Multiple sequence alignment - TraesCS5B01G250900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5B01G250900 chr5B 100.000 2264 0 0 1 2264 433002512 433000249 0 4181
1 TraesCS5B01G250900 chr5B 99.337 2264 14 1 1 2264 471294932 471292670 0 4096
2 TraesCS5B01G250900 chr5B 98.764 2265 26 2 1 2264 351469615 351467352 0 4026
3 TraesCS5B01G250900 chr5B 98.719 2264 28 1 1 2264 281832852 281830590 0 4019
4 TraesCS5B01G250900 chr2A 99.382 2264 13 1 1 2264 728933673 728935935 0 4102
5 TraesCS5B01G250900 chr7A 99.338 2265 12 3 1 2264 16005012 16007274 0 4096
6 TraesCS5B01G250900 chr6B 98.984 2264 18 2 1 2264 381313993 381311735 0 4048
7 TraesCS5B01G250900 chr7B 98.631 2264 30 1 1 2264 133432652 133430390 0 4008
8 TraesCS5B01G250900 chr7B 98.411 2265 34 2 1 2264 102652613 102654876 0 3982
9 TraesCS5B01G250900 chr4A 98.498 2264 33 1 1 2264 735292696 735294958 0 3991


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5B01G250900 chr5B 433000249 433002512 2263 True 4181 4181 100.000 1 2264 1 chr5B.!!$R3 2263
1 TraesCS5B01G250900 chr5B 471292670 471294932 2262 True 4096 4096 99.337 1 2264 1 chr5B.!!$R4 2263
2 TraesCS5B01G250900 chr5B 351467352 351469615 2263 True 4026 4026 98.764 1 2264 1 chr5B.!!$R2 2263
3 TraesCS5B01G250900 chr5B 281830590 281832852 2262 True 4019 4019 98.719 1 2264 1 chr5B.!!$R1 2263
4 TraesCS5B01G250900 chr2A 728933673 728935935 2262 False 4102 4102 99.382 1 2264 1 chr2A.!!$F1 2263
5 TraesCS5B01G250900 chr7A 16005012 16007274 2262 False 4096 4096 99.338 1 2264 1 chr7A.!!$F1 2263
6 TraesCS5B01G250900 chr6B 381311735 381313993 2258 True 4048 4048 98.984 1 2264 1 chr6B.!!$R1 2263
7 TraesCS5B01G250900 chr7B 133430390 133432652 2262 True 4008 4008 98.631 1 2264 1 chr7B.!!$R1 2263
8 TraesCS5B01G250900 chr7B 102652613 102654876 2263 False 3982 3982 98.411 1 2264 1 chr7B.!!$F1 2263
9 TraesCS5B01G250900 chr4A 735292696 735294958 2262 False 3991 3991 98.498 1 2264 1 chr4A.!!$F1 2263

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1141 1145 1.680735 GGTGTGGTGATGTTTGCAAGA 59.319 47.619 0.0 0.0 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2052 2056 4.008933 GTGTGGGAGGCAGACGCT 62.009 66.667 0.0 0.0 38.6 5.07 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1141 1145 1.680735 GGTGTGGTGATGTTTGCAAGA 59.319 47.619 0.0 0.0 0.00 3.02
1164 1168 1.302511 GGTGTCCACTGACCGCAAT 60.303 57.895 0.0 0.0 41.01 3.56
2052 2056 1.541310 CCCAGACGCCAAGGTCACTA 61.541 60.000 0.0 0.0 39.42 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
262 263 1.699083 TGGAACTCTTGCATCCTCACA 59.301 47.619 4.96 0.0 34.24 3.58
578 582 2.357952 GCCTCCACGACTTGTTTTTCTT 59.642 45.455 0.00 0.0 0.00 2.52
1141 1145 0.321671 CGGTCAGTGGACACCTTCAT 59.678 55.000 0.00 0.0 46.17 2.57
1164 1168 5.422331 CCTTCTACCTTCTGTCCATGACTTA 59.578 44.000 0.00 0.0 33.15 2.24
2052 2056 4.008933 GTGTGGGAGGCAGACGCT 62.009 66.667 0.00 0.0 38.60 5.07


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.