Multiple sequence alignment - TraesCS5B01G254000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G254000 chr5B 100.000 2640 0 0 1 2640 436476554 436479193 0 4876
1 TraesCS5B01G254000 chr5B 99.174 2178 18 0 1 2178 281832853 281830676 0 3923
2 TraesCS5B01G254000 chr5B 98.899 2179 23 1 1 2178 351469616 351467438 0 3890
3 TraesCS5B01G254000 chr5B 97.751 489 10 1 2153 2640 281830665 281830177 0 841
4 TraesCS5B01G254000 chr7B 99.312 2179 14 1 1 2178 102652612 102654790 0 3940
5 TraesCS5B01G254000 chr7B 99.219 2178 17 0 1 2178 133432653 133430476 0 3928
6 TraesCS5B01G254000 chr7B 99.352 2162 14 0 1 2162 618534971 618532810 0 3916
7 TraesCS5B01G254000 chr7B 98.975 488 5 0 2153 2640 102654683 102655170 0 874
8 TraesCS5B01G254000 chr4B 99.312 2179 14 1 1 2178 649623167 649625345 0 3940
9 TraesCS5B01G254000 chr4B 99.128 2180 17 1 1 2178 655790978 655793157 0 3919
10 TraesCS5B01G254000 chr4B 98.156 488 8 1 2153 2640 649625238 649625724 0 850
11 TraesCS5B01G254000 chr4A 99.311 2178 15 0 1 2178 735292695 735294872 0 3940
12 TraesCS5B01G254000 chr3A 98.899 2179 24 0 1 2179 237052956 237055134 0 3892
13 TraesCS5B01G254000 chr1B 98.367 490 6 1 2153 2640 302770287 302769798 0 859
14 TraesCS5B01G254000 chrUn 97.967 492 10 0 2149 2640 361055721 361055230 0 854
15 TraesCS5B01G254000 chr7A 97.967 492 10 0 2149 2640 497717382 497716891 0 854
16 TraesCS5B01G254000 chr2B 97.347 490 11 1 2153 2640 364335903 364335414 0 832
17 TraesCS5B01G254000 chr2A 97.154 492 14 0 2149 2640 728935856 728936347 0 832
18 TraesCS5B01G254000 chr5A 97.154 492 13 1 2149 2640 591475756 591476246 0 830


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G254000 chr5B 436476554 436479193 2639 False 4876 4876 100.0000 1 2640 1 chr5B.!!$F1 2639
1 TraesCS5B01G254000 chr5B 351467438 351469616 2178 True 3890 3890 98.8990 1 2178 1 chr5B.!!$R1 2177
2 TraesCS5B01G254000 chr5B 281830177 281832853 2676 True 2382 3923 98.4625 1 2640 2 chr5B.!!$R2 2639
3 TraesCS5B01G254000 chr7B 133430476 133432653 2177 True 3928 3928 99.2190 1 2178 1 chr7B.!!$R1 2177
4 TraesCS5B01G254000 chr7B 618532810 618534971 2161 True 3916 3916 99.3520 1 2162 1 chr7B.!!$R2 2161
5 TraesCS5B01G254000 chr7B 102652612 102655170 2558 False 2407 3940 99.1435 1 2640 2 chr7B.!!$F1 2639
6 TraesCS5B01G254000 chr4B 655790978 655793157 2179 False 3919 3919 99.1280 1 2178 1 chr4B.!!$F1 2177
7 TraesCS5B01G254000 chr4B 649623167 649625724 2557 False 2395 3940 98.7340 1 2640 2 chr4B.!!$F2 2639
8 TraesCS5B01G254000 chr4A 735292695 735294872 2177 False 3940 3940 99.3110 1 2178 1 chr4A.!!$F1 2177
9 TraesCS5B01G254000 chr3A 237052956 237055134 2178 False 3892 3892 98.8990 1 2179 1 chr3A.!!$F1 2178

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
44 45 0.947244 AAGCAAGCAAGTCTTCACGG 59.053 50.0 0.0 0.0 31.27 4.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2307 2465 2.357517 GTCTGGTCACCTGCGTGG 60.358 66.667 0.0 0.0 40.65 4.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 0.947244 AAGCAAGCAAGTCTTCACGG 59.053 50.000 0.00 0.0 31.27 4.94
871 875 4.350816 AGGAATGGTTGATAATGGATCGGA 59.649 41.667 0.00 0.0 37.38 4.55
1253 1257 5.531122 ACTAACGCATATGACATACCACT 57.469 39.130 6.97 0.0 0.00 4.00
2082 2086 2.060383 CCAGATCCAGACGCCAGGA 61.060 63.158 0.00 0.0 38.50 3.86
2083 2087 1.617018 CCAGATCCAGACGCCAGGAA 61.617 60.000 0.00 0.0 37.48 3.36
2130 2134 2.122413 AGGTGACCAGACAGGCCA 60.122 61.111 5.01 0.0 43.14 5.36
2384 2542 2.743718 CCTGGCGTCTGGTGTTCT 59.256 61.111 4.52 0.0 0.00 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
14 15 3.068590 ACTTGCTTGCTTGTAACTGCAAT 59.931 39.130 0.00 0.0 46.20 3.56
871 875 7.989416 TCTGGATTAAACAAATAACCGAAGT 57.011 32.000 0.00 0.0 0.00 3.01
2307 2465 2.357517 GTCTGGTCACCTGCGTGG 60.358 66.667 0.00 0.0 40.65 4.94
2384 2542 8.806429 TTATCCATTAGACAAGAATGCTTTCA 57.194 30.769 14.15 0.0 33.70 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.