 0.00 34.07 3.18
701 703 0.966370 GCTAGAGGTGGTGGTCGAGT 60.966 60.000 0.00 0.00 0.00 4.18
867 884 2.294979 GGATCGGCCTTCGGTTATTTT 58.705 47.619 0.00 0.00 39.77 1.82
1453 1472 1.101635 TCGAGGAGTCCTATGCACGG 61.102 60.000 12.99 0.00 31.76 4.94
1629 1648 2.758434 GGGAAAGTGGCCCCGTAA 59.242 61.111 0.00 0.00 39.81 3.18
1786 1851 3.124466 TGCAAACTATGTTCGTCATTCGG 59.876 43.478 0.00 0.00 40.32 4.30
1797 1894 3.614092 TCGTCATTCGGGACTAGTTAGT 58.386 45.455 0.00 0.00 40.32 2.24
1861 1970 6.647212 AAGCAAAAACTTTAACAAGCTGTC 57.353 33.333 0.00 0.00 32.57 3.51
1922 2031 1.081641 CGTCTGGCTTGCTTTGCTG 60.082 57.895 0.00 0.00 0.00 4.41
1992 2101 0.754217 CCAAGGTCCATGGCATCTGG 60.754 60.000 6.96 7.59 34.93 3.86
1993 2102 0.033796 CAAGGTCCATGGCATCTGGT 60.034 55.000 6.96 0.00 35.19 4.00
1995 2104 0.033796 AGGTCCATGGCATCTGGTTG 60.034 55.000 6.96 0.00 35.19 3.77
1996 2105 0.323725 GGTCCATGGCATCTGGTTGT 60.324 55.000 6.96 0.00 35.19 3.32
2000 2109 1.687054 CCATGGCATCTGGTTGTCCAT 60.687 52.381 0.00 0.00 43.43 3.41
2036 2145 3.774528 CTGGCGTCTGGCTGGCTA 61.775 66.667 2.00 0.00 42.94 3.93
2217 2327 1.355210 GTGGCCAGACGTGTGTTTG 59.645 57.895 5.11 0.00 0.00 2.93
2455 2655 1.524863 CCAACGTCACTCCCTCGTCT 61.525 60.000 0.00 0.00 36.80 4.18
2464 2664 0.183014 CTCCCTCGTCTAGCACCCTA 59.817 60.000 0.00 0.00 0.00 3.53
2615 2869 9.991906 GGTTTAATGTATCATAGGTTAGCTACA 57.008 33.333 0.00 0.00 0.00 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
163 164 4.420168 CGCACGGTTTTTCCATCATAAAT 58.580 39.130 0.00 0.0 35.57 1.40
204 206 3.452627 CCCATGTCAACCTAGTAGCTTCT 59.547 47.826 0.00 0.0 0.00 2.85
312 314 3.090037 TCTCCTTCTACCCTTTGTCTCG 58.910 50.000 0.00 0.0 0.00 4.04
318 320 5.722441 CCTCTTAGTTCTCCTTCTACCCTTT 59.278 44.000 0.00 0.0 0.00 3.11
370 372 6.392354 CAAATTGTTTCATGCCAGTGTATCT 58.608 36.000 0.00 0.0 0.00 1.98
549 551 2.923035 CCTCGACCACCACCACCT 60.923 66.667 0.00 0.0 0.00 4.00
620 622 2.492484 CCTCTACGAACACTAGCACCTT 59.508 50.000 0.00 0.0 0.00 3.50
701 703 3.245514 ACCACCTCTAGTACTTGTGCCTA 60.246 47.826 0.00 0.0 0.00 3.93
1031 1048 4.680237 CCTCTTGGTCCGCGCACA 62.680 66.667 8.75 0.0 0.00 4.57
1431 1449 2.605823 CGTGCATAGGACTCCTCGAATC 60.606 54.545 0.00 0.0 34.61 2.52
1453 1472 4.918201 CGCTCCCGCTCCAATCCC 62.918 72.222 0.00 0.0 0.00 3.85
1629 1648 6.116126 GCCTTTCCATTTGTCTACTGAGTAT 58.884 40.000 0.00 0.0 0.00 2.12
1786 1851 9.765795 ATATGAACAAAGCATACTAACTAGTCC 57.234 33.333 0.00 0.0 37.73 3.85
1861 1970 1.069596 GGGCCTGGTGTTTTTGCAG 59.930 57.895 0.84 0.0 0.00 4.41
1922 2031 4.314440 TGTCTGGTCACCTGCGCC 62.314 66.667 4.18 0.0 0.00 6.53
1992 2101 0.743345 GGCGTCTGGGTATGGACAAC 60.743 60.000 0.00 0.0 33.19 3.32
1993 2102 1.195442 TGGCGTCTGGGTATGGACAA 61.195 55.000 0.00 0.0 33.19 3.18
1995 2104 1.144057 CTGGCGTCTGGGTATGGAC 59.856 63.158 0.00 0.0 0.00 4.02
1996 2105 2.063979 CCTGGCGTCTGGGTATGGA 61.064 63.158 4.79 0.0 0.00 3.41
2202 2311 0.238289 CCATCAAACACACGTCTGGC 59.762 55.000 0.00 0.0 0.00 4.85
2217 2327 0.107703 TTGGCGTCTGGATGTCCATC 60.108 55.000 1.54 0.0 46.46 3.51
2615 2869 7.206981 CCATCTACAACACACAAATCTCTTT 57.793 36.000 0.00 0.0 0.00 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.