Multiple sequence alignment - TraesCS5B01G258300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G258300 chr5B 100.000 3107 0 0 1 3107 440513533 440516639 0.000000e+00 5738.0
1 TraesCS5B01G258300 chr5B 98.426 3113 40 3 1 3107 440533198 440536307 0.000000e+00 5469.0
2 TraesCS5B01G258300 chr5B 91.264 435 14 12 879 1293 441124340 441123910 3.480000e-159 571.0
3 TraesCS5B01G258300 chr5D 94.851 3127 113 21 1 3107 371267080 371270178 0.000000e+00 4839.0
4 TraesCS5B01G258300 chr5D 91.369 1622 114 10 906 2510 371023184 371021572 0.000000e+00 2196.0
5 TraesCS5B01G258300 chr5D 84.653 619 51 19 2508 3106 371021054 371020460 7.470000e-161 577.0
6 TraesCS5B01G258300 chr5A 93.192 2688 137 12 231 2893 474062033 474059367 0.000000e+00 3908.0
7 TraesCS5B01G258300 chr5A 92.804 2696 140 13 231 2893 474195568 474192894 0.000000e+00 3855.0
8 TraesCS5B01G258300 chr5A 92.770 2697 140 14 231 2893 474327513 474324838 0.000000e+00 3849.0
9 TraesCS5B01G258300 chr5A 96.018 226 6 1 2881 3106 474185500 474185278 6.330000e-97 364.0
10 TraesCS5B01G258300 chr5A 95.575 226 7 1 2881 3106 474052024 474051802 2.950000e-95 359.0
11 TraesCS5B01G258300 chr5A 94.690 226 9 1 2881 3106 474317446 474317224 6.380000e-92 348.0
12 TraesCS5B01G258300 chr5A 86.164 159 13 4 712 868 382336308 382336459 2.480000e-36 163.0
13 TraesCS5B01G258300 chrUn 98.910 1284 13 1 1824 3107 272196413 272195131 0.000000e+00 2292.0
14 TraesCS5B01G258300 chrUn 97.126 1183 25 3 1 1177 371166039 371167218 0.000000e+00 1988.0
15 TraesCS5B01G258300 chrUn 99.006 805 7 1 1824 2628 465607524 465606721 0.000000e+00 1441.0
16 TraesCS5B01G258300 chrUn 98.925 186 2 0 2922 3107 281140476 281140291 1.790000e-87 333.0
17 TraesCS5B01G258300 chr7D 90.593 691 57 6 2 688 184517282 184517968 0.000000e+00 909.0
18 TraesCS5B01G258300 chr3D 90.435 690 60 4 1 688 375235290 375235975 0.000000e+00 904.0
19 TraesCS5B01G258300 chr3D 90.318 692 61 4 7 696 363070237 363069550 0.000000e+00 902.0
20 TraesCS5B01G258300 chr6A 82.075 106 12 2 708 813 104056393 104056491 1.990000e-12 84.2
21 TraesCS5B01G258300 chr6D 78.689 122 17 5 712 831 10720581 10720695 4.300000e-09 73.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G258300 chr5B 440513533 440516639 3106 False 5738.0 5738 100.000 1 3107 1 chr5B.!!$F1 3106
1 TraesCS5B01G258300 chr5B 440533198 440536307 3109 False 5469.0 5469 98.426 1 3107 1 chr5B.!!$F2 3106
2 TraesCS5B01G258300 chr5D 371267080 371270178 3098 False 4839.0 4839 94.851 1 3107 1 chr5D.!!$F1 3106
3 TraesCS5B01G258300 chr5D 371020460 371023184 2724 True 1386.5 2196 88.011 906 3106 2 chr5D.!!$R1 2200
4 TraesCS5B01G258300 chr5A 474059367 474062033 2666 True 3908.0 3908 93.192 231 2893 1 chr5A.!!$R2 2662
5 TraesCS5B01G258300 chr5A 474192894 474195568 2674 True 3855.0 3855 92.804 231 2893 1 chr5A.!!$R4 2662
6 TraesCS5B01G258300 chr5A 474324838 474327513 2675 True 3849.0 3849 92.770 231 2893 1 chr5A.!!$R6 2662
7 TraesCS5B01G258300 chrUn 272195131 272196413 1282 True 2292.0 2292 98.910 1824 3107 1 chrUn.!!$R1 1283
8 TraesCS5B01G258300 chrUn 371166039 371167218 1179 False 1988.0 1988 97.126 1 1177 1 chrUn.!!$F1 1176
9 TraesCS5B01G258300 chrUn 465606721 465607524 803 True 1441.0 1441 99.006 1824 2628 1 chrUn.!!$R3 804
10 TraesCS5B01G258300 chr7D 184517282 184517968 686 False 909.0 909 90.593 2 688 1 chr7D.!!$F1 686
11 TraesCS5B01G258300 chr3D 375235290 375235975 685 False 904.0 904 90.435 1 688 1 chr3D.!!$F1 687
12 TraesCS5B01G258300 chr3D 363069550 363070237 687 True 902.0 902 90.318 7 696 1 chr3D.!!$R1 689

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
213 220 0.671163 TCATTCGGGTTGGTACGTGC 60.671 55.000 0.00 0.00 0.00 5.34 F
277 284 1.269988 TGTCTTGAGCTGCACTCTCAC 60.270 52.381 12.13 8.65 46.41 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1060 1086 0.107897 ATGAGGTTGATACGGCGCAA 60.108 50.0 10.83 0.00 0.00 4.85 R
2721 3305 1.016130 CATAGCGGCGGCCTCATAAG 61.016 60.0 18.34 0.75 41.24 1.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
80 86 3.920231 ACTCTTGAATAGCAGCCATCA 57.080 42.857 0.00 0.00 0.00 3.07
160 166 2.657143 AGTCGGATGAAGAGAGGGTAC 58.343 52.381 0.00 0.00 0.00 3.34
213 220 0.671163 TCATTCGGGTTGGTACGTGC 60.671 55.000 0.00 0.00 0.00 5.34
277 284 1.269988 TGTCTTGAGCTGCACTCTCAC 60.270 52.381 12.13 8.65 46.41 3.51
441 466 8.025270 TCTCGGTATCACCAATAAAATCCTTA 57.975 34.615 0.00 0.00 38.47 2.69
769 795 3.814842 TGCACATCAAAGTGTAAGTCCTG 59.185 43.478 0.00 0.00 41.52 3.86
2721 3305 4.750098 TCACTGGTTCTTCTTTTCATCGTC 59.250 41.667 0.00 0.00 0.00 4.20
2999 3597 6.097554 CCAGGACACTATAGTCTTCATTCTGT 59.902 42.308 1.26 0.00 38.57 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
80 86 2.044793 TCCATGTTGAAGGGGAGACT 57.955 50.000 0.00 0.00 0.00 3.24
213 220 2.969306 GTCGGATACTATGCGTTACACG 59.031 50.000 9.48 0.00 44.82 4.49
277 284 1.420138 AGGTAAGTGGGTGAAGTGTGG 59.580 52.381 0.00 0.00 0.00 4.17
441 466 1.745115 CCGTGTTCATGCCCGTGAT 60.745 57.895 0.00 0.00 0.00 3.06
672 698 4.159321 TGTTTGGTTGAAGAATGTGAGCAA 59.841 37.500 0.00 0.00 0.00 3.91
769 795 6.910536 ATCTCCGAGTAAAATCAATGACAC 57.089 37.500 0.00 0.00 0.00 3.67
1060 1086 0.107897 ATGAGGTTGATACGGCGCAA 60.108 50.000 10.83 0.00 0.00 4.85
2721 3305 1.016130 CATAGCGGCGGCCTCATAAG 61.016 60.000 18.34 0.75 41.24 1.73
2999 3597 2.942376 CCCTGCGCATGTAAATTGTCTA 59.058 45.455 12.24 0.00 0.00 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.